Integration of Lncrna and Mrna Transcriptome Analyses Reveals
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Progress in Understanding 2-Hydroxyglutaric Acidurias
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Springer - Publisher Connector J Inherit Metab Dis (2012) 35:571–587 DOI 10.1007/s10545-012-9462-5 METABOLIC DISSERTATION Progress in understanding 2-hydroxyglutaric acidurias Martijn Kranendijk & Eduard A. Struys & Gajja S. Salomons & Marjo S. Van der Knaap & Cornelis Jakobs Martijn Kranendijk Received: 13 December 2011 /Revised: 25 January 2012 /Accepted: 30 January 2012 /Published online: 6 March 2012 # The Author(s) 2012. This article is published with open access at Springerlink.com Abstract The organic acidurias D-2-hydroxyglutaric acidu- D2HGDH gene encoding D-2-hydroxyglutarate ria (D-2-HGA), L-2-hydroxyglutaric aciduria (L-2-HGA), dehydrogenase and combined D,L-2-hydroxyglutaric aciduria (D,L- L-2-HG L-2-hydroxyglutaric acid 2-HGA) cause neurological impairment at young age. L-2-HGA L-2-hydroxyglutaric aciduria Accumulation of D-2-hydroxyglutarate (D-2-HG) and/or L- L-2-HGDH L-2-hydroxyglutarate dehydrogenase 2-hydroxyglutarate (L-2-HG) in body fluids are the bio- enzyme chemical hallmarks of these disorders. The current review L2HGDH gene encoding L-2-hydroxyglutarate describes the knowledge gathered on 2-hydroxyglutaric dehydrogenase acidurias (2-HGA), since the description of the first patients D,L-2-HGA combined D,L-2-hydroxyglutaric aciduria in 1980. We report on the clinical, genetic, enzymatic and IDH2 gene encoding isocitrate dehydrogenase 2 metabolic characterization of D-2-HGA type I, D-2-HGA 2-KG 2-ketoglutaric acid type II, L-2-HGA and D,L-2-HGA, whereas for D-2-HGA HOT hydroxyacid-oxoacid transhydrogenase type I and type II novel clinical information is presented enzyme which was derived from questionnaires. -
CD56+ T-Cells in Relation to Cytomegalovirus in Healthy Subjects and Kidney Transplant Patients
CD56+ T-cells in Relation to Cytomegalovirus in Healthy Subjects and Kidney Transplant Patients Institute of Infection and Global Health Department of Clinical Infection, Microbiology and Immunology Thesis submitted in accordance with the requirements of the University of Liverpool for the degree of Doctor in Philosophy by Mazen Mohammed Almehmadi December 2014 - 1 - Abstract Human T cells expressing CD56 are capable of tumour cell lysis following activation with interleukin-2 but their role in viral immunity has been less well studied. The work described in this thesis aimed to investigate CD56+ T-cells in relation to cytomegalovirus infection in healthy subjects and kidney transplant patients (KTPs). Proportions of CD56+ T cells were found to be highly significantly increased in healthy cytomegalovirus-seropositive (CMV+) compared to cytomegalovirus-seronegative (CMV-) subjects (8.38% ± 0.33 versus 3.29%± 0.33; P < 0.0001). In donor CMV-/recipient CMV- (D-/R-)- KTPs levels of CD56+ T cells were 1.9% ±0.35 versus 5.42% ±1.01 in D+/R- patients and 5.11% ±0.69 in R+ patients (P 0.0247 and < 0.0001 respectively). CD56+ T cells in both healthy CMV+ subjects and KTPs expressed markers of effector memory- RA T-cells (TEMRA) while in healthy CMV- subjects and D-/R- KTPs the phenotype was predominantly that of naïve T-cells. Other surface markers, CD8, CD4, CD58, CD57, CD94 and NKG2C were expressed by a significantly higher proportion of CD56+ T-cells in healthy CMV+ than CMV- subjects. Functional studies showed levels of pro-inflammatory cytokines IFN-γ and TNF-α, as well as granzyme B and CD107a were significantly higher in CD56+ T-cells from CMV+ than CMV- subjects following stimulation with CMV antigens. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Teleological Role of L-2-Hydroxyglutarate
