Submitted for partial fulfilment of Doctor of Philosophy (PhD)
ANALYSIS OF THE SUBCELLULAR LOCALIZATION OF
PROTEINS IMPLICATED IN ALZHEIMER’S DISEASE
Anne Hwee Ling Lim
Supervised by Assoc Prof. Michael Lardelli and Dr. Joan Kelly
Department of Genetics and Evolution
School of Biological Sciences
The University of Adelaide Australia
DECLARATION
I certify that this work contains no material which has been accepted for the award of any other degree or diploma in my name, in any university or other tertiary institution and, to the best of my knowledge and belief, contains no material previously published or written by another person, except where due reference has been made in the text. In addition, I certify that no part of this work will, in the future, be used in a submission in my name, for any other degree or diploma in any university or other tertiary institution without the prior approval of the University of Adelaide and where applicable, any partner institution responsible for the joint award of this degree.
I give consent to this copy of my thesis when deposited in the University Library, being made available for loan and photocopying, subject to the provisions of the Copyright Act 1968.
The author acknowledges that copyright of published works contained within this thesis resides with the copyright holder(s) of those works.
I also give permission for the digital version of my thesis to be made available on the web, via the University’s digital research repository, the Library Search and also through web search engines, unless permission has been granted by the University to restrict access for a period of time.
Signed
…………………………………………………… Date……………………………
1
Table of Contents
Acknowledgements ...... 3
List of Publications contributed to during Ph.D. candidature ...... 4
Abstract ...... 5
List of abbreviations ...... 7
CHAPTER 1 ...... 8
1.1 Introduction ...... 9
1.2 Summary of chapters 2-6 and links between them ...... 49
CHAPTER 2 ...... 52
Research paper 1 ...... 53
CHAPTER 3 ...... 55
Research paper 2 ...... 58
CHAPTER 4 ...... 85
Research paper 3 ...... 87
CHAPTER 5 ...... 106
Research paper 4 ...... 108
CHAPTER 6 ...... 122
Research paper 5 ...... 125
CHAPTER 7 ...... 156
Discussion ...... 157
References ...... 167
APPENDIX I ...... 180
2
ACKNOWLEDGEMENTS
I would like to give my thanks and appreciation to:
Associate Prof. Michael Lardelli, for providing me with this wonderful opportunity. Your patience, knowledge and wisdom have guided and motivated me throughout my Ph.D. You have been a continuous inspiration for the scientific process and the virtues of a critical thinking lifestyle.
Dr. Morgan Newman, for your continuous support throughout my honours year till now. Your advice and feedback has helped me greatly in producing this thesis.
Past and present members of the Genetics discipline for their support and advice over the last few years. To Dr. Simon Wells and Dr. Zeeshan Shaukat, for advice on writing this thesis. To everyone in the lab, particularly Dr. Hani Moussavi Nik, Swamynathan Ganesan and Tanya Jayne, for adding a touch of fun to the lab atmosphere.
To Mom and Dad, for everything you have done for me and for all the support, encouragement and belief you have in me. I could not have made it this far without you. To my other family members especially my brother Jason, for the inspiration and support you have given me.
To Dasrath, for putting up with me during the ups and downs, keeping me sane, and for constantly reminding me that I can do it. Your understanding, patience, and faith in me have been a great comfort.
Thank you.
3
LIST OF PUBLICATIONS CONTRIBUTED TO DURING PH.D CANDIDATURE
Analysis of nicastrin gene phylogeny and expression in zebrafish.
Anne Lim, Seyyed Hani Moussavi Nik, Esmaeil Ebrahimie, Michael Lardelli.
Development Genes and Evolution, 2015
Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease.
Morgan Newman, Lachlan Wilson, Giuseppe Verdile, Anne Lim, Imran Khan, Seyyed Hani Moussavi Nik, Sharon Pursglove, Gavin Chapman, Ralph Martins, Michael Lardelli.
Human Molecular Genetics, 2014
Preparation of dissociated zebrafish cells for analysis of Psen1 truncation subcellular localization.
Anne Lim, Morgan Newman, Michael Lardelli.
Zebrafish, 2015 (Under review)
4
ABSTRACT
Alzheimer’s disease (AD) is a neurodegenerative disorder involving neuropathological changes including the presence of amyloid plaques in the brain. Amyloid plaques are comprised mainly of the Aβ peptide, formed by the cleavage of the AMYLOID BETA A4 PRECURSOR PROTEIN (APP) by the enzyme complex γ-secretase. The catalytic component of the γ-secretase complex is PRESENILIN (PSEN1 or PSEN2). Mutations in the human PSEN1 gene have been identified in AD. Some mutations have been found to cause frame shifts leading to premature stop codons that produce transcripts encoding truncated PSEN1 protein. The subcellular location of the PSENs has been controversial, with studies detecting these proteins in multiple areas in the cell. However recent research has shown that the PSENs are enriched in the mitochondria associated membranes (MAM).
The zebrafish is a small freshwater fish that is a useful animal model for the study of human diseases. Zebrafish have genes that are orthologous to human genes that play a role in AD, including those that encode the components of the γ-secretase complex. However, the zebrafish orthologue of the NICASTRIN gene has not been studied in detail. In Chapter II, we characterize in zebrafish the orthologue of the human NICASTRIN (NCSTN) gene that encodes a protein component of the γ-secretase. We demonstrate the spatial and temporal expression level of zebrafish ncstn in embryos and various adult tissues. This work provides the basic knowledge required to further the understanding of the role of Ncstn in the γ- secretase complex using the zebrafish animal model.
Several truncations of the human PSEN1 and zebrafish Psen1 proteins appear to have differential effects on Notch signalling and Appa cleavage. The basis for these differences is still unclear. Chapter III examines the subcellular localization of fusions of truncations of zebrafish Psen1 protein with green fluorescent protein (GFP) using a simple protocol to obtain single cells from zebrafish embryos for microscopy analysis. We show that the different truncations analysed appear to have similar distributions, suggesting that the differential effects on γ-secretase substrates are likely not due to different subcellular
5 localisations of these truncated forms of Psen1. This chapter contributes a new method of viewing a single layer of zebrafish cells with confocal microscopy.
The mitochondria-associated membranes (MAM) are a subcompartment of the endoplasmic reticulum (ER) which interacts with mitochondria. The MAM is highly enriched in PSEN1 and PSEN2. Mitochondrion-ER appositions are increased in Psen1-/-/Psen2-/- mouse embryonic fibroblasts (MEFs) and also in familial AD (FAD) and sporadic AD (SAD) patient cells. These results, which were performed using mammalian cells, have not been studied in the zebrafish animal model. Therefore, Chapter IV of this thesis examines the effect of inhibiting zebrafish psen1 and psen2 activity on mitochondrion-ER appositions in 24 hpf embryos. The findings in this study differ from those done in mammalian cells. In Chapter V we use Western immunoblot analysis to determine if the MAM contains several proteins of interest. The results of this study show that SORL1 protein, which has been linked to SAD, is present in the MAM. The work in Chapters IV and V will help to give deeper insight into the role MAM plays in both SAD and FAD.
Autophagy is a regulated catabolic process in which the cell digests cytoplasmic constituents by lysosomal degradation. The role of autophagy in AD continues to be investigated, as dysfunction in any of the stages of autophagosome formation could lead to neurodegeneration. In Chapter VI we examine the ability of the antihistamine drug Latrepirdine to induce autophagy in zebrafish larvae. The findings of this chapter indicate Latrepirdine is capable of inducing autophagy in 72 hpf larvae, making it a suitable model to study the mechanisms of this drug.
6
LIST OF ABBREVIATIONS
AD Alzheimer’s disease
AI Acne Inversa
AICD APP intracellular domain
CHO Chinese hamster ovary
CTF C-terminal fragment
DAP DYIGS and peptidase region
DRM Detergent-resistant membrane
EOAD Early-onset Alzheimer’s disease
ER Endoplasmic reticulum
FAD Familial Alzheimer’s disease
FTD Frontotemporal dementia
LOAD Late-onset Alzheimer’s disease
LTP Long-term potentiation
MAM Mitochondria-associated membrane
MCI Mild cognitive impairment
MEF Mouse embryonic fibroblast
MO Morpholino
NTF N-terminal fragment
PE Phosphatidylethanolamine
PS Phosphatidylserine
SAD Sporadic Alzheimer’s disease
TGN Trans-Golgi network
ROS Reactive oxygen species
7
CHAPTER 1
LITERATURE REVIEW
8
1.1. Introduction
Dementia is a term used to describe diseases that cause the progressive deterioration of mental abilities such that it is severe enough to interfere with daily functioning. Alzheimer’s disease
(AD) is the most common form of dementia with 60-80% of dementia cases classified as AD [1,
2]. It is a neurodegenerative disorder characterized by progressive memory loss, in addition to impairment of speech and motor ability, depression, delusions, hallucinations, aggressive behaviour, and ultimately death (reviewed in [3]).The neuropathological hallmarks of AD are the presence of neurofibrillary tangles and amyloid plaques in the brain. Neurofibrillary tangles consist of the hyperphosphorylated forms of a protein called tau [4]. Amyloid plaques are composed mainly of the Aβ peptide, formed from the cleavage of the C99 fragment of the
AMYLOID BETA (A4) PRECURSOR PROTEIN (APP) by the enzyme complex known as γ- secretase. Besides these hallmarks, other abnormal features observed in AD patients are altered lipid, cholesterol or phospholipid metabolism [5], aberrant calcium homeostasis [6] and mitochondrial dysfunction (reviewed in [7]). Risk factors of the disease can be of a genetic or non-genetic nature.
AD can be divided into two forms as defined by age, early onset AD (EOAD, <65 years) and late onset AD (LOAD, >65 years) (reviewed in [8]. The majority of AD cases are of the sporadic
LOAD form (90-95%) [9]. EOAD cases only constitute 1-6% of all AD cases, of which approximately 60% are familial (FAD), inherited from one generation to the next [8]. However, even though EOFAD only makes up a small number of cases, a large body of research has been
9 focused on studying the defective genes linked to EOFAD as it has advanced the understanding of the molecular pathology of AD. Genes linked to EOAD are known to have mutations that cause AD. However, LOAD genes are associated as risk factors for developing AD but may not result in the disease.
The Amyloid Cascade Hypothesis
There are several hypotheses regarding the pathogenesis of AD, with the amyloid hypothesis being the most popular. It states that the accumulation of Aβ either via overproduction or lack of clearance, leads to its oligomerization and deposition in the brain and ultimately to neuronal dysfunction, degeneration and death [10]. The focus of the amyloid cascade hypothesis has shifted from plaques to soluble forms of Aβ as the toxic forms that harm neurons and synapses.
Most research has focused mainly on how Aβ causes neurodegeneration. Some studies suggest that one of the causes of neuritic dystrophy is the ability of Aβ peptides to promote oxidative stress (reviewed in [11]). Aβ overexpression in transgenic mice, C. elegans, and cell cultures results in increased biomarkers of oxidative stress [12]. In the AD brain, regions that are Aβ-rich appear to have increased levels of protein oxidation [13]. Compared to normal brain, the AD brain also shows decreased amounts of α-tocopherol, an antioxidant [14, 15]. However, it has also been suggested that the presence of Aβ in the brain is a protective response to oxidative stress [16]. Aβ can prevent lipid peroxidation at concentrations similar to those measured in biological fluids [16] and can prevent metal-induced cell death in neuronal cell culture [17].
10
Other research suggests Aβ can bind to particular molecules on the neuronal surface [18-20] that in turn affect signalling pathways. Aβ potentially interferes with long term potentiation (LTP)
[21]. Aβ appears to disrupt the activation of several kinases that are required for LTP and further investigation indicated that Aβ binds to the insulin receptor, inhibiting it and multiple downstream kinases important for hippocampal LTP [21]. This could lead to loss of dendritic spines and synapses.
The γ-secretase complex, its components and substrates
The γ-secretase complex generates Aβ peptides of varying sizes but mainly forms Aβ40 and Aβ42.
In normal cells, Aβ40 is the more common species found, accounting for roughly 90% of total Aβ
[22]. Aβ42 only accounts for 10% of total Aβ in the cell [23]. However, Aβ42 is the predominant peptide found in amyloid plaques, probably because it is more aggregation prone than Aβ40.
The γ-secretase complex is an aspartyl protease that proteolytically cleaves many type I transmembrane proteins. These are single-pass transmembrane proteins with an extracellular N- terminus and cytosolic C-terminus. Among the most well-known of the γ-secretase substrates are
AMYLOID BETA (A4) PRECURSOR PROTEIN (APP) and NOTCH proteins.
APP is a transmembrane protein with a large extracellular domain and a short cytoplasmic region
(reviewed in [24]). There are two pathways in which cleavage of APP occurs (Figure 1). In the
11 non-amyloidogenic pathway, APP is first cleaved in the extracellular juxtamembrane region by
α-secretase, releasing secreted soluble α-APP fragments, with a C83 fragment remaining embedded in the membrane. The C83 fragment is then cleaved by γ-secretase to form a non amyloidogenic P3 fragment and the APP intracellular domain (AICD). AICD translocates to the nucleus and activates gene transcription [25]. In the amyloidogenic pathway, APP is cleaved by
BETA APP CLEAVING ENZYME (BACE), releasing soluble, secreted β-APPs and an embedded C99 fragment. C99 is then cleaved by γ-secretase to generate smaller Aβ peptides of different sizes, such as Aβ40 and Aβ42, while releasing AICD intracellularly [25]. Aberration in proteolytic processing of APP leads to the formation of Aβ plaques in the brain and is associated with Alzheimer’s disease [10].
Figure 1. Two pathways of proteolytic processing of APP. Schematic diagram representing cleavage of APP. a) In the non-amyloidogenic pathway, APP is cleaved by α-secretase, releasing α-APP. γ-secretase cleavage of the C83 fragment forms the P3 fragment and the AICD. b) In the amyloidogenic pathway, BACE cleaves APP to form β-APP. C99 is cleaved by γ-secretase generating Aβ peptides and AICD (Diagram taken from De Strooper et al. (2010)).
12
NOTCH proteins are cell surface receptors involved in cell fate decisions during development
[26, 27]. γ-secretase cleaves NOTCH at its intracellular domain when receptor-ligand binding occurs. This cleavage releases the NOTCH intracellular domain (NICD) that similarly to AICD, translocates into the cell nucleus and is involved in transcription regulation [26, 28].
The γ-secretase complex is the proteolytic complex critical for processing of many substrates including APP [29-31]. The complex consists of four main components (Figure 2), the
PRESENILINS (PSEN1 OR PSEN2), NICASTRIN (NCSTN), ANTERIOR PHARYNX
DEFECTIVE HOMOLOG 1 (APH1) and PRESENILIN ENHANCER γ-SECRETASE
SUBUNIT (PSENEN). These four components interact in a stoichiometric ratio of 1:1:1:1 [32].
A substantial amount of literature has been dedicated to studying each component of the complex in order to elucidate their function.
Figure 2. The four members of the γ-secretase complex within the lipid bilayer. PRESENILINS are proposed to be nine-pass transmembrane proteins that are synthesized as approximately 50 kDa holoproteins. Endoproteolytic cleavage occurs at the loop domain between transmembrane domains 6 and
13
7 to form an N-terminal fragment (NTF) of approximately 28 kDa and a C-terminal fragment (CTF) of approximately 18k Da. The remaining proteins, NCSTN, APH1 and PSENEN (formerly PEN2) make up the γ-secretase complex (Diagram taken from Tomita and Takeshi (2013)).
PSEN
PRESENILINS are transmembrane proteins that are core components of the gamma-secretase (γ- secretase) complex, a multi subunit enzyme complex involved in intramembrane proteolysis of a large number of transmembrane proteins. In humans, there are two PRESENILINS proteins,
PRESENILIN-1 (PSEN1) and PRESENILIN-2 (PSEN2) which share close to 67% sequence identity and are encoded by the respective genes PSEN1 on chromosome 14, and PSEN2 on chromosome 1[33].
The PRESENILINS are synthesized as approximately 50kDa holoproteins with 9 transmembrane domains that undergo endoproteolytic processing to form an N-terminal fragment (NTF) of approximately 28kDa and a C-terminal fragment (CTF) of approximately 18kDa in a 1:1 stoichiometry [34, 35]. Recent evidence points to the endoproteolysis of PRESENILINS being an autoproteolytic event [36] with cleavage of the holoprotein being necessary to form the active γ- secretase [36, 37]. Full length PRESENILIN is short lived, with a rapid turnover rate giving it a half-life of approximately 1.5 hrs whereas cleaved fragments have a half-life of up to 24 hrs [38].
The function of the PRESENILINS in γ-secretase is believed to be that of the enzyme catalytic core. PRESENILIN has two highly conserved aspartates at position 257 and 385 within
14 transmembrane domains 6 and 7 of the protein. Mutation of either aspartate residue results in loss of endoproteolysis of PRESENILIN and abolishes the production of Aβ [39, 40]. Wolfe et al. found that substituting either aspartate with alanine in PSEN1 prevented endoproteolysis of human PSEN1 in Chinese hamster ovary (CHO) cells. They also observed significant reduction in Aβ peptides and an increase in the amount of APP CTF compared to controls. This decrease in
Aβ and increase in APP CTF correlated with the amount of mutant holoprotein produced. No changes in production of β-APP or α-APP were seen, indicating that the increased APP CTF levels were due to reduction of γ-secretase activity and not due to increased cleavage by β- or α- secretases [39]. Similar results were observed in PSEN2 mutants lacking either aspartate [40].
The PRESENILINS are best known for their role in the γ-secretase complex. However, they appear to also have γ-secretase independent functions. PSEN1 has been shown to be involved in lysosomal-dependent proteolysis (discussed later under the subheading “Autophagy and
Alzheimer’s disease”) [41]. The PRESENILINs in holoprotein form are able to form passive calcium leak channels which allow a trickle of calcium ions to escape from the ER and into the cytoplasm [42, 43].
NCSTN
The second protein to be identified in the γ-secretase complex, NICASTRIN (NCSTN) was discovered through co-immunoprecipitation studies with PSEN1 [44]. NCSTN is a large 130kDa type I transmembrane protein that can have a highly glycosylated ectodomain [44, 45]. NCSTN’s role in the γ-secretase complex is unclear, but it may be involved in assembly and maturation of
15 the γ-secretase complex, with the ectodomain being necessary for γ-secretase complex maturation but not its activity [46]. The NCSTN ectodomain contains a conserved glutamate 333 residue
(E333) that may have a significant role in the maturation of NCSTN via the secretory pathway
[46]. Furthermore, studies have shown that NCSTN might not take part in γ-secretase activity
[47]. γ-secretase retained activity in two independent NCSTN deficient mouse embryonic (MEF) cell lines [47]. The trimeric γ-secretase component is similar biochemically to wild type γ- secretase but is unstable in detergent solution compared to γ-secretase containing NCSTN, signifying NCSTN’s main role is to stabilize γ-secretase [47]. Trimeric γ-secretase with PSEN1 mutants (S438P or F411Y/S438P) are also fully capable of proteolysing substrates [48]. It is possible that the S438P mutation increased the stability of the γ-secretase complex, and therefore reduced its dependency on NCSTN [48].
Alternatively, it has been argued that NCSTN’s role in the γ-secretase complex is in substrate recognition [49]. The ectodomain of NCSTN has been shown to interact with γ-secretase substrates, with the carboxylate side chain of the E333 residue playing a crucial role in recognition of the N-termini of substrates [49]. The NCSTN ectodomain is the location of the
DAP domain (DYIGS and peptidase region) where E333 is also located. Also located in the domain are five consecutive residues that make the conserved DYIGS motif. Interestingly, a region downstream of the DAP domain mediates substrate binding but not γ-secretase complex formation [50]. Furthermore, work by Xie et al. who studied the crystal structure of Nicastrin from the eukaryote Dictyostelium purpureum found that the extracellular/luminal domain has a large lobe which most likely constitutes the substrate binding site of Nicastrin, and a small lobe which associates with the large lobe [51]. Interestingly, the conserved glutamate residue cognate
16 to human E333 and a Y293 residue that corresponds to Y337 of the DYIGS motif in human
NICASTRIN are located within the putative substrate-binding pocket of the large lobe, further signifying the importance of the E333 residue and the DYIGS motif in substrate binding [51].
Figure 3. The topology of NCSTN. The large ectodomain contains the DYIGS motif and glycosylation sites (indicated by the ovals). SP indicates the signal peptide, C indicates conserved cysteine residues, TM indicated the transmembrane domain. The shaded areas indicate highly conserved domains between human, murine, D. melanogaster and C. elegans NCSTN orthologues (Diagram taken from Yu et al. (2013)).
APH1
ANTERIOR PHARYNX DEFECTIVE HOMOLOG 1 (APH1) contains seven transmembrane domains with its N-terminal in the lumen and the C-terminal in cytosol [52]. In humans, there are two APH1 homologs, APH1a and APH1b. APH1a has two splice variants, APH1aL and APH1aS
[53]. In mice, there is an additional homolog known as APH1c [54]. Deletion of APH1a in mice causes embryonic lethality but deletion of APH1b or APH1c does not, implying that the different
APH1 isoforms perform different functions, with APH1a being important for embryonic
17 development [54, 55]. The actual role APH1 plays in the γ-secretase complex is not fully elucidated although it is likely a scaffolding protein to which PRESENILIN can bind to [56].
Figure 4. The structure of APH1. APH1 is a seven transmembrane protein with its N-terminal facing the lumen and the C-terminal in the cytosol (Diagram modified from Kimberly et al. (2003)).
PSENEN
PRESENILIN ENHANCER γ-SECRETASE SUBUNIT (PSENEN), formerly known as PEN2, is a 101amino acid, double membrane spanning protein [57]. It binds preferentially to the
PRESENILINS in the complex, and endoproteolytic cleavage of the PRESENILINS to form NTF and CTF requires the presence of PSENEN [58]. PSENEN appears to be important for stabilization of the PSEN fragments and in maturation of the complex [59].
18
Figure 5. The structure of PSENEN. PSENEN is a double membrane spanning protein with both terminals believed to face the cytosol (Diagram modified from Kimberly et al. (2003)).
Formation of the γ-secretase complex
The endoproteolytically cleaved PSEN1 protein along with the three other components, NCSTN,
APH-1, and PSENEN form the active enzyme complex. The assembly of the γ-secretase complex is believed to begin at the endoplasmic reticulum (ER) [56]. It is believed immature NCSTN and
APH-1 form the scaffolding to which PSEN1 holoprotein binds, forming a trimeric intermediate
[56]. Structural analysis points to the NCSTN-APH1 complex binding to the CTF of PSEN1 [60-
62]. PSENEN is added to the intermediate, after which NCSTN undergoes a conformational switch, resulting in the release of γ-secretase from the ER [56]. A structural prediction approach modelled on the crystal structure of the PSEN1 archaeal homologue PSH indicates PSENEN binds transmembrane 4 of PSEN1, which lies opposite to where NCSTN and APH1 bind in the complex [63]. Maturation of the complex occurs further down the secretory pathway, via endoproteolysis of PSEN to its NTF and CTF [64].
19
Genetic risk factors associated with familial Alzheimer’s disease
Mutations in three genes have been identified to cause FAD. These are the APP [65], PSEN1 [66] and PSEN2 genes [33]. Of the three proteins, the focus has been on PSEN1 due to the large number of mutations in the PSEN1 gene that have been linked to dementias such as Alzheimer’s disease and frontotemporal dementia [67], the familial form of the heart condition dilated cardiomyopathy [68], and the chronic inflammatory skin condition known as Acne Inversa [69].
Mutations in APP
The earliest reported APP mutation was in 1991 [65]. Since then upwards of 30 different missense APP mutations have been described, most of which are pathogenic. APP mutations located at the β and γ-cleavage sites of APP increase the Aβ42 to Aβ40 ratio [70].
Mutations in PSEN1
There are currently more than 170 known mutations of PSEN1
(http://www.molgen.ua.ac.be/admutations). These mutations are believed to affect APP processing and increase the Aβ42: 40 ratio. Of these, most are missense mutations that do not cause truncation or affect the C-terminal sequence of the protein [71]. However, aberrant splicing of PSEN1 has been linked to disease progression in some cases of AD. Some mutations affect splice sites, forming mRNAs lacking one or more exons. The L271V mutation was found in a
20 familial pedigree with FAD and encodes for a substitution of valine for leucine at codon 271, within exon 8 [72]. The mutation appears to increase exclusion of exon 8 from mRNAs obtained from AD brain and gives increased Aβ42 production in COS-7 cells [72].
A deletion of exon 9 (Δ9) from PSEN1 transcripts from AD has also been observed [37]. The loss of exon 9 in PSEN1 transcripts can be due to a mutation affecting the splice acceptor site of exon 9 [73], or a genomic deletion of exon 9 [74]. Loss of exon 9 in PSEN1 causes a high level of Aβ42 production in AD brain [37].
Mutations have also been found that cause a frame shift leading to a premature stop codon and transcripts encoding truncated protein. The PSEN1 delta 4 mutation was found in 2 patients with
EOAD [34]. It causes a 1 base pair (bp) deletion within the splice donor site of intron 4, resulting in transcripts which lack part, or all of exon 4 and causes a shift in reading frame leading to a premature stop codon. Normal full length transcripts, and full-length transcripts with an additional TAC triplet coding for insertion of an amino acid after amino acid 113 are also formed.
A PSEN1 mutation has also been identified in frontotemporal dementia (FTD), a form of dementia characterized by changes in behaviour and personality, impaired thinking and language difficulties (reviewed in [75]). Among the neuropathological symptoms observed in FTD is the atrophy of the temporal and frontal lobes [75]. The mutation G183V encodes a change from G to
T at codon 183, at the splice junction of exon 6 and intron 6 [67]. RT-PCR of a cDNA clone
21 sequence revealed transcripts lacking exon 6 or exons 6 and 7, with a shift in the reading frame encoding a premature stop codon downstream of exon 5 [67]. Full-length transcripts with the altered sequence are also produced [67].
Recently a PSEN1 mutation was found in one family suffering from familial Acne Inversa (AI), a chronic inflammatory disease that affects the hair follicles [76]. This mutation caused a single bp deletion in PSEN1 leading to a frameshift mutation [76]. Transcript expression of the mutant allele was reduced, most likely due to nonsense-mediated decay. Mutations were also found in
NCSTN and PSENEN. Surprisingly none of the AI affected individuals showed symptoms of AD or dementia.
The effects of interference of PSEN1 splicing have been studied further by Nornes et al. using the zebrafish animal model (see later for zebrafish animal model). Zebrafish have orthologues of human PSEN1 and PSEN2, named presenilin 1 (psen1) and presenilin 2 (psen2) [71].
Interference with translation of the Psen1 protein or with splicing of the psen1 transcript was performed using morpholino antisense oligonucleotides (MOs), which are patented oligonucleotides with backbone modifications that make them more resistant to nuclease digestion (reviewed in [77]). MOs bind to the translation start codon/5´- untranslated region (5´
UTR) or splice donor/acceptor sites of mRNAs via Watson-Crick basepairing to prevent the translation or splicing machinery from binding the target mRNA [77].
22
Nornes et al. attempted to model human PSEN1 splicing mutations such as L271V and PSEN1Δ9 using MOs. Zebrafish embryos were injected with MOs targeting the splice sites of the psen1 mRNA in order to exclude the exons of interest [71]. However, it was found that MO blockage of the splice acceptor site did not result in exon exclusion; rather it resulted in the inclusion of the preceding intron and failure of correct splicing out of targeted exons from transcripts. This in turn resulted in the truncation of the open reading frame (ORF). These aberrant transcripts were capable of evading nonsense mediated decay and were translated into truncated forms of the
Psen1 protein [71].
Due to their high homology and to simplify discussion, the zebrafish psen1 exons have been referred in terms of the human PSEN1 exon number. Interference with Psen1 translation results in phenotypes that resemble a loss of Notch signalling, likely due to loss of function of the γ- secretase complex [71]. Likewise, truncation after exons 6 and 7 also appeared to show loss of
Notch signalling. A reduction in Notch signalling is known to cause increased expression of the gene neurogenin1 (neurog1) [71]. Increased expression of neurog1 was observed in zebrafish embryos injected with MOs inhibiting translation or causing truncation after exons 6 or 7, further confirming a loss of Notch signalling [71].
A phenotype seen in zebrafish embryos during interference in exon 7 or 8 splicing was expanded brain ventricles [71]. This phenotype is not due to loss of the γ-secretase activity as use of the γ- secretase inhibitor DAPT failed to give this phenotype [71]. Therefore the expanded brain ventricle phenotype is likely due to an alternative molecular activity of Psen1. Loss of Psen1 also
23 interfered with Psen2 activity, as it was found that the number of dorsal longitudinal ascending
(DoLA) interneurons increased relative to controls. The increase of DoLA interneurons is a phenotype seen only when Psen2 translation is blocked, while decreased Psen1 expression does not have an effect [78]. RT-PCR to quantify the level of mRNA splicing found that normal levels of Psen1 mRNA were present with only low levels of aberrantly spliced mRNA produced. This indicates that truncation of the Psen1 protein after exon 6 or 7 acts in a dominant negative manner to reduce Psen1 activity, with only a small amount of aberrant protein required to give the phenotype [71]. To confirm the results observed with MOs, mRNAs encoding the truncated proteins were synthesized and injected into embryos, and confirmed the MO observations. It is hypothesized that these Presenilin truncations interfere with normal Presenilin function through unknown mechanisms that require elucidation.
The subcellular localization of truncated forms of PSEN1 proteins is currently unknown.
Interestingly, a substitution of aspartate 257 to alanine in PSEN1 causes a change in PSEN1 distribution, favouring anterograde flow to post-Golgi compartments over retrograde flow from the Golgi to the ER [79]. Likewise, truncations of PSEN1 could cause changes in its distribution in the cell. Identifying their cellular localization may give insights into their dominant negative effects.
The subcellular localization of NOTCH and APP in the cell differs slightly. For instance,
NOTCH is localized mainly at the plasma membrane, but can be found in endosomes [80, 81].
24
APP has been found mostly within the cell along the late secretory pathway, with a small amount at the plasma membrane [24].
Risk factors associated with sporadic Alzheimer’s disease
Several environmental and dietary risk factors are known to associate with SAD. These include old age, previous family history of dementia [82, 83], high cholesterol levels [84, 85], obesity
[86], and diabetes [87]. This section covers a more in depth look at some of these factors.
The association between cholesterol and plaque formation in the brain appears to be dependent on the fraction of cholesterol present. A study on serum cholesterol has identified elevated cerebral Aβ with higher fasting levels of low-density lipoprotein (LDL), the cholesterol linked to atherosclerosis, and lower levels of high-density lipoprotein (HDL) [88]. Although animal model studies have shown that a high cholesterol diet does increase Aβ plaque formation [89-91] the mechanism linking cholesterol with Aβ is not fully understood.
It has been suggested that the link between obesity and AD is through metabolic abnormalities such as type 2 Diabetes mellitus, a disorder of glucose metabolism [92]. Insulin can be transferred across the blood-brain barrier, where it can bind to receptors in the brain and modulates cognitive function (reviewed in [93]). Large numbers of these receptors are located in areas of the brain involved in memory such as the hippocampus and cerebral cortex (reviewed in
25
[94]). The presence of insulin increases the expression of the insulin degrading enzyme (IDE), which degrades insulin as well as Aβ. Therefore insulin deficiency results in the accumulation of
Aβ peptides in the brain [95].
