Intercellular Bacterial Signalling in Activated Sludge
by
Grace Chong
A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy
School of Biotechnology and Biomolecular Sciences Faculty of Science The University of New South Wales Sydney, Australia
March 2010
Table of Contents
Table of Contents ...... 2 Acknowledgements ...... 7 Abstract ...... 9 Originality Statement...... 11 List of Figures ...... 12 List of Tables ...... 14 List of Abbreviations ...... 15 1 General introduction and literature review ...... 18 1.1 Introduction ...... 18 1.2 Introduction to cell-cell communication ...... 18 1.2.1 Quorum sensing paradigm ...... 20 1.2.2 Vibrio fischeri ...... 21 1.2.2.1 LuxR, the acyl-HSL response regulator ...... 23 1.2.2.2 LuxI, the acyl-HSL synthase ...... 25 1.2.2.3 luxICDABEG, the bioluminescence operon ...... 28 1.2.3 Quorum sensing in Gram-negative bacteria ...... 29 1.3 Ecological aspects of bacterial intercellular signalling ...... 30 1.3.1 Intraspecies signalling ...... 31 1.3.2 Interspecies signalling ...... 32 1.3.2.1 LuxR interacting with more than one species of luxI homologue gene product ...... 32 1.3.2.2 Bacterial strains producing more than one luxI gene product ... 33 1.3.2.3 The lack of luxI homologues in some bacterial strains that possess luxR homologues ...... 34 1.3.4 Quorum sensing interference ...... 36 1.4 Wastewater treatment process ...... 38 1.4.1 Activated sludge ...... 41 1.4.2 Organic carbon removal ...... 42 1.4.3 Nitrogen removal ...... 45 1.4.4 Acyl-HSLs and activated sludge ...... 46 1.5 Bacterial acyl-HSL biosensors ...... 48
2
1.5.1 Thin-layer chromatography ...... 50 1.5.2 In situ applications of acyl-HSL biosensors...... 51 1.5.3 Advantages of biosensors ...... 51 1.6 Evolutionary biology of microbial social behaviour ...... 52 1.6.1 Costs of cell-cell communication ...... 53 1.6.2 Explaining cooperation ...... 55 1.6.2.1 Mutual benefits...... 55 1.6.2.2 Kin selection...... 56 1.6.3 Other forms of cooperation ...... 58 1.6.4 Multi-species cooperation in activated sludge ...... 58 1.7 Aims and objectives ...... 60 1.7.1 Chapter synopses ...... 61 2 Detection of acyl-HSL-like activity in activated sludge ...... 63 2.1 Introduction ...... 63 2.2 Material and Methods ...... 66 2.2.1 Bacterial strains and culture conditions ...... 66 2.2.2 Activated sludge sampling ...... 68 2.2.3 Isolation of bacterial strains from activated sludge...... 68 2.2.4 Assays for detection of acyl-HSL molecules ...... 68 2.2.4.1 Screening for acyl-HSL in agar systems ...... 68 2.2.4.2 Screening for acyl-HSLs in liquid systems ...... 69 2.2.5 Construction of acyl-HSL monitor strain ...... 69 2.2.6 Characterization of acyl-HSL monitor strain ...... 70 2.2.7 Masking effects ...... 70 2.2.8 Acyl-HSL detection in sludge samples ...... 71 2.2.8.1 Epifluorescence microscopy ...... 71 2.2.9 Extraction of activated sludge supernatant ...... 71 2.2.9.1 Acyl-HSL screening of sludge extract using agar systems ...... 72 2.2.9.2 Acyl-HSL screening of sludge extract using thin-layer chromatography (TLC) ...... 72 2.3 Results ...... 73 2.3.1 Construction of acyl-HSL monitor strain ...... 73 2.3.2 Characterization of the acyl-HSL monitor strain ...... 73 2.3.3 Masking effects ...... 78
3