© 2020. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2020) 13, dmm045898. doi:10.1242/dmm.045898 RESEARCH ARTICLE Teleological role of L-2-hydroxyglutarate dehydrogenase in the kidney Garrett Brinkley1, Hyeyoung Nam1, Eunhee Shim1,*, Richard Kirkman1, Anirban Kundu1, Suman Karki1, Yasaman Heidarian2, Jason M. Tennessen2, Juan Liu3, Jason W. Locasale3, Tao Guo4, Shi Wei4, Jennifer Gordetsky5, Teresa L. Johnson-Pais6, Devin Absher7, Dinesh Rakheja8, Anil K. Challa9 and Sunil Sudarshan1,10,‡ ABSTRACT insight into the physiological role of L2HGDH as well as mechanisms L-2-hydroxyglutarate (L-2HG) is an oncometabolite found elevated in that promote L-2HG accumulation in disease states. renal tumors. However, this molecule might have physiological roles that extend beyond its association with cancer, as L-2HG levels are KEY WORDS: L-2-hydroxyglutarate, L-2-hydroxyglutarate dehydrogenase, TCA cycle, PPARGC1A elevated in response to hypoxia and during Drosophila larval development. L-2HG is known to be metabolized by L-2HG dehydrogenase (L2HGDH), and loss of L2HGDH leads to elevated INTRODUCTION L-2HG levels. Despite L2HGDH being highly expressed in the kidney, Oncometabolites are small molecules that have been found elevated its role in renal metabolism has not been explored. Here, we report our in various malignancies. To date, these molecules include the findings utilizing a novel CRISPR/Cas9 murine knockout model, with tricarboxylic acid (TCA) cycle intermediates succinate and fumarate a specific focus on the role of L2HGDH in the kidney. Histologically, as well as both enantiomers of 2-hydroxyglutarate (D-2HG and L2hgdh knockout kidneys have no demonstrable histologic L-2HG) (Tomlinson et al., 2002; Baysal et al., 2000; Niemann and abnormalities. -
C2orf3 (GCFC2) (NM 001201334) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG234563 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone Tag: TurboGFP Symbol: GCFC2 Synonyms: C2orf3; DNABF; GCF; TCF9 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 C2orf3 (GCFC2) (NM_001201334) Human Tagged ORF Clone – RG234563 ORF Nucleotide >RG234563 representing NM_001201334 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAAGAGAGAGAGCGAAGATGACCCTGAGAGTGAGCCTGATGACCATGAAAAGAGAATACCATTTACTC TAAGACCTCAAACACTTAGACAAAGGATGGCTGAGGAATCAATAAGCAGAAATGAAGAAACAAGTGAAGA AAGTCAGGAAGATGAAAAGCAAGATACTTGGGAACAACAGCAAATGAGGAAAGCAGTTAAAATCATAGAG GAAAGAGACATAGATCTTTCCTGTGGCAATGGATCTTCAAAAGTGAAGAAATTTGATACTTCCATTTCAT TTCCGCCAGTAAATTTAGAAATTATAAAGAAGCAATTAAATACTAGATTAACATTACTACAGGAAACTCA CCGCTCACACCTGAGGGAGTATGAAAAATACGTACAAGATGTCAAAAGCTCAAAGAGTACCATCCAGAAC CTAGAGAGTTCATCAAATCAAGCTCTAAATTGTAAATTCTATAAAAGCATGAAAATTTATGTGGAAAATT TAATTGACTGCCTTAATGAAAAGATTATCAACATCCAAGAAATAGAATCATCCATGCATGCACTCCTTTT -
Table SI. Genes Upregulated ≥ 2-Fold by MIH 2.4Bl Treatment Affymetrix ID
Table SI. Genes upregulated 2-fold by MIH 2.4Bl treatment Fold UniGene ID Description Affymetrix ID Entrez Gene Change 1558048_x_at 28.84 Hs.551290 231597_x_at 17.02 Hs.720692 238825_at 10.19 93953 Hs.135167 acidic repeat containing (ACRC) 203821_at 9.82 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 1559509_at 9.41 Hs.656636 202957_at 9.06 3059 Hs.14601 hematopoietic cell-specific Lyn substrate 1 (HCLS1) 202388_at 8.11 5997 Hs.78944 regulator of G-protein signaling 2 (RGS2) 213649_at 7.9 6432 Hs.309090 serine and arginine rich splicing factor 7 (SRSF7) 228262_at 7.83 256714 Hs.127951 MAP7 domain containing 2 (MAP7D2) 38037_at 7.75 1839 Hs.799 heparin binding EGF like growth factor (HBEGF) 224549_x_at 7.6 202672_s_at 7.53 467 Hs.460 activating transcription factor 3 (ATF3) 243581_at 6.94 Hs.659284 239203_at 6.9 286006 Hs.396189 leucine rich single-pass membrane protein 1 (LSMEM1) 210800_at 6.7 1678 translocase of inner mitochondrial membrane 8 homolog A (yeast) (TIMM8A) 238956_at 6.48 1943 Hs.741510 ephrin A2 (EFNA2) 242918_at 6.22 4678 Hs.319334 nuclear autoantigenic sperm protein (NASP) 224254_x_at 6.06 243509_at 6 236832_at 5.89 221442 Hs.374076 adenylate cyclase 10, soluble pseudogene 1 (ADCY10P1) 234562_x_at 5.89 Hs.675414 214093_s_at 5.88 8880 Hs.567380; far upstream element binding protein 1 (FUBP1) Hs.707742 223774_at 5.59 677825 Hs.632377 small nucleolar RNA, H/ACA box 44 (SNORA44) 234723_x_at 5.48 Hs.677287 226419_s_at 5.41 6426 Hs.710026; serine and arginine rich splicing factor 1 (SRSF1) Hs.744140 228967_at 5.37 -