Recent work has indicated a link between periodontal disease and AD. Periodontal disease is an inflammatory condition of the tissues supporting teeth that is caused by polymicrobial bacteria present in the mouth. The host immune response against the pathogens gives rise to systemic inflammation [96]. In the study, post mortem AD brain tissue was found to contain periodontal- related bacteria, but not control brain tissue [96]. The hypothetical mechanism suggests that bacteria transferred into the brain could cause vascular inflammation which would exacerbate AD features [96].
Metal toxicity also appears to associate with SAD. Cortical iron elevation has been a feature seen in AD brain and could be a contributor to oxidative damage in the brain [97]. Similarly, aluminium toxicity has also been linked to SAD. Although its mechanisms are unclear, there is evidence that aluminium is able to increase the leakiness of epithelial and endothelial barriers, which in turn may allow its transfer from the blood to the brain [98].
26
APOE
Several genome wide association studies have been undertaken to try and identify genetic risk factors of late sporadic LOAD [99]. One genetic risk factor that has been linked to a majority of
LOAD cases is the inheritance of one or more ε4 alleles of the APOLIPOPROTEIN E (APOE) gene encoding the APOE4 protein which is involved in lipid transfer [99, 100]. The brain is abundant in lipids (reviewed in [101]). However, lipids are insoluble and must be coated with apolipoproteins such as APOE before they can be transported via receptor mediated endocytosis
[102, 103] between lipid producing cells such as from glial cells to neurons [104]. APOE has three isoforms, with the most common allele being APOEε3 followed by APOEε4 and APOEε2
[102, 105].
Although it is known that APOE plays a role in lipoprotein metabolism, the neuropathological pathway by which it is involved in AD has remained unclear [105]. Currently, there are several hypotheses concerning the role of APOE ε4 in AD. One such hypothesis suggests that APOE facilitates the clearance of Aβ from the brain by interacting with receptors to transfer Aβ across the blood brain barrier (BBB) [102]. Castellano et al. have shown that cognitively normal individuals under the age of 70 with the APOE ε4/ ε4 genotype have lower levels of Aβ in the cerebrospinal fluid (CSF) compared to those with the ε2/ε3 or ε3/ ε3 genotypes [102]. This indicates that, in individuals with the ε4/ ε4 genotype, Aβ tends to accumulate in the brain and does not move into the CSF [102]. Using a dye that binds amyloid plaques in the brain, it was also found that individuals with the ε4/ ε4 genotype bind more dye in the hippocampus and
27 interstitial fluid, compared to the other genotypes, further indicating accumulation of Aβ in the brain [102]. On the other hand, other research appears to link APOE to Aβ deposition [103].
Studies using aged APPV717F AD mice models expressing APOE have shown significant Aβ fibrilar deposits compared to controls [103]. However, APPV717F AD mice lacking APOE have very little or no neuritic plaque development, suggesting that APOE is required for Aβ deposition and fibril formation [103].
SORL1
Another gene identified by genome wide association studies to be associated with sporadic
LOAD is the neuronal sorting receptor SORL1, with multiple SNPs identified that significantly associated with AD [106-108]. SORL1 is a 250 kDa type I transmembrane protein that is a member of the low-density lipoprotein receptor (LDLR) family of APOE receptors and also the vacuolar protein sorting 10 (VPS10) domain receptor family. SORL1 expression is widespread in the brain, with most prominent expression in neurons of the hippocampus, some nuclei of the brain stem and in Purkinje cells [109]. Subcellularly, SORL1 appears to be in the Golgi compartment, plasma membrane and endosomes [110, 111].
The pathogenic nature of SORL1 in AD is not entirely clear. The discovery that SORL1 can interact with APP and acts as a sorting receptor, therefore affecting its processing and trafficking in the cell, indicates its importance in APP metabolism [111]. Two models have been suggested
28 for the mechanism by which SORL1 regulates APP metabolism. In the first model, SORL1 regulates the release of APP from the TGN to the cell surface [112]. SORL1 mediated accumulation of APP in the TGN would in turn prevent APP cleavage by secretases and reduce production of Aβ. The second model suggests it assists retrograde transport away from amyloidogenic processing in the endocytic pathway where BACE cleavage of APP primarily occurs [113].
The levels SORL1 present affect the production of Aβ produced within cells [111]. Increasing
SORL1 in cell lines appears to reduce processing of APP to produce Aβ while SORL1-deficient mice show a 30% increase in Aβ levels compared to controls [111]. Some studies found SORL1 expression is reduced in the brain tissue of individuals with AD [111, 114]. SORL1 levels were also reduced in cases of mild cognitive impairment (MCI) and their levels were intermediate between no cognitive impairment and AD cases [115]. The reason for SORL1 reduction in the brain is unclear but its reduction appears to relate to the severity of impairment of individuals.
Hypoxia, PS2V and reactive oxygen species
Evidence suggests a vascular component in the development of SAD. Studies have found that cerebral blood flow declines with age. However, it is more pronounced in the AD brain [116], with decreased density and fragmentation of microvasculature and Aβ deposition occurring in blood vessels in the AD brain [117]. These changes to vasculature lead to hypoperfusion and hypoxia of the brain, and can contribute to an increase in production of reactive oxygen species
29
[116]. Hypoxia has been shown to have an effect on BACE. Zhang et al. have shown that mice neuroblastoma N2a cells exposed to acute hypoxia have increased expression of BACE1 mRNA and protein, and increased production of Aβ peptides [118]. Hypoxia also increases expression of
PSEN2 [119], and PSEN1 [120] in rat and mice cells.
Hypoxia also induces HMGA1a, a non-histone DNA binding protein, which can bind to specific sites on the fifth exon of PSEN2 pre-mRNA resulting in exon 5 exclusion from the pre-mRNA to form the truncated isoform PS2V [121, 122]. PS2V has been found in the cerebral cortex and hippocampus of SAD patients [121].
Studies relating to hypoxia have also been performed using zebrafish. Exposure to hypoxia produces oxidative stress in zebrafish [122]. Interestingly, exposure of zebrafish to hypoxia leads to increased expression of zebrafish bace1, psen1, psen2, and the paralogues of human APP, appa and appb, at the embryonic developmental stage equivalent to 48 hours, and in adult zebrafish brain [123]. These results obtained in the zebrafish animal model appear to be consistent with results obtained using mammalian animal models and imply that the response of these genes to hypoxia is evolutionarily conserved [123].
Alternative hypotheses to the Amyloid Cascade Hypothesis
The amyloid cascade hypothesis has dominated the field of AD research for more than 20 years.
This hypothesis proposes that toxic forms of Aβ are the main cause of AD [10]. The increased
30 levels of Aβ observed in AD patients compared to controls had given support to the hypothesis
[124, 125]. Based on the assumption that clearance of Aβ would improve cognition, several drugs were designed targeting amyloid in the brain. Several drugs did in fact successfully remove Aβ from the brain, however none of the drugs under clinical trials improved cognitive function
(reviewed in [126]). The failure of the clinical trials has cast doubt over whether Aβ is the causal in AD, or perhaps may be associated with the disease but not the specific cause of the disease.
Furthermore, cognitively normal elderly individuals have been shown to have large deposits of amyloid in brain tissue [127, 128] and this seems to indicate that AD neuropathology does not necessarily associate with cognitive decline. Individuals with trisomy 21 (Down syndrome) who possess three copies of the APP gene have elevated levels of the Aβ peptide and diffuse non- fibrillar plaques but the prevalence of dementia was 70% by age 70, not the presumed 100% prevalence for individuals growing old with Down syndrome ( reviewed in [129]). Most adults
(~95-98%) with Down syndrome in their 30s to 40s do not suffer from dementia [129].
Therefore, the presence of plaques does not always correlate with cognitive impairment.
Other abnormalities observed in AD patients such as altered lipid, cholesterol or phospholipid metabolism [5], aberrant calcium homeostasis [6] and mitochondrial dysfunction (reviewed in
[7]) lack an apparent direct link to the amyloid cascade hypothesis. These less well-known features of AD have prompted numerous alternative hypotheses focusing on cholesterol [130,
131], calcium [132], mitochondria [133], glucose [134], inflammation [135], tau [136] and more to explain how each feature contributes to the pathogenesis of AD.
31
Subcellular localization of PSEN1
To better understand how all the features of AD fit together to bring about the disease, research has focused on the subcellular level including identifying the localization of AD-related proteins.
The intracellular localization of APP and the components of its cleavage are of interest in order to identify the cellular compartments in which Aβ is produced. The general consensus is that APP is localized to the late secretory pathway and cell surface [24]. Previous studies estimated that 10% of APP is found at the plasma membrane where α-secretase activity produces the p3 fragment, while the majority of APP resides at the Golgi/trans Golgi network (TGN) [24]. APP has also been identified in endosomes and lysosomes [137]. Similar to APP localization, BACE has been located in the TGN, endosomes and the cell surface where it can come into contact with APP
[138]. BACE cleavage in these compartments can be linked to the generation of Aβ peptides in the TGN and endosomes [24, 139, 140]. The presence of Aβ and p3 peptides is also indicative of
γ-secretase activity in plasma membrane, TGN and endosomes, however the location of its catalytic component PSEN1, appears to be somewhat controversial. PSEN1 has been detected abundantly in the early secretory compartments such as the ER or Golgi [141, 142]. Other studies detected lesser amounts of PSEN1 in many other cellular locations such as the lysosomes [137], mitochondria [143], centrosomes [144], interphase kinetochores [144] and nuclear envelope [79,
141, 144].
A recent study by Area-Gomes et al. sheds more light on the subject of PSEN1’s cellular localization. They suggest that PSEN1 is highly enriched in the mitochondrial associated
32 membrane (MAM), a detergent resistant membrane (DRM), while PSEN2 appears to localize exclusively at the MAM [145]. The MAM is a sub-compartment of the ER that is in close contact with the mitochondria, allowing for physical interaction between the ER and mitochondria to occur (Figure 3) [145].
The MAM appears to play several important roles. For instance, the MAM appears to regulate the
Ca2+ levels in mitochondria, via the presence of membrane receptors such as inositol-1,4,5 triphosphate receptors (IP3R) and sarco/endoplasmic reticulum Ca2+ ATPase (SERCA) (reviewed in [146]). MAM also contains proteins involved in lipid metabolism [145, 147]. The production of phosphatidylethanolamine (PE) can occur in the ER alone but is mostly synthesized collaboratively by the MAM and mitochondria. Phosphatidylserine (PS) is synthesized in the
MAM with the presence of the enzyme PHOSPHATIDYLSERINE SYNTHASE2 (PTDSS2)
[148]. PS can then be transferred to the mitochondria to synthesize PE [149]. The synthesis of cholesterol to cholesteryl esters also occurs at the MAM [150].
The MAM is also the site of oxidative protein folding via the formation of an electron transport chain involving two proteins, ERO1-LIKE PROTEIN ALPHA (ERO1L) and PROTEIN
DISULFIDE ISOMERASE (PDI) [146]. ERO1L generates disulfide bonds, which are then transferred to PDI via oxidation of PDI by ERO1L [151-153]. PDI in turn catalyses the formation of disulfide bonds within folding proteins [152, 153].
Besides PSEN1, the other components of the γ-secretase complex were also detected, along with the γ-secretase substrate APP in MAM [145]. A fluorescence based γ-secretase assay using a
33 fluorogenic peptide substrate detected γ-secretase activity in the MAM while Western blotting revealed cleavage of APP to form the AICD fragment, further demonstrating active γ-secretase was present in the MAM [145]. This new finding may point to disruption of the MAM as playing an important role in AD pathogenesis. Interestingly, APOE protein has been detected in the
MAM [154], implying that disruption of the MAM could be the link to the sporadic form of AD.
As altered lipid, cholesterol, or phospholipid metabolism and calcium homeostasis are among some of the features seen in AD, and MAM is known to play a role in Ca2+ regulation as well as lipid and cholesterol metabolism, altered MAM function may be the key to understanding AD pathogenesis.
The close interaction between MAM and the mitochondria may also be linked to mitochondrial dysfunction seen in AD [7, 155]. Aβ is found in mitochondria [156], and it is possible that Aβ produced by APP cleavage in MAM is transferred to mitochondria, contributing to mitochondrial dysfunction. Mitochondrial damage leads to a decrease in ATP production while increasing production of reactive oxygen species (ROS) (reviewed in [157]).
Area-Gomez et al. further explained why the PSENs were not identified in the MAM in previous localization studies. The authors have suggested that the discrepancy in PSEN1 localization may be due to the lipid raft nature of MAM that can result in its co-purification with bulk ER, Golgi, endosomes, and mitochondria [155]. Due to its detergent resistant nature, the use of detergents for permeabilization in immunocytochemical techniques would only visualize the epitopes in
MAM that are not embedded within the DRM [155]. This may explain why PSEN and the other
34 components of γ-secretase were not identified in this sub-compartment earlier [155]. The use of proper markers also allowed for the unequivocal identification of the MAM [145, 155]. It would be interesting to ascertain if other proteins that may play a role in AD are localized to the MAM and determine how their localization contributes to AD pathogenesis.
More recent work indicates cholesteryl ester and phospholipid synthesis is elevated in MEFs lacking PSENs and in both FAD and SAD patient fibroblasts [158]. The number of ER- mitochondrial contacts was also increased in these cells, with increased lengths between ER and mitochondria compared to controls [158].
γ-secretase inhibitor treatment with DAPT increased cholesteryl ester synthesis in various cells, indicating that increased cholesteryl ester synthesis appears to be due to a decrease in γ-secretase activity. However, the same treatment appears to have little effect on co-localization of mitochondria and ER and only causes minor changes to phospholipid synthesis [158]. These results imply that intraorganellar functions within MAM, and interorganellar interactions between mitochondria and MAM, require functional PSENs either as a part of γ-secretase or independently.
35
Figure 3. the MAM and mitochondria. The MAM is a lipid-raft like domain of the ER that is in close contact with mitochondria, allowing for communication between both organelles to occur. The MAM is enriched in anionic phospholipids, cholesterol, and sphingomyelin, compared to bulk ER (Diagram taken from Schon and Area-Gomez (2012)).
Autophagy and its role in Alzheimer’s disease
Autophagy is a regulated catabolic process where the cell digests cytoplasmic constituents such as long lived proteins, macromolecular aggregates and damaged organelles by lysosomal degradation [159]. The metabolites in these lysosomes can be reused by the cell, and so the autophagy pathway can be seen as a recycling pathway for the cell. Additionally, autophagy is involved in the clearance of intracellular microbes from the cell [160, 161].
36
There are three major types of autophagy; macroautophagy, microautophagy and chaperone mediated autophagy. In microautophagy, the formation of the autophagosome sequestration step is not required. Instead invaginations of the lysosomal membrane directly engulf the substrate
(reviewed in [162]). Chaperone-mediated autophagy does not require the formation of vesicles.
Instead, specific chaperone proteins bind to substrate proteins that contain a KFERQ sequence and direct them to the lysosome surface [163, 164]. Macroautophagy is the major subtype of autophagy and involves the formation of a double membrane vesicle known as the autophagosome that sequesters cytoplasmic constituents that require degradation. The autophagosome fuses with a lysosome to form an autolysosome and lysosomal enzymes degrade the contents of the autolysosome. The further focus of this chapter will be on macroautophagy, hereafter referred to as autophagy.
The underlying molecular machinery that drives the induction, elongation and formation of autophagosomes involves many different proteins. Under normal, nutrient rich conditions, the polyprotein complex mammalian target of rapamycin (mTOR) complex 1 (mTORC1) interacts with the ULK1 protein complex (ULK1, ATG13, ATG101, FIP200). Initiation of autophagy occurs with mTORC1 inhibition or AMPK activation which results in mTORC1 dissociation from ULK1 and leads to phosphorylation of specific residues of ULK1. Activation of ULK1 catalyses phosphorylation of other components of the ULK1 complex and leads to its assembly at isolation membranes [165]. ULK1 phosphorylates AMBRA, a component of the BECLIN-
1/PI3K complex (VPS34, VPS15, ATG14, BECLIN-1) and leads to its relocation to the isolation membrane from the cytoskeleton, resulting in the production of phosphatidylinositol 3-phosphate
37
(PI3P) [166]. PI3P binds PI3P effectors, the WD repeat domain phosphoinositide-interacting
(WIPI) family of proteins, to mediate the initial stages of autophagosome formation [167, 168].
Various other proteins that interact with BECLIN-1 are involved in inducing or inhibiting autophagy. For example, ATG14 and UVRAG (UV radiation resistance-associated gene) interact with the PI3K complex in a mutually exclusive manner and compete for binding to the BECLIN-
1/PI3K complex in order to promote autophagosome formation [169-171]. BAX-
INTERACTING FACTOR-1 (BIF-1) which functions as a positive regulator of the PI3K complex interacts with BECLIN-1 via UVRAG and likely generates membrane curvature [172,
173]. RUBICON (Run domain protein as BECLIN1 interacting and cysteine-rich containing) is a negative regulator of autophagy [169, 170].
Following nucleation, the regulation of isolation membrane elongation and expansion involves two ubiquitination-like reactions. In the first, ATG7 and ATG10 are required for the conjugation of ATG5 to the ubiquitin-like molecule ATG12. This conjugate then interacts with ATG16L1 to form the multimeric complex ATG12-ATG5-ATG16L1 which functions as the E3 ligase of LC3
(reviewed in [174, 175]). In the second reaction, the ATG12-ATG5-ATG16L1 complex interacts with ATG3, ATG4 and ATG7 and mediates the conjugation of phosphatidylethanolamine (PE) to the MICROTUBULE-ASSOCIATED PROTEIN 1 LIGHT CHAIN 3 (LC3)-I to form LC3-II
[174, 175]. LC3 is cleaved at its C-terminus by ATG4 to generate cytosolic LC3-I which has a C- terminal glycine residue. This glycine residue is then conjugated to PE in a reaction that requires
ATG7 and ATG3, forming LC3-II. This leads to the translocation of LC3 from the cytoplasm to
38 both sides of the isolation membrane, and the isolation membrane closes to form the autophagosome [176-178]. Most of the ATG12-ATG5-ATG16L1 complex dissociates from fully formed autophagosomes, while LC3-II remains on the autophagosomes [179]. Levels of LC3-II are increased at this point.
After the formation of the autophagosomes, its outer membrane fuses with a lysosome to form an autolysosome. RAB7 is required for autophagosome-lysosome fusion [180, 181]. At this stage
ATG4 delipidates LC3-II on the outer surface of the autophagosome and converts it back to cytosolic LC3-I [182]. RAB7 and LC3 interact with FYVE AND COILED-COIL DOMAIN
CONTAINING 1 (FYCO1) to form a complex that mediates microtubule plus end-directed vesicle transport [183]. After fusion of the autophagosome with a lysosome, the lysosomal enzymes degrade the intra-autophagosomal contents including LC3-II present on the inner surface. Therefore the conversion of LC3-II to LC3-I by ATG4 and the degradation of the luminal LC3-II by lysosomal hydrolases causes the level of LC3-II to decrease (reviewed in
[178]).
39
Figure 4. Autophagy induction and autophagosome biogenesis. Autophagy is the cell’s mechanism for turnover of cytoplasmic constituents including organelles. Many proteins are involved in the molecular machinery that drives the induction, elongation and formation of autophagosomes. Initiation of autophagy occurs with mTORC1 inhibition or AMPK activation leading to formation of the isolation membrane, elongation of the isolation membrane and closure of the inner and outer membranes to form the double- membrane autophagosome (Diagram taken from Nixon (2013)).
Autophagy and Alzheimer’s disease
The presence of autophagic vesicles (AVs) is scarce in neurons of the healthy brain [184, 185] with several possibilities as to why this is the case. One possibility is that the baseline autophagy in healthy neurons is naturally low. A second possibility is that autophagosomes that form are quickly cleared and do not accumulate within the cell. To answer this question, Boland et al.
40 performed a study using cultured cortical neurons derived from rat pups in which they induced autophagy using rapamycin [185]. The strong autophagy induction in neurons resulted in LC3 compartments that were found to also contain active cathepsin D, a lysosomal protease indicative of autophagosome-lysosome fusion, forming autolysosomes. The rapamycin-treated cultures contained greater numbers of autolysosomes than autophagosomes when compared to controls
[185]. These observations indicate healthy neurons can initiate and sustain autophagy induction but that accumulation of autophagosomes does not occur as these are converted to autolysosomes and rapidly cleared from the cell.
In the AD affected human brain, the presence of AVs was frequently observed compared to controls lacking AD pathology. The AVs appear to contain undigested or partially digested cytoplasmic constituents [184]. The AVs appear to be mostly autolysosomes and are the main organelles contained in giant neuritic swellings. Therefore autophagosomes likely can fuse with lysosomes but cannot eliminate substrates properly [184, 186]. Interestingly, when Boland et al. interfered with the clearance of autophagosomes by inhibition of cathepsins using inhibitors in the cell cultures, they observed an increased number of LC3 compartments considerably exceeding the numbers seen in rapamycin-treated cultures. Many of the AVs appeared to be autolysosomes containing undegraded materials, resembling the AD pathology in human brain.
Thus inhibiting lysosomal proteolysis consequently leads to an accumulation of AVs in neurons without altering induction of autophagy [185] and may point to disruption in the lysosomal degradation step as critical in AD pathology. A critical finding has linked the AD genetic risk factor PSEN1 to the lysosomal turnover of autophagosomal and endosomal protein substrates
[41]. The PSEN1 holoprotein physically interacts with the v-ATPase V0a1 subunit in order for it
41 to be N-glycosylated in the ER before it can be delivered to the lysosome [41]. The function of v-
ATPase is as a proton pump that acidifies newly formed autolysosomes in order for activation of cathepsins to occur. Of particular significance was the finding that AD-related PSEN1 mutations affect the targeting of the v-ATPase to lysosomes in fibroblasts from AD patients and cause the impairment of autophagy [41].
Altered lysosomal proteolysis may not be the only potential contributor of AD, as dysfunction in any of the stages of autophagosome formation is likely to cause neurodegeneration. For example, the elimination of basal neuronal autophagy by loss of ATG5 expression in neural cells is sufficient to cause neurodegeneration in a mouse model along with behavioural abnormalities that are often observed in mouse models of neurodegenerative diseases [187]. This loss of autophagy in cells causes an accumulation of abnormal proteins followed later on by the formation of inclusion bodies [187]. It has also been found that BECLIN-1 mRNA and protein levels are reduced in the AD brain [188]. Likewise, transgenic mice expressing APP and a heterozygous deletion of BECLIN-1 appear to have accelerated extracellular Aβ deposits, enlarged lysosomes containing electron dense materials and neuronal loss [188], pointing to a role for autophagy in APP metabolism within cells, with autophagy potentially playing a protective role against AD.
Until recently, the origin of isolation membranes was unclear with the ER, mitochondria and plasma membrane thought to be the organelles from which the membranes derive [189, 190].
Isolation membranes were found to emerge from an omega shaped subdomain of the ER called
42 the omegasome that is labelled by the protein DFCP1 [191]. One of the most interesting recent discoveries is that the initial site of formation of the autophagosomes is at mitochondria-ER (i.e
MAM) contact sites in mammalian cells [192]. Under starvation conditions, ATG14L and ATG5 exclusively relocate to the mitochondria-ER contact sites [192]. Another protein that is involved in omegasome formation, double FYVE DOMAIN-CONTAINING PROTEIN 1(DFCP1) also relocalises under starvation conditions [192]. The knockdown of PHOSPHOFURIN ACIDIC
CLUSTER SORTING PROTEIN 2 (PACS2), a protein involved in mitochondria-ER contact formation, or MITOFUSIN 2 (MFN2), which tethers the ER to mitochondria, leads to a decrease of ATG14 and DFCP1 in MAM fractions [192]. Therefore any disruption to the MAM- mitochondria contact site would inhibit relocation of autophagy related proteins important in the formation of autophagosomes. Interestingly another protein that also relocated along with ATG14 and DFCP1 was SYNTAXIN17 (STX17) [192]. STX17 appears to direct ATG14 to the MAM, and its knockdown in HeLa cells lead to arrested autophagosome maturation at the isolation membrane formation step [192]. Overall, this points to the MAM as a very versatile subunit of the ER that has a major role in autophagosomes formation, and disruption to the MAM could potentially affect many cellular functions including autophagy.
There has been some focus on developing a treatment for the reduction of protein aggregates as a viable strategy to delay or stop the progression of neurodegeneration, with promising results in
Drosophila and mouse models of neurodegenerative diseases [193-195]. In particular, long term mTOR inhibition by the drug rapamycin lowered Aβ42 levels and prevented the cognitive deficits that are associated with the AD-relevant PDAPP transgenic mouse model [195]. However due to the side effects of rapamycin [196] it would be desirable to develop safer alternatives that can
43 increase the induction of autophagy or reduce accumulated abnormal proteins that cause neuronal dysfunction and cell loss.
The zebrafish as a model organism
Transgenic rodent models of AD have been used extensively due to the similarity in their genome and brain anatomy to humans, along with the availability of various behavioural tests developed for rodents to reveal neural dysfunction (reviewed in [197]). However, generating transgenic rodents can be costly and time intensive. This has led researchers to use various other animal models as alternatives. One such model that has been gaining popularity is the zebrafish Danio rerio.
The zebrafish is a small freshwater fish native to northern India. Both larval and adult fish are used in neuroscience research (reviewed in [198]). The zebrafish is gaining popularity as a new model organism due to a number of characteristics. Firstly, zebrafish produce large numbers of eggs which develop rapidly ex utero allowing for easy viewing and staging of embryos along with swift completion of experimental work. Secondly, zebrafish are translucent during early larval stages, making them suitable for tracking the expression of fluorescently labelled proteins or dyes for fluorescent microscopy. Thirdly, the embryos are easily handled due to their large size and are hardy enough to withstand experimental manipulation such as microinjection of
44 oligonucleotides. With regards to brain morphology, the zebrafish brain is fairly comparable to rodent models [198]. Besides this, adult zebrafish have a relatively long lifespan of up to 5 years.
The genetics of zebrafish
Zebrafish are teleosts (bony fish) whose evolutionary lineage separated from the tetrapod lineage at around 450 million years ago [199, 200]. The common ancestor of the teleostei underwent an additional round of whole-genome duplication known as the teleost-specific genome duplication
(TSD) [200]. However, completion of the sequencing of the zebrafish genome has revealed that around 70% of human genes have at least one clear zebrafish orthologue [200] making zebrafish good models for genetic studies.
Figure 5. Zebrafish embryonic development. Zebrafish embryos are transparent, making them suitable for use in fluorescence microscopy. The fast development of the larvae allows for faster completion of experiments. (Diagram taken from Dahm and Geisler (2006)).
45
There are several ways in which the zebrafish genome can be manipulated. The transient expression of disease-causing proteins can be studied by injecting synthesized DNA or mRNA directly into single cell embryos. Genetic manipulation of zebrafish embryos can be furthered by the injection of morpholino antisense nucleotides directly into embryos to target RNAs. A morpholino subunit is made up of a nucleic acid base, a morpholine ring and a non-ionic phosphodiamidate backbone [77]. The difference between the altered backbone of morpholinos and the phosphodiester backbone of DNA/RNA makes it resistant to digestion by nucleases for up to 48 hours. Morpholinos do not cause the degradation of their target RNA sequence. Instead they work via a steric blocking mechanism and bind to complementary RNA by Watson-Crick basepairing [77]. This allows for the use of morpholinos in translation blocking by preventing the translation initiation complex from binding at the translation start site. Therefore morpholinos need to be designed to target the 5ˊ – untranslated region (UTR) or the start codon. Morpholinos have also been used to block splicing by targeting the morpholino to span the exon-intron junction of pre-mRNAs. The morpholino sterically blocks splicing machinery from binding, allowing for the modification of normal splicing events [201]. Unfortunately, targeting a splice donor or acceptor site can also lead to the full or partial inclusion of introns and subsequently lead to premature truncation of open reading frames [71].
More recent tools for genetic modification involve the use of sequence specific endonucleases to introduce mutations into targeted sites in the genome. The two systems currently of greatest interest are the transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR) – CRISPR-associated (Cas) (CRISPR-
Cas) 9 systems. Both systems work to induce double strand breaks (DSBs) at the genomic target
46 site, introducing insertions and deletions (indels) [202, 203]. These systems can be used for several genetic applications such as the generation of loss of function alleles [202, 203], or DNA integration into the zebrafish genome [204] .
Zebrafish models of neurodegeneration/Alzheimer’s disease
Zebrafish are currently being used as relevant models of human neurodegenerative disorders such as Parkinson’s disease, Huntington’s disease and AD as zebrafish have orthologues of the disease-causing genes of the respective diseases.
Zebrafish have genes that are orthologous to human genes that play a role in AD. There are two zebrafish genes, appa and appb, that are co-orthologues to human APP [205]. Zebrafish possesses orthologues of all of the mammalian γ-secretase components [206-208]. Transcripts of all the zebrafish γ-secretase components are detected before zygotic gene activation, indicating the mRNAs are contributed to early embryos maternally [206-208]. The BACE1 orthologue, bace1 has also been found in zebrafish [123]. The MAPT gene which encodes for tau protein has two zebrafish co-orthologues, mapta and maptb [209]. Zebrafish also possess co-orthologues of the sporadic, late onset AD associated gene APOE, apoea and apoeb [210, 211].
Zebrafish psen1 and psen2 are expressed maternally, and show ubiquitous expression in early embryos, indicating they are important for embryonic development [206, 207]. Zebrafish
47 embryos that are translationally blocked for Psen1 protein with the use of morpholinos are still viable, but show aberrant somite formation and Notch signalling defects [71, 208, 212]. This is similar to conditional knockout mouse models (reviewed in [213]), although Psen1- /- mice have been shown to die during development [214]. When Psen2 is blocked in zebrafish embryos,
Notch signalling is noticeably affected, whereas in Psen2- /- mice there is only a minor phenotype
[215]. The loss of Psen2 in zebrafish embryos affects Dorsal Longitudinal Ascending (DoLA) interneurons but loss of Psen1 does not, signifying that different cell types rely differently on the activity of these two proteins [78].
Investigating autophagy in zebrafish
Zebrafish possess one homologue of mTOR (mtor) [216]. Transcripts of zebrafish homologues
Beclin-1 and Lc3 are also expressed at 0 hpf, although the conversion of zebrafish Lc3I to Lc3II only occurs at 32 hpf onwards, in contrast to mouse embryos where LC3II is detected in oocytes
[217]. The delay of autophagy induction may be due to the fact that zebrafish homologues of proteins related to autophagy in other organisms, such as Ulk1a, Ulk1b and Atg9 only show transcript expression after 23 hpf [218].
Zebrafish are a good model in which to measure autophagic flux. Autophagic flux is the process from synthesis of the autophagosome to the degradation of the cytoplasmic constituents in autolysosomes, and provides a good indicator of autophagic activity. This can be done by
48 comparing the Lc3II to Lc3I ratio in the presence of lysosomal inhibitors [218]. Since zebrafish can be easily manipulated pharmacologically by the addition of chemicals of interest directly to tank water, they can be used to screen a variety of chemicals for inhibitors or inducers of autophagy.
1.2. Summary of chapters 2-6 and links between them
AD is a complex disorder that is characterized mainly by two main neuropathological hallmarks; amyloid plaques and neurofibrillary tangles. The familial and sporadic forms of AD appear to share similar clinical features of the disease, their underlying processes are distinct. Much research has focused on pathogenic mutations found in PSEN1, the most common mutation causing FAD. Furthering the understanding of the PSENs role in AD could give greater understanding to the mechanisms of both SAD and FAD. Additionally, the MAM sub- compartment may also prove to be important in understanding the underlying pathology of AD.