2.3.4 Detection of acyl-HSLs in sludge ...... 80 2.3.5 Identification of acyl-HSL profiles in activated sludge ...... 83 2.4 Discussion ...... 85 3 Testing for acyl-HSL activity and acyl-HSL regulated phenotypes in activated sludge isolates ...... 88 3.1 Introduction ...... 88 3.2 Materials and methods ...... 91 3.2.1 Bacterial strains and culture conditions ...... 91 3.2.2 Activated sludge collection ...... 93 3.2.3 Isolation and identification of bacterial strains from activated sludge 93 3.2.4 Assays for detection of acyl-HSL molecules ...... 94 3.2.4.1 Screening of acyl-HSL in agar systems ...... 94 3.2.4.2 Screening of acyl-HSL in liquid systems ...... 95 3.2.5 Phenotypic characterization of sludge isolates ...... 95 3.2.5.1 Cellulase assay ...... 95 3.2.5.2 Lipase assay ...... 96 3.2.5.3 Chitinase assay ...... 96 3.2.5.4 Elastase assay ...... 96 3.2.5.5 Surfactant production ...... 97 3.2.5.6 Antimicrobial assay ...... 97 3.3 Results ...... 98 3.3.1 Characterisation of sludge floc community ...... 98 3.3.2 Identification of acyl-HSL-producers in the collection of isolates ... 98 3.3.3 Phenotypic characterization of sludge isolates ...... 103 3.4 Discussion ...... 108 4 Acyl-HSL responses in activated sludge ...... 112 4.1 Introduction ...... 112 4.2 Materials and Methods ...... 115 4.2.1 Bacterial strains ...... 115 4.2.2 Activated sludge collection ...... 115 4.2.3 Measurement of acyl-HSL stability in sludge (using well-diffusion assay) 115 4.2.4 Phenotypic analysis of community function with OHHL addition . 116
4
4.2.5 Quantification of nitrate ...... 116 4.3 Results ...... 117 4.3.1 Rate of acyl-HSL degradation in sludge ...... 117 4.3.2 Phenotypic analysis of community function with OHHL addition . 120 4.3.3 Quantification of nitrate with OHHL addition ...... 122 4.4 Discussion ...... 124 5 Exploring the evolutionary advantage of acyl-HSL synthase in V. fischeri 129 5.1 Introduction ...... 129 5.2 Materials and Methods ...... 132 5.2.1 Bacterial strains and media ...... 132 5.2.2 Growth studies of V. fischeri strains ...... 134 5.2.3 Competition between V. fischeri luxI– mutant and wild type...... 134 5.2.4 Stress-induced response of V. fischeri strains ...... 134 5.2.5 Long-term evolution of bioluminescence in V. fischeri ...... 135 5.2.6 Construction of functional luxR plasmid inserted into V. fischeri luxR– mutant ...... 135 5.2.7 Testing for luxI– mutants ...... 136 5.3 Results ...... 137 5.3.1 Growth of V. fischeri variants ...... 137 5.3.2 Competition between wild-type and luxI– mutant ...... 139 5.3.3 Stress-induced response of V. fischeri lineages ...... 142 5.3.4 Long-term evolution of V. fischeri mutants ...... 144 5.4 Discussion ...... 151 6 Summary and general discussion ...... 155 6.1 Bacterial signalling in the sludge environment ...... 155 6.1.1 Acyl-HSL detection and degradation in activated sludge ...... 156 6.1.2 Sludge behaviours performed by the microbial sludge community strongly linked to quorum sensing ...... 157 6.1.2.1 Increased chitinase activity ...... 157 6.1.2.2 Reduced nitrification ...... 158 6.2 Signal production drives cooperation in a V. fischeri population ...... 159 6.2.1 luxI synthase gene in V. fischeri observed to be stable in long-term evolutionary study ...... 160 6.2.2 Selective advantages of the luxI synthase gene...... 161
5
6.2.3 Relationship between a beneficial stable luxI gene and activated sludge 163 6.3 Future directions...... 163 References ...... 165
6
Acknowledgements
First and foremost, I would like to express my deepest gratitude to my supervisor, Mike Manefield, whose guidance for me throughout the PhD is more than I can ask for. Thank you for generously sharing your vast knowledge and teaching me to tackle challenges and not giving up. I couldn‟t ask for more the things I‟ve learnt from you in this journey and your enthusiasm and integrity as a scientist really inspired me in many ways.
Many thanks to Scott Rice for technical guidance with molecular work as well as the many interesting scientific discussions. Also, many thanks to Staffan Kjelleberg for sharing your enthusiasm in this project.