Structural Variant Calling by Assembly in Whole Human Genomes: Applications in Hypoplastic Left Heart Syndrome by Matthew Kendzi
STRUCTURAL VARIANT CALLING BY ASSEMBLY IN WHOLE HUMAN GENOMES: APPLICATIONS IN HYPOPLASTIC LEFT HEART SYNDROME BY MATTHEW KENDZIOR THESIS Submitted in partial FulFillment oF tHe requirements for the degree of Master of Science in BioinFormatics witH a concentration in Crop Sciences in the Graduate College of the University oF Illinois at Urbana-Champaign, 2019 Urbana, Illinois Master’s Committee: ProFessor MattHew Hudson, CHair ResearcH Assistant ProFessor Liudmila Mainzer ProFessor SaurabH SinHa ABSTRACT Variant discovery in medical researcH typically involves alignment oF sHort sequencing reads to the human reference genome. SNPs and small indels (variants less than 50 nucleotides) are the most common types oF variants detected From alignments. Structural variation can be more diFFicult to detect From short-read alignments, and thus many software applications aimed at detecting structural variants From short read alignments have been developed. However, these almost all detect the presence of variation in a sample using expected mate-pair distances From read data, making them unable to determine the precise sequence of the variant genome at the speciFied locus. Also, reads from a structural variant allele migHt not even map to the reference, and will thus be lost during variant discovery From read alignment. A variant calling by assembly approacH was used witH tHe soFtware Cortex-var for variant discovery in Hypoplastic Left Heart Syndrome (HLHS). THis method circumvents many of the limitations oF variants called From a reFerence alignment: unmapped reads will be included in a sample’s assembly, and variants up to thousands of nucleotides can be detected, with the Full sample variant allele sequence predicted. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
GCF (H-87): Sc-366876
SAN TA C RUZ BI OTEC HNOL OG Y, INC . GCF (H-87): sc-366876 BACKGROUND APPLICATIONS GCF (GC-rich sequence DNA-binding factor), also known as C2orf3 (chro - GCF (H-87) is recommended for detection of GCF of mouse, rat and human mosome 2 open reading frame 3), transcription factor 9 (TCF-9) or DNABF, origin by Western Blotting (starting dilution 1:200, dilution range 1:100- is a 781 amino acid nuclear protein that belongs to the GCF family. Widely 1:1000), immunoprecipitation [1-2 µg per 100-500 µg of total protein (1 ml expressed, GCF binds the GC-rich sequences of β-Actin, EGFR and calcium- of cell lysate)], immunofluorescence (starting dilution 1:50, dilution range dependent protease (CANP) promoters. GCF contains multiple phosphoser - 1:50-1:500) and solid phase ELISA (starting dilution 1:30, dilution range ine and phosphothreonine residues, and two GCF isoforms are produced 1:30- 1:3000). due to alternative splicing events. GCF is considered a candidate for sus - GCF (H-87) is also recommended for detection of GCF in additional species, ceptibility to dyslexia (DYX3) as both genes reside in close proximity on including equine, canine and porcine. human chromosome 2. Chromosome 2 is the second largest human chro - mosome and consists of 237 million bases, encodes over 1,400 genes and Suitable for use as control antibody for GCF siRNA (h): sc-94282, GCF siRNA makes up approximately 8% of the human genome. (m): sc-141404, GCF shRNA Plasmid (h): sc-94282-SH, GCF shRNA Plasmid (m): sc-141404-SH, GCF shRNA (h) Lentiviral Particles: sc-94282-V and GCF REFERENCES shRNA (m) Lentiviral Particles: sc-141404-V. -
DNA Damage Sensitization of Breast Cancer Cells with PARP10/ARTD10 Inhibitor Mikko Hukkanen