The zebrafish is a versatile animal model for the study of human disease. Zebrafish possess genes orthologous to those involved in Alzheimer’s disease in humans. In Chapter II of this thesis, we characterize in zebrafish the orthologue of the human NICASTRIN (NCSTN) gene that encodes a protein forming part of the γ-secretase complex involved in formation of the Amyloidβ peptide.
Zebrafish Ncstn is predicted to possess the conserved glutamate 333 residue and DYIGS motif of human NCSTN that are important for its functions, indicating that zebrafish Ncstn likely retains similar functions to human NCSTN. We determine the spatial and temporal expression level of
49 zebrafish ncstn in embryonic and adult tissues. This work helps to further the basic knowledge of the zebrafish ncstn gene and is a published article in the journal Development, Genes and
Evolution.
Having established a better understanding of zebrafish Ncstn, the work went on to study another
γ-secretase component, Psen1. Various truncations of the human PSEN1 and zebrafish Psen1 proteins have been shown to have differential effects on Notch signalling and Appa cleavage
[219]. The basis for these differences remains unclear. To further understand the effects of truncations of PSEN1, the work in Chapter III explores the subcellular localization of fusions of truncations of zebrafish Psen1 protein with green fluorescent protein (GFP). A simple protocol is developed to obtain single cells from zebrafish embryos for microscopy analysis. The results indicate that the different Psen1 truncations analysed appear to have similar distributions. This suggests that the differential effects of these truncated proteins on γ-secretase substrates are likely not due to differences in their subcellular locations.
Following the work on Psen1 truncations, the next chapter focuses on a known subcellular location in the cell where PRESENILINs are found. The ER contains a subcompartment known as the mitochondrial-associated membranes (MAM), which interacts with mitochondria. The
MAM is highly enriched in the PRESENILIN proteins [145]. Mitochondrion-ER appositions are increased in Psen1-/-/Psen2-/- MEFs and also in cells from FAD and SAD patients [158]. In
Chapter IV of this thesis we examine the effect of inhibiting zebrafish psen1 and psen2 activity
50 on mitochondrion-ER appositions in zebrafish embryos. Chapter V further examines the potential presence of several proteins of interest in the MAM.
The MAM is the initiation site of autophagosome formation. The final work in this thesis now shifts focus from the MAM to autophagy. There has been some focus on the development of drugs which can safely and effectively reduce the accumulation of abnormal proteins within the brain. One potential therapy would be to modulate the autophagy pathway to improve β-amyloid clearance. In Chapter VI we examine the ability of the antihistamine drug Latrepirdine to induce autophagy in zebrafish. Our results suggest Latrepirdine is able to induce autophagy in 72 hpf larvae, similar to observations in yeast [220].
51
CHAPTER 2
Research Paper 1
Analysis of nicastrin gene phylogeny and expression in
zebrafish
52
STATEMENT OF AUTHOURSHIP
Analysis of nicastrin gene phylogeny and expression in zebrafish.
Development Genes and Evolution, 2015
Anne Hwee Ling Lim (Candidate/First author) • Performed phylogenetic and synteny analysis • Performed qPCR and WISH experiments • Wrote manuscript. Certification that the statement of contribution is accurate
Signed
Seyyed Hani Moussavi Nik (co-author) • Supervised and contributed to qPCR and WISH experiments Certification that the statement of contribution is accurate
Signed
Esmaeil Ebrahimie (co-author)
• Performed statistical analysis for qPCR results. Certification that the statement of contribution is accurate
Signed
53
Michael Lardelli (co-author) • Planned the research and supervised development of work. • Editing of paper • Microscopy imaging of zebrafish embryos Certification that the statement of contribution is accurate
Signed
54
Lim, A., Moussavi Nik, S.H., Ebrahimie, E. & Lardelli, M. (2015). Analysis of nicastrin gene phylogeny and expression in zebrafish. Development Genes and Evolution, 225(3), 171-178.
NOTE:
This publication is included between pages 54 - 55 in the print
copy of the thesis held in the University of Adelaide Library.
It is also available online to authorised users at:
http://dx.doi.org/10.1007/s00427-015-0500-9
CHAPTER 3
Research Paper 2
Preparation of dissociated zebrafish cells for analysis of
Psen1 truncation subcellular localization.
55
STATEMENT OF AUTHOURSHIP
Preparation of dissociated zebrafish cells for analysis of Psen1 truncation subcellular localization.
Zebrafish, 2015 (Under review)
Anne Hwee Ling Lim (Candidate/First author) • Performed all experiments (except where noted) and wrote manuscript. Certification that the statement of contribution is accurate
Signed
Morgan Newman (co-author) • Performed preliminary injection of mRNA into embryos. • Supervised development of work for Lim. Certification that the statement of contribution is accurate
Signed
56
Michael Lardelli (co-author) • Planned the research, supervised development of work and edited the manuscript. Certification that the statement of contribution is accurate
Signed
57
Preparation of dissociated zebrafish cells for analysis of Psen1 truncation subcellular localization.
Anne Lim1, Morgan Newman1 and Michael Lardelli1
1. Alzheimer’s Disease Genetics Laboratory, Department of Genetics and Evolution, School of Biological Sciences, The University of Adelaide, South Australia, Australia.
Corresponding author: Anne Lim
Tel.: +61 8 8313 4863
Fax: +61 8 8313 7534
Email: [email protected]
58
Abstract
Truncated forms of PRESENILIN (PSEN) proteins are possibility involved in the pathological mechanisms of a number of neurological diseases such as Alzheimer’s disease and Pick disease of brain. Depending on their size, the truncated forms appear to have differential effects on cleavage of various γ-secretase substrates but the basis of these differences is not known. One possibility is that different sizes of truncated protein have different patterns of subcellular localisation and so differentially affect γ-secretase substrates localised in different cellular compartments. To test this we generated mRNAs encoding fusions of enhanced GFP (EGFP) to the N-termini of various truncations of the zebrafish
Psen1 protein. We injected these mRNAs into fertilized eggs and then observed their localisation using fluorescence microscopy. We developed a simple protocol, described here, to obtain single cells from zebrafish embryos for microscopy analysis. Cells obtained by this method successfully retain organelle-specific dyes and express fluorescently tagged proteins.
The EGFP-tagged truncated Presenilin1 proteins were observed to be uniformly distributed in the cytoplasm but not imported into the nucleus. Cells appeared to lack EGFP fluorescence in lysosomes although this may have been due to the pH sensitivity of EGFP and protein degradation.
59
Introduction
The human PRESENILIN proteins, PSEN1 and PSEN2, are the catalytic components of the
γ-secretase complex, an enzyme complex that is required for the intra-membrane cleavage of over 70 different protein substrates. Among its substrates are the NOTCH proteins and the
AMYLOID BETA A4 PRECURSOR PROTEIN (APP). The PSEN1 gene contains 10 coding exons which encode an approximately 50kDa holoprotein with 9 transmembrane domains. It undergoes endoproteolytic processing forming an N-terminal fragment (NTF) and a C- terminal fragment (CTF) in a 1:1 stoichiometry [1, 2]. Cleavage of the holoprotein is necessary to form active γ-secretase [3, 4]. PSEN1 has two highly conserved aspartates within transmembrane domains 6 and 7 of the protein that are important for endoproteolysis and catalytic activity.
Mutations in the human PSEN1 gene have been identified in Alzheimer’s disease (AD) and frontotemporal dementia (FTD, reviewed in [5]). Some of these mutations have been found to cause frame shifts leading to premature stop codons, producing transcripts encoding truncated
PSEN1 protein [6, 7]. A truncated form of PSEN2 known as PS2V has been found in the cerebral cortex and hippocampus of AD patients suffering from sporadic AD (SAD) [8] and its formation is hypoxia-dependent. Hypoxia induces HMGA1a, a non-histone DNA binding protein, which binds specific sites on the fifth exon of PSEN2 pre-mRNA resulting in exon 5 exclusion from the pre-mRNA and forming the truncated isoform PS2V [8, 9]. In addition to mutations causing AD, a mutation (G183V) affecting the splice donor site of exon 6 in
PSEN1 has been found in patients suffering from Pick disease of brain, a form of frontotemporal dementia (FTD). Interestingly, this mutation does not appear to produce any associated AD pathology. The mutant gene produces transcripts coding for the full length protein with a missense mutation, as well as transcripts with frame-shifted open reading
60 frames that code for proteins truncated after exon 5 [6]. A mutation (P242LfsX11) in PSEN1 causing a frameshift in exon 7 resulting in a premature termination codon was found in families suffering from familial Acne Inversa (AI), a disease affecting the hair follicles [10].
None of the individuals with familial AI suffered from familial AD (Wang, pers. comm.).
Interestingly, work done in the zebrafish animal model has shown that various truncations of the zebrafish Psen1 protein can have differential effects on zebrafish Notch signalling and cleavage of Appa (a co-orthologue of APP) [11]. The different truncations can suppress or stimulate Appa cleavage but not Notch signalling and vice versa (Fig. 3) [11]. For instance, injection of mRNAs coding for a truncation resembling human PS2V resulted in increases in both Notch signalling and Appa cleavage, consistent with previous work indicating that PS2V increases γ-secretase activity [12]. A truncation resembling that encoded by aberrantly spliced transcripts from the G183V mutant allele had no significant effect on Notch signalling but decreased Appa cleavage, consistent with the lack of AD pathology observed in patients [11].
Injection of mRNA coding for a truncation resembling that potentially produced by the familial AI P242LfsX11 mutation resulted in increased Notch signalling but had no effect on
Appa cleavage [11]. This is also consistent with the finding that none of the individuals with this mutation had familial AD and it has been suggested that familial AI may be due to changes in NOTCH signalling that affect follicle biology [10]. The cellular/molecular basis for the differential effects of different Psen1 truncations is unknown.
Fluorescent probes such as fluorescent proteins and dyes have become a common feature in molecular imaging. The availability of fluorescent proteins has proven beneficial in biological imaging using fluorescence microscopy, particularly when used as a marker of gene expression or to visualize protein interactions and localization in intracellular structures of the
61 cell. Fluorescent proteins are commonly used as fluorescent tags by fusion to a protein of interest [13]. A commonly used fluorescent protein is the green fluorescent protein (GFP) of the jellyfish Aequorea victoria [14]. GFP fusion proteins have been successfully targeted to specific structures within the cell (reviewed in [15]). Fluorescent dyes with organelle specificity have also been useful in biological imaging. Many dyes can be used on live cells, allowing for live cell imaging to identify the subcellular structure in which a particular protein may reside [16-18].
Among animal models, the zebrafish is an excellent model for in vivo imaging using fluorescent probes. The advantages of using the zebrafish include that they produce embryos externally. The embryos are produced in large numbers and are optically transparent during early development. Zebrafish embryos are also robust and amenable to genetic manipulation such as microinjection of DNAs or mRNAs into the cell to produce transiently or stably transfected embryos [19, 20]. However a drawback of imaging whole organisms including zebrafish embryos is the difficulty in visualizing processes within single cells due to the complex matrix of cells within the organism and technical limitations involving microscopy.
Imaging single cells can be done using cell lines but this requires continuous maintenance and the cells may develop abnormal phenotypes with time due to their unusual environmental conditions (reviewed in [21]).
Here we present a simple dissociation method for zebrafish embryos to obtain single cells for viewing by fluorescence microscopy. We have tested organelle-specific dyes on cells obtained using this method. We also have generated several fusions of GFP to truncated forms of the zebrafish Presenilin1 (Psen1) protein using the polymerase chain reaction (PCR)
62 driven overlap extension method. We use the cell dissociation method to analyse the subcellular localization of these truncated forms of Psen1.
63
Materials and Methods
Ethics statement and animal husbandry
All zebrafish work was performed under the auspices of The Animal Ethics Committee of
The University of Adelaide. Wild-type zebrafish were maintained in a recirculated water system with a 14 hour light/10 hour dark cycle. Fertilized embryos were grown at 28˚C in embryo medium (E3) [22]
Materials
Pronase E (Sigma Aldrich, MO, USA, Cat. No P6911), Laminin (Sigma Aldrich, Cat. No
L2020), Dyes: MitoTracker Red CMXRos (Life Technologies, Cat. No M-7512),
LysoTracker Red,DND-99 (Life Technologies, Cat. No L-7528), Hoechst 33342 (2'-[4- ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5'-bi-1H-benzimidazole trihydrochloride trihydrate) (Life Technologies, Cat. No H1399), mMessage mMachine T7 transcription kit
(Life Technologies, Cat. No AM1344), MinElute Gel Extraction kit (Qiagen, Limburg,
Netherlands, Cat. No 28604), Phusion High Fidelity DNA Polymerase (New England
Biolabs, MA, USA), Vectors: N1-EGFP plasmid (Clontech, Cat No PT3027-5), The pcGlobin2 plasmid [20] was a kind gift from Professor Myungchull Rhee, Chungnam
National University, Korea. Plasmids containing the DNA encoding the H2B-RFP and
CAAX-GFP (referred to as membrane-GFP) were kind gifts from Professor Jonathan Clarke,
Kings College London, UK. Ringer’s solution: 116mM NaCl, 2.9mM KCl, 1.8mM CaCl2,
5.0mM HEPES pH7.2, E2 embryo medium: 15mM NaCl, 0.5mM KCl, 1mM MgSO4,
0.15mM KH2PO4, 0.05mM Na2HPO4, 1.0mM CaCl2, 0.7mM NaHCO3
64
Table 1. Primer sequences.
Primers were synthesised Sigma Aldrich, MO, USA.
Primer Primer sequence (5'-3') Notes EGFP forward CGGGATCCACCATGGTGAGCAAGGGCGAG The underlined bases are the Bam H1 restriction enzyme recognition site. The bases in bold are the Kozak sequence. EGFP reverse TAAATCAGCCATCTTGTACAGCTCGTCCATGCC The underlined bases are complementary to the sequence of the 5' end of psen1 forward. psen1 forward GAGCTGTACAAGATGGCTGATTTAGTGCAGAATGCT The underlined bases are complementary sequence of the 3' end of EGFP reverse. psen1Δ4 reverse GGAATTCTTACTGCTGTCCGTCCTTCTG The underlined bases are the Eco R1 psen1Δ5 reverse GGAATTCTTACTTGTAGCATCTGTACTT restriction enzyme recognition sites. psen1Δ6 reverse GGAATTCTTACAAATAAATTAAGGAG psen1Δ7 reverse GGAATTCTTAGTAGACTGAAATAGCAGCGAGGA psen1Δ8 reverse GGAATTCTTAGGAGTAGATGAGCGCTGGGA
psen1ΔFL GGAATTCTTATATGTAGAACTGATGGACG
reverse
Generation of EGFP - psen1 fusion cDNA constructs cDNA encoding the zebrafish Psen1 protein fused in frame to the enhanced green fluorescent protein (EGFP) was made using the modified polymerase chain reaction (PCR)-driven overlap extension method which requires two PCR steps (Fig. 1) [23]. Briefly, primers were designed such that a reverse primer for EGFP cDNA is complementary at its 5' end to the 5' end of a forward primer binding to zebrafish psen1 cDNA. This allows fusion to occur between the EGFP and Psen1 coding sequences during PCR amplification. The forward primer for EGFP contained a restriction site for Bam HI while the reverse primer for psen1 contained an Eco RI restriction site at the 5' end. Table 1 lists the primers used. The EGFP cDNA fragment was amplified using the forward and reverse primers for EGFP cDNA in the initial PCR step. Similarly the psen1 cDNA fragment was amplified using forward and reverse primers for psen1 cDNA. High fidelity Phusion DNA Polymerase was used and the
PCR parameters followed the manufacturer’s protocol for Phusion polymerase, with the number of cycles kept to 15 to reduce the risk of nucleotide mis-incorporations. Each PCR
65 product was analysed on a 1% agarose gel and the size of each PCR fragment was confirmed before excision from the gel using a clean razor blade and placement into a 1.5 mL tube. The
PCR fragments were purified using the QIAquick Gel Extraction kit following the manufacturer’s protocol. The fusion of the two fragments was performed in the second PCR step, where equal concentrations of the EGFP and psen1 fragments were added to the PCR reaction mix along with the forward primer for EGFP and the reverse primer for psen1. PCR parameters remained the same as during the initial PCR. The second PCR generated the
EGFP-psen1 fusion cDNA construct. The cDNA construct was gel-purified followed by restriction with Bam HI and Eco RI, and ligation into pcGlobin2, a vector system which is suitable for the transcription of in vitro capped mRNA as it contains three elements (the 5' and
3' zebrafish β-globin UTRs and a 30 mer poly (A) tail) that generate mRNAs with increased stability and translation efficiency [20]. Next, the EGFP-psen1 fusion cDNA construct was used as a template in PCR to obtain cDNAs encoding EGFP - psen1 truncations varying in their number of exons. Each truncated psen1 cDNA construct was inserted into pcGlobin2. mRNA encoding the various fusion proteins was made using the mMessage mMachine T7 in vitro transcription kit following the instructions provided. The resultant mRNA was diluted in
RNase-free water.
Microinjection of zebrafish embryos
Fertilized embryos were collected from wild type zebrafish and placed in a petri dish containing E3 medium. Embryos were injected with mRNA at the one cell stage before cleavage occurred and then incubated at 28˚C. To determine if mRNA injections were successful, the embryos were observed under a fluorescence dissection microscope for chimeric protein expression at approximately 2.5 hpf.
66
Dye staining of zebrafish embryos
Once expression of a GFP-Psen1 fusion protein was confirmed, the embryos were placed in a small petri dish and dechorionated using Pronase at a concentration of 0.5 mg/ml. We found that the chorions were easily removed once embryos were in Pronase for approximately 4 minutes with gentle swirling of the petri dish. Embryos were removed when touching the chorion with forceps resulted in an indentation. Care was taken not to leave the embryos in
Pronase for too long as this led to damage of the embryos. To remove the embryos from
Pronase, the petri dish containing the embryos was slowly submerged in a large beaker containing water. The embryos were allowed to sink to the bottom of the beaker before 2/3 of the water in the beaker was poured off and replaced with clean water. This was repeated three times to ensure all Pronase was removed. The dechorionated embryos are very fragile and cannot be exposed to air as this damages them. At 3 hpf, 12-15 embryos were incubated with gentle rocking in Ringer’s solution with organelle-specific dyes. Table 2 lists the dyes and conditions used.
Table 2. Organelle dyes.
Organelle stain Concentration Incubation period (min) Wash period (min) MitoTracker Red CMXRos 100nM 50 10 LysoTracker Red DND-99 75nM 30 - Added prior to loading sample onto Hoechst 33342 9.7μM (6μg/mL) - coverslip/coverglass
Embryo dissociation and microscopy
At the end of the incubation period, the animal pole of each embryo was separated from the yolk using a needle. The cell clumps of each animal pole were transferred to a 1.5 mL tube and clean Ringer’s solution was added for the wash period if necessary. Hoechst 33342, a
67 blue fluorescent nuclear stain, was added to each tube to a final concentration of 6 μg/mL. To dissociate the cell clumps, a 200μL pipette tip with the end trimmed was used to gently pipette the cells up and down several times. Approximately 35-40 μL of the sample was placed on the surface of a clean 22 X 60 mm coverslip using a trimmed 200 μL pipette tip. A smaller 18 X 18 mm coverslip was then coated on all 4 edges with a small amount of silicone grease before being gently placed over the sample to prevent the sample from drying.
Alternatively, glass bottom dishes can replace coverslips, with the sample directly added onto the coverglass and imaged. Imaging was performed using a Leica TCS SP5 confocal microscope system with sequential scanning for multiple fluorophores. Images were obtained from a single optical plane.
68
Results
Testing of an embryo dissociation method for observing single cells
The embryo dissociation method we developed for obtaining single cells for microscopic analysis is described in Materials and Methods. We first tested the dissociation method using organelle specific dyes to observe the ability of the cells to retain the dyes following cell dissociation. The dyes used were MitoTracker Red CMXRos, a rosamine derivative containing a mildly thiol reactive chloromethyl moiety, which labels mitochondria, and
LysoTracker Red DND-99, an acidotrophic probe suitable for labelling lysosomes. We found that the cells successfully retained the dyes after dissociation was performed on the embryos.
However we found that labelling of the cells varied, as some cells had low levels of fluorescence intensity while other cells had noticeably higher levels (Fig. 2a). This mosaic labelling of the cells likely occurs due to the differential penetration of the dye into embryos with surface cells receiving most dye.
We next injected embryos with mRNAs coding for CAAX motif membrane-green fluorescent protein (membrane-GFP) and histone 2B-red fluorescent protein (H2B-RFP). The CAAX motif targets a protein to the plasma membrane [24]. The nuclear protein H2B is one of five kinds of histone proteins which interact with chromatin to form the nucleosome [25, 26].
These constructs have been successfully used previously by Alexandre et al. following injection into 64-128 cell stage embryos and imaging at 21-24 hpf [27]. We injected the mRNAs at the one cell stage and observed the effect of the dissociation method on subcellular localization of these proteins. The expression of H2B-RFP and membrane-GFP was mostly confined to the nuclear region and cell membrane respectively, indicating that the cell dissociation method does not noticeably affect the subcellular localization of these proteins
69
(Fig. 2b). However, mosaic expression of both proteins was observed, similar to that observed for dye labelling of cell organelles. Cells showed varied levels of fluorescence intensity of the
RFP- and GFP-tagged proteins. This is likely due to uneven initial distribution of injected mRNA. We also observed autofluorescence of any yolk still attached to cells when using the
488nm laser to excite GFP. Therefore the use of nucleus-specific dyes such as Hoechst 33342 or the injection of mRNAs encoding fluorophore-labelled nuclear proteins is necessary in order to distinguish cells from yolk debris.
Cell survival was found to be approximately 3 to 3.5 hours in Ringer’s medium before cell blebbing followed by apoptosis occurs. We did not test other types of media, but it may be possible to increase survival time by using suitable growth media [28]. We found that not all cells formed a single layer, as clumps of cells were still visible. However attempts to reduce cell clumps by increased pipetting to increase dissociation caused high rates of cell fragmentation as the cells are too fragile and could not withstand the increased force. Many cells still maintained a spherical appearance indicating that they did not fully adhere to the coverslip surface during the short timeframe. The use of coating substrates for coverslips such as Laminin did not appear to increase cell attachment noticeably.
Subcellular localisation of different truncations of Psen1
The differential effects of the Psen1 truncations on Appa cleavage and Notch signalling could be due to the different subcellular localizations of these truncated proteins, as well as differences in substrate localizations within the cell. Thus far PSEN1 has been detected abundantly in the early secretory compartments such as the ER or Golgi [29], and in lesser
70 amounts in other cellular locations such as the lysosomes [30], mitochondria [31], centrosomes [32], interphase kinetochores [32] and nuclear envelope [29, 32, 33]. More recent work has indicated that PSENs are highly enriched in the mitochondria-associated ER membranes (MAM) [34]. We were interested to know the effects truncation of a protein would have on its localization within the cell, specifically whether different truncations localize to different organelles within the cell. Using the modified-PCR driven overlap extension method, we created cDNA constructs of EGFP fused in frame to the full-length zebrafish psen1 coding sequence as well as psen1 sequences possessing varying numbers of exons, specifically psen1 truncated after exon 4,5,6,7 and 8 respectively (Δ> hereby denotes
“truncation after”). We chose to fuse the COOH-terminus of EGFP to the NH2-terminus of
Psen1 as the C-terminal end of EGFP is flexible and rarely requires the presence of a linker for flexibility between the two proteins [35]. Additionally, Psen1 is a nine-pass transmembrane protein, with its N-terminus facing the cytoplasm [1, 2]. Thus, placing EGFP at the Psen1 C-terminus might affect its conformation within the membrane. Fusion of GFP at the N-terminal of human PSEN1 does not appear to affect its activity [36]. The mRNA for the various constructs was synthesised and injected into embryos at the one-cell stage.
We first injected mRNA encoding the EGFP–Psen1 full length fusion, but could not detect noticeable fluorescence under the dissection microscope at 2.5 hpf. We have previously observed that it is difficult to force ectopic expression of full-length Presenilin protein in zebrafish embryos if endogenous protein expression is not blocked (Michael Lardelli, unpublished observations). Next we injected mRNAs encoding the different EGFP-Psen1Δ> constructs into embryos and stained them with MitoTracker dye before cellular dissociation.
A relatively low level of EGFP fluorescence intensity was detected throughout the cytoplasm of the cell for the five different truncations and there appears to be overlap with the
71
MitoTracker dye (Fig. 4). The truncated proteins do not seem to localize to a specific organellar region of the cell, although no importation into the nucleus was observed. In some of the cells examined there appeared to be areas within the cytoplasm where a lack of green fluorescence was detected (Fig. 4 and Fig.5, arrowheads), initially indicating that these areas may not contain the chimeric protein. When we stained cells with LysoTracker dye, the areas lacking fluorescence appeared to overlap with the LysoTracker dye stain (Fig. 5).
72
Discussion
Our dissociation method for zebrafish embryos is a simple and quick way to observe genetically manipulated single cells under fluorescence microscopy. A benefit of using embryos at the earlier time points used in this protocol is that cells can be mechanically separated without the use of proteinases or calcium- and magnesium-free medium, which are normally used when dealing with later stage embryos. The use of such harsh conditions may affect cellular function and, consequently, protein localization within the cell. One disadvantage of this protocol is that the cells do not survive for a long period of time.
However the use of suitable growth media such as Leibovitz medium which has been used previously with zebrafish spinal neuron cultures [28] may increase survival time. Determining the most suitable media will be a future task to improve the protocol. Increasing cell survival time will allow more time for cells to fully adhere to the slide surface and should improve imaging. The protocol described in this paper can potentially be used for a number of applications such as determining the sub-cellular localization of proteins of interest, determining the successful expression of a fusion construct or testing new organellar dyes.
We have successfully used this method to observe the localization of the EGFP-Psen1Δ> truncations. These appear to be localized uniformly throughout the cytoplasm suggesting that differential cellular localisation cannot explain their apparent differential effects on cleavage of various γ-secretase substrates. While the truncations appear to be excluded from the nucleus, they show no obvious localisation to any particular cytosolic compartment although no fluorescence was detected in lysosomes. There are a number of possible explanations for the lack of expression in lysosomes. Firstly, EGFP is sensitive to low pH [37], therefore in acidic environments such as lysosomes its fluorescence is quenched. It is possible that the
73
EGFP-Psen1Δ> truncation proteins are present within lysosomes but cannot be visualized under fluorescence using GFP. Alternatively these proteins may not be accumulated into lysosomes. A third possibility is that the turnover for these proteins within lysosomes is rapid.
Further work using a fluorescent protein with less sensitivity to low pH or the use of drugs that raise lysosome pH are possible future tests to clarify whether or not the EGFP-Psen1Δ> truncations are found within lysosomes. Alternatively, the use of polyclonal anti-GFP antibodies to detect the GFP-fusion protein by immunocytochemistry can also be performed.
Although unlikely, the lack of fluorescence in lysosomes may be indicative of either a lack of fusion between autophagosomes and lysosomes, or a reduced induction of autophagy, with the truncated forms of Psen1 as a causal factor. It is known that PSEN1 is involved in lysosomal acidification [38], and that the initial site of formation of autophagosomes is at
MAM contact sites in mammalian cells [39]. The MAM is highly enriched in PSENs [34].
Therefore it is necessary to further investigate the localization of the EGFP-Psen1Δ> truncations within lysosomes.
Expression of the EGFP–Psen1 full length fusion protein could not be detected at 2.5 hpf as it is difficult to force ectopic expression of full-length Presenilin protein in zebrafish embryos if endogenous protein expression is still present. Therefore it is necessary to block endogenous expression in order to visualise the localization of EGFP–Psen1. One possible way to block endogenous protein expression would be to use morpholino antisense oligonucleotides that specifically targets endogenous mRNA encoding for Psen1 to prevent translation by means of a steric block mechanism.
74
Fluorescent tags are a useful way to visualize protein localization within a cell. However, fusion of a sizeable protein such as EGFP to a protein of interest has the potential to disrupt native protein function and localization [40]. Therefore, we cannot rule out the possibility that the subcellular localization of the Psen1 truncations has been affected by the presence of
EGFP at their N-termini. One method to validate their supposed lack of localization would be to create constructs encoding EGFP fused at the C-termini of the Psen1 truncations to determine if these show a similar localization pattern to the N-terminal fusions. However for multiple membrane-spanning proteins such as Psen1, fusion of EGFP at the C-terminus might disrupt protein conformation within the membrane layer in some cases. Fusion of a much smaller polypeptide protein tag such as the FLAG tag [41] to the protein of interest followed by immunocytochemistry could be used as another method of confirmation of our in vivo results.
75
Acknowledgements
This research was supported by the award to AL of an Adelaide Graduate Research
Scholarship from the University of Adelaide, by a grant from the Australian National Health and Medical Research Council [NHMRC, Project Grant APP1061006 to ML and MN http://www.nhmrc.gov.au/] and by funds from the School of Biological Sciences and
Department of Genetics and Evolution of the University of Adelaide [support of ML and
MN]. We are grateful for the support to MN given by the family of Lindsay Carthew.
Author Disclosure Statement
No competing financial interests exist.
76
Figure legends
Figure 1. The modified polymerase chain reaction (PCR) driven overlap extension method. Template cDNA for EGFP (straight lines) and psen1 (dotted lines) was used in initial PCRs to amplify the two fragments. Blue arrows indicate the EGFP primers a and b, and the psen1 primers c and d. The reverse primer for EGFP is complementary at its 5' end to the 5' end of the forward primer for zebrafish psen1. The two amplified fragments are fused together in a second PCR in which only primers a and d are present. The chimeric cDNA is then restricted and ligated into the vector pcGblobin2 after which mRNA can be synthesized for injection into zebrafish embryos.
77
Figure 2. Fluorescent protein expression and dye staining following cell dissociation. a)
Live staining of cells with MitoTracker Red dye and the nuclear dye Hoechst 33342 (in blue).
The fluorescence intensity of the cells was not uniform, as can be seen for the cell on the left indicated by an arrowhead. b) Expression of fluorescently-tagged nuclear H2B-RFP (in red) and CAAX motif membrane-GFP (in green) proteins in cells. The cell to the right indicated by an arrowhead has lower fluorescence intensity compared to adjacent cells.
78
Figure 3. Structure of the zebrafish Psen1 protein and truncations. The upper portion of the figure shows the relationship of psen1 exons to protein structure. Alternating thick and thin areas on the protein strand indicate the sequence coded by successive exons, and are numbered after their cognate human exons. Horizontal grey lines represent the lipid bilayer.
‘D’ indicates the position of the two highly conserved aspartate residues critical for the catalytic site (shown by a star). The arrowhead indicates the site of endoproteolysis that creates the N- and C-terminal fragments and the N- and C-termini are indicated. The cytoplasmic loop domain and the approximate locations of the G183V mutation (Pick disease) and the P242LfsX11 mutation (Acne Inversa) in human PSEN1 are indicated. The lower portion of the figure shows the putative structure of each truncation of Psen1 and their observed effects on Notch signalling and Appa cleavage. Δ> denotes truncation after a particular exon. ↑ indicates increase, ↓ indicates decrease, 0 indicates no significant change
(Reprinted by permission from Newman et al. (2013) [11])
79
80
Figure 4. Expression of the EGFP-Psen1 truncations in dissociated cells. Cells expressing a) EGFP-Psen1Δ>4, b) EGFP-Psen1Δ>5, c) EGFP-Psen1Δ>6, d) EGFP-Psen1Δ>7, e) EGFP-
Psen1Δ>8. Embryos were stained with MitoTracker Red prior to cell dissociation.
Arrowheads indicate areas within the cell with no detectable EGFP fluorescence.
81
Figure 5. Regions within cells lacking EGFP fluorescence expression colocalize with lysosomal dye stain. Cells expressing a) EGFP-Psen1Δ>4, b) EGFP-Psen1Δ>6. Embryos were stained with LysoTracker Red prior to cell dissociation. Arrowheads indicate areas within the cell with no detectable EGFP fluorescence but which show noticeable LysoTracker
Red indicating the presence of lysosomes.
82
References
1. De Jonghe, C., et al., Aberrant splicing in the presenilin-1 intron 4 mutation causes presenile Alzheimer's disease by increased Abeta42 secretion. Human molecular genetics, 1999. 8(8): p. 1529-40. 2. Laudon, H., et al., A nine-transmembrane domain topology for presenilin 1. The Journal of biological chemistry, 2005. 280(42): p. 35352-60. 3. Mann, D.M., et al., Cases of Alzheimer's disease due to deletion of exon 9 of the presenilin-1 gene show an unusual but characteristic beta-amyloid pathology known as 'cotton wool' plaques. Neuropathology and applied neurobiology, 2001. 27(3): p. 189-96. 4. Fukumori, A., et al., Three-Amino Acid Spacing of Presenilin Endoproteolysis Suggests a General Stepwise Cleavage of gamma-Secretase-Mediated Intramembrane Proteolysis. Journal of Neuroscience, 2010. 30(23): p. 7853-7862. 5. Sjogren, M. and C. Andersen, Frontotemporal dementia--a brief review. Mech Ageing Dev, 2006. 127(2): p. 180-7. 6. Dermaut, B., et al., A novel presenilin 1 mutation associated with Pick's disease but not beta- amyloid plaques. Annals of neurology, 2004. 55(5): p. 617-26. 7. Watanabe, H., et al., Familial frontotemporal dementia-associated presenilin-1 c.548G>T mutation causes decreased mRNA expression and reduced presenilin function in knock-in mice. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2012. 32(15): p. 5085-96. 8. Manabe, T., et al., HMGA1a: sequence-specific RNA-binding factor causing sporadic Alzheimer's disease-linked exon skipping of presenilin-2 pre-mRNA. Genes to cells : devoted to molecular & cellular mechanisms, 2007. 12(10): p. 1179-91. 9. Moussavi Nik, S.H., M. Newman, and M. Lardelli, The response of HMGA1 to changes in oxygen availability is evolutionarily conserved. Experimental cell research, 2011. 317(11): p. 1503-12. 10. Wang, B., et al., Gamma-secretase gene mutations in familial acne inversa. Science, 2010. 330(6007): p. 1065. 11. Newman, M., et al., Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease. Human molecular genetics, 2013. 12. Sato, N., et al., Increased production of beta-amyloid and vulnerability to endoplasmic reticulum stress by an aberrant spliced form of presenilin 2. The Journal of biological chemistry, 2001. 276(3): p. 2108-14. 13. Shaner, N.C., P.A. Steinbach, and R.Y. Tsien, A guide to choosing fluorescent proteins. Nature methods, 2005. 2(12): p. 905-9. 14. Prasher, D.C., et al., Primary structure of the Aequorea victoria green-fluorescent protein. Gene, 1992. 111(2): p. 229-33. 15. Gerdes, H.H. and C. Kaether, Green fluorescent protein: applications in cell biology. FEBS letters, 1996. 389(1): p. 44-7. 16. Contento, A.L., Y. Xiong, and D.C. Bassham, Visualization of autophagy in Arabidopsis using the fluorescent dye monodansylcadaverine and a GFP-AtATG8e fusion protein. Plant J, 2005. 42(4): p. 598-608. 17. Spandl, J., et al., Live Cell Multicolor Imaging of Lipid Droplets with a New Dye, LD540. Traffic, 2009. 10(11): p. 1579-1584. 18. Bereiter-Hahn, J., Dimethylaminostyrylmethylpyridiniumiodine (DASPMI) as a fluorescent probe for mitochondria in situ. Biochimica et Biophysica Acta (BBA) - Bioenergetics, 1976. 423(1): p. 1-14. 19. Draper, B.W., P.A. Morcos, and C.B. Kimmel, Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown. Genesis, 2001. 30(3): p. 154-6.
83
20. Ro, H., et al., Novel vector systems optimized for injecting in vitro-synthesized mRNA into zebrafish embryos. Mol Cells, 2004. 17(2): p. 373-6. 21. Burdall, S.E., et al., Breast cancer cell lines: friend or foe? Breast Cancer Res, 2003. 5(2): p. 89- 95. 22. Westerfield, M., ed. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th ed. ed. 2000, Univ. of Oregon Press, Eugene. 23. Heckman, K.L. and L.R. Pease, Gene splicing and mutagenesis by PCR-driven overlap extension. Nature protocols, 2007. 2(4): p. 924-32. 24. Hancock, J.F., et al., A CAAX or a CAAL motif and a second signal are sufficient for plasma membrane targeting of ras proteins. The EMBO journal, 1991. 10(13): p. 4033-4039. 25. Kanda, T., K.F. Sullivan, and G.M. Wahl, Histone–GFP fusion protein enables sensitive analysis of chromosome dynamics in living mammalian cells. Current Biology, 1998. 8(7): p. 377-385. 26. Bhasin, M., E.L. Reinherz, and P.A. Reche, Recognition and classification of histones using support vector machine. J Comput Biol, 2006. 13(1): p. 102-12. 27. Alexandre, P., et al., Neurons derive from the more apical daughter in asymmetric divisions in the zebrafish neural tube. Nature neuroscience, 2010. 13(6): p. 673-9. 28. Andersen, S.L., Preparation of dissociated Zebrafish spinal neuron cultures. Methods in Cell Science, 2001. 23(4): p. 205-209. 29. Annaert, W.G., et al., Presenilin 1 controls gamma-secretase processing of amyloid precursor protein in pre-golgi compartments of hippocampal neurons. The Journal of cell biology, 1999. 147(2): p. 277-94. 30. Pasternak, S.H., Presenilin-1, Nicastrin, Amyloid Precursor Protein, and -Secretase Activity Are Co-localized in the Lysosomal Membrane. Journal of Biological Chemistry, 2003. 278(29): p. 26687-26694. 31. Ankarcrona, M. and K. Hultenby, Presenilin-1 is located in rat mitochondria. Biochemical and biophysical research communications, 2002. 295(3): p. 766-70. 32. Li, J., et al., Alzheimer presenilins in the nuclear membrane, interphase kinetochores, and centrosomes suggest a role in chromosome segregation. Cell, 1997. 90(5): p. 917-27. 33. Rechards, M., et al., Presenilin-1 exists in both pre- and post-Golgi compartments and recycles via COPI-coated membranes. Traffic, 2003. 4(8): p. 553-65. 34. Area-Gomez, E., et al., Presenilins are enriched in endoplasmic reticulum membranes associated with mitochondria. The American journal of pathology, 2009. 175(5): p. 1810-6. 35. Snapp, E., Design and Use of Fluorescent Fusion Proteins in Cell Biology. Current protocols in cell biology / editorial board, Juan S. Bonifacino ... [et al.], 2005. CHAPTER: p. Unit-21.4. 36. Ludtmann, M.H., et al., An ancestral non-proteolytic role for presenilin proteins in multicellular development of the social amoeba Dictyostelium discoideum. Journal of cell science, 2014. 127(Pt 7): p. 1576-84. 37. Tsien, R.Y., The green fluorescent protein. Annu Rev Biochem, 1998. 67: p. 509-44. 38. Lee, J.H., et al., Lysosomal proteolysis and autophagy require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell, 2010. 141(7): p. 1146-58. 39. Hamasaki, M., et al., Autophagosomes form at ER-mitochondria contact sites. Nature, 2013. 495(7441): p. 389-93. 40. Skube, S.B., J.M. Chaverri, and H.V. Goodson, Effect of GFP tags on the localization of EB1 and EB1 fragments in vivo. Cytoskeleton, 2010. 67(1): p. 1-12. 41. Hopp, T.P., et al., A Short Polypeptide Marker Sequence Useful for Recombinant Protein Identification and Purification. Nat Biotech, 1988. 6(10): p. 1204-1210.
84
CHAPTER 4
Research Paper 3
Mitochondrion-ER apposition lengths in zebrafish embryos under inhibition of presenilin1 and presenilin2
gene expression
85
STATEMENT OF AUTHOURSHIP
Mitochondrion-ER apposition lengths in zebrafish embryos under inhibition of presenilin1 and presenilin2 gene expression.
Unsubmitted manuscript
Anne Hwee Ling Lim (Candidate/First author) • Performed all experiments (except where noted) and wrote manuscript. Certification that the statement of contribution is accurate Signed
Morgan Newman (co-author) • Performed all morpholino injections into embryos. Certification that the statement of contribution is accurate Signed
Michael Lardelli (co-author) • Planned the research, supervised development of work and edited the manuscript. Certification that the statement of contribution is accurate Signed
86
Mitochondrion-ER apposition lengths in zebrafish embryos under inhibition of presenilin1 and presenilin2 gene expression.
Anne Lim1*, Morgan Newman1, Michael Lardelli1.
1. Alzheimer’s Disease Genetics Laboratory, Department of Genetics and Evolution, School of Biological Sciences, The University of Adelaide, South Australia, Australia.
Email: [email protected]*
* Corresponding author: Anne Lim.
87
Abstract
• Background: Mutations in the genes PRESENILIN1 (PSEN1), PRESENILIN2 (PSEN2)
and AMYLOID BETA (A4) PRECURSOR PROTEIN (APP) have been identified in
familial Alzheimer’s disease (FAD), which makes up approximately 5% of total AD
cases. Some subcellular compartments of the cell appear capable of interacting with each
other physically and also chemically. For instance, mitochondria and endoplasmic
reticulum (ER) are able to form physical appositions by linking via tethers. The length of
mitochondrion-ER appositions is increased in Psen1-/-/Psen2-/- double knockout murine
embryonic fibroblasts and in AD patient fibroblasts. To determine the effect of inhibition
of zebrafish psen1 and psen2 activity on mitochondrion-ER appositions in the zebrafish
animal model, we injected zebrafish embryos with morpholinos (MOs) that inhibit
expression of zebrafish psen1 and psen2. We then analyzed mitochondrion-ER apposition
in neural cells under electron microscopy.
• Results: Our analysis showed no significant difference in mitochondrion-ER apposition
lengths between control MO and psen1 & psen2 MO co-injected embryos at 24 hours post
fertilization. Instead, the distribution of mitochondrion-ER apposition lengths into
different length classes was close to identical.
• Conclusions: While our observations differ from those of the murine and human studies,
this may be due to differences in cell type, cell age and differences in organism species.
Keywords
Zebrafish, morpholino, TEM, mitochondrion-ER apposition lengths.
88
Background
Alzheimer’s disease (AD) is a neurodegenerative disorder characterized by the occurrence of memory loss in its initial stages, with other effects such as the impairment of speech and motor ability, depression, hallucinations, behaviour disturbances and, ultimately death in more advanced stages of the disease (reviewed in [1]). The major neuropathological hallmarks of the disease in the brain are amyloid plaques that consist of mainly the Amyloid beta (Aβ) peptides, and neurofibrillary tangles, which are hyperphosphorylated forms of the tau protein.
The exact mechanism of the disease remains unclear. There have been numerous hypotheses suggested with the most widely accepted being the amyloid cascade hypothesis. This states that the accumulation of Aβ either via overproduction or lack of clearance, leads to its oligomerization and deposition in the brain and ultimately to neuronal dysfunction, degeneration and death. However, the amyloid hypothesis does not cover nor explain other features observed in AD patients such as aberrant calcium homeostasis (reviewed in [2]), mitochondrial dysfunction (reviewed in [3]), increased levels of cholesterol [4, 5] and altered fatty acid and phospholipid metabolism [6].
The majority of AD cases are sporadic (SAD), with a small number of cases that are familial
(FAD). FAD characteristically has an early age of onset (<65 years). Although only accounting for a small percentage of AD cases, most of our understanding of the molecular events underlying the development of Alzheimer’s comes from FAD since genetic analysis can be used to identify the genes and proteins involved.
Mutations in the PRESENILIN genes (PSEN1 and PSEN2) [7, 8] and the AMYLOID BETA
(A4) PRECURSOR PROTEIN (APP) [9] gene have been identified in FAD. The
PRESENILIN proteins make up one of the components of the γ-secretase enzyme complex 89
which cleaves type I transmembrane proteins. APP is a substrate of γ-secretase and its cleavage forms the Aβ peptides found in plaques [10]. PRESENILINS also function independently of γ-secretase. For instance, the PRESENILIN holoprotein plays a role in lysosomal-dependent proteolysis by interacting with the v-ATPase V0a1 subunit resulting in the maintenance of autolysosome/lysosome acidification [11]. PRESENILINS also regulate
β-catenin stability via a pathway for phosphorylation of β-catenin independent of Axin [12] and form Ca2+ leak channels in the endoplasmic reticulum that allow the release of Ca2+ to the cytoplasm [13]. SAD accounts for the majority of Alzheimer’s disease cases (95%), and usually shows late-onset (>65 years). A combination of genetic and environmental risk factors
[e.g. inheritance of one or two APOE ε4 alleles, high cholesterol levels, obesity and diabetes] have been linked to SAD (reviewed in [14-16]). Although SAD and FAD show similar AD pathology, different mechanisms may underlie them since genes involved in FAD are not detected in genome-wide association studies of SAD [17].
The subcellular localizations of the components of γ-secretase and its substrate APP have been of great interest because determining where these components reside within cells would provide further insight into the pathogenesis of AD. Various studies have found
PRESENILINS located in almost all membranous compartments of the cell [18-24]. A recent discovery by Area-Gomez and colleagues appears to have identified a compartment where
PSEN1 and PSEN2 are highly enriched. Using mammalian cells they found PRESENILINS to be located predominantly in the endoplasmic reticulum (ER) and specifically in a sub- compartment of the ER known as the mitochondria-associated ER membrane (MAM) [25].
The MAM is a lipid raft-like compartment [26] that contains various enzymes involved in key functions including the synthesis and transfer of phospholipids [27], oxidative protein folding
(reviewed in [28]) and calcium homeostasis [29]. Interestingly, the MAM is also the site of 90
formation of autophagosomes [30]. The MAM is physically linked to the outer mitochondrial membrane by protein tethers that are sufficiently stable for MAM to be co-isolated with mitochondria by subcellular fractionation [27](reviewed in [31]). Further work by Area-
Gomez et al. looked at the degree of mitochondrion-ER apposition in double knockout murine embryonic fibroblasts (MEFs) and AD patient cells by electron microscopy [26].
Interestingly, they observed that the length of mitochondrion-ER appositions is increased in
Psen1-/-/Psen2-/- double knockout MEFs and also in both FAD and SAD patient fibroblasts compared to controls [26]. Increased levels of phospholipid and cholesteryl ester synthesis in
MEFs and AD patient fibroblasts were also seen. This suggests that increased mitochondrial-
MAM communication may be a common factor in familial and sporadic AD. Perturbations to
MAM function might possibly result in various features of AD that the amyloid hypothesis fails to explain.
The zebrafish is an advantageous model organism for the study of human disease. Zebrafish embryos are robust and can undergo experimental manipulations such as the injection of morpholino oligonucleotides into embryos to modify simultaneously the expression of multiple genes. Zebrafish embryos are produced in large numbers and develop rapidly [32].
Zebrafish possess genes orthologous to human APP, PSEN1 and PSEN2 along with the other components of the γ-secretase complex [33-35]. To date, the zebrafish animal model has not been used to study mitochondrion-ER apposition. Our previous work has revealed aspects of
Presenilin protein function not seen in cell culture systems [36-38]. We were, therefore, curious to see whether zebrafish might be an advantageous model in which to study the effects of Presenilin activity on mitochondrion-ER apposition. Here, we determine the effect of inhibition of psen1 and psen2 mRNA translation on mitochondrion-ER apposition in
91
midline spinal cord cells in the trunk region of 24 hours post fertilization (hpf) zebrafish embryos.
Methods
Ethics statement
All zebrafish work was performed under the auspices of The Animal Ethics Committee of
The University of Adelaide
Animal husbandry
Wild-type zebrafish were maintained in a recirculated water system with a 14 hour light/10 hour dark cycle. Fertilized embryos were grown at 28˚C in embryo medium (E3)[39].
Morpholino microinjection of zebrafish embryos
Morpholinos were synthesized by Gene Tools LLC (Corvallis, OR, USA) and are listed in
Table 1. Fertilized zebrafish embryos were rinsed in E3 medium and injected at the one cell stage. These morpholino-injected embryos were grown to 24 hpf before fixation was performed. To ensure consistency of morpholino injections, zebrafish eggs were always injected with solutions at 1 mM total concentration (i.e. 0.5 mM MoPsen1Tln + 0.5 mM
MoPsen2Tln, or 1.0 mM MoCont alone).
Transmission electron microscopy
24 hpf zebrafish larvae were fixed in 4% paraformaldehyde, 1.25% glutaraldehyde in PBS with 4% sucrose, pH 7.2 overnight at 4˚C, and then rinsed in washing buffer (PBS with 4% sucrose). Embryos were post-fixed in 2% osmium tetroxide, followed by dehydration through an ethanol series, and rinsed with propylene oxide followed by resin infiltration. Embedded 92
embryos were sectioned transversely and posterior to the embryonic yolk ball, at the beginning of the yolk extension using an ultramicrotome to obtain several 85nm thick sections of the spinal cord. The ultrathin sections were stained with uranyl acetate and lead citrate and imaged on an Olympus-SIS Veleta CCD camera in a FEI Tecnai G2 Spirit TEM.
Images were obtained from 3 cells at the midline area of the spinal cord. This was performed for 3 embryos from each treatment. The mitochondrion-ER apposition lengths were measured using Image J software and analysed statistically using Fisher’s exact test.
Results and Discussion
A recent study by Area-Gomez et al. found that MEFs as well as fibroblasts from patients with FAD and SAD show increased length of mitochondrion-ER appositions compared to wild type (WT) cells [26]. They found relatively more appositions in the 50-200nm (long) and
>200nm (very long) ranges compared to WT MEFs which have relatively more appositions with a shorter length of <50nm. Zebrafish have proven to be a highly manipulable model for analysis of PRESENILIN gene function and might prove to be a useful tool for analysis of the role of these genes in communication between the ER and mitochondria. Therefore, we sought to determine the effect of inhibition of psen1 and psen2 activity on mitochondrion-ER apposition in the zebrafish animal model. To do this we simultaneously blocked translation of the Presenilin proteins by injecting zebrafish embryos at the 1-cell stage with morpholinos binding over the start codons of the psen1 and psen2 mRNAs (MoPS1Tln and MoPS2Tln respectively). We injected an inactive morpholino as a negative control (MoCont). To standardise the area of the embryo being observed, we chose to section 24 hpf embryos transversely and posterior to the embryonic yolk ball, at the beginning of the yolk extension
(i.e. in the trunk region, Figure. 1). We chose to examine mitochondrion-ER apposition lengths in neural cells at the midline of the developing spinal cord under the assumption that 93
these are most likely to represent neural precursor cells and therefore be a reasonably homogenous cell type (Figure. 2). Three embryos injected with MoCont and three embryos injected with both MoPS1Tln and MoPS2Tln were analysed. Mitochondrion-ER apposition lengths were examined in three midline cells from each embryo (Figure 3). A total of 23 appositions in MoCont-injected embryos and 25 appositions in MoPS1Tln and MoPS2Tln co- injected embryos were observed.
We observed that the majority of mitochondrion-ER apposition lengths for MoPS1Tln and
MoPS2Tln co-injected 24hpf embryos were long followed by short appositions and very long appositions at 68%, 28% and 4% respectively. However, this distribution of apposition lengths was also seen in the MoCont-injected embryos, i.e. 65.2% long, 30.4% short and
4.4% very long appositions (Figure. 4a and b and Table 2.1 and 2.2). We further divided the long apposition lengths into smaller interval class lengths of 50-100nm, 100-150nm and 150-
200nm to determine if changes in apposition were occurring along a smaller length range.
Analysis by Fisher’s exact test showed no significant difference in apposition length distribution between control embryos and those lacking Presenilin activity. Therefore the distribution of mitochondrion-ER apposition lengths into different length classes at 24 hpf is similar between embryos injected with negative control morpholino and embryos co-injected with MoPS1Tln and MoPS2Tln.
Our observations do not appear consistent with those of the 2012 study by Area-Gomez et al..
There are several possible explanations for this. Firstly, the ability of the MoPS1Tln plus
MoPS2Tln morpholino injection to suppress expression of the psen1 and psen2 genes may be questioned. A known phenotypic effect of the loss of Psen1 and Psen2 activity in zebrafish embryos at 48 hpf is a decrease in the size and number of melanocytes such that surface 94
pigmentation overall appears reduced [36]. To check the effectiveness of our injection of morpholinos to affect psen1 and psen2 activity, we injected embryos with the same batch of morpholinos used in our TEM study above and confirmed the previously seen phenotypic effects at 48 hpf. MoPS1Tln plus MoPS2Tln injected embryos showed reduced pigmentation while MoCont-injected embryos were indistinguishable from wild type uninjected controls
(data not shown). Based on this result, we believe that significant loss of Presenilin activity was achieved in 24 hpf embryos, and the efficiency of the morpholinos in inhibition of translation was unlikely to cause the differences in mitochondrion-ER apposition lengths observed between mammalian cells and zebrafish. However, it is possible that sufficient zebrafish Presenilin protein remains at 24 hours to allow normal mitochondrion-ER apposition. Future studies should control more closely for Presenilin protein loss at 24 hpf after morpholino injection. One technique would be the use of immunohistochemistry on tissue sections to confirm morpholino efficiency at inhibiting Presenilin protein translation. A second possibility concerns the age of the embryos. Changes in apposition length may require a longer time frame than 24 hours of embryonic development. It may be that a transient knockdown of Psen1 and Psen2 does not permit sufficient time for noticeable changes in mitochondrion-ER apposition lengths to occur when compared to controls. In mammalian cells, the majority of apposition lengths in wild type cells were punctate (< 50 nm) while in our study, the majority apposition lengths fall into the 50-200 nm range. The cell type examined may also be a cause of this difference. Area-Gomez et al. [26] used fibroblast cells from mice and AD patients while we examined putative neuronal progenitor cells that probably have quite different energy and substrate requirements relative to fibroblasts. These differences may affect the interaction between mitochondria and the ER. The psen1 and psen2 mRNA can be detected ubiquitously at early stages of embryogenesis, well before 24 hpf [34,
35, 40]. However the possibility that the putative neuronal progenitor cells examined do not 95
express Presenilin proteins during the timepoint analyzed must be recognized. Assaying for the presence of the proteins in these cell types using immunohistochemistry will clarify this issue. Lastly, although the number of total contacts analyzed for MoCont and MoPS1Tln plus
MoPS2Tln injected embryos were comparable to the number of contacts analysed by Area-
Gomez et al. in AD patient fibroblasts, it cannot be excluded that mosaicism in knockdown due to an uneven distribution of morpholinos during injection of embryos could affect the results obtained from the small sample size of 3 cells analysed per embryo. Such mosaicism is presumably small in the AD patient fibroblasts used by Area-Gomez et al.. Therefore increasing the number of cells analyzed will be necessary to reduce the margin of error and increase accuracy.
Conclusions
We observed no significant difference in the distribution of mitochondrion-ER apposition lengths between embryos injected with negative control morpholino and those injected with morpholinos for simultaneous blockage of psen1 and psen2 expression at 24 hours post fertilization. The difference between our observations and those from studies performed in mammalian systems may be due to differences in cell type, cell age and/or differences in organism species. Future studies should examine other zebrafish cell types and ages and should control closely for loss of Presenilin protein expression.
96
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
AL carried out the TEM imaging and analysis, and drafted the manuscript. MN carried out the morpholino injections of embryos and contributed to the design of the study. ML conceived of the study, partook in its design and helped draft the manuscript. All authors read and approved the final manuscript.
Acknowledgements
We would like to acknowledge Ruth Williams and Lyn Waterhouse from Adelaide
Microscopy for their technical assistance in TEM. This work was supported by funds from
The School of Molecular and Biomedical Sciences of the University of Adelaide and from
NHMRC project grant APP1061006 to MN and ML.
97
Tables
Table 1. Morpholino sequences
Morpholino Morpholino Sequences (5ˊ - 3ˊ) MoCont CCTCTTACCTCAGTTACAATTTATA MoPS1Tln ACTAAATCAGCCATCGGAACTGTGA MoPS2Tln GTGACTGAATTTACATGAAGGATGA
Table 2.1. Percentage observed per length class, 3 classes.
Length of region of apposition, mitochondrial Treatment perimeter (nm) <50nm 50-200nm >200nm MoCont (n=23) 30.4% (7) 65.2% (15) 4.4% (1) MoPS1Tln/MoPS2Tln injected 28% (7) 68% (17) 4% (1) (n=25)
Table 2.2. Percentage observed per length class, 5 classes.
Length of region of apposition, mitochondrial perimeter (nm) Treatment >100- >150- <50nm 50-100nm >200nm 150nm 200nm MoCont (n=23) 30.4% (7) 34.8% (8) 17.4% (4) 13% (3) 4.4% (1) MoPS1Tln/MoPS2Tl 28% (7) 44% (11) 8% (2) 16% (4) 4% (1) n injected (n=25)
98
Figure Legends
Figure 1. Zebrafish embryo at 24 hpf. Several sections of 85 nm thickness were obtained from the area posterior to the yolk ball, within the yolk extension as indicated by the vertical line.
99
Figure 2. The midline of the spinal cord region. Mitochondrion-ER apposition lengths were measured in 3 cells at the midline area of the spinal cord in each embryo. Three MoCont- injected embryos and three MoPS1Tln/MoPS2Tln-injected embryos were examined. The midline of the spinal cord is indicated with a dashed line. Typical cells in which mitochondrion-ER apposition lengths would be examined are indicated with arrows.
100
Figure 3. Electron microscopy of zebrafish neural cells. Cells were treated with morpholinos binding the start codon of psen1 and psen2 mRNA (MoPS1Tln and MoPS2Tln respectively). Arrowheads indicate the region of apposition between mitochondria (M) and endoplasmic reticulum (E) i.e. MAM.
101
Figure 4. Quantitation of mitochondrion-ER apposition lengths (length of region of contact). A) 3 length classes. B) 5 length classes. Total apposition events analysed was 23 in
MoCont and 25 in MoPS1Tln/MoPS2Tln-injected embryos, p = 1.00 for A and p = 0.889 for
B).
102
References
1. Voisin, T. and B. Vellas, Diagnosis and treatment of patients with severe Alzheimer's disease. Drugs & aging, 2009. 26(2): p. 135-44. 2. Bezprozvanny, I. and M.P. Mattson, Neuronal calcium mishandling and the pathogenesis of Alzheimer's disease. Trends in neurosciences, 2008. 31(9): p. 454-63. 3. Wang, X., et al., The role of abnormal mitochondrial dynamics in the pathogenesis of Alzheimer's disease. Journal of neurochemistry, 2009. 109 Suppl 1: p. 153-9. 4. Kuo, Y.M., et al., Elevated low-density lipoprotein in Alzheimer's disease correlates with brain abeta 1-42 levels. Biochemical and biophysical research communications, 1998. 252(3): p. 711-5. 5. Pappolla, M.A., et al., Mild hypercholesterolemia is an early risk factor for the development of Alzheimer amyloid pathology. Neurology, 2003. 61(2): p. 199-205. 6. Pettegrew, J.W., et al., Brain membrane phospholipid alterations in Alzheimer's disease. Neurochemical research, 2001. 26(7): p. 771-82. 7. Sherrington, R., et al., Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature, 1995. 375(6534): p. 754-60. 8. Levy-Lahad, E., et al., Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science, 1995. 269(5226): p. 973-7. 9. Goate, A., et al., Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature, 1991. 349(6311): p. 704-6. 10. De Strooper, B., et al., Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein. Nature, 1998. 391(6665): p. 387-90. 11. Lee, J.H., et al., Lysosomal proteolysis and autophagy require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell, 2010. 141(7): p. 1146-58. 12. Kang, D.E., et al., Presenilin couples the paired phosphorylation of beta-catenin independent of axin: implications for beta-catenin activation in tumorigenesis. Cell, 2002. 110(6): p. 751-62. 13. Tu, H., et al., Presenilins form ER Ca2+ leak channels, a function disrupted by familial Alzheimer's disease-linked mutations. Cell, 2006. 126(5): p. 981-93. 14. Martins, I.J., et al., Apolipoprotein E, cholesterol metabolism, diabetes, and the convergence of risk factors for Alzheimer's disease and cardiovascular disease. Molecular psychiatry, 2006. 11(8): p. 721-36. 15. Gustafson, D., et al., An 18-year follow-up of overweight and risk of Alzheimer disease. Archives of internal medicine, 2003. 163(13): p. 1524-8. 16. Luchsinger, J.A., et al., Diabetes mellitus and risk of Alzheimer's disease and dementia with stroke in a multiethnic cohort. American journal of epidemiology, 2001. 154(7): p. 635-41. 17. Bertram, L. and R.E. Tanzi, Genome-wide association studies in Alzheimer's disease. Human molecular genetics, 2009. 18(R2): p. R137-45.
103
18. Annaert, W.G., et al., Presenilin 1 controls gamma-secretase processing of amyloid precursor protein in pre-golgi compartments of hippocampal neurons. The Journal of cell biology, 1999. 147(2): p. 277-94. 19. Kimura, N., et al., Age-related changes in the localization of presenilin-1 in cynomolgus monkey brain. Brain research, 2001. 922(1): p. 30-41. 20. Vetrivel, K.S., et al., Association of gamma-secretase with lipid rafts in post-Golgi and endosome membranes. The Journal of biological chemistry, 2004. 279(43): p. 44945-54. 21. Pasternak, S.H., Presenilin-1, Nicastrin, Amyloid Precursor Protein, and -Secretase Activity Are Co-localized in the Lysosomal Membrane. Journal of Biological Chemistry, 2003. 278(29): p. 26687-26694. 22. Ankarcrona, M. and K. Hultenby, Presenilin-1 is located in rat mitochondria. Biochemical and biophysical research communications, 2002. 295(3): p. 766-70. 23. Li, J., et al., Alzheimer presenilins in the nuclear membrane, interphase kinetochores, and centrosomes suggest a role in chromosome segregation. Cell, 1997. 90(5): p. 917- 27. 24. Marambaud, P., et al., A presenilin-1/gamma-secretase cleavage releases the E- cadherin intracellular domain and regulates disassembly of adherens junctions. The EMBO journal, 2002. 21(8): p. 1948-56. 25. Area-Gomez, E., et al., Presenilins are enriched in endoplasmic reticulum membranes associated with mitochondria. The American journal of pathology, 2009. 175(5): p. 1810-6. 26. Area-Gomez, E., et al., Upregulated function of mitochondria-associated ER membranes in Alzheimer disease. The EMBO journal, 2012. 31(21): p. 4106-23. 27. Vance, J.E., PHOSPHOLIPID-SYNTHESIS IN A MEMBRANE-FRACTION ASSOCIATED WITH MITOCHONDRIA. Journal of Biological Chemistry, 1990. 265(13): p. 7248-7256. 28. Raturi, A. and T. Simmen, Where the endoplasmic reticulum and the mitochondrion tie the knot: the mitochondria-associated membrane (MAM). Biochimica et biophysica acta, 2013. 1833(1): p. 213-24. 29. Csordas, G., et al., Imaging interorganelle contacts and local calcium dynamics at the ER-mitochondrial interface. Molecular cell, 2010. 39(1): p. 121-32. 30. Hamasaki, M., et al., Autophagosomes form at ER-mitochondria contact sites. Nature, 2013. 495(7441): p. 389-93. 31. Vance, J.E., MAM (mitochondria-associated membranes) in mammalian cells: Lipids and beyond. Biochimica et biophysica acta, 2013. 32. Dahm, R. and R. Geisler, Learning from small fry: the zebrafish as a genetic model organism for aquaculture fish species. Marine biotechnology, 2006. 8(4): p. 329-45. 33. Musa, A., H. Lehrach, and V. Russo, Distinct expression patterns of two zebrafish homologues of the human APP gene during embryonic development. Development genes and evolution, 2001. 211(11): p. 563-567. 34. Leimer, U., et al., Zebrafish (Danio rerio) presenilin promotes aberrant amyloid beta- peptide production and requires a critical aspartate residue for its function in amyloidogenesis. Biochemistry, 1999. 38(41): p. 13602-9. 35. Groth, C., et al., Identification of a second presenilin gene in zebrafish with similarity to the human Alzheimer's disease gene presenilin2. Development genes and evolution, 2002. 212(10): p. 486-90. 36. Nornes, S., et al., Independent and cooperative action of Psen2 with Psen1 in zebrafish embryos. Experimental cell research, 2009. 315(16): p. 2791-801. 104
37. Newman, M., et al., Altering presenilin gene activity in zebrafish embryos causes changes in expression of genes with potential involvement in Alzheimer's disease pathogenesis. Journal of Alzheimer's disease : JAD, 2009. 16(1): p. 133-47. 38. Nornes, S., et al., Interference with splicing of Presenilin transcripts has potent dominant negative effects on Presenilin activity. Human molecular genetics, 2008. 17(3): p. 402-12. 39. Westerfield, M., ed. The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). 4th ed. ed. 2000, Univ. of Oregon Press, Eugene. 40. Rauch, G.J., et al. Submission and Curation of Gene Expression Data. ZFIN Direct Data Submission. 2003; Available from: (http://zfin.org).
105
CHAPTER 5
Research Paper 4
Assessment of proteins present in the mitochondria-
associated membrane, a sub-compartment of the
endoplasmic reticulum.
106
STATEMENT OF AUTHOURSHIP
Assessment of proteins present in the mitochondria-associated membrane, a sub- compartment of the endoplasmic reticulum.
Unsubmitted manuscript
Anne Hwee Ling Lim (Candidate/First author)
• Performed all experiments and wrote manuscript. Certification that the statement of contribution is accurate
Signed
Michael Lardelli (co-author)
• Planned the research, supervised development of work and edited the manuscript. Certification that the statement of contribution is accurate
Signed
107
Assessment of proteins present in the mitochondria-associated membrane, a sub-compartment of the endoplasmic reticulum.
Anne Lim1, Michael Lardelli1.
1. Alzheimer’s Disease Genetics Laboratory, Department of Genetics and Evolution, School of Biological Sciences, The University of Adelaide, South Australia, Australia.
Corresponding author: Anne Lim
Tel.: +61 8 8313 4863
Fax: +61 8 8313 7534
Email: [email protected]
108
Abstract
The different functions of a cell are performed by various organelle compartments, with each structure containing its own assortment of proteins. One such compartment is the mitochondria associated membrane, a sub-compartment of the endoplasmic reticulum that performs specialized functions in the cell. It is also one of the subcellular locations of the components of the gamma secretase complex, an enzyme complex involved in the production of the Aβ peptide, the main component of amyloid plaques in the Alzheimer’s disease brain.
Using Western immunoblot analysis, we studied the presence or absence of several proteins of interest in four subcellular fractions. Among the proteins analysed, the SORTILIN-
RELATED RECEPTOR was of great interest as it has been identified in several genome-wide association studies to associate with sporadic late onset Alzheimer’s disease. Our results show that SORL1 is present in the MAM.
Introduction
Subcellular fractionation studies have found that mitochondria can be isolated with a sub- compartment of the endoplasmic reticulum (ER) known as the mitochondria associated membrane (MAM) [1]. The MAM is a specialized subdomain of the ER that is physically tethered and biochemically connected to the mitochondria. The MAM has the characteristics of an intracellular lipid raft [2], such as its enrichment in cholesterol and lipids [3, 4]. The links between both organelles are formed from proteins such as phosphofurin acidic cluster sorting protein 2 (PACS2) [5] and mitofusin-2 (MFN2) [6], allowing for intercommunication to occur.
109
The MAM is involved in several key functions. One such function is its role in cholesterol metabolism. The MAM is enriched in the enzyme acyl-coenzyme A (CoA):cholesterol acyltransferase 1 (ACAT1) [7]. ACAT1 is involved in the conversion of free cholesterol to cholesteryl esters which are stored mainly as lipid droplets [8]. Another role of the MAM is in lipid metabolism. For instance, the MAM and mitochondria collaborate to synthesize phosphatidylethanolamine (PE) [9, 10]. The MAM is also enriched in calcium related proteins such as the sigma-1 receptors [11] and the inositol-1,4,5-trisphosphate (IP3) receptors [12], and appears to regulate Ca2+ levels from the ER to the mitochondria [13]. Intriguingly, the
MAM appears to be the site of formation of autophagosomes, with studies showing that autophagosomal marker proteins were localised to contact sites during induction of autophagy
[14]. Additionally, depletion of MFN2 results in impairment of autophagosome formation
[15]. The MAM also has protein-folding chaperones and oxidoreductases and is a site of disulfide bond formation (reviewed in [16]).
More focus has been given to the MAM in recent years due to its potential link to neurodegenerative diseases. For instance, the MAM is the predominant location of the
PRESENILINS (PSEN1 and PSEN2), proteins implicated in familial Alzheimer’s disease
(FAD) [17]. The PRESENILINS are the catalytic unit of the enzyme γ-secretase complex which is involved in the production of Aβ, the peptide that predominantly forms amyloid plaques in the brains of AD patients. The majority of FAD is due to mutations in the gene encoding for the PSEN1 protein, PSEN1. The MAM also contains the three other major components which make up the γ-secretase complex, as well as the γ-secretase substrate
AMYLOID BETA (A4) PRECURSOR PROTEIN (APP) from which the Aβ peptide is derived. The α-synuclein protein which makes up the major constituent of Lewy bodies, the pathological hallmark of Parkinson’s disease (PD), has also been localised to the MAM [18].
110
Here we determine via Western immunoblot analysis if the AD associated proteins BETA
APP CLEAVING ENZYME (BACE1) and SORTILIN-RELATED RECEPTOR (SORL1) are present at the MAM. We also examine the localization of Aβ associated 37kDa/67kDa
Laminin Receptor.
Results and discussion:
Analysis of the presence of proteins involved in Aβ production or trafficking in MAM.
The MAM has been discovered as the predominant location of PSEN1, and also contains the other three components of the γ-secretase complex [17]. We have confirmed the localization of PSEN1 to the MAM in mouse brain tissues (Fig. 1, data also available as a supplemental data file to [19], Appendix I). The γ-secretase substrate, APP also resides at the MAM [17], therefore we wanted to look at other proteins potentially related to the production or trafficking of Aβ. The discovery of γ-secretase activity in MAM [17] made us question the localization of BACE. BACE is involved in the amyloidogenic pathway where it cleaves APP to release soluble, secreted β-APPs and an embedded C99 fragment. This C99 fragment is subsequently cleaved by γ-secretase to generate smaller Aβ peptides of different sizes, such as
Aβ40 and Aβ42.
Two homologues of BACE, BACE1 and BACE2 have been identified [20], both of which can cleave APP [21]. BACE1 is highly expressed in the pancreas and brain but BACE2 is expressed at very low levels in the brain and is mostly expressed in peripheral tissues
(reviewed in [22, 23]). In the cell, BACE1 has thus far been localized mainly to the trans-
111
Golgi network (TGN) and endosomes [24]. However, it is not known if BACE1 localizes to the MAM.
We performed a Western immunoblot analysis using the mouse mitochondrial, ER, MAM and plasma membrane (PM) fractions. The MAM and ER fractions were free of contamination.
However there was cross-contamination between the mitochondrial and PM fractions (Fig.
2d). Due to this, the results of the immunoblot analysis were focused mainly on the MAM and
ER fractions.
We analysed the fractions for the presence of BACE1. Our Western blot analysis indicated a strong band that was the expected size of 70kDa in the mitochondria, ER and PM fraction
(Fig. 2a). It should be noted that Area-Gomez et al. have shown that the PM fractionation protocol results in the Golgi fraction co-purifying with the PM fraction [17]. However no clear band was visible in the MAM fraction.
Although there was cross-contamination, the presence of BACE1 in the PM/Golgi fraction concurs with previous studies that BACE1 localises to the TGN. However the presence of
BACE1 in mitochondria has to our knowledge not been detected in previous studies and is probably due to the cross-contamination with the PM/Golgi fraction (Fig. 2d). Its localization in the ER is unsurprising as BACE1 travels from the ER to the TGN [25]. Unlike PSEN1, the
MAM is not the predominant location of BACE1 even though γ-secretase activity and APP are present there. This could be a cellular mechanism by which the cell prevents an overproduction of Aβ since cleavage of APP by BACE1 is the rate limiting step in the
112 amyloidogenic pathway (reviewed in [26]). Besides the MAM, APP has previously been observed in endosomes, lysosomes [27], TGN, the late secretory pathway and at the cell surface [24]. A recent study using neuronal cells indicates that, under basal conditions, the majority of BACE1 localizes to recycling endosomes, with only 10-30% localizing at the
TGN, while the majority of APP resides in the Golgi therefore spatially separating substrate and enzyme [25]. When neurons are stimulated with glycine to mimic induction of neuronal activity in the brain, more APP can be observed in recycling endosomes [25]. The activity of
BACE1 has a low pH optimum [28]. Therefore it is likely that APP cleavage by BACE1 occurs in the acidic environment of endosomes and not likely at the MAM, thereby limiting its presence in this compartment. The C99 fragment formed from the cleavage of APP by
BACE1 could be transported back to the MAM for further processing by the γ-secretase complex, as the γ-secretase-cleaved APP intracellular domain (AICD) which is formed after cleavage of C99 is detected at the MAM [17]. Further analysis of MAM fractions will look for the presence of C99.
Next we examined a protein that is involved in trafficking of APP and possibly Aβ, SORL1.
SORL1 is a 250kDa transmembrane receptor that binds APP [29] and controls APP trafficking through the TGN to endosomes. Multiple SORL1 alleles are associated with AD risk [30]. SORL1 appears to be localized in the Golgi compartment, plasma membrane and endosomes [29, 31]. We performed a Western blot analysis to determine if it could also be localised in the MAM. Interestingly SORL1 protein is detected in the MAM (Fig. 2b). The presence of both SORL1 and APP in the MAM may be an indication that the MAM is the initial site of SORL1 receptor binding with APP, from which APP can then be trafficked to the TGN, with regulated release from TGN to endosomes, lysosomes or plasma membrane.
113
Another receptor with interactions with Aβ is the 37kDa/67kDa Laminin Receptor (also known as LRP/LR or RPSA). LRP/LR is a multifunctional receptor that acts as a cell surface receptor for the cellular prion protein PrPc and as well as its misfolded form PrPSc. PrPc has been shown to bind Aβ oligomers within cholesterol-rich lipid rafts upon which it is internalized and trafficked to lysosomes, all of which requires the transmembrane low density lipoprotein receptor-related protein-1 (LRP1) [32]. Interestingly, LRP/LR is also found in lipid rafts and also interacts with Aβ resulting in its internalization at the cell surface [33].
Fluorescence studies indicate that LRP/LR localises to the cell surface, nucleus and to a perinuclear compartment [34]. We hypothesized that this perinuclear compartment might be the MAM. However, our Western blot analysis revealed no detectable LRP/LR within the
MAM fraction. Instead, LRP/LR was detected mainly in the ER fraction, which is likely the perinuclear compartment (Fig. 2c).
Conclusion
We analysed three proteins for their presence in the MAM and have found that SORL1 can be found in the MAM fraction. Its role in the MAM has yet to be elucidated. SORL1 is involved in APP trafficking, with mutations linking it to AD. Understanding its role in MAM may give insight into APP trafficking through the cell and may also clarify the role the MAM plays in
AD.
114
Methods and materials
Antibodies
Primary antibodies were against the proteins BACE1 (Santa Cruz Biotechnology, CA, USA,
Cat. No sc-10053), SORL1 (Aviva Systems Biology, CA, USA, Cat. No OAEB01612),
LRP/LR (Aviva Systems Biology, Cat. No ARP54683_P050), MTCO1 (Abcam, Cat. No. ab14705), Na+/K+-ATPase (Abcam, Cat. No. ab7671), IP3R3 (Millipore, Temecula, USA,
Cat. No. AB9076), and KDEL (Abcam, ab12223). Secondary antibodies were donkey anti- mouse Ig, (Rockland, Gilbertsville, USA, Cat. No. 610-703-124) and donkey anti-rabbit Ig,
(Rockland, 611-703-127).
Preparation of subcellular fractions
Mice brain tissue were quickly removed and placed in isolation buffer (250 mM mannitol, 5 mM HEPES pH 7.4, and 0.5 mM EGTA). The tissue was minced with scissors and gently homogenized with 4-6 strokes in a loose Potter-Elvehjem grinder (Thermo Fisher, MA,
USA). The homogenate was centrifuged for 5 minutes at 1000 X g. This gave a pellet of cell debris and nuclei which was discarded. The supernatant was centrifuged for 15 minutes at
10000 X g to pellet crude mitochondria which was separated from the supernatant. The supernatant was centrifuged for 1 hour at 100000 X g in a Beckman Ti-70 rotor (Beckman
Coulter, CA, USA) to pellet the ER/microsomal fraction. The crude mitochondrial fraction was layered on top of a 30% Percoll (GE Healthcare, UK) gradient and centrifuged for 30 minutes at 95000 X g in a Beckman Ti-70 rotor. The upper band contained the MAM fraction.
The lower band contained mitochondria fraction that was free of ER. The upper band was diluted fivefold with isolation buffer and washed twice at 8000 X g for 10 minutes to obtain the mitochondrial fraction in the pellet. The supernatant containing the MAM was centrifuged
115 at 100000 X g for 1 hour to obtain the MAM pellet which was resuspended in isolation buffer.
The lower band was diluted fivefold with isolation buffer and centrifuged twice at 8000 X g for 10 minutes to remove any Percoll present. The resulting pellet was resuspended in isolation buffer.
For the plasma membrane fraction, minced tissue was homogenised in STM 0.25 buffer (0.25
M sucrose, 10 mM Tris_Cl pH 7.4, 1.0 mM MgCl2; 4.5 ml/g tissue), using 10 strokes of the loose-fitting Potter-Elvehjem grinder. The homogenate was centrifuged for 5 minutes 260 X g. The supernatant was kept on ice while the pellet was resuspended in half the volume of
STM 0.25 buffer, homogenised again with three strokes of the loose gringer and centrifuged 5 minutes 260 X g. The two supernatants were combined, centrifuged for 10 minutes at 1500 X g and the pellet resuspended in twice the volume of STM 0.25 buffer initially used. The resuspended pellet was homogenised using three strokes of a tight fitting Potter-Elvehjem grinder. An equal volume of STM 2 buffer (2 M sucrose, 10 mM Tris_Cl pH 7.4, 1.0 mM
MgCl2) was added to the homogenate, and centrifuged for 1 hour at 113,000 X g. The layer at the top of the gradient is enriched in plasma membrane, and was resuspended in STM 0.25 buffer. All fractions were quantitated for total protein content using the Bradford system
(BioRad, CA, USA).
Western immunoblot assays for fractions
20 μg of total protein was placed in sample buffer [2% sodium dodecyl sulfate (SDS), 5% b- mercaptoethanol, 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromphenol blue], heated at 55˚C for 10 min, and separated on 4-12% SDS–PAGE gel. Proteins were transferred to nitrocellulose membranes using a semidry electrotransfer system. Western immunoblotting used the conditions recommended by the antibody providers and visualized with luminol
116 reagents (Amresco, OH, USA) using the ChemiDocTM MPimaging system (Bio-Rad, CA,
USA).
117
Figures
Figure 1. The majority of PSEN1 is localized to the MAM in mammalian (mouse) brain tissues. Fractionation of mouse brain cellular membranes was done to obtain plasma membrane
(PM), mitochondrial membranes (Mito), mitochondrial associated membranes (MAM) and non-
MAM endoplasmic reticulum (ER). Fractions were identified by their physical behaviour during the fractionation procedure and confirmed by western immunoblotting using antibodies recognising proteins MTCO1 in mitochondria, Na+/K+-ATPase in PM, IP3R3 in MAM, and
KDEL, predominantly in non-MAM ER.
118
Figure 2. Western blot analysis of subcellular fractions obtained from mouse brain. The fractions mitochondria (Mito), endoplasmic reticulum (ER), mitochondrial associated membranes (MAM) and plasma membrane (PM) were probed with antibodies against a)
BACE1 b) SORL1 and c) LRP/LR. d) Western immunoblotting using antibodies recognising proteins MTCO1 mitochondria with detection in PM fraction indicating cross-contamination,
Na+/K+-ATPase in PM with detection in mitochondria fraction indicating cross-contamination,
IP3R3 in MAM, and KDEL in non-MAM ER.
119
References
1. Vance, J.E., PHOSPHOLIPID-SYNTHESIS IN A MEMBRANE-FRACTION ASSOCIATED WITH MITOCHONDRIA. Journal of Biological Chemistry, 1990. 265(13): p. 7248-7256. 2. Area-Gomez, E., et al., Upregulated function of mitochondria-associated ER membranes in Alzheimer disease. The EMBO journal, 2012. 31(21): p. 4106-23. 3. Hayashi, T. and T.P. Su, Sigma-1 receptors (sigma(1) binding sites) form raft-like microdomains and target lipid droplets on the endoplasmic reticulum: roles in endoplasmic reticulum lipid compartmentalization and export. The Journal of pharmacology and experimental therapeutics, 2003. 306(2): p. 718-25. 4. Hayashi, T. and T.P. Su, Intracellular dynamics of sigma-1 receptors (sigma(1) binding sites) in NG108-15 cells. Journal of Pharmacology and Experimental Therapeutics, 2003. 306(2): p. 726-733. 5. Simmen, T., et al., PACS-2 controls endoplasmic reticulum-mitochondria communication and Bid-mediated apoptosis. The EMBO journal, 2005. 24(4): p. 717-29. 6. de Brito, O.M. and L. Scorrano, Mitofusin 2 tethers endoplasmic reticulum to mitochondria. Nature, 2008. 456(7222): p. 605-10. 7. Rusinol, A.E., et al., A unique mitochondria-associated membrane fraction from rat liver has a high capacity for lipid synthesis and contains pre-Golgi secretory proteins including nascent lipoproteins. The Journal of biological chemistry, 1994. 269(44): p. 27494-502. 8. Chang, T.-Y., et al., Acyl-coenzyme A:cholesterol acyltransferases. American Journal of Physiology - Endocrinology and Metabolism, 2009. 297(1): p. E1-E9. 9. Stone, S.J. and J.E. Vance, Phosphatidylserine Synthase-1 and -2 Are Localized to Mitochondria-associated Membranes. Journal of Biological Chemistry, 2000. 275(44): p. 34534-34540. 10. Zborowski, J., A. Dygas, and L. Wojtczak, Phosphatidylserine decarboxylase is located on the external side of the inner mitochondrial membrane. FEBS letters, 1983. 157(1): p. 179-82. 11. Hayashi, T. and T.P. Su, Sigma-1 receptor chaperones at the ER-mitochondrion interface regulate Ca(2+) signaling and cell survival. Cell, 2007. 131(3): p. 596-610. 12. Mendes, C.C., et al., The type III inositol 1,4,5-trisphosphate receptor preferentially transmits apoptotic Ca2+ signals into mitochondria. The Journal of biological chemistry, 2005. 280(49): p. 40892-900. 13. Rizzuto, R., et al., Close contacts with the endoplasmic reticulum as determinants of mitochondrial Ca2+ responses. Science, 1998. 280(5370): p. 1763-6. 14. Hamasaki, M., et al., Autophagosomes form at ER-mitochondria contact sites. Nature, 2013. 495(7441): p. 389-93. 15. Hailey, D.W., et al., Mitochondria Supply Membranes for Autophagosome Biogenesis during Starvation. Cell, 2010. 141(4): p. 656-667. 16. Simmen, T., et al., Oxidative protein folding in the endoplasmic reticulum: Tight links to the mitochondria-associated membrane (MAM). Biochimica Et Biophysica Acta-Biomembranes, 2010. 1798(8): p. 1465-1473. 17. Area-Gomez, E., et al., Presenilins are enriched in endoplasmic reticulum membranes associated with mitochondria. The American journal of pathology, 2009. 175(5): p. 1810-6. 18. Guardia-Laguarta, C., et al., alpha-Synuclein Is Localized to Mitochondria-Associated ER Membranes. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2014. 34(1): p. 249-59. 19. Newman, M., et al., Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease. Human molecular genetics, 2013.
120
20. Vassar, R., et al., Beta-secretase cleavage of Alzheimer's amyloid precursor protein by the transmembrane aspartic protease BACE. Science, 1999. 286(5440): p. 735-41. 21. Hussain, I., et al., ASP1 (BACE2) cleaves the amyloid precursor protein at the beta-secretase site. Molecular and cellular neurosciences, 2000. 16(5): p. 609-19. 22. Vassar, R., Beta-secretase (BACE) as a drug target for Alzheimer's disease. Adv Drug Deliv Rev, 2002. 54(12): p. 1589-602. 23. Zacchetti, D., et al., BACE1 expression and activity: relevance in Alzheimer's disease. Neuro- degenerative diseases, 2007. 4(2-3): p. 117-26. 24. Thinakaran, G. and E.H. Koo, Amyloid precursor protein trafficking, processing, and function. The Journal of biological chemistry, 2008. 283(44): p. 29615-9. 25. Das, U., et al., Activity-Induced Convergence of APP and BACE-1 in Acidic Microdomains via an Endocytosis-Dependent Pathway. Neuron, 2013. 79(3): p. 447-60. 26. Vassar, R., BACE1: the beta-secretase enzyme in Alzheimer's disease. Journal of molecular neuroscience : MN, 2004. 23(1-2): p. 105-14. 27. Pasternak, S.H., Presenilin-1, Nicastrin, Amyloid Precursor Protein, and -Secretase Activity Are Co-localized in the Lysosomal Membrane. Journal of Biological Chemistry, 2003. 278(29): p. 26687-26694. 28. Vassar, R., et al., The beta-Secretase Enzyme BACE in Health and Alzheimer's Disease: Regulation, Cell Biology, Function, and Therapeutic Potential. Journal of Neuroscience, 2009. 29(41): p. 12787-12794. 29. Andersen, O.M., et al., Neuronal sorting protein-related receptor sorLA/LR11 regulates processing of the amyloid precursor protein. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(38): p. 13461-13466. 30. Reitz, C., et al., Meta-analysis of the association between variants in SORL1 and Alzheimer disease. Archives of neurology, 2011. 68(1): p. 99-106. 31. Jacobsen, L., et al., Activation and functional characterization of the mosaic receptor SorLA/LR11. The Journal of biological chemistry, 2001. 276(25): p. 22788-96. 32. Rushworth, J.V., et al., Prion protein-mediated toxicity of amyloid-beta oligomers requires lipid rafts and the transmembrane LRP1. The Journal of biological chemistry, 2013. 288(13): p. 8935-51. 33. Da Costa Dias, B., et al., The 37kDa/67kDa Laminin Receptor acts as a receptor for Aβ42 internalization. Sci. Rep., 2014. 4. 34. Nikles, D., et al., Subcellular localization of prion proteins and the 37 kDa/67 kDa laminin receptor fused to fluorescent proteins. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease, 2008. 1782(5): p. 335-340.
121
CHAPTER 6
Research Paper 5
Latrepirdine (Dimebon) induces autophagy in
zebrafish larvae
122
123
124
Latrepirdine (Dimebon) induces autophagy in zebrafish larvae
Swamynathan Ganesan 1*Ŧ, Anne Lim 1 Ŧ, Seyyed Hani Moussavi Nik 1, Morgan
Newman 1, Prashant Bharadwaj 2, Giuseppe Verdile 2, Ralph Martins 2, 3, 4, Michael
Lardelli 1.
1. Alzheimer’s Disease Genetics Laboratory, Department of Genetics and Evolution,
School of Biological Sciences, The University of Adelaide, South Australia, Australia.
2. Centre of Excellence for Alzheimer's Disease Research and Care, School of Medical
Sciences, Edith Cowan University, Joondalup, WA, Australia.
3. School of Psychiatry and Clinical Neuroscience, University of Western Australia,
Crawley, WA, Australia.
4. The Sir James McCusker Alzheimer's Disease Research Unit, Hollywood Private
Hospital, Nedlands, WA, Australia.
SG Ŧ and AL Ŧ contributed equally to this work.
125
Abstract
Alzheimer’s disease (AD) is the most common form of dementia, and remains an incurable disease. One of the neuropathological hallmarks AD is the presence of β- amyloid plaques in the brain. Drug treatments for AD have thus far been unable to significantly reverse disease progression; therefore the search for new treatments is ongoing. Latrepirdine is one of several drugs that have been tested to combat AD.
Latrepirdine has been shown to induce autophagy and reduce β-amyloid aggregation. It has been tested effectively on several animal models; however the effects of
Latrepirdine have not been tested on zebrafish embryos. Here we used zebrafish embryos to test whether Latrepirdine can induce autophagy. We tested Latrepirdine at a series of concentrations and found that a 5 µM concentration of Latrepirdine can induce autophagy in zebrafish larvae. This is evident from a LC3 immunoblot assay, where we observed an increase in the LC3II/LC3I ratio in the presence of a lysosomal inhibitor, chloroquine. Our TEM analysis supported the finding that Latrepirdine induces autophagy in zebrafish larvae at 72 hpf.
Introduction
Living organisms are under constant external stress by environmental factor. They respond to these external factors by altering their cellular structure through various molecular pathways. One such pathway found in most living organisms is autophagy
[1]. In this paper we discuss about macroautophagy (referred to as autophagy), which primarily involves the degradation of proteins and organelles through the formation of autophagosomes. The other forms of autophagy include microautophagy, which
126
involves the direct degradation of cytoplasmic cargo by lysosomes and chaperone- mediated autophagy which involves the binding of chaperones (HSC 70) to specific proteins and enabling their lysosomal degradation [2, 3]. Autophagy degrades proteins, protein aggregates and whole organelles to maintain cellular homeostasis [4]. The proteins and organelles degraded by autophagy provide substrates required for cellular metabolism [5]. Unlike apoptosis, autophagy promotes cell survival mechanism allowing cells to recover from damage and restore normal functioning [6]. Although initially thought to function only in clearing harmful peptides from the cell, current research has shown that it may have other significant functions in cellular metabolism
[7]. Studies have shown that it may play a significant role during ageing, development and in other process which require constant protein turnover.
Recently autophagy has been implicated in cancer, neurodegenerative disorders and other metabolic disorders [8]. Most of these disorders are multifactorial and involve many of other factors for their progression. Therefore it becomes important to investigate whether autophagy is protective or contributes to the progression of a disease. Alzheimer’s disease is one of the few disorders investigated in detail for the role of autophagy. Several studies in the past have highlighted that autophagy has a crucial role in the progression of Alzheimer’s disease (AD), in which it may have contradictory actions [9-11]. Some studies have shown that autophagy is impaired as a result of AD progression [12]. Other studies have shown that autophagy may be modulated to enhance β-amyloid clearance which is a pathological feature observed in
AD and that this may slow down disease progression [13].
127
Several drugs have been tested for their effectiveness in reducing amyloid plaque formation [14]. Latrepirdine is one drug that has undergone clinical trials of relevance to AD pathogenesis. Studies have shown that latrepirdine possesses neuroprotective properties and improves cognition and behaviour in animal models [15, 16]. It has also been shown to be involved in mitochondrial function, calcium homeostasis and other pathways related to AD pathogenesis [17]. A study on cultured cells by Lermontova et al (2001) has shown that Latrepirdine inhibits the neurotoxic effects of β-amyloid and protects cells from cytotoxicity [18]. Although studies on animal models have indicated that Latrepirdine might be useful in the treatment of cognitive disorders, the results of clinical trials have been contradictory. An initial pilot trial and early phase II trials of the drug showed promise, but a large scale phase III clinical trial was unsuccessful
(reviewed in [19]). The mechanism of action of Latrepirdine also remains to be fully understood.
Zebrafish is widely used as an animal model to investigate various biochemical pathways that contribute to AD pathogenesis [20]. Zebrafish serves as an excellent tool to either over-express genes or to block gene expression by using morpholino antisense oligonucleotides [21, 22]. Zebrafish embryos are optically transparent and chemicals can be directly added to their aqueous support medium making it easy to analyse their effects on various biochemical pathways [23, 24]. Previously we have shown that autophagy can be analysed in zebrafish embryos by using various chemicals that induce and inhibit this function. We have also validated that autophagy can be monitored effectively in zebrafish embryos using the LC3 immunoblot assay [25].
128
In the work described in this paper, we use 3-day old zebrafish larvae to test whether
Latrepirdine (Dimebon) induces autophagy. Although Latrepirdine has been shown to induce autophagy in cell lines, we report here the inductive effect of latrepirdine on autophagy in zebrafish. We show that autophagy induced by Latrepirdine can be monitored more sensitively in zebrafish embryos by direct observation of autophagosomes by transmission electron microscopy (TEM). Our findings support the use of zebrafish as a system in which to investigate the effects of Latrepirdine in vivo.
Materials and Methods
Ethics
This work was conducted under the auspices of The Animal Ethics Committee of The
University of Adelaide and in accordance with EC Directive 86/609/EEC for animal experiments and the Uniform Requirements for Manuscripts Submitted to Biomedical
Journals.
Zebrafish husbandry and experimental procedures
Wild-type zebrafish were maintained in a recirculated water system with a 14 hour light/10 hour dark cycle. Fertilized embryos were placed in petri plates containing embryo medium (E3) and grown at 28 ˚C in a humid incubator.
129
Drug Treatment
Latrepirdine (Dimebon) was added to 66 hpf larvae for 6 h at the concentrations specified in the experimental descriptions (1 µM to 200 µM). Chloroquine, a lysosomal inhibitor was added to a final concentration of 50 µM at 56 hpf followed by incubation for a further 16 h [23, 26]. At 72 hpf, all larvae were deyolked. The deyolked samples were then lysed with sample lysis buffer and immunoblotted.
Western immunoblot analyses
Deyolked larvae were placed in sample buffer (2% sodium dodecyl sulfate (SDS), 5%
β-mercaptoethanol, 25% v/v glycerol, 0.0625 M Tris–HCl (pH 6.8), and bromphenol blue), and then heated immediately at 100 ºC for 5 min. Samples were run on 15%
SDS-PAGE gels and proteins were transferred to PVDF membranes using a wet electrotransfer system. The membranes were blocked with 5% Western Blocking
Solution in TBST and then probed with anti-LC3 antibody and anti-β-tubulin antibody
(Antibody E7, Developmental Studies Hybridoma Bank, The University of Iowa, IA,
USA) which was used as a loading control. The blots were visualized using luminol reagents (Amresco, Ohio, USA) and the ChemiDoc™ MP imaging system (Bio-Rad,
Hercules, CA, USA).
Transmission electron microscopy
To observe the number of autophagosomes in zebrafish cells, treated and untreated larvae were grown to the 72 hpf stage. The larvae were fixed in 4% paraformaldehyde,
130
1.25% glutaraldehyde in PBS with 4% sucrose, pH 7.2 overnight at 4 ˚C, and then rinsed in washing buffer (PBS with 4% sucrose) twice for ten minutes. Larvae were post-fixed in 2% osmium tetroxide for 45 minutes on a rotator, followed by dehydration through an ethanol series of 70, 90, 95 and 100%. The ethanol was replaced by propylene oxide for 15 minutes followed by a mixture of propylene oxide and resin at a
1:1 ratio for 45 minutes. This was followed by 100% resin infiltration overnight. The embryos were then embedded in fresh resin and the resin polymerized at 70 ˚C for 24 hours. The embedded larvae were sectioned coronally in a rostral to caudal direction through the head of the embryo using an ultramicrotome. The depth at which sections were obtained was approximately 100-130 μm from the rostral end of the head, roughly one-fifth into the eye to obtain an ultrathin 85 nm section of the forebrain. The ultrathin sections were stained with uranyl acetate and lead citrate and imaged on an Olympus-
SIS Veleta CCD camera in a FEI Tecnai G2 Spirit TEM (FEI, Oregon, USA). Images were obtained from 10 cells per larva. Thus, the cells observed for counting of autophagosomes were 30 per treatment.
Statistical analysis
Each experiment was carried out with 3 biological replicates (n=3). Data were analysed using GraphPad Version 6.0 (GraphPad Prism, La Jolla, CA). For the LC3II/LC3I assays, since single clutches of larvae were used to generate the various treatments of any biological replicate, differences among the groups were evaluated using a two- tailed paired t-test. For the TEM analysis, the treatments were conducted on one clutch of larvae and cells from three separate larvae from each treatment were analysed. P- values were calculated for all the comparisons and p<0.05 was considered significant. 131
Results
Determining the concentration of Latrepirdine that can induce autophagy in zebrafish embryos by an LC3 immunoblot assay
The most commonly used assay to measure autophagy is monitoring of the conversion of LC3, an autophagy marker. LC3 is a microtubule associated protein that is present in cytosol as LC3I and LC3II. Upon induction of autophagy, the cytosol LC3I undergoes lipidation with phosphotidyl ethanolamine (PE) and converts to LC3II which then binds to autophagosomes. Therefore determining the ratio of LC3II to LC3I reveals changes in autophagic activity.
Latrepirdine has been shown to induce autophagy in cell lines and in mice but no study has shown whether this effect can be generalised to other in vivo models. Since we are interested in the use of zebrafish to study Alzheimer’s disease, we carried out an initial screening of Latrepirdine at different concentrations to find out an optimum concentration that might induce autophagy in zebrafish larvae. We performed a standard LC3 Immunoblot assay on 72 hpf zebrafish embryos treated with a range of concentrations of Latrepirdine. In our initial screening we used Latrepirdine concentrations ranging from 50µM to 200µM. We then calculated the LC3II/LC3I ratio and did not find any significant difference in the ratio between control and Latrepirdine- treated samples (Figure 1B). Previous studies have demonstrated that a 10 nM concentration of Latrepirdine can induce autophagy in SH-SY5Y cells [27]. A very high concentration of Latrepirdine could be a reason for not finding any significant change and we decided to do a screen with lower concentrations of Latrepirdine.
132
In our second screen, we used Latrepirdine at concentrations in the range of 1µM to
50µM and performed the LC3 immunoblot assay. We found the most significant increase in the LC3II/LC3I ratio was observed between samples treated with 5 µM
Latrepirdine and untreated control samples at 72 hpf. We saw that the autophagic induction increases gradually with increasing Latrepirdine concentration and reaches a maximum increase at 5 µM of Latrepirdine when compared to untreated wild-type larvae (Figure 2B).
Currently, a standard requirement to validate observations of changes in LC3 isoform ratios is to observe the effects on LC3II of lysosomal inhibition. (If a treatment has increased autophagic flux then lysosomal inhibition should result in relative LC3II accumulation). Therefore we performed the LC3 immunoblot assay in the presence of chloroquine, a lysosomal inhibitor to validate our findings further.
Induction of autophagy by Latrepirdine is confirmed by an increase in the LC3II/I ratio in the presence of chloroquine
The LC3 immunoblot assay was performed using the 5 µM concentration of
Latrepirdine that had shown an increase in the LC3II/LC3I ratio. No significant morphological changes were observed when larvae were treated with 5 µM Latrepirdine and chloroquine either in combination or alone suggesting that these treatments are not toxic (Figure 3). Larvae treated with 5 µM Latrepirdine and chloroquine showed a significant increase in the LC3II/LC3I ratio when compared to wild-type larvae treated
133
with chloroquine alone. This supported our finding that 5 µM Latrepirdine induces autophagy in zebrafish larvae (Figure 4B).
Determining induction of autophagy by counting the number of autophagic vacuoles using transmission electron microscopy (TEM)
Autophagosomes were first discovered using electron microscopy [28]. Transmission electron microscopy (TEM) is a widely used technique to assess numbers of autophagic vacuoles in cells. Electron microscopy produces high resolution images of autophagosomes which give a visual validation of the presence of autophagic vesicles assessed in other assays such as using the LC3 immunoblot assay. In electron microscopy autophagosomes can be identified as membrane bound vesicles that contain cytosolic materials such as organelles [29]. Our LC3 immunoblot assay showed that autophagy can be induced by Latrepirdine in zebrafish larvae. In order to validate further our LC3 immunoblot assay findings, we used TEM to quantitate the number of autophagic vacuoles present in the brains of treated and untreated zebrafish larvae. To do this we treated larvae using the same conditions used for the immunoblot assay and then processed the larvae for TEM. All embryos were sectioned in the forebrain region, approximately 100-130 μm from the rostral extremity of the head. We chose cells from brain sections because LC3 levels are known to be high in the brain and Latrepirdine is proposed as a treatment for the neurodegenerative disease AD. We used the presence of the mandibular cartilage and ethmoid plate of the larva as a visual guide to confirm that we were observing cells from similar regions of each larva (Figure 5). Cells from the centre of the ventral area of the forebrain were chosen since these cells appeared fairly uniform in morphology and may represent a more homogenous cell type (Figure 5). 134
We analysed the number of autophagosomes present in ten cells per zebrafish larva and repeated this in triplicate, using three biological replicates. Cells of untreated larvae rarely contained autophagosomes, but treatment of larvae with only chloroquine increased the number of autophagosomes in cells by more than three-fold (Figure 6).
This appears to indicate that under normal conditions, autophagosomes are degraded rapidly after induction in larvae and chloroquine treatment blocks their degradation by inhibiting the activity of lysosomal enzymes. We found that treatment with 5 µM
Latrepirdine significantly increased the number of autophagosomes present in cells when compared with untreated larvae (Figure 7). For a more accurate assessment of autophagic flux, we compared larvae treated with 5 µM Latrepirdine in the presence of chloroquine to larvae treated with chloroquine only as was done in our immunoblot analyses. We found that Latrepirdine significantly increased the number of autophagic vacuoles present in cells (Figure 7). Our TEM results are in agreement with the LC3 immunoblot assay and indicate that 5 µM Latrepirdine causes induction of autophagy in the brains of zebrafish larvae at 72 h.
Discussion
AD is a complex multifactorial disorder characterised by the accumulation of β-amyloid in plaques in the brain [30-32]. β-amyloid accumulation is one of the important pathological features observed during the progression of the disease, therefore much research has focussed on the neurotoxicity of β-amyloid aggregation. Research has also identified several other factors influencing AD progression [33]. One such factor is autophagy. It is thought that failure of β-amyloid clearance due to a block in the autophagy pathway might play a critical role in AD progression [34, 35]. This has led to 135
studies of several compounds that can possibly induce autophagy and might potentially alleviate AD symptoms [36].
In recent times, research has focussed on identifying potential drugs that might alleviate
AD symptoms by reducing β-amyloid aggregation through stimulation of autophagy.
Latrepirdine is one such drug that has been tested for amyloid clearance on yeast and mouse models [37, 38]. Initially studied as an anti-histamine drug, subsequent research has tested whether Latrepirdine has any other neuroprotective properties [39]. Studies have shown promising results regarding the effectiveness of Latrepirdine for reducing symptoms in several neurodegenerative disorders. While some research carried out on
Latrepirdine has suggested that it acts as a neuroprotector and enhances improvement in cognition and behaviour [15, 40, 41], other studies have shown that it can also reduce the aggregation of β-amyloid [42]. Moreover it has also been shown to interact with several other pathways involved in neurodegenerative disorders [43]. Although
Latrepirdine has been shown to have neuroprotective properties, the pathways and mechanisms it interacts with to achieve this are still unknown. Therefore further research is required to characterize this chemical and to understand the various critical pathways influenced by it.
In our study, we examined whether Latrepirdine can induce autophagy in zebrafish larvae. Zebrafish is an excellent tool for dissection of molecular pathways as embryos and, to some extent, larvae can be manipulated to over-express or inhibit gene activity
[44]. Also chemicals can be directly added to the fish’s support medium making it
136
simple to observe effects at the molecular level and in animal behaviour. The ease of breeding large numbers of zebrafish embryos in a short time span and its cost effectiveness compared to other animal models such as mice make zebrafish a popular model for testing drugs such as Latrepirdine. Using animal models with a vertebrate system is more advantageous over organisms such as yeast as more complex interactions within a particular type of cell, tissue or organ can be observed. Therefore the zebrafish has the benefits of higher organism animal models while also being easy to use much like a lower organism. Furthermore, 70% of human genes have at least one clear zebrafish orthologue, including genes involved in autophagy [45-48]. Therefore it would seem that zebrafish are the optimum animal model to use for further studies on
Latrerpirdine and other autophagy modifying drugs.
One aim of our study was to test whether treatment with Latrepirdine has any morphological effects on early zebrafish development since this may indicate drug toxicity. Latrepirdine treatment of developing zebrafish embryos did not result in any gross morphological changes. Another aim was to find an optimum concentration of
Latrepirdine for induction of autophagy in zebrafish larvae. Through our concentration screening we identified that Latrepirdine at 5 µM concentration induces autophagy in zebrafish larvae by 72 h. Further testing of 5 µM Latrepirdine in the presence of the lysosomal inhibitor, chloroquine, confirmed the induction of autophagy by this drug. To support the findings of our LC3 immunoblot assay we performed a TEM analysis. The
TEM analysis allowed actual quantification of autophagosomes and supported the findings of the LC3 assays. Future analysis will focus on identifying the underlying molecular machinery of autophagy that is affected by Latrepirdine.
137
In conclusion we have shown that exposure of developing zebrafish larvae to 5 µM
Latrepirdine can induce autophagy in zebrafish by 72 hpf. Our observations are consistent with other published studies showing that Latrepirdine can induce autophagy in a number of other animal models and cell lines. The activity of Latrepirdine in zebrafish opens up several avenues to understanding and testing the properties of this drug with respect to AD progression and it is hoped that further understanding of the mechanism of action of Latrepirdine will be elucidated. This also supports the use of zebrafish in testing of other drugs that may have potential in treatment of AD.
138
Figures
Figure 1 – (A) LC3 Immunoblot assay to analyse the effect on autophagy of concentrations of 50 µM-200 µM of Latrepirdine. Zebrafish larvae were treated with the Latrepirdine concentrations shown from 66 hpf before deyolking at 72 h, lysis and
SDS-PAGE followed by detection of LC3II and LC3I using an anti-LC3 antibody.
Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software. Each analysis was carried out in triplicate. Error bars represent standard error of means (n=3).
139
Figure 2 – (A) LC3 Immunoblot assay to analyse the effect on autophagy of concentrations of 1 µM-50 µM of Latrepirdine. Larvae were treated with the
Latrepirdine concentrations shown from 66 hpf. Larvae were then deyolked at 72 h, lysed and subjected to SDS-PAGE before LC3II and LC3I were detected by immunoblotting using an anti-LC3 antibody. Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software.
Each analysis was carried out in triplicate. Error bars represent standard errors of means.
140
Figure 3 – Dissection microscope images of zebrafish larvae at 72hpf showing the absence of morphological changes under 5 µM Latrepirdine and chloroquine treatment.
Representative image of respective treatments are shown. CQ, Chloroquine;
141
Figure 4 – LC3 Immunoblot assay carried in the presence of chloroquine, a lysosomal inhibitor. Larvae treated with 5 µM Latrepirdine and chloroquine were deyolked at 72 h, lysed and subjected to SDS-PAGE before LC3II and LC3I were detected by immunoblotting using an anti-LC3 antibody. Anti-tubulin antibody was used as a loading control. (B) The LC3II/LC3I ratio was calculated using Image Lab software.
Each analysis was carried out in triplicate. Error bars represent standard errors of means. CQ, Chloroquine;
142
Figure 5 – TEM image showing a transverse section through the head of a zebrafish larva at 72 h. The ventral forebrain in which cells were imaged in our TEM studies is indicated by asterisks (*) within the boxed region. The ethmoid plate (E) and mandibular cartilage (M) were used as visual references to locate a similar area of the brain for imaging in the various treatment samples and replicates. L, lens; IPL, inner plexiform layer; OPL, outer plexiform layer; GCL, ganglion cell layer;
143
Figure 6 - TEM of autophagic vacuoles present in a cell. Electron microscopy images from cells from the ventral forebrain of larvae treated with (a) control (b) 5 μM
Latrepirdine (c) control with chloroquine (d) 5 μM Latrepirdine with chloroquine. Each image shows the presence or absence of autophagic vacuoles in a cell from the brain of a 72 hpf larva. Arrows indicate autophagic vacuoles. The control cell, panel (a) does not contain any autophagic vacuoles. Panel (d) is a composite of two images of a single cell as autophagic vacuoles were located in different regions within the cell.
144
Figure 7 - The quantification of autophagosomes using TEM indicates that Latrepirdine increases the number of autophagosomes present in cells in the ventral forebrain of zebrafish larvae. Autophagosomes were counted in ten cells per embryo and the experiment was done using three separate larvae (n=3). Error bars represent standard deviation, statistical significance values are from a two-tailed unpaired student’s t-test assuming unequal variance.
145
References
1. Rikiishi, H., Novel Insights into the Interplay between Apoptosis and Autophagy. Int J Cell Biol, 2012. 2012: p. 317645. 2. Boya, P., F. Reggiori, and P. Codogno, Emerging regulation and functions of autophagy. Nat Cell Biol, 2013. 15(7): p. 713-20. 3. Reggiori, F., et al., Selective types of autophagy. Int J Cell Biol, 2012. 2012: p. 156272. 4. Mizushima, N. and B. Levine, Autophagy in mammalian development and differentiation. Nat Cell Biol, 2010. 12(9): p. 823-30. 5. Parzych, K.R. and D.J. Klionsky, An overview of autophagy: morphology, mechanism, and regulation. Antioxid Redox Signal, 2014. 20(3): p. 460-73. 6. Altman, J.K., et al., Autophagy is a survival mechanism of acute myelogenous leukemia precursors during dual mTORC2/mTORC1 targeting. Clin Cancer Res, 2014. 20(9): p. 2400-9. 7. Kim, K.H. and M.S. Lee, Autophagy--a key player in cellular and body metabolism. Nat Rev Endocrinol, 2014. 10(6): p. 322-37. 8. Shintani, T. and D.J. Klionsky, Autophagy in health and disease: a double-edged sword. Science, 2004. 306(5698): p. 990-5. 9. Tung, Y.T., et al., Autophagy: a double-edged sword in Alzheimer's disease. J Biosci, 2012. 37(1): p. 157-65. 10. Boland, B., et al., Autophagy induction and autophagosome clearance in neurons: relationship to autophagic pathology in Alzheimer's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2008. 28(27): p. 6926-37. 11. Yang, D.S., J.H. Lee, and R.A. Nixon, Monitoring autophagy in Alzheimer's disease and related neurodegenerative diseases. Methods in enzymology, 2009. 453: p. 111-44. 12. Li, L., X. Zhang, and W. Le, Autophagy dysfunction in Alzheimer's disease. Neurodegener Dis, 2010. 7(4): p. 265-71. 13. Zhu, X.C., et al., Autophagy modulation for Alzheimer's disease therapy. Mol Neurobiol, 2013. 48(3): p. 702-14. 14. Nakamura, Y., [New anti-AD drugs--their possibilities and issues]. Seishin Shinkeigaku Zasshi, 2012. 114(3): p. 255-61. 15. Bachurin, S., et al., Antihistamine agent Dimebon as a novel neuroprotector and a cognition enhancer. Ann N Y Acad Sci, 2001. 939: p. 425-35. 16. Lermontova, N.N., et al., Dimebon improves learning in animals with experimental Alzheimer's disease. Bull Exp Biol Med, 2000. 129(6): p. 544-6. 17. Wu, J., Q. Li, and I. Bezprozvanny, Evaluation of Dimebon in cellular model of Huntington's disease. Mol Neurodegener, 2008. 3: p. 15. 18. Lermontova, N.N., et al., Dimebon and tacrine inhibit neurotoxic action of beta- amyloid in culture and block L-type Ca(2+) channels. Bull Exp Biol Med, 2001. 132(5): p. 1079-83. 19. Bezprozvanny, I., The rise and fall of Dimebon. Drug news & perspectives, 2010. 23(8): p. 518-523. 20. Newman, M., et al., Zebrafish as a tool in Alzheimer's disease research. Biochim Biophys Acta, 2011. 1812(3): p. 346-52. 21. Nornes, S., et al., Interference with splicing of Presenilin transcripts has potent dominant negative effects on Presenilin activity. Hum Mol Genet, 2008. 17(3): p. 402- 12. 22. Nornes, S., et al., Independent and cooperative action of Psen2 with Psen1 in zebrafish embryos. Exp Cell Res, 2009. 315(16): p. 2791-801. 146
23. Ganesan, S., et al., Identification and expression analysis of the zebrafish orthologues of the mammalian MAP1LC3 gene family. Exp Cell Res, 2014. 24. Moussavi Nik, S.H., et al., The comparison of methods for measuring oxidative stress in zebrafish brains. Zebrafish, 2014. 11(3): p. 248-54. 25. Ganesan, S., et al., Identification and expression analysis of the zebrafish orthologues of the mammalian MAP1LC3 gene family. Exp Cell Res, 2014. 328(1): p. 228-37. 26. Cui, J., et al., Generation of transgenic zebrafish with liver-specific expression of EGFP- Lc3: a new in vivo model for investigation of liver autophagy. Biochem Biophys Res Commun, 2012. 422(2): p. 268-73. 27. Steele, J.W., et al., Latrepirdine stimulates autophagy and reduces accumulation of alpha-synuclein in cells and in mouse brain. Mol Psychiatry, 2013. 18(8): p. 882-8. 28. Novikoff, A.B., The proximal tubule cell in experimental hydronephrosis. J Biophys Biochem Cytol, 1959. 6(1): p. 136-8. 29. Eskelinen, E.L., Maturation of autophagic vacuoles in Mammalian cells. Autophagy, 2005. 1(1): p. 1-10. 30. Capetillo-Zarate, E., et al., Intraneuronal Abeta accumulation, amyloid plaques, and synapse pathology in Alzheimer's disease. Neurodegener Dis, 2012. 10(1-4): p. 56-9. 31. Yilmazer-Hanke, D.M., Alzheimer's disease. The density of amygdalar neuritic plaques is associated with the severity of neurofibrillary pathology and the degree of beta- amyloid protein deposition in the cerebral cortex. Acta Anat (Basel), 1998. 162(1): p. 46-55. 32. Mann, S.S. and J.A. Hammarback, Molecular characterization of light chain 3. A microtubule binding subunit of MAP1A and MAP1B. J Biol Chem, 1994. 269(15): p. 11492-7. 33. Munoz, D.G. and H. Feldman, Causes of Alzheimer's disease. CMAJ, 2000. 162(1): p. 65- 72. 34. Nixon, R.A. and D.S. Yang, Autophagy failure in Alzheimer's disease--locating the primary defect. Neurobiol Dis, 2011. 43(1): p. 38-45. 35. Wolfe, D.M., et al., Autophagy failure in Alzheimer's disease and the role of defective lysosomal acidification. Eur J Neurosci, 2013. 37(12): p. 1949-61. 36. Yang, D.S., et al., Therapeutic effects of remediating autophagy failure in a mouse model of Alzheimer disease by enhancing lysosomal proteolysis. Autophagy, 2011. 7(7): p. 788-9. 37. Bharadwaj, P.R., et al., Latrepirdine (dimebon) enhances autophagy and reduces intracellular GFP-Abeta42 levels in yeast. J Alzheimers Dis, 2012. 32(4): p. 949-67. 38. Steele, J.W. and S. Gandy, Latrepirdine (Dimebon(R)), a potential Alzheimer therapeutic, regulates autophagy and neuropathology in an Alzheimer mouse model. Autophagy, 2013. 9(4): p. 617-8. 39. Okun, I., et al., From anti-allergic to anti-Alzheimer's: Molecular pharmacology of Dimebon. Curr Alzheimer Res, 2010. 7(2): p. 97-112. 40. Doody, R.S., et al., Effect of dimebon on cognition, activities of daily living, behaviour, and global function in patients with mild-to-moderate Alzheimer's disease: a randomised, double-blind, placebo-controlled study. Lancet, 2008. 372(9634): p. 207- 15. 41. Egea, J., et al., Neuroprotective effect of dimebon against ischemic neuronal damage. Neuroscience, 2014. 267: p. 11-21. 42. Ustyugov, A.A., et al., Dimebon reduces the levels of aggregated amyloidogenic protein forms in detergent-insoluble fractions in vivo. Bull Exp Biol Med, 2012. 152(6): p. 731- 3.
147
43. Zhang, S., et al., Dimebon (latrepirdine) enhances mitochondrial function and protects neuronal cells from death. J Alzheimers Dis, 2010. 21(2): p. 389-402. 44. Newman, M., E. Ebrahimie, and M. Lardelli, Using the zebrafish model for Alzheimer's disease research. Front Genet, 2014. 5: p. 189. 45. Howe, K., et al., The zebrafish reference genome sequence and its relationship to the human genome. Nature, 2013. 496(7446): p. 498-503. 46. Makky, K., J. Tekiela, and A.N. Mayer, Target of rapamycin (TOR) signaling controls epithelial morphogenesis in the vertebrate intestine. Developmental biology, 2007. 303(2): p. 501-13. 47. Tsukamoto, S., et al., Autophagy is essential for preimplantation development of mouse embryos. Science, 2008. 321(5885): p. 117-20. 48. He, C., et al., Assaying autophagic activity in transgenic GFP-Lc3 and GFP-Gabarap zebrafish embryos. Autophagy, 2009. 5(4): p. 520-6.
148
Supplementary Data
Table 1 – Densitometric analysis of western blots using zebrafish larvae (control larvae and larvae treated with concentrations of 50 µM - 200 µM of Latrepirdine
(Figure 1B). The intensity values of the LC3I and LC3II bands of each replicate are given.
Set 1 Control 50µM 100µM 125µM 150µM LC3I 2,924,565 3,066,416 3,050,582 4,251,522 4,596,696 LC3II 8,201,865 7,402,063 8,745,948 17,500,032 13,469,248
LC3II/LC3I Ratio 2.804473486 2.413913507 2.866976859 4.116180511 2.930202041
Set 2 Control 50µM 100µM 125µM 150µM LC3I 2,798,684 1,803,822 2,384,046 2,401,584 2,161,632 LC3II 10,905,293 11,003,508 12,686,490 10,768,800 8,330,112
LC3II/LC3I Ratio 3.896578892 6.100107439 5.321411584 4.484040533 3.853621708
Set 3 Control 50µM 100µM 125µM 150µM LC3I 4,933,026 6,504,685 8,707,920 9,521,875 8,195,550 LC3II 11,437,027 14,438,655 20,533,812 25,887,840 21,719,350
LC3II/LC3I Ratio 2.318460718 2.219731624 2.358061627 2.718775451 2.650139405
Set 1 175µM 200µM LC3I 4,325,832 5,720,767 LC3II 5,133,618 14,662,662 LC3II/LC3I Ratio 1.186735407 2.563058765 Set 2 175µM 200µM LC3I 4,373,692 3,965,998 LC3II 16,447,500 12,690,068 LC3II/LC3I Ratio 3.760552869 3.199716187 Set 3 175µM 200µM LC3I 13,653,935 7,232,114 LC3II 28,555,259 19,131,712 LC3II/LC3I Ratio 2.091357473 2.645383079
149
Statistical Analysis p-value Control Vs 50µM 0.5582 Control Vs 100µM 0.3821 Control Vs 125µM 0.1102 Control Vs 150µM 0.3303 Control Vs 175µM 0.3023 Control Vs 200µM 0.5625
150
Table 2 – Densitometric analysis of western blots using zebrafish larvae (control larvae and larvae treated with concentrations of 1 µM - 50 µM of latrepirdine
(Figure 2B). The intensity values of the LC3I and LC3II bands of each replicate are given.
Set 1 Control 1µM 2.5µM 5µM 10µM 50µM LC3I 6,372,826 5,346,250 9,046,125 3,505,680 5,724,950 6,585,696 LC3II 4,425,341 5,253,942 9,433,113 4,535,028 6,295,100 8,033,088
LC3II/LC3I 0.6944079 0.9827340 1.0427794 1.2936229 1.0995903 1.2197781 Ratio 44 66 22 21 89 37
Set 2 Control 1µM 2.5µM 5µM 10µM 50µM 10,600,79 LC3I 8,845,912 8,648,350 7,465,635 8,320,884 5 6,663,519 13,098,47 15,102,15 15,076,48 19,418,88 20,593,36 11,166,40 LC3II 3 0 5 0 2 1
LC3II/LC3I 1.4807374 1.7462463 2.0194511 2.3337520 1.9426243 1.6757513 Ratio 3 94 25 39 03 56
Set 3 Control 1µM 2.5µM 5µM 10µM 50µM LC3I 2,588,572 3,867,540 3,040,477 4,953,832 3,415,808 3,487,146 10,069,68 16,778,63 11,419,09 LC3II 6,558,051 0 8,627,743 8 9,748,244 5
LC3II/LC3I 2.5334628 2.6036395 2.8376281 3.3870018 2.8538618 3.2746248 Ratio 51 23 09 2 1 65
151
Statistical Analysis p-value Control Vs 1µM 0.0952 Control Vs 2.5µM 0.0313 Control Vs 5µM 0.0119 Control Vs 10µM 0.0106 Control Vs 50µM 0.0919
152
Table 3 – Densitometric analysis of western blots of zebrafish larvae (control larvae and larvae treated with 5 µM Latrepirdine and 50 µM chloroquine (Figure
4B). The intensity values of the LC3I and LC3II bands of each replicate are given.
Set 1 Con+Chl Lat(5µM)+Chl LC3I 724,458 560,306 LC3II 2,606,352 2,379,271
LC3II/LC3I Ratio 3.59765784 4.246377872
Set 2 Con+Chl Lat(5µM)+Chl LC3I 605,324 565,600 LC3II 2,077,921 2,264,800
LC3II/LC3I Ratio 3.4327418 4.004243281
Set 3 Con+Chl Lat(5µM)+Chl LC3I 676,623 1,356,390 LC3II 1,198,717 3,056,382
LC3II/LC3I Ratio 1.77161728 2.253320948
Statistical Analysis p-value Con+Chl Vs Lat(5µM)+Chl 0.0072
153
Table 4 – Counting of autophagosomes in 10 cells from the ventral forebrain of a
72hpf zebrafish larva. 3 biological replicates were performed using TEM (Figure
7) Lat, Latrepirdine; CQ, Chloroquine;
Control Control+CQ Lat Lat + CQ Sample 1 Sample 1 Sample 1 Sample 1 Cell 1 0 Cell 1 1 Cell 1 1 Cell 1 2 Cell 2 0 Cell 2 1 Cell 2 1 Cell 2 3 Cell 3 0 Cell 3 1 Cell 3 1 Cell 3 4 Cell 4 0 Cell 4 1 Cell 4 4 Cell 4 2 Cell 5 0 Cell 5 1 Cell 5 1 Cell 5 3 Cell 6 1 Cell 6 1 Cell 6 2 Cell 6 3 Cell 7 0 Cell 7 0 Cell 7 0 Cell 7 5 Cell 8 2 Cell 8 1 Cell 8 1 Cell 8 0 Cell 9 0 Cell 9 0 Cell 9 0 Cell 9 3 Cell 10 0 Cell 10 1 Cell 10 2 Cell 10 Average 3 8 13 25
Sample 2 Sample 2 Sample 2 Sample 2 Cell 1 0 Cell 1 1 Cell 1 1 Cell 1 2 Cell 2 1 Cell 2 1 Cell 2 1 Cell 2 4 Cell 3 0 Cell 3 0 Cell 3 2 Cell 3 3 Cell 4 0 Cell 4 3 Cell 4 1 Cell 4 2 Cell 5 1 Cell 5 2 Cell 5 2 Cell 5 1 Cell 6 1 Cell 6 1 Cell 6 1 Cell 6 1 Cell 7 0 Cell 7 0 Cell 7 2 Cell 7 0 Cell 8 0 Cell 8 0 Cell 8 0 Cell 8 1 Cell 9 0 Cell 9 1 Cell 9 0 Cell 9 2 Cell 10 0 Cell 10 2 Cell 10 1 Cell 10 2 Average 3 11 11 18
Sample 3 Sample 3 Sample 3 Sample 3 Cell 1 0 Cell 1 0 Cell 1 1 Cell 1 3 Cell 2 0 Cell 2 0 Cell 2 1 Cell 2 2 Cell 3 0 Cell 3 2 Cell 3 1 Cell 3 3 Cell 4 0 Cell 4 1 Cell 4 3 Cell 4 0 Cell 5 0 Cell 5 1 Cell 5 3 Cell 5 1
154
Cell 6 0 Cell 6 1 Cell 6 1 Cell 6 3 Cell 7 0 Cell 7 1 Cell 7 2 Cell 7 2 Cell 8 0 Cell 8 0 Cell 8 1 Cell 8 1 Cell 9 1 Cell 9 1 Cell 9 0 Cell 9 3 Cell 10 0 Cell 10 0 Cell 10 1 Cell 10 3 Average 1 7 14 21
Total Number of Autophagosomes
Control 7 Control + Chloroquine (50µM) 26 Latrepirdine (5µM) 38 Latrepirdine (5µM) + Chloroquine (50µM) 64
Statistical Analysis p-value Control Vs Lat 0.001 Control Vs Con+CQ 0.0176 Lat Vs Lat+CQ 0.035 Con+CQ Vs Lat+CQ 0.0102
155
CHAPTER 7
DISCUSSION
156
AD is a complex disease with an unclear underlying pathology. Much focus has remained on the
PRESENILINS, mainly PSEN1 due to its role as the catalytic core of the γ-secretase complex producing Aβ, as well as the many mutations in PSEN1 that have been linked to FAD.
Understanding the role PSENs play in AD could provide insight to the mechanisms of both SAD and FAD. Furthermore, focus on the MAM sub-compartment, where PSENs are enriched, may reveal more clearly the pathology of AD. However, understanding the structure and function of the other components of γ-secretase is equally important to fully comprehend how mutations in
PSEN1 potentially affect the complex as a whole. NCSTN is one of the four main components of the γ-secretase complex. In zebrafish, the psen1, psen2, aph1 and psenen genes have been studied and characterized to some extent, but information regarding zebrafish ncstn is lacking.
In this thesis we have confirmed the identity of zebrafish ncstn. The conservation of the glutamate residue cognate to E333 in human and the DYIGS motif that are important for either
Ncstn substrate recognition or γ-secretase formation indicate that zebrafish Ncstn likely retains the same functions as human NCSTN. This thesis includes the first detailed publication regarding zebrafish Ncstn and hopefully has laid the groundwork to further clarify Ncstn’s function using the zebrafish model. It would be interesting to further analyze why ncstn expression levels (high) do not coordinate with those of psen1 and psen2 (low) in adult tissues.
To date more than 170 mutations have been identified in the PSEN1 gene
(http://www.molgen.ua.ac.be/admutations). Some mutations cause aberrant splicing or result in a frame shift leading to a premature stop codon and transcripts encoding truncated proteins [34, 72,
157
221]. Various truncations of human PSEN1 and zebrafish Psen1 have been shown to have differential effects on Notch signalling and Appa cleavage [219] but the mechanisms by which these truncations exert their effects remain unclear. One possibility was that these different effects were due to the different sizes of truncated protein localizing to different cellular compartments.
We demonstrated that EGFP-tagged truncated Presenilin1 proteins were observed to be uniformly distributed in the cytoplasm but not imported into the nucleus, with a lack of EGFP fluorescence in lysosomes. However it cannot be ruled out that this may have been due to the pH sensitivity of EGFP and protein degradation. Therefore further work to confirm the localisation of Psen1 truncations will help to validate the results seen here. Although preliminary, our results in this thesis indicate that the different truncations analysed appear to have similar distributions, therefore their differential effects on γ-secretase substrates are likely not due to their different subcellular localisations.
Another possibility is that the different sizes of truncated proteins can bind to and interfere with wild type Psen1 function either within the γ-secretase complex or as a holoprotein. It is possible that the structure of each truncated protein may differentially change the arrangement of the four components of the γ-secretase complex structure within the bilayer, thus having different effects on different substrates. It has been shown that wild type Psen1 is required for the effects of one of the truncations to be seen [219]. Previous work has suggested that changes to membrane thickness in which γ-secretase complex is localized could interfere in the packing and tilting of its
158 transmembrane domains and might influence the positioning of the substrate cleavage site thereby changing the ratio of Aβ40 to Aβ42 produced [222]. Therefore it could be possible that the truncated forms of Psen1 may also have a similar effect on substrate cleavage. Analysing the three dimensional structure of the γ-secretase complex or holoprotein obtained from the mRNA- injected embryos, using cryo-EM single-particle analysis (as performed in [62]) would be a valid method to observe any differences in structure.
This thesis also gives focus to the ER subcompartment which interacts physically and biochemically with mitochondria, the MAM. We investigated the potential of the zebrafish model as a suitable system in which to study the effects of Psen1 and Psen2 activity on mitochondrion-
ER apposition. Our findings indicate that blocking translation of the Psen proteins using morpholinos in single-cell stage embryos results in no significant change in the distribution of mitochondrion-ER apposition lengths at 24 hours post fertilization. Therefore we could not replicate the observations of increased lengths between ER and mitochondria that were seen in mammalian cells lacking PSEN1 and PSEN2. There are a number of possible reasons for this difference, with the most likely being an inability to reduce Psen activity sufficiently in embryos at the age of 24 hours. The expression of mRNAs of genes encoding the components of the γ- secretase complex are contributed to early embryos maternally [206-208, 223] and their proteins appear be quite stable in the γ-secretase complex [38, 224-226]. The full-length PSENs have a half-life of 1.5 h, but once cleaved their NTF and CTF half-life is approximately 24 h [38].
Therefore it is possible that sufficient zebrafish Psen protein remains at 24 hours to allow normal mitochondrion-ER apposition.
159
Morpholinos reportedly remain effective through 50 hpf in zebrafish embryos [227]. Therefore in order to ensure that negligible or no Psen protein remains at 24 hours, further work will be to repeat the experiment and observe if changes in apposition are observable at a later time in development, such as 50 hpf. Using this later time point would ensure that degradation of any
Psen NTF and CTF present at 24 hpf has already occurred. It would also be interesting to study the effect hypoxia would have on ER-mitochondrial apposition, as hypoxia has been shown to increase expression of zebrafish bace1, psen1, psen2, and the paralogues of human APP, appa and appb [123]. Besides hypoxia, certain chemical compounds (such as the former candidate AD therapeutic drug Latrepirdine) should also be tested to determine if their mechanisms involve modifying the cross-talk between ER and mitochondria via increased or decreased apposition.
The MAM is enriched in various proteins [228] including proteins with links to AD. The MAM contains the other components of the γ-secretase complex, as well as its substrate APP [145]. We have found that the sorting receptor SORL1 is present in the MAM. SORL1 interacts with APP
[111] and either regulates its release from the TGN [112] or assists retrograde transport away from endosomes, reducing Aβ production [113]. SORL1 levels can affect Aβ production [111] as reducing SORL1 consequently increases Aβ levels. The YENPTY domain in APP [229] and the extracellular cluster containing 11 complement-type repeat (CR) domains are important for binding [230], with mutations to these domains resulting in loss of APP-SORL1 complex formation.
160
The discovery of APP in the MAM by Area Gomez et al. [145] along with our discovery of
SORL1 in MAM suggests that the MAM is a potential site of initial contact between these two proteins. If this is the case, it would be interesting to know what effects perturbation of the MAM would have on APP trafficking to the TGN, endocytic pathway and cell surface. Although speculative, if MAM dysfunction leads to less binding of SORL1 to APP, then this might result in increased Aβ production.
The role of autophagy in AD continues to be investigated, but remains unclear. Autophagy influences secretion of Aβ to the extracellular space, directly affecting Aβ plaque formation
[231]. Researchers have suggested that autophagy may be modulated to enhance β-amyloid clearance [232]. Therefore attention has been given to finding an effective and safe method to increase the induction of autophagy and reduce the accumulation of abnormal proteins that cause neuronal dysfunction. In our work we have shown that the antihistamine drug Latrepirdine can induce autophagy in zebrafish larvae. In previous studies, there have been contradictory findings regarding the clinical efficacy of Latrepirdine in patients with AD [233]. Although initially showing clinical benefits in a pilot study [234], later trials did not indicate any benefits in using
Latrepirdine (discussed in [235]). However, our findings in this thesis and work done in yeast have indicated that Latrepirdine induces autophagy [220]. In animal models, Latrepirdine appears to have neuroprotective properties and improves cognition and behaviour [234, 236]. It has also been shown to be involved in mitochondrial function and calcium homeostasis [237]. Further meta-analysis of the combined Latrepirdine trials indicates a potential benefit of Latrepirdine on neuropsychiatric symptoms in AD [233]. Understanding the mechanism for the beneficial use of
Latrepirdine is crucial, and our work indicates that the zebrafish is an advantageous model for the
161 further study of autophagy in AD. It would be interesting to know if Latrepirdine affects MAM function, as intriguingly, the initial site of formation of the autophagosomes is at the MAM [192].
Autophagy modulation as a potential therapy for AD has been gaining interest among researchers. However, autophagy modulation may increase extracellular secretion of Aβ, which in turn could affect plaque formation, although decreasing intracellular Aβ may be beneficial in reducing intracellular toxicity-induced neurodegeneration. Also of concern is the finding by Yu et al. that autophagy partakes in Aβ metabolism [238]. Their study showed that γ-secretase activity, along with PSEN1, NCSTN, APP, βAPP-CTF and Aβ peptides are enriched in autophagic vacuoles (AVs). In a separate study, Tian et al. discovered that the adaptor complex
AP2/PICALM recruits APP-CTF to autophagosomes [239]. Although believed to result in degradation, this movement of APP-CTF to AVs could result in more Aβ production instead.
Therefore the induction of autophagy as a form of treatment must be studied carefully, and would likely require the additional use of Aβ modifying drugs in conjunction.
The MAM as an important factor in both SAD and FAD?
The MAM is important for numerous cellular functions, many of which are dysfunctional in individuals with AD. For instance the MAM is involved in cholesterol metabolism, which is altered in AD [130, 131]. The enzyme acyl-coenzyme A: cholesterol acyltransferase-1 (ACAT1) catalyzes cholesteryl ester (CE) formation from free cholesterol (FC) and maintains their equilibrium, making it important for cholesterol homeostasis (reviewed in [240]). Interestingly the MAM is a platform for the transfer and synthesis of lipids, and is highly enriched in ACAT1
162
[150]. A reduction in CE due to decreased ACAT1 expression leads to a decline in Aβ production, although the mechanistic details of this occurrence are still uncertain [241]. Likewise an increase in CE levels upregulates generation of Aβ, and is due to alteration in the rate of Aβ generation [242]. The activity of the α-, β- and γ-secretases appears to be affected when ACAT1 levels are reduced since Aβ, APP-C99 and also APP-C83 levels were decreased [241]. The link between MAM and the PSENs is that the MAM is a known subcellular location of non-truncated
PRESENILINs [145]. Cholesteryl ester and phospholipid synthesis is elevated in MEFs lacking
PSENs and in FAD and also in SAD patient fibroblasts [158] although the mechanisms remain unclear. This upregulation would likely produce more Aβ. The changes in the profile of Aβ lengths may also be a consequence of changes in the lipid constitution of the MAM itself and not necessarily due to the effect of PSEN mutations on cleavage activity.
Aβ itself appears capable of causing mitochondrial dysfunction. Aβ can be imported into mitochondria using the translocase of the outer membrane (TOM) machinery [243]. Evidence suggests accumulation of Aβ in mitochondria affects bioenergetics, with decreases in ATP production and increased ROS production (reviewed in [244, 245]). Normal aerobic respiration produces ROS by mitochondria during electron transport in the oxidative phosphorylation chain.
Under normal conditions these ROS are mainly sequestered within mitochondria (reviewed in
[246]). However some leakage of ROS does occur and causes damage to the surroundings. The presence of antioxidant mechanisms are meant to reduce the level of damage by sequestering
ROS [247]. However the increased ROS production due to impaired mitochondrial function would reduce their effectiveness and likely cause increased oxidative damage-induced neuronal
163 death. Therefore it is possible that a dysfunction of the MAM could ultimately result in the increased ROS and damaged mitochondria previously observed in AD patients, at least in SAD.
Certain neurodegenerative disorders including AD appear to share the common feature of protein aggregation within the CNS (reviewed in [248]). Metabolic energy is required for proper disulfide bond formation, and a lack of ATP might result in misfolding [249, 250]. Interestingly the MAM is rich in oxidoreductases, and is the site of disulfide bond folding (reviewed in [146]), suggesting that MAM disruption could also be a cause of protein aggregation.
Ca2+ dysregulation has been noted in AD patients (reviewed in [251]). Not surprisingly, the
MAM is the location of several Ca2+ receptors (reviewed in [228]) and plays a role in regulating
Ca2+ release to mitochondria. Interestingly, the zymogen forms of the PSEN proteins act as Ca2+ leak channels in the ER, and FAD mutations appear to interfere with this ability [42]. Several functions of mitochondria are dependent upon Ca2+ levels in the cell. For instance, mitochondrial motility is dependent upon cytosolic concentrations of Ca2+ ([Ca2+]c), as mitochondria are retained at sites of [Ca2+]c elevations [252]. This suggests that a dysfunction of Ca2+ release at the MAM might redirect mitochondria away from areas that require them for energy production, such as the synapses of neurons.
164
One of the important roles of Ca2+ is its role in mitochondrial metabolism (reviewed in [253]).
However, too close an association between mitochondria and MAM could result in toxic mitochondria Ca2+ overload [254], with the activation of apoptotic cell death. Work done by
Area-Gomez et al. has found the number of ER-mitochondrial contacts was increased in MEFs lacking PSENs and in both FAD and SAD patient fibroblasts with increased apposition lengths between ER and mitochondria [158]. Furthermore Aβ exposure increases the number of contact points between ER and mitochondria [255]. In terms of energy requirement, the brain is a high energy organ and is highly dependent on ATP production by mitochondria, which are abundant at synapses of neurons [256], but the AD brain shows deficits in brain metabolism [257], with evidence that dysfunction of mitochondria is a likely cause.
As was mentioned earlier, autophagy is linked to the MAM as it is the initiation site of autophagosome formation. Moreover, PSEN1 also partakes in the pathway, as its presence is required for lysosomal acidification and proteolysis during autophagy [41]. Taken together, it is noticeable that the multitudes of abnormal features observed in AD are the same processes which involve the MAM. Not only are these features observed in SAD, many are also observed in FAD.
Added to this is the fact that the FAD-related proteins, PSEN1 and PSEN2 are enriched in the
MAM, and that other risk proteins such as the SAD-associated SORL1 are also localized there. It is becoming more apparent that the MAM plays a central role in AD pathogenesis, and that the work done thus far regarding MAM has given us some small insight into how AD symptoms are linked together. Many of the pathways that MAM plays a role in (autophagy, Ca2+, lipid and cholesterol dysregulation, mitochondrial damage and energy deficiency, protein misfolding) are interconnected such that disruption to one of the MAM’s functions has the potency to result in
165 the disturbance of the MAM’s other tasks. It is likely this cycle of interference within various cellular pathways ultimately culminates in neuronal cell loss and death. How the mutations in the
PSENs affect MAM-mitochondrial apposition remains unclear, but it is hoped that the future work to validate the use of the zebrafish animal model as a useful model in studying apposition will reveal its successful use to further studying the link between MAM and the PSENs.
In summary, AD is a complex disease with numerous genetic and environmental influences. To fully understand the mechanisms of AD pathogenesis, it is important to identify the subcellular localization of proteins implicated in AD. The discovery of the MAM as a significant site of enrichment of the PRESENILINS and other AD-risk related proteins such as SORL1, as well as its role in features known to be perturbed in AD will likely have a large impact on our understanding of AD pathogenesis.
166
REFERENCES
1. Alzheimer's, A., 2010 Alzheimer's disease facts and figures. Alzheimers Dement, 2010. 6(2): p. 158-94. 2. Ferri, C.P., et al., Global prevalence of dementia: a Delphi consensus study. Lancet, 2005. 366(9503): p. 2112-7. 3. Voisin, T. and B. Vellas, Diagnosis and treatment of patients with severe Alzheimer's disease. Drugs & aging, 2009. 26(2): p. 135-44. 4. Grundke-Iqbal, I., et al., Abnormal phosphorylation of the microtubule-associated protein tau (tau) in Alzheimer cytoskeletal pathology. Proceedings of the National Academy of Sciences of the United States of America, 1986. 83(13): p. 4913-4917. 5. Pettegrew, J.W., et al., Brain membrane phospholipid alterations in Alzheimer's disease. Neurochemical research, 2001. 26(7): p. 771-82. 6. Bezprozvanny, I. and M.P. Mattson, Neuronal calcium mishandling and the pathogenesis of Alzheimer's disease. Trends in neurosciences, 2008. 31(9): p. 454-63. 7. Muirhead, K.E., et al., The consequences of mitochondrial amyloid beta-peptide in Alzheimer's disease. The Biochemical journal, 2010. 426(3): p. 255-70. 8. Bekris, L.M., et al., Genetics of Alzheimer disease. Journal of geriatric psychiatry and neurology, 2010. 23(4): p. 213-27. 9. Campion, D., et al., Early-onset autosomal dominant Alzheimer disease: prevalence, genetic heterogeneity, and mutation spectrum. American journal of human genetics, 1999. 65(3): p. 664-670. 10. Hardy, J.A. and G.A. Higgins, Alzheimer's disease: the amyloid cascade hypothesis. Science, 1992. 256(5054): p. 184-5. 11. Axelsen, P.H., H. Komatsu, and I.V.J. Murray, Oxidative Stress and Cell Membranes in the Pathogenesis of Alzheimer's Disease. Physiology, 2011. 26(1): p. 54-69. 12. Pratico, D., et al., Increased lipid peroxidation precedes amyloid plaque formation in an animal model of Alzheimer amyloidosis. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2001. 21(12): p. 4183-7. 13. Hensley, K., et al., Brain regional correspondence between Alzheimer's disease histopathology and biomarkers of protein oxidation. Journal of neurochemistry, 1995. 65(5): p. 2146-56. 14. Jeandel, C., et al., Lipid peroxidation and free radical scavengers in Alzheimer's disease. Gerontology, 1989. 35(5-6): p. 275-82. 15. Zaman, Z., et al., Plasma concentrations of vitamins A and E and carotenoids in Alzheimer's disease. Age Ageing, 1992. 21(2): p. 91-4. 16. Kontush, A., N. Donarski, and U. Beisiegel, Resistance of human cerebrospinal fluid to in vitro oxidation is directly related to its amyloid-beta content. Free radical research, 2001. 35(5): p. 507-17. 17. Zou, K., et al., A novel function of monomeric amyloid beta-protein serving as an antioxidant molecule against metal-induced oxidative damage. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2002. 22(12): p. 4833-41. 18. Dineley, K.T., et al., Beta-amyloid activates the mitogen-activated protein kinase cascade via hippocampal alpha7 nicotinic acetylcholine receptors: In vitro and in vivo mechanisms related
167
to Alzheimer's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2001. 21(12): p. 4125-33. 19. Wang, Q., et al., Block of long-term potentiation by naturally secreted and synthetic amyloid beta-peptide in hippocampal slices is mediated via activation of the kinases c-Jun N-terminal kinase, cyclin-dependent kinase 5, and p38 mitogen-activated protein kinase as well as metabotropic glutamate receptor type 5. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2004. 24(13): p. 3370-8. 20. Huang, H.M. and G.E. Gibson, Altered beta-adrenergic receptor-stimulated cAMP formation in cultured skin fibroblasts from Alzheimer donors. Journal of Biological Chemistry, 1993. 268(20): p. 14616-14621. 21. Townsend, M., T. Mehta, and D.J. Selkoe, Soluble Abeta inhibits specific signal transduction cascades common to the insulin receptor pathway. The Journal of biological chemistry, 2007. 282(46): p. 33305-12. 22. Dovey, H.F., et al., Cells with a familial Alzheimer's disease mutation produce authentic beta- peptide. Neuroreport, 1993. 4(8): p. 1039-42. 23. Asami-Odaka, A., et al., Long amyloid beta-protein secreted from wild-type human neuroblastoma IMR-32 cells. Biochemistry, 1995. 34(32): p. 10272-8. 24. Thinakaran, G. and E.H. Koo, Amyloid precursor protein trafficking, processing, and function. The Journal of biological chemistry, 2008. 283(44): p. 29615-9. 25. Krishnaswamy, S., et al., The structure and function of Alzheimer's gamma secretase enzyme complex. Critical reviews in clinical laboratory sciences, 2009. 46(5-6): p. 282-301. 26. Schroeter, E.H., J.A. Kisslinger, and R. Kopan, Notch-1 signalling requires ligand-induced proteolytic release of intracellular domain. Nature, 1998. 393(6683): p. 382-6. 27. Artavanis-Tsakonas, S., K. Matsuno, and M.E. Fortini, Notch signaling. Science, 1995. 268(5208): p. 225-32. 28. Struhl, G. and I. Greenwald, Presenilin-mediated transmembrane cleavage is required for Notch signal transduction in Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 2001. 98(1): p. 229-34. 29. Hemming, M.L., et al., Proteomic profiling of gamma-secretase substrates and mapping of substrate requirements. PLoS Biol, 2008. 6(10): p. e257. 30. Haapasalo, A. and D.M. Kovacs, The many substrates of presenilin/gamma-secretase. Journal of Alzheimer's disease : JAD, 2011. 25(1): p. 3-28. 31. McCarthy, J.V., C. Twomey, and P. Wujek, Presenilin-dependent regulated intramembrane proteolysis and gamma-secretase activity. Cellular and molecular life sciences : CMLS, 2009. 66(9): p. 1534-55. 32. Sato, T., et al., Active gamma-secretase complexes contain only one of each component. Journal of Biological Chemistry, 2007. 282(47): p. 33985-33993. 33. Levy-Lahad, E., et al., Candidate gene for the chromosome 1 familial Alzheimer's disease locus. Science, 1995. 269(5226): p. 973-7. 34. De Jonghe, C., et al., Aberrant splicing in the presenilin-1 intron 4 mutation causes presenile Alzheimer's disease by increased Abeta42 secretion. Human molecular genetics, 1999. 8(8): p. 1529-40. 35. Laudon, H., et al., A nine-transmembrane domain topology for presenilin 1. The Journal of biological chemistry, 2005. 280(42): p. 35352-60. 36. Fukumori, A., et al., Three-Amino Acid Spacing of Presenilin Endoproteolysis Suggests a General Stepwise Cleavage of gamma-Secretase-Mediated Intramembrane Proteolysis. Journal of Neuroscience, 2010. 30(23): p. 7853-7862.
168
37. Mann, D.M., et al., Cases of Alzheimer's disease due to deletion of exon 9 of the presenilin-1 gene show an unusual but characteristic beta-amyloid pathology known as 'cotton wool' plaques. Neuropathology and applied neurobiology, 2001. 27(3): p. 189-96. 38. Ratovitski, T., et al., Endoproteolytic processing and stabilization of wild-type and mutant presenilin. The Journal of biological chemistry, 1997. 272(39): p. 24536-41. 39. Wolfe, M.S., et al., Two transmembrane aspartates in presenilin-1 required for presenilin endoproteolysis and gamma-secretase activity. Nature, 1999. 398(6727): p. 513-7. 40. Kimberly, W.T., et al., The transmembrane aspartates in presenilin 1 and 2 are obligatory for gamma-secretase activity and amyloid beta-protein generation. The Journal of biological chemistry, 2000. 275(5): p. 3173-8. 41. Lee, J.H., et al., Lysosomal proteolysis and autophagy require presenilin 1 and are disrupted by Alzheimer-related PS1 mutations. Cell, 2010. 141(7): p. 1146-58. 42. Tu, H., et al., Presenilins form ER Ca2+ leak channels, a function disrupted by familial Alzheimer's disease-linked mutations. Cell, 2006. 126(5): p. 981-93. 43. Zhang, H., et al., Role of presenilins in neuronal calcium homeostasis. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2010. 30(25): p. 8566-80. 44. Yu, G., et al., Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing. Nature, 2000. 407(6800): p. 48-54. 45. Yang, D.S., et al., Mature glycosylation and trafficking of nicastrin modulate its binding to presenilins. The Journal of biological chemistry, 2002. 277(31): p. 28135-42. 46. Chavez-Gutierrez, L., et al., Glu(332) in the Nicastrin ectodomain is essential for gamma- secretase complex maturation but not for its activity. The Journal of biological chemistry, 2008. 283(29): p. 20096-105. 47. Zhao, G., et al., Gamma-secretase composed of PS1/Pen2/Aph1a can cleave notch and amyloid precursor protein in the absence of nicastrin. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2010. 30(5): p. 1648-56. 48. Futai, E., S. Yagishita, and S. Ishiura, Nicastrin Is Dispensable for γ-Secretase Protease Activity in the Presence of Specific Presenilin Mutations. The Journal of biological chemistry, 2009. 284(19): p. 13013-13022. 49. Shah, S., et al., Nicastrin functions as a gamma-secretase-substrate receptor. Cell, 2005. 122(3): p. 435-47. 50. Zhang, X., et al., Identification of a tetratricopeptide repeat-like domain in the nicastrin subunit of gamma-secretase using synthetic antibodies. Proceedings of the National Academy of Sciences of the United States of America, 2012. 109(22): p. 8534-9. 51. Xie, T., et al., Crystal structure of the gamma-secretase component nicastrin. Proceedings of the National Academy of Sciences of the United States of America, 2014. 111(37): p. 13349-54. 52. Fortna, R.R., et al., Membrane topology and nicastrin-enhanced endoproteolysis of APH-1, a component of the gamma-secretase complex. The Journal of biological chemistry, 2004. 279(5): p. 3685-93. 53. Shirotani, K., et al., Identification of distinct gamma-secretase complexes with different APH-1 variants. The Journal of biological chemistry, 2004. 279(40): p. 41340-5. 54. Serneels, L., et al., Differential contribution of the three Aph1 genes to gamma-secretase activity in vivo. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(5): p. 1719-24. 55. Ma, G., et al., APH-1a is the principal mammalian APH-1 isoform present in gamma-secretase complexes during embryonic development. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2005. 25(1): p. 192-8.
169
56. Capell, A., et al., Gamma-secretase complex assembly within the early secretory pathway. The Journal of biological chemistry, 2005. 280(8): p. 6471-8. 57. Crystal, A.S., et al., Membrane topology of gamma-secretase component PEN-2. The Journal of biological chemistry, 2003. 278(22): p. 20117-23. 58. Luo, W.J., et al., PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1. The Journal of biological chemistry, 2003. 278(10): p. 7850-4. 59. Prokop, S., et al., Requirement of PEN-2 for stabilization of the presenilin N-/C-terminal fragment heterodimer within the gamma-secretase complex. The Journal of biological chemistry, 2004. 279(22): p. 23255-61. 60. Steiner, H., E. Winkler, and C. Haass, Chemical cross-linking provides a model of the gamma- secretase complex subunit architecture and evidence for close proximity of the C-terminal fragment of presenilin with APH-1. The Journal of biological chemistry, 2008. 283(50): p. 34677-86. 61. Kaether, C., et al., The presenilin C-terminus is required for ER-retention, nicastrin-binding and gamma-secretase activity. The EMBO journal, 2004. 23(24): p. 4738-48. 62. Lu, P., et al., Three-dimensional structure of human gamma-secretase. Nature, 2014. 512(7513): p. 166-70. 63. Li, X., et al., Structure of a presenilin family intramembrane aspartate protease. Nature, 2013. 493(7430): p. 56-61. 64. De Strooper, B. and W. Annaert, Novel research horizons for presenilins and gamma-secretases in cell biology and disease. Annual review of cell and developmental biology, 2010. 26: p. 235- 60. 65. Goate, A., et al., Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer's disease. Nature, 1991. 349(6311): p. 704-6. 66. Sherrington, R., et al., Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease. Nature, 1995. 375(6534): p. 754-60. 67. Dermaut, B., et al., A novel presenilin 1 mutation associated with Pick's disease but not beta- amyloid plaques. Annals of neurology, 2004. 55(5): p. 617-26. 68. Li, D.X., et al., Mutations of presenilin genes in dilated cardiomyopathy and heart failure. American journal of human genetics, 2006. 79(6): p. 1030-1039. 69. Fitzsimmons, J.S. and P.R. Guilbert, A family study of hidradenitis suppurativa. Journal of medical genetics, 1985. 22(5): p. 367-73. 70. De Jonghe, C., et al., Pathogenic APP mutations near the γ-secretase cleavage site differentially affect Aβ secretion and APP C-terminal fragment stability. Human molecular genetics, 2001. 10(16): p. 1665-1671. 71. Nornes, S., et al., Interference with splicing of Presenilin transcripts has potent dominant negative effects on Presenilin activity. Human molecular genetics, 2008. 17(3): p. 402-12. 72. Kwok, J.B., et al., Presenilin-1 mutation L271V results in altered exon 8 splicing and Alzheimer's disease with non-cored plaques and no neuritic dystrophy. The Journal of biological chemistry, 2003. 278(9): p. 6748-54. 73. Perez-Tur, J., et al., A mutation in Alzheimer's disease destroying a splice acceptor site in the presenilin-1 gene. Neuroreport, 1995. 7(1): p. 297-301. 74. Hiltunen, M., et al., Identification of a novel 4.6-kb genomic deletion in presenilin-1 gene which results in exclusion of exon 9 in a Finnish early onset Alzheimer's disease family: an Alu core sequence-stimulated recombination? European journal of human genetics : EJHG, 2000. 8(4): p. 259-66. 75. Seelaar, H., et al., Clinical, genetic and pathological heterogeneity of frontotemporal dementia: a review. Journal of neurology, neurosurgery, and psychiatry, 2011. 82(5): p. 476-86.
170
76. Wang, B., et al., Gamma-secretase gene mutations in familial acne inversa. Science, 2010. 330(6007): p. 1065. 77. Corey, D.R. and J.M. Abrams, Morpholino antisense oligonucleotides: tools for investigating vertebrate development. Genome biology, 2001. 2(5): p. REVIEWS1015. 78. Nornes, S., et al., Independent and cooperative action of Psen2 with Psen1 in zebrafish embryos. Experimental cell research, 2009. 315(16): p. 2791-801. 79. Rechards, M., et al., Presenilin-1 exists in both pre- and post-Golgi compartments and recycles via COPI-coated membranes. Traffic, 2003. 4(8): p. 553-65. 80. Tarassishin, L., et al., Processing of Notch and amyloid precursor protein by gamma-secretase is spatially distinct. Proceedings of the National Academy of Sciences of the United States of America, 2004. 101(49): p. 17050-5. 81. Kopan, R. and M.X. Ilagan, The canonical Notch signaling pathway: unfolding the activation mechanism. Cell, 2009. 137(2): p. 216-33. 82. Heyman, A., et al., Alzheimer's disease: A study of epidemiological aspects. Annals of neurology, 1984. 15(4): p. 335-341. 83. Heston, L.L., et al., Dementia of the alzheimer type: Clinical genetics, natural history, and associated conditions. Archives of general psychiatry, 1981. 38(10): p. 1085-1090. 84. Merched, A., et al., Decreased high-density lipoprotein cholesterol and serum apolipoprotein AI concentrations are highly correlated with the severity of Alzheimer's disease. Neurobiology of aging, 2000. 21(1): p. 27-30. 85. Kuo, Y.M., et al., Elevated low-density lipoprotein in Alzheimer's disease correlates with brain abeta 1-42 levels. Biochemical and biophysical research communications, 1998. 252(3): p. 711- 5. 86. Gustafson, D., et al., An 18-year follow-up of overweight and risk of Alzheimer disease. Archives of internal medicine, 2003. 163(13): p. 1524-8. 87. Luchsinger, J.A., et al., Diabetes mellitus and risk of Alzheimer's disease and dementia with stroke in a multiethnic cohort. American journal of epidemiology, 2001. 154(7): p. 635-41. 88. Reed, B., et al., Associations between serum cholesterol levels and cerebral amyloidosis. JAMA Neurol, 2014. 71(2): p. 195-200. 89. Refolo, L.M., et al., Hypercholesterolemia accelerates the Alzheimer's amyloid pathology in a transgenic mouse model. Neurobiology of disease, 2000. 7(4): p. 321-31. 90. Shie, F.S., et al., Diet-induced hypercholesterolemia enhances brain A beta accumulation in transgenic mice. Neuroreport, 2002. 13(4): p. 455-9. 91. Sparks, D.L., et al., Alterations of Alzheimer's disease in the cholesterol-fed rabbit, including vascular inflammation. Preliminary observations. Annals of the New York Academy of Sciences, 2000. 903: p. 335-44. 92. Craft, S., The role of metabolic disorders in Alzheimer disease and vascular dementia: two roads converged. Archives of neurology, 2009. 66(3): p. 300-5. 93. Sridhar, G.R., G. Lakshmi, and G. Nagamani, Emerging links between type 2 diabetes and Alzheimer’s disease. World Journal of Diabetes, 2015. 6(5): p. 744-751. 94. Kawamura, T., T. Umemura, and N. Hotta, Cognitive impairment in diabetic patients: Can diabetic control prevent cognitive decline? Journal of Diabetes Investigation, 2012. 3(5): p. 413- 423. 95. Qiu, W.Q., et al., Insulin-degrading enzyme regulates extracellular levels of amyloid beta- protein by degradation. The Journal of biological chemistry, 1998. 273(49): p. 32730-8. 96. Poole, S., et al., Determining the presence of periodontopathic virulence factors in short-term postmortem Alzheimer's disease brain tissue. Journal of Alzheimer's disease : JAD, 2013. 36(4): p. 665-77.
171
97. Ayton, S., et al., Ferritin levels in the cerebrospinal fluid predict Alzheimer/'s disease outcomes and are regulated by APOE. Nat Commun, 2015. 6. 98. Suwalsky, M., et al., Effects of Al(III) speciation on cell membranes and molecular models. Coordination Chemistry Reviews, 2002. 228(2): p. 285-295. 99. Harold, D., et al., Genome-wide association study identifies variants at CLU and PICALM associated with Alzheimer's disease. Nature genetics, 2009. 41(10): p. 1088-U61. 100. Strittmatter, W.J., et al., Apolipoprotein E: high-avidity binding to beta-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proceedings of the National Academy of Sciences of the United States of America, 1993. 90(5): p. 1977-81. 101. Bjorkhem, I. and S. Meaney, Brain cholesterol: long secret life behind a barrier. Arteriosclerosis, thrombosis, and vascular biology, 2004. 24(5): p. 806-15. 102. Castellano, J.M., et al., Human apoE isoforms differentially regulate brain amyloid-beta peptide clearance. Science translational medicine, 2011. 3(89): p. 89ra57. 103. Holtzman, D.M., et al., Apolipoprotein E isoform-dependent amyloid deposition and neuritic degeneration in a mouse model of Alzheimer's disease. Proceedings of the National Academy of Sciences of the United States of America, 2000. 97(6): p. 2892-2897. 104. Hollingworth, P., et al., Alzheimer's disease genetics: current knowledge and future challenges. International Journal of Geriatric Psychiatry, 2011. 26(8): p. 793-802. 105. Martins, I.J., et al., Apolipoprotein E, cholesterol metabolism, diabetes, and the convergence of risk factors for Alzheimer's disease and cardiovascular disease. Molecular psychiatry, 2006. 11(8): p. 721-36. 106. Meng, Y., et al., Association between SORL1 and Alzheimer's disease in a genome-wide study. Neuroreport, 2007. 18(17): p. 1761-4. 107. Miyashita, A., et al., SORL1 is genetically associated with late-onset Alzheimer's disease in Japanese, Koreans and Caucasians. PloS one, 2013. 8(4): p. e58618. 108. Wen, Y., et al., SORL1 is genetically associated with neuropathologically characterized late- onset Alzheimer's disease. Journal of Alzheimer's disease : JAD, 2013. 35(2): p. 387-94. 109. Motoi, Y., et al., Neuronal localization of a novel mosaic apolipoprotein E receptor, LR11, in rat and human brain. Brain research, 1999. 833(2): p. 209-15. 110. Jacobsen, L., et al., Activation and functional characterization of the mosaic receptor SorLA/LR11. The Journal of biological chemistry, 2001. 276(25): p. 22788-96. 111. Andersen, O.M., et al., Neuronal sorting protein-related receptor sorLA/LR11 regulates processing of the amyloid precursor protein. Proceedings of the National Academy of Sciences of the United States of America, 2005. 102(38): p. 13461-13466. 112. Schmidt, V., et al., SorLA/LR11 Regulates Processing of Amyloid Precursor Protein via Interaction with Adaptors GGA and PACS-1. Journal of Biological Chemistry, 2007. 282(45): p. 32956-32964. 113. Lane, R.F., et al., Protein kinase C and rho activated coiled coil protein kinase 2 (ROCK2) modulate Alzheimer's APP metabolism and phosphorylation of the Vps10-domain protein, SorL1. Molecular neurodegeneration, 2010. 5: p. 62. 114. Scherzer, C.R., et al., Loss of apolipoprotein E receptor LR11 in Alzheimer disease. Archives of neurology, 2004. 61(8): p. 1200-5. 115. Sager, K.L., et al., Neuronal LR11/sorLA expression is reduced in mild cognitive impairment. Annals of neurology, 2007. 62(6): p. 640-7. 116. Zhu, X., et al., Vascular oxidative stress in Alzheimer disease. Journal of the neurological sciences, 2007. 257(1-2): p. 240-6.
172
117. Gama Sosa, M.A., et al., Age-Related Vascular Pathology in Transgenic Mice Expressing Presenilin 1-Associated Familial Alzheimer's Disease Mutations. The American journal of pathology, 2010. 176(1): p. 353-368. 118. Zhang, X., et al., Hypoxia-inducible factor 1alpha (HIF-1alpha)-mediated hypoxia increases BACE1 expression and beta-amyloid generation. The Journal of biological chemistry, 2007. 282(15): p. 10873-80. 119. Mohuczy, D., K. Qian, and M.I. Phillips, Presenilins in the heart: presenilin-2 expression is increased by low glucose and by hypoxia in cardiac cells. Regulatory peptides, 2002. 110(1): p. 1-7. 120. Tamagno, E., et al., Oxidative stress activates a positive feedback between the γ- and β- secretase cleavages of the β-amyloid precursor protein. Journal of neurochemistry, 2008. 104(3): p. 683-695. 121. Manabe, T., et al., HMGA1a: sequence-specific RNA-binding factor causing sporadic Alzheimer's disease-linked exon skipping of presenilin-2 pre-mRNA. Genes to cells : devoted to molecular & cellular mechanisms, 2007. 12(10): p. 1179-91. 122. Moussavi Nik, S.H., M. Newman, and M. Lardelli, The response of HMGA1 to changes in oxygen availability is evolutionarily conserved. Experimental cell research, 2011. 317(11): p. 1503-12. 123. Moussavi Nik, S.H., et al., The BACE1-PSEN-AbetaPP regulatory axis has an ancient role in response to low oxygen/oxidative stress. Journal of Alzheimer's disease : JAD, 2012. 28(3): p. 515-30. 124. Klunk, W.E., et al., Imaging brain amyloid in Alzheimer's disease with Pittsburgh Compound-B. Annals of neurology, 2004. 55(3): p. 306-319. 125. Fleisher, A.S., et al., USing positron emission tomography and florbetapir f 18 to image cortical amyloid in patients with mild cognitive impairment or dementia due to alzheimer disease. Archives of neurology, 2011. 68(11): p. 1404-1411. 126. Morris, G.P., I.A. Clark, and B. Vissel, Inconsistencies and controversies surrounding the amyloid hypothesis of Alzheimer's disease. Acta Neuropathol Commun, 2014. 2: p. 135. 127. Balasubramanian, A.B., et al., Alzheimer disease pathology and longitudinal cognitive performance in the oldest-old with no dementia. Neurology, 2012. 79(9): p. 915-921. 128. Price, J.L., et al., Neuropathology of nondemented aging: Presumptive evidence for preclinical Alzheimer disease. Neurobiology of aging, 2009. 30(7): p. 1026-1036. 129. Zigman, W.B., et al., Alzheimer’s Disease in Adults with Down Syndrome. International review of research in mental retardation, 2008. 36: p. 103-145. 130. Pappolla, M.A., et al., Mild hypercholesterolemia is an early risk factor for the development of Alzheimer amyloid pathology. Neurology, 2003. 61(2): p. 199-205. 131. Solomon, A., et al., Midlife Serum Cholesterol and Increased Risk of Alzheimer's and Vascular Dementia Three Decades Later. Dementia and geriatric cognitive disorders, 2009. 28(1): p. 75- 80. 132. Berridge, M.J., Calcium hypothesis of Alzheimer's disease. Pflugers Archiv : European journal of physiology, 2010. 459(3): p. 441-9. 133. Swerdlow, R.H., J.M. Burns, and S.M. Khan, The Alzheimer's disease mitochondrial cascade hypothesis. Journal of Alzheimer's disease : JAD, 2010. 20 Suppl 2: p. S265-79. 134. Gong, C.X., et al., Impaired brain glucose metabolism leads to Alzheimer neurofibrillary degeneration through a decrease in tau O-GlcNAcylation. Journal of Alzheimer's disease : JAD, 2006. 9(1): p. 1-12. 135. Ringheim, G.E. and A.M. Szczepanik, Brain inflammation, cholesterol, and glutamate as interconnected participants in the pathology of Alzheimer's disease. Current pharmaceutical design, 2006. 12(6): p. 719-38.
173
136. Takashima, A., et al., Presenilin 1 associates with glycogen synthase kinase-3beta and its substrate tau. Proceedings of the National Academy of Sciences of the United States of America, 1998. 95(16): p. 9637-41. 137. Pasternak, S.H., Presenilin-1, Nicastrin, Amyloid Precursor Protein, and -Secretase Activity Are Co-localized in the Lysosomal Membrane. Journal of Biological Chemistry, 2003. 278(29): p. 26687-26694. 138. Huse, J.T., et al., Maturation and Endosomal Targeting of β-Site Amyloid Precursor Protein- cleaving Enzyme. Journal of Biological Chemistry, 2000. 275(43): p. 33729-33737. 139. Koo, E.H. and S.L. Squazzo, Evidence that production and release of amyloid beta-protein involves the endocytic pathway. The Journal of biological chemistry, 1994. 269(26): p. 17386-9. 140. Huse, J.T., et al., Beta-secretase processing in the trans-Golgi network preferentially generates truncated amyloid species that accumulate in Alzheimer's disease brain. The Journal of biological chemistry, 2002. 277(18): p. 16278-84. 141. Annaert, W.G., et al., Presenilin 1 controls gamma-secretase processing of amyloid precursor protein in pre-golgi compartments of hippocampal neurons. The Journal of cell biology, 1999. 147(2): p. 277-94. 142. Vetrivel, K.S., et al., Association of gamma-secretase with lipid rafts in post-Golgi and endosome membranes. The Journal of biological chemistry, 2004. 279(43): p. 44945-54. 143. Ankarcrona, M. and K. Hultenby, Presenilin-1 is located in rat mitochondria. Biochemical and biophysical research communications, 2002. 295(3): p. 766-70. 144. Li, J., et al., Alzheimer presenilins in the nuclear membrane, interphase kinetochores, and centrosomes suggest a role in chromosome segregation. Cell, 1997. 90(5): p. 917-27. 145. Area-Gomez, E., et al., Presenilins are enriched in endoplasmic reticulum membranes associated with mitochondria. The American journal of pathology, 2009. 175(5): p. 1810-6. 146. Simmen, T., et al., Oxidative protein folding in the endoplasmic reticulum: Tight links to the mitochondria-associated membrane (MAM). Biochimica Et Biophysica Acta-Biomembranes, 2010. 1798(8): p. 1465-1473. 147. Hayashi, T., et al., MAM: more than just a housekeeper. Trends in cell biology, 2009. 19(2): p. 81-8. 148. Stone, S.J. and J.E. Vance, Phosphatidylserine Synthase-1 and -2 Are Localized to Mitochondria- associated Membranes. Journal of Biological Chemistry, 2000. 275(44): p. 34534-34540. 149. Zborowski, J., A. Dygas, and L. Wojtczak, Phosphatidylserine decarboxylase is located on the external side of the inner mitochondrial membrane. FEBS letters, 1983. 157(1): p. 179-82. 150. Rusinol, A.E., et al., A unique mitochondria-associated membrane fraction from rat liver has a high capacity for lipid synthesis and contains pre-Golgi secretory proteins including nascent lipoproteins. The Journal of biological chemistry, 1994. 269(44): p. 27494-502. 151. Benham, A.M., et al., The CXXCXXC motif determines the folding, structure and stability of human Ero1-Lalpha. The EMBO journal, 2000. 19(17): p. 4493-502. 152. Mezghrani, A., et al., Manipulation of oxidative protein folding and PDI redox state in mammalian cells. The EMBO journal, 2001. 20(22): p. 6288-6296. 153. Frand, A.R. and C.A. Kaiser, Ero1p oxidizes protein disulfide isomerase in a pathway for disulfide bond formation in the endoplasmic reticulum. Molecular cell, 1999. 4(4): p. 469-77. 154. Vance, J.E., PHOSPHOLIPID-SYNTHESIS IN A MEMBRANE-FRACTION ASSOCIATED WITH MITOCHONDRIA. Journal of Biological Chemistry, 1990. 265(13): p. 7248-7256. 155. Schon, E.A. and E. Area-Gomez, Is Alzheimer's disease a disorder of mitochondria-associated membranes? Journal of Alzheimer's disease : JAD, 2010. 20 Suppl 2: p. S281-92. 156. Lustbader, J.W., et al., ABAD directly links Abeta to mitochondrial toxicity in Alzheimer's disease. Science, 2004. 304(5669): p. 448-52.
174
157. Zhu, X., et al., Mitochondrial failures in Alzheimer's disease. American journal of Alzheimer's disease and other dementias, 2004. 19(6): p. 345-52. 158. Area-Gomez, E., et al., Upregulated function of mitochondria-associated ER membranes in Alzheimer disease. The EMBO journal, 2012. 31(21): p. 4106-23. 159. He, C. and D.J. Klionsky, Regulation mechanisms and signaling pathways of autophagy. Annu Rev Genet, 2009. 43: p. 67-93. 160. Nakagawa, I., et al., Autophagy defends cells against invading group A Streptococcus. Science, 2004. 306(5698): p. 1037-40. 161. Gutierrez, M.G., et al., Autophagy is a defense mechanism inhibiting BCG and Mycobacterium tuberculosis survival in infected macrophages. Cell, 2004. 119(6): p. 753-66. 162. Li, W.W., J. Li, and J.K. Bao, Microautophagy: lesser-known self-eating. Cellular and molecular life sciences : CMLS, 2012. 69(7): p. 1125-36. 163. Fred Dice, J., Peptide sequences that target cytosolic proteins for lysosomal proteolysis. Trends in biochemical sciences, 1990. 15(8): p. 305-309. 164. Majeski, A.E. and J. Fred Dice, Mechanisms of chaperone-mediated autophagy. The International Journal of Biochemistry & Cell Biology, 2004. 36(12): p. 2435-2444. 165. Shang, L. and X. Wang, AMPK and mTOR coordinate the regulation of Ulk1 and mammalian autophagy initiation. Autophagy, 2011. 7(8): p. 924-6. 166. Di Bartolomeo, S., et al., The dynamic interaction of AMBRA1 with the dynein motor complex regulates mammalian autophagy. The Journal of cell biology, 2010. 191(1): p. 155-68. 167. Polson, H.E., et al., Mammalian Atg18 (WIPI2) localizes to omegasome-anchored phagophores and positively regulates LC3 lipidation. Autophagy, 2010. 6(4): p. 506-22. 168. Obara, K., et al., The Atg18-Atg2 Complex Is Recruited to Autophagic Membranes via Phosphatidylinositol 3-Phosphate and Exerts an Essential Function. The Journal of biological chemistry, 2008. 283(35): p. 23972-23980. 169. Zhong, Y., et al., Distinct regulation of autophagic activity by Atg14L and Rubicon associated with Beclin 1-phosphatidylinositol-3-kinase complex. Nature cell biology, 2009. 11(4): p. 468- 76. 170. Matsunaga, K., et al., Two Beclin 1-binding proteins, Atg14L and Rubicon, reciprocally regulate autophagy at different stages. Nature cell biology, 2009. 11(4): p. 385-96. 171. Liang, C., et al., Autophagic and tumour suppressor activity of a novel Beclin1-binding protein UVRAG. Nature cell biology, 2006. 8(7): p. 688-99. 172. Takahashi, Y., et al., Bif-1 interacts with Beclin 1 through UVRAG and regulates autophagy and tumorigenesis. Nature cell biology, 2007. 9(10): p. 1142-51. 173. Takahashi, Y., C.L. Meyerkord, and H.G. Wang, Bif-1/endophilin B1: a candidate for crescent driving force in autophagy. Cell death and differentiation, 2009. 16(7): p. 947-55. 174. Yang, Z. and D.J. Klionsky, Mammalian autophagy: core molecular machinery and signaling regulation. Current opinion in cell biology, 2010. 22(2): p. 124-131. 175. Yang, Z. and D.J. Klionsky, An Overview of the Molecular Mechanism of Autophagy. Current topics in microbiology and immunology, 2009. 335: p. 1-32. 176. Kabeya, Y., et al., LC3, a mammalian homologue of yeast Apg8p, is localized in autophagosome membranes after processing. The EMBO journal, 2000. 19(21): p. 5720-8. 177. Kirisako, T., et al., The reversible modification regulates the membrane-binding state of Apg8/Aut7 essential for autophagy and the cytoplasm to vacuole targeting pathway. The Journal of cell biology, 2000. 151(2): p. 263-76. 178. Tanida, I., Autophagy basics. Microbiol Immunol, 2011. 55(1): p. 1-11. 179. Burman, C. and N. Ktistakis, Autophagosome formation in mammalian cells. Seminars in Immunopathology, 2010. 32(4): p. 397-413.
175
180. Gutierrez, M.G., et al., Rab7 is required for the normal progression of the autophagic pathway in mammalian cells. Journal of cell science, 2004. 117(Pt 13): p. 2687-97. 181. Jager, S., et al., Role for Rab7 in maturation of late autophagic vacuoles. Journal of cell science, 2004. 117(Pt 20): p. 4837-48. 182. Tanida, I., et al., HsAtg4B/HsApg4B/autophagin-1 cleaves the carboxyl termini of three human Atg8 homologues and delipidates microtubule-associated protein light chain 3- and GABAA receptor-associated protein-phospholipid conjugates. The Journal of biological chemistry, 2004. 279(35): p. 36268-76. 183. Pankiv, S., et al., FYCO1 is a Rab7 effector that binds to LC3 and PI3P to mediate microtubule plus end-directed vesicle transport. The Journal of cell biology, 2010. 188(2): p. 253-69. 184. Nixon, R.A., et al., Extensive involvement of autophagy in Alzheimer disease: An immuno- electron microscopy study. Journal of neuropathology and experimental neurology, 2005. 64(2): p. 113-122. 185. Boland, B., et al., Autophagy induction and autophagosome clearance in neurons: relationship to autophagic pathology in Alzheimer's disease. The Journal of neuroscience : the official journal of the Society for Neuroscience, 2008. 28(27): p. 6926-37. 186. Nixon, R.A. and D.-S. Yang, Autophagy failure in Alzheimer's disease—locating the primary defect. Neurobiology of disease, 2011. 43(1): p. 38-45. 187. Hara, T., et al., Suppression of basal autophagy in neural cells causes neurodegenerative disease in mice. Nature, 2006. 441(7095): p. 885-9. 188. Pickford, F., et al., The autophagy-related protein beclin 1 shows reduced expression in early Alzheimer disease and regulates amyloid β accumulation in mice. The Journal of clinical investigation, 2008. 118(6): p. 2190-2199. 189. Ravikumar, B., et al., Plasma membrane contributes to the formation of pre-autophagosomal structures. Nature cell biology, 2010. 12(8): p. 747-757. 190. Hailey, D.W., et al., Mitochondria Supply Membranes for Autophagosome Biogenesis during Starvation. Cell, 2010. 141(4): p. 656-667. 191. Axe, E.L., et al., Autophagosome formation from membrane compartments enriched in phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum. The Journal of cell biology, 2008. 182(4): p. 685-701. 192. Hamasaki, M., et al., Autophagosomes form at ER-mitochondria contact sites. Nature, 2013. 495(7441): p. 389-93. 193. Berger, Z., et al., Rapamycin alleviates toxicity of different aggregate-prone proteins. Human molecular genetics, 2006. 15(3): p. 433-42. 194. Ravikumar, B., R. Duden, and D.C. Rubinsztein, Aggregate-prone proteins with polyglutamine and polyalanine expansions are degraded by autophagy. Human molecular genetics, 2002. 11(9): p. 1107-17. 195. Spilman, P., et al., Inhibition of mTOR by rapamycin abolishes cognitive deficits and reduces amyloid-beta levels in a mouse model of Alzheimer's disease. PloS one, 2010. 5(4): p. e9979. 196. Falke, L.L., et al., Local therapeutic efficacy with reduced systemic side effects by rapamycin- loaded subcapsular microspheres. Biomaterials, 2015. 42: p. 151-60. 197. Braidy, N., et al., Recent rodent models for Alzheimer's disease: clinical implications and basic research. J Neural Transm, 2012. 119(2): p. 173-95. 198. Kalueff, A.V., A.M. Stewart, and R. Gerlai, Zebrafish as an emerging model for studying complex brain disorders. Trends Pharmacol Sci, 2014. 35(2): p. 63-75. 199. Kumar, S. and S.B. Hedges, A molecular timescale for vertebrate evolution. Nature, 1998. 392(6679): p. 917-20.
176
200. Howe, K., et al., The zebrafish reference genome sequence and its relationship to the human genome. Nature, 2013. 496(7446): p. 498-503. 201. Draper, B.W., P.A. Morcos, and C.B. Kimmel, Inhibition of zebrafish fgf8 pre-mRNA splicing with morpholino oligos: a quantifiable method for gene knockdown. Genesis, 2001. 30(3): p. 154-6. 202. Hwang, W.Y., et al., Efficient genome editing in zebrafish using a CRISPR-Cas system. Nat Biotech, 2013. 31(3): p. 227-229. 203. Huang, P., et al., Heritable gene targeting in zebrafish using customized TALENs. Nat Biotech, 2011. 29(8): p. 699-700. 204. Auer, T.O., et al., Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology- independent DNA repair. Genome Res, 2014. 24(1): p. 142-53. 205. Musa, A., H. Lehrach, and V. Russo, Distinct expression patterns of two zebrafish homologues of the human APP gene during embryonic development. Development genes and evolution, 2001. 211(11): p. 563-567. 206. Leimer, U., et al., Zebrafish (Danio rerio) presenilin promotes aberrant amyloid beta-peptide production and requires a critical aspartate residue for its function in amyloidogenesis. Biochemistry, 1999. 38(41): p. 13602-9. 207. Groth, C., et al., Identification of a second presenilin gene in zebrafish with similarity to the human Alzheimer's disease gene presenilin2. Development genes and evolution, 2002. 212(10): p. 486-90. 208. Campbell, W.A., et al., Zebrafish lacking Alzheimer presenilin enhancer 2 (Pen-2) demonstrate excessive p53-dependent apoptosis and neuronal loss. Journal of neurochemistry, 2006. 96(5): p. 1423-40. 209. Chen, M., R.N. Martins, and M. Lardelli, Complex splicing and neural expression of duplicated tau genes in zebrafish embryos. Journal of Alzheimer's disease : JAD, 2009. 18(2): p. 305-17. 210. Babin, P.J., et al., Both apolipoprotein E and A-I genes are present in a nonmammalian vertebrate and are highly expressed during embryonic development. Proceedings of the National Academy of Sciences of the United States of America, 1997. 94(16): p. 8622-7. 211. Woods, I.G., et al., The zebrafish gene map defines ancestral vertebrate chromosomes. Genome Res, 2005. 15(9): p. 1307-14. 212. Nornes, S., Developmental control of Presenilin1 expression, endoproteolysis, and interaction in zebrafish embryos. Experimental cell research, 2003. 289(1): p. 124-132. 213. van Tijn, P., et al., Presenilin mouse and zebrafish models for dementia: focus on neurogenesis. Progress in neurobiology, 2011. 93(2): p. 149-64. 214. Shen, J., et al., Skeletal and CNS defects in Presenilin-1-deficient mice. Cell, 1997. 89(4): p. 629- 39. 215. Herreman, A., et al., Presenilin 2 deficiency causes a mild pulmonary phenotype and no changes in amyloid precursor protein processing but enhances the embryonic lethal phenotype of presenilin 1 deficiency. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(21): p. 11872-7. 216. Makky, K., J. Tekiela, and A.N. Mayer, Target of rapamycin (TOR) signaling controls epithelial morphogenesis in the vertebrate intestine. Developmental biology, 2007. 303(2): p. 501-13. 217. Tsukamoto, S., et al., Autophagy is essential for preimplantation development of mouse embryos. Science, 2008. 321(5885): p. 117-20. 218. He, C., et al., Assaying autophagic activity in transgenic GFP-Lc3 and GFP-Gabarap zebrafish embryos. Autophagy, 2009. 5(4): p. 520-6. 219. Newman, M., et al., Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease. Human molecular genetics, 2013.
177
220. Bharadwaj, P.R., et al., Latrepirdine (dimebon) enhances autophagy and reduces intracellular GFP-Abeta42 levels in yeast. Journal of Alzheimer's disease : JAD, 2012. 32(4): p. 949-67. 221. Steiner, H., et al., The biological and pathological function of the presenilin-1 Deltaexon 9 mutation is independent of its defect to undergo proteolytic processing. The Journal of biological chemistry, 1999. 274(12): p. 7615-8. 222. Winkler, E., et al., Generation of Alzheimer Disease-associated Amyloid β(42/43) Peptide by γ- Secretase Can Be Inhibited Directly by Modulation of Membrane Thickness. The Journal of biological chemistry, 2012. 287(25): p. 21326-21334. 223. Lim, A., et al., Analysis of nicastrin gene phylogeny and expression in zebrafish. Development genes and evolution, 2015. 224. Herreman, A., et al., gamma-Secretase activity requires the presenilin-dependent trafficking of nicastrin through the Golgi apparatus but not its complex glycosylation. Journal of cell science, 2003. 116(Pt 6): p. 1127-36. 225. Niimura, M., et al., Aph-1 Contributes to the Stabilization and Trafficking of the γ-Secretase Complex through Mechanisms Involving Intermolecular and Intramolecular Interactions. Journal of Biological Chemistry, 2005. 280(13): p. 12967-12975. 226. Crystal, A.S., et al., Presenilin modulates Pen-2 levels posttranslationally by protecting it from proteasomal degradation. Biochemistry, 2004. 43(12): p. 3555-63. 227. Bedell, V.M., S.E. Westcot, and S.C. Ekker, Lessons from morpholino-based screening in zebrafish. Briefings in Functional Genomics, 2011. 228. Raturi, A. and T. Simmen, Where the endoplasmic reticulum and the mitochondrion tie the knot: the mitochondria-associated membrane (MAM). Biochimica et biophysica acta, 2013. 1833(1): p. 213-24. 229. La Rosa, L.R., et al., Y(682)G Mutation of Amyloid Precursor Protein Promotes Endo-Lysosomal Dysfunction by Disrupting APP–SorLA Interaction. Frontiers in Cellular Neuroscience, 2015. 9: p. 109. 230. Mehmedbasic, A., et al., SorLA complement-type repeat domains protect the amyloid precursor protein against processing. The Journal of biological chemistry, 2015. 290(6): p. 3359-76. 231. Nilsson, P., et al., Abeta secretion and plaque formation depend on autophagy. Cell Rep, 2013. 5(1): p. 61-9. 232. Zhu, X.C., et al., Autophagy modulation for Alzheimer's disease therapy. Mol Neurobiol, 2013. 48(3): p. 702-14. 233. Chau, S., et al., Latrepirdine for Alzheimer's disease. Cochrane Database Syst Rev, 2015. 4: p. CD009524. 234. Bachurin, S., et al., Antihistamine agent Dimebon as a novel neuroprotector and a cognition enhancer. Annals of the New York Academy of Sciences, 2001. 939: p. 425-35. 235. Jones, R.W., Dimebon disappointment. Alzheimer's research & therapy, 2010. 2(5): p. 25. 236. Lermontova, N.N., et al., Dimebon improves learning in animals with experimental Alzheimer's disease. Bulletin of experimental biology and medicine, 2000. 129(6): p. 544-6. 237. Wu, J., Q. Li, and I. Bezprozvanny, Evaluation of Dimebon in cellular model of Huntington's disease. Molecular neurodegeneration, 2008. 3: p. 15. 238. Yu, W.H., et al., Macroautophagy—a novel β-amyloid peptide-generating pathway activated in Alzheimer's disease. The Journal of cell biology, 2005. 171(1): p. 87-98. 239. Tian, Y., et al., Adaptor complex AP2/PICALM, through interaction with LC3, targets Alzheimer's APP-CTF for terminal degradation via autophagy. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(42): p. 17071-17076.
178
240. Puglielli, L., R.E. Tanzi, and D.M. Kovacs, Alzheimer's disease: the cholesterol connection. Nature neuroscience, 2003. 6(4): p. 345-51. 241. Huttunen, H.J., C. Greco, and D.M. Kovacs, Knockdown of ACAT-1 reduces amyloidogenic processing of APP. FEBS letters, 2007. 581(8): p. 1688-1692. 242. Puglielli, L., et al., Acyl-coenzyme A: cholesterol acyltransferase modulates the generation of the amyloid [beta]-peptide. Nature cell biology, 2001. 3(10): p. 905-912. 243. Hansson Petersen, C.A., et al., The amyloid beta-peptide is imported into mitochondria via the TOM import machinery and localized to mitochondrial cristae. Proceedings of the National Academy of Sciences of the United States of America, 2008. 105(35): p. 13145-50. 244. Picone, P., et al., Mitochondrial dysfunction: different routes to Alzheimer's disease therapy. Oxid Med Cell Longev, 2014. 2014: p. 780179. 245. Chen, J.X. and S.S. Yan, Role of mitochondrial amyloid-beta in Alzheimer's disease. Journal of Alzheimer's disease : JAD, 2010. 20 Suppl 2: p. S569-78. 246. Turrens, J.F., Mitochondrial formation of reactive oxygen species. The Journal of Physiology, 2003. 552(Pt 2): p. 335-344. 247. Gaté, L., et al., Oxidative stress induced in pathologies: The role of antioxidants. Biomedicine & Pharmacotherapy, 1999. 53(4): p. 169-180. 248. Mulligan, V.K. and A. Chakrabartty, Protein misfolding in the late-onset neurodegenerative diseases: common themes and the unique case of amyotrophic lateral sclerosis. Proteins, 2013. 81(8): p. 1285-303. 249. Braakman, I., J. Helenius, and A. Helenius, Role of ATP and disulphide bonds during protein folding in the endoplasmic reticulum. Nature, 1992. 356(6366): p. 260-2. 250. Mirazimi, A. and L. Svensson, ATP is required for correct folding and disulfide bond formation of rotavirus VP7. Journal of virology, 2000. 74(17): p. 8048-52. 251. Contreras, L., et al., Mitochondria: the calcium connection. Biochimica et biophysica acta, 2010. 1797(6-7): p. 607-18. 252. Yi, M., D. Weaver, and G. Hajnoczky, Control of mitochondrial motility and distribution by the calcium signal: a homeostatic circuit. The Journal of cell biology, 2004. 167(4): p. 661-72. 253. Graier, W.F., M. Frieden, and R. Malli, Mitochondria and Ca(2+) signaling: old guests, new functions. Pflugers Archiv : European journal of physiology, 2007. 455(3): p. 375-96. 254. Csordas, G., et al., Structural and functional features and significance of the physical linkage between ER and mitochondria. The Journal of cell biology, 2006. 174(7): p. 915-21. 255. Hedskog, L., et al., Modulation of the endoplasmic reticulum-mitochondria interface in Alzheimer's disease and related models. Proceedings of the National Academy of Sciences of the United States of America, 2013. 110(19): p. 7916-21. 256. Palay, S.L., SYNAPSES IN THE CENTRAL NERVOUS SYSTEM. The Journal of Biophysical and Biochemical Cytology, 1956. 2(4): p. 193-202. 257. Pettegrew, J.W., et al., Alterations of cerebral metabolism in probable Alzheimer's disease: a preliminary study. Neurobiology of aging, 1994. 15(1): p. 117-32.
179
APPENDIX I
180
Newman, M., Wilson, L., Verdile, G., Lim, A., Khan, I., Moussavi Nik, S.H., Pursglove, S., Chapman, G., Martins, R.N. & Lardelli, M. (2014). Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease. Human Molecular Genetics, 23(3), 602-617.
NOTE:
This publication is included after page 180 in the print
copy of the thesis held in the University of Adelaide Library.
It is also available online to authorised users at:
http://dx.doi.org/10.1093/hmg/ddt448