Many thanks to Environmental Biotechnology Cooperative Research Centre for providing me with the scholarship and the opportunity to work on this project. Thank you to the School of Microbiology and Immunology as well as the Graduate Research School for assistance and opportunities throughout the PhD. To everyone in CMB, thank you for your support and contribution in one way or another.
Many thanks to everyone in Lab 141! The time spent toiling in the lab was so much more interesting and enriching with all of you around, sharing both scientific knowledge and advice, and the many fun chats in between incubations. Thank you for all your friendships.
To my wonderful family, albeit far away, are the biggest supporters for what I am doing. I cannot thank you enough for all the love and constant encouragement you showed me throughout the PhD.
I am very grateful to have the most caring and supportive friends who got me through this PhD. To Charmaine, thanks for all the chats, lunches and coffee breaks that I always look forward to. To all my friends at International House, you made life so enjoyable everyday. To Junyi, thank you for all the amazing
7
experiences we shared in Australia. To my tennis buddies, thanks for all the fun hitting sessions!
Finally, my heartfelt gratitude to Ruihang Huang, who has been my pillar of support at all times. Thank you for always being there.
8
Abstract
Many bacteria use quorum sensing or cell-cell signalling to alter their behaviour in response to changes in population density. The capacity to behave collectively as a group has obvious advantages, such as conjugal plasmid transfer and biofilm formation. As such, their study creates opportunities to understand their applications that might be useful in some important processes, such as wastewater treatment.
In the first part of the work described here, the local accumulation of signalling molecules, N-acyl-L-homoserine lactones (acyl-HSLs), in activated sludge, was investigated using a bacterial monitor strain derived from this environment. Additionally, 52 different activated sludge isolates were tested for acyl-HSL production using CviR, TraR, LuxR and LasR based biosensors and for expression of six known acyl-HSL regulated phenotypes. A surprising 77 % of isolates produced acyl-HSLs and of these acyl-HSL producing isolates, 75 % expressed known acyl-HSL dependent phenotypes (eg. lipase, protease, surfactant production). Bacteria belonging to the Aeromonadaceae family were common amongst the acyl-HSL producers and many of them produced extracellular lipase and chitinase activity in vitro. Addition of N-3-oxo-hexanoyl-L-homoserine lactone (OHHL) to activated sludge stimulated chitinase production in the whole sludge community. These experiments provide insight into the role of acyl-HSL mediated gene expression in activated sludge and may ultimately create opportunities to improve sludge performance.
The second part of the project explored the nature of the selection pressure maintaining an acyl-HSL synthase gene in a model quorum sensing organism. Specifically, the spontaneous evolution of quorum sensing cheats in batch cultures of wild-type acyl-HSL-producing Vibrio fischeri cells was monitored in a long- term evolutionary study. It was hypothesised that if signal-production represents a resource cost to the individual cell, then signal deficient mutants should evolve over time in the absence of selection for the regulated phenotype (bioluminescence). After 325 days of daily subculturing, half of the ten V. fischeri
9
lineages were dominated by „cheating‟ genotypes, indicated by the permanent loss of their bioluminescence phenotype in the bacterial cultures. LuxR mutants were detected in four of the five permanently dark lineages. However, the acyl-HSL synthase gene was intact in all of the lineages. Together with the finding that wild-type V. fischeri cells have a competitive growth advantage over signalling- deficient cells in a mixed culture, the cost of acyl-HSL synthesis in V. fischeri is suggested to be compensated for by an unknown selective advantage to the individual cell other than group benefits derived from signalling. This finding offers a partial explanation for how genes encoding cooperative traits are retained over evolutionary time.
Overall, the results presented here described how acyl-HSL signalling systems are prevalent in engineered environments, such as activated sludge, and the stability of their molecular components over time, could be due to selective advantages beyond signalling, as observed in the model acyl-HSL producing organism, V. fischeri.
10
Originality Statement
„I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project‟s design and conception or in style, presentation and linguistic expression is acknowledged.‟
Signed …………………………………….
Date …………………………….………
11
List of Figures
Figure 1.1 Regulation of bioluminescence in V. fischeri...... 22 Figure 1.2 Generic representation of acyl-HSLs produced by bacteria ...... 26 Figure 1.3 Basic steps of the activated sludge process ...... 40 Figure 1.4 Degradation of organic polymers to monomers from wastewaters by activated sludge microorganisms ...... 43 Figure 2.1 Dose response of the monitor strain (pBB-LuxR) to OHHL ...... 75 Figure 2.2 Epifluorescence and light microscopy images of acyl-HSL monitor strain Aeromonas sp. (pBB-Lux) in the absence and presence of OHHLs, and V. fischeri cells ...... 77 Figure 2.3 Masking effects of biomass on fluorescence measurements ...... 79 Figure 2.4 Detection of production of acyl-HSL-like activity in sludge ...... 81 Figure 2.5 Agar plate assays for screening of presence of acyl-HSL in activated sludge extracts using A. tumefaciens A136 and C. violaceum CV026 ...... 84 Figure 3.1 Examples of qualitative phenotypic assays...... 105 Figure 4.1 A. tumefaciens A136 well diffusion assay ...... 118 Figure 4.2 Standard curve comparing the concentration of acyl-HSL to A. tumefaciens A136 response to OHHL-induced beta-galactosidase production. 119 Figure 4.3 Rate of OHHL degradation in activated sludge and activated sludge supernatant ...... 119 Figure 4.4 Extracellular chitinase activity in activated sludge in the presence and absence of OHHL ...... 121 Figure 4.5 Quantification of nitrate in activated sludge in the presence and absence of OHHL ...... 123 Figure 5.1 Growth curves of V. fischeri variants, wild-type MJ1, and luxI– mutant MJ211 ...... 138 Figure 5.2 Growth curves of V. fischeri variants, wild-type MJ1, and luxI– mutant MJ211, in the presence of OHHL...... 138 Figure 5.3 Competitive growth study between V. fischeri wild-type MJ1 and luxI– mutant MJ211 at starting ratios of 50:50 in a mixed culture ...... 141 Figure 5.4 Competitive growth study between V. fischeri wild-type MJ1 and luxI– mutant MJ211 at starting ratios of 10:90 in a mixed culture ...... 141
12
Figure 5.5 Growth effects of V. fischeri lineages with or without hydrogen peroxide...... 143 Figure 5.6 Measurements of bioluminescence taken from V. fischeri lineage 1...... 145 Figure 5.7 Measurements of bioluminescence taken from V. fischeri lineage 2 ...... 145 Figure 5.8 Measurements of bioluminescence taken from V. fischeri lineage 3 ...... 146 Figure 5.9 Measurements of bioluminescence taken from V. fischeri lineage 4 ...... 146 Figure 5.10 Measurements of bioluminescence taken from V. fischeri lineage 5 .... 147 Figure 5.11 Measurements of bioluminescence taken from V. fischeri lineage 6 .... 147 Figure 5.12 Measurements of bioluminescence taken from V. fischeri lineage 7 .... 148 Figure 5.13 Measurements of bioluminescence taken from V. fischeri lineage 8 .... 148 Figure 5.14 Measurements of bioluminescence taken from V. fischeri lineage 9 .... 149 Figure 5.15 Measurements of bioluminescence taken from V. fischeri lineage 10 .. 149
13
List of Tables
Table 1.1 Some common microbial signal molecules ...... 27 Table 1.2 Examples of multi-species quorum sensing interactions ...... 35 Table 2.1 Bacterial strains and plasmids used in Chapter 2 ...... 67 Table 3.1 Bacterial strains and plasmids used in Chapter 3 ...... 92 Table 3.2 Sludge flocs isolates and their acyl-HSL activities in various bioassays. 101 Table 3.3 Phenotypic characterisation of sludge floc isolates ...... 106 Table 5.1 Bacterial strains and plasmids used in Chapter 5 ...... 133 Table 5.2 Primers used for sequencing of V. fischeri bioluminescence-associated genes and construction of functional luxR plasmid...... 133 Table 5.3 Bioluminescence effects of hydrogen peroxide added in V. fischeri lineages ...... 143
14
List of Abbreviations
ACP Acyl carrier protein AI-2 Autoinducer 2 AIP Autoinducing signal peptide Amp Ampicillin AMP Adenosine monophosphate AOB Ammonia-oxidizing bacteria ATCC American type culture collection ATP Adenosine triphosphate AWW Artifical wastewater BHL Butyryl-L-HSL BLAST Basic local alignment search tool bp Base pair C Celsius CCD Charged-coupled device cm Centimetre Cm Chloramphenicol CMC Carboxymethyl cellulose DGGE Denaturing gradient gel electrophoresis DMSO Dimethyl sulfoxide DNA Deoxyribonucleic acid EPS Extracellular polysaccharide substances f Forward FISH Fluorescent in situ hybridisation g Gram GC Gas chromatography Gfp Green fluorescent protein Gm Gentamycin
H2O Water
H2O2 Hydrogen peroxide H+ Hydrogen ion h Hour
15
HHL Hexanoyl-L-HSL HSL Homoserine lactone Kan Kanamycin kb Kilobase pair L Litre LB Luria-Bertani medium M Molar mg Milligram min Minute ml Millilitre mm Millimetre mM Millimolar mU Milliunit MS Mass spectrometry
N2 Nitrogen gas
N2O Nitrous oxide NCBI National Centre for Biotechnology Information ng Nanogram
NH3 Ammonia nm Nanometre nM Nanomolar NO Nitric oxide – NO2 Nitrite – NO3 Nitrate NOB Nitrite-oxidizing bacteria
O2 Oxygen OdDHL 3-oxo-dodecanoyl-L-HSL OD Optical density ODHL 3-oxo-decanoyl-L-HSL OHHL 3-oxo-hexanoyl-L-HSL OHL Octanoyl-L-HSL OtDHL 3-oxo-tetradecanoyl-L-HSL PCR Polymerase chain reaction pmol Picomolar
16
PQS 2-heptyl-3-hydroxyl-4-quinolone R2A Reasoner‟s 2A r Reverse RNA Ribonucleic acid rpm Revolutions per minute rRNA Ribosomal ribonucleic acid s Second
SAM S-adenosyl-methionine sp. Species str. Strain Tc Tetracycline TLC Thin layer chromatography U Unit µg Microgram µl Microlitre µm Micrometre µM Micromolar UV Ultraviolet v/v Volume per volume W Watt w/v Weight per volume X-gal 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside
17 Chapter 1
1 General introduction and literature review
1.1 Introduction
It is now generally acknowledged that bacteria predominantly live as spatially distinct communities in many environments, including soil (27), rock material (205), and surfaces of indwelling biomedical devices (302). Although such bacterial communities play important roles in our ecosystems, such as the recycling of nutrients in food webs (228), they can also have unwanted effects, such as being responsible for biofouling (168), biocorrosion (251), and wound infections (341), all of which generate social problems and huge financial losses in industry. As a result, there is increasing interest in gaining an improved understanding of the mechanisms of bacterial group behaviour and selection to exploit or manipulate such mechanisms to benefit environmental or engineered applications. This thesis explores the intercellular communication between Gram- negative bacteria in activated sludge and the potential roles mediated by signal molecules, N-acyl-L-homoserine lactone (acyl-HSL), in sludge ecology.
In Chapter One, a brief background on bacterial cell-cell communication is introduced, with a focus on acyl-HSL signalling systems. The relevance of cell- cell signalling in activated sludge, concerning the main hypothesis of the project, is addressed. Biological constructs designed to detect acyl-HSLs in natural environments are also considered. The evolutionary stability of social behaviours like cell-cell signalling is discussed in general and in the context of the sludge environment. A brief summary of the contents of the thesis is included.
1.2 Introduction to cell-cell communication
The discovery in the 1970s that bioluminescent bacteria produce a sudden light emission, only during the late exponential growth phase, when cultures have a high density but not in concert with its growth at its early stages, when cultures
18 Chapter 1 have a low density, sparked considerable scientific interest in this phenomenon. It led on to numerous experiments and discussions surrounding this observation (137). The term „quorum-sensing‟ is used to describe such behaviour where gene regulation is density dependent.
It is now apparent that bacteria are capable of forming communities and cooperating as a quorum (346). To accomplish this, bacteria utilize signalling compounds or unexpectedly sophisticated cell-cell communication to sense and respond to the rest of the population and collectively activate specific gene(s) and coordinate behaviour.
Quorum sensing systems are important determinants of diverse activities regulated by signal molecules. These systems have been identified in a wide range of bacterial genera from different environments including plant and animal pathogens. Examples of such activities include virulence factor production from both Pseudomonas aeruginosa, which colonizes the lungs of cystic fibrosis patients (75) and Staphylococcus aureus, which attacks the human innate immune system (162). Another example is the successful invasion of plant tissues by the secretion of cell wall-degrading exoenzymes by Erwinia carotovora, as well as the production of the carbapenem antibiotic, which is presumably active against competing opportunistic bacteria at the site of infection (339). This strategy, in which bacterial cells only express virulence factors when their population size is high, is believed to ensure that the host defence mechanism will be overwhelmed by the sustained attack of the bacteria, to achieve a reasonable chance of success.
Cell density depends on two parameters, the volume of the confined compartment and the number of cells within. Redfield (256) proposed that quorum sensing is in fact diffusion sensing, whereby cell density is measured by the mass transfer activity of secreted effectors serving as probes for the individual cells and providing information about the diffusive properties of the immediate environment. Although this is a much simpler hypothesis that does not invoke social behaviour, it disregards the specificity of the information and the fact that a sufficiently confined space such as the grooves of a rhizosphere, or a light organ of a marine squid, can lead to upregulation of quorum sensing behaviour,
19 Chapter 1 produced by only a small population of cells, triggering an inefficient response on the host. Thus, for such scenarios, it is important to consider the total number of specific cells especially within heterogenous bacterial communities, when analysing quorum sensing behaviours as well as the dynamics of a single signal- receptive microoganism in the environment.
Other beneficial quorum sensing activities include the protective habitat of fruiting bodies formed by aggregation of Myxococcus xanthus in times of starvation (189), the production of an extracellular polysaccharide matrix by P. aeruginosa biofilms that encases and shields the microorganism from external harsh conditions, such as antibiotics and biocides (65), and the development of bacterial competence in Bacillus subtilis and Streptococcus pneumoniae (83, 243). This form of communication has also evolved to benefit eukaryotic hosts, for example as is the case with rhizobium species such as R. leguminosarum, which form symbiotic relationships with leguminous plants to fix nitrogen within the roots (120). Another example is the marine luminous bacterium, Vibrio fischeri, the original acyl-HSL producer which uses quorum sensing to regulate light production for marine fishes, and in return receives nutrients from the animal host (262). The expression of these diverse phenotypic characteristics regulated by intercellular communication systems, are often relevant to community behaviour.
1.2.1 Quorum sensing paradigm
Quorum sensing bacteria produce specific chemical signal molecules that increase in concentration with increasing cell population density. After a minimal population of bacteria or a critical threshold signal concentration is achieved in the environment, a response is triggered that controls transcription of certain genes. Using this mechanism, quorum sensing bacteria can efficiently couple gene expression to fluctuations in cell population density.
There are several recognized intercellular signalling mechanisms used by quorum sensing bacteria, such as peptide-based signals in Gram-positive bacteria (307) and the AI-2 (a furanosyl borate diester) system defined as the universal signal
20 Chapter 1 used by organisms such as Vibrio harveyi (309). This portion of the review will focus primarily on acyl-HSL mediated signalling, since it is the best understood signalling system at the molecular level. It is commonly utilized by Gram- negative bacteria and has been intensively studied in the symbiotic bacterium, V. fischeri, which continues to serve as the classic model system (346).
1.2.2 Vibrio fischeri
The two main regulatory genes involved in acyl-HSL quorum sensing are the I and R genes. The I gene encodes the synthesis of an acyl-HSL signal molecule and the R gene encodes the receptor protein that responds to the acyl-HSL signal. In V. fischeri, the luxI gene directs the synthesis of its cognate signal, 3- oxohexanoyl-L-HSL (OHHL), which is freely diffusible across the cell membrane (153) (Fig. 1.1). As the V. fischeri culture grows, more OHHL is produced. When OHHL accumulates to a critical threshold concentration in the environment, the LuxR receptor protein, which resides in the cytoplasm, is activated and binds to OHHL. This OHHL-LuxR complex induces the transcription of the luxICDABE operon which encodes enzymes involved in luminescence (270).
The lux operon transcription also includes the synthesis of more of the ultimate luxI gene product, OHHL. With this increased production of signal molecules, more LuxR receptor molecules can be activated to ensure the continuous expression of the luminescence system. Hence, this signal molecule, which generates a positive feedback system for the quorum-sensing phenotype, is also termed an autoinducer.
21 Chapter 