Pro gradu DNA damage sensitization of breast cancer cells with PARP10/ARTD10 inhibitor Mikko Hukkanen University of Oulu Faculty of Biochemistry and Molecular Medicine 2019 This thesis was completed at the Faculty of Biochemistry and Molecular Medicine, University of Oulu. Oulu, Finland Supervisors: Professor Lari Lehtiö, Dr. Jarkko Koivunen and MSc Sudarshan Murthy Acknowledgements The work of this thesis was made in Faculty of Biochemistry and Molecular Medicine (FBMM) of University of Oulu. Firstly, I would like to thank Professor Lari Lehtiö for the opportunity working in his group, and the advice I received for my thesis. My gratitude is expressed also to my other supervisors, Jarkko Koivunen, for all the guidance I received in the cell culture, and Sudarshan Murthy, for the guidance to express and purify protein, and to conclude IC50 analysis. I would also thank all the personnel in LL group for all the advice I received in laboratory. I would especially thank Sven Sowa who made the Mantis run for IC50 analysis possible. Abbreviations 5-FU – 5-fluorouracil aa – Aminoacid ADP – Adenosine diphosphate ADPr – ADP-ribosylation AEC – Anion-exchange chromatography AIF – Apoptosis inducing factor AIM – Auto-induction medium Arg – Arginine ART – ADP-ribosyltransferase ARTD – Diphtheria toxin –like ADP-ribosyltransferase Asp – Aspartate BRCA – Breast cancer gene BRCT – BRCA1 C terminus CPT – Camptothecin CRC – Colorectal cancer CRM1 – Chromosome region maintenance 1 Cys – Cysteine DDR – DNA damage response dH2O – Distilled water DMEM – Dulbecco’s -
Genome-Wide Association Scan Identifies New Variants Associated
Gialluisi et al. Translational Psychiatry (2019) 9:77 https://doi.org/10.1038/s41398-019-0402-0 Translational Psychiatry ARTICLE Open Access Genome-wide association scan identifies new variants associated with a cognitive predictor of dyslexia Alessandro Gialluisi 1,2,3, Till F. M. Andlauer 1,2, Nazanin Mirza-Schreiber1,KristinaMoll4, Jessica Becker5,6, Per Hoffmann 5,6, Kerstin U. Ludwig 5,6,DarinaCzamara 1,BeateStPourcain 7,8,9, William Brandler10, Ferenc Honbolygó11,DénesTóth11,ValériaCsépe11, Guillaume Huguet12,13, Andrew P. Morris14,15, Jacqueline Hulslander16, Erik G. Willcutt16, John C. DeFries16,RichardK.Olson16, Shelley D. Smith17, Bruce F. Pennington18, Anniek Vaessen19,UrsMaurer20, Heikki Lyytinen21, Myriam Peyrard-Janvid22, Paavo H. T. Leppänen21, Daniel Brandeis23,24,25,26, Milene Bonte19,JohnF.Stein 27,JoelB.Talcott 28, Fabien Fauchereau12,13, Arndt Wilcke29,ClydeFrancks7,8, Thomas Bourgeron12,13, Anthony P. Monaco15,30, Franck Ramus 31, Karin Landerl32,JuhaKere 22,33,34,ThomasS.Scerri15,35, Silvia Paracchini 36,SimonE.Fisher 7,8, Johannes Schumacher5,6,MarkusM.Nöthen5,6, Bertram Müller-Myhsok1,2,37 and Gerd Schulte-Körne4 Abstract Developmental dyslexia (DD) is one of the most prevalent learning disorders, with high impact on school and psychosocial development and high comorbidity with conditions like attention-deficit hyperactivity disorder (ADHD), depression, and anxiety. DD is characterized by deficits in different cognitive skills, including word reading, spelling, 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; rapid naming, and phonology. To investigate the genetic basis of DD, we conducted a genome-wide association study (GWAS) of these skills within one of the largest studies available, including nine cohorts of reading-impaired and typically developing children of European ancestry (N = 2562–3468). -
Mouse Gcfc2 Conditional Knockout Project (CRISPR/Cas9)
https://www.alphaknockout.com Mouse Gcfc2 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Gcfc2 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Gcfc2 gene (NCBI Reference Sequence: NM_177884 ; Ensembl: ENSMUSG00000035125 ) is located on Mouse chromosome 6. 17 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 17 (Transcript: ENSMUST00000043195). Exon 5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Gcfc2 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-442L23 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 5 starts from about 29.69% of the coding region. The knockout of Exon 5 will result in frameshift of the gene. The size of intron 4 for 5'-loxP site insertion: 2994 bp, and the size of intron 5 for 3'-loxP site insertion: 3358 bp. The size of effective cKO region: ~616 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 5 17 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Gcfc2 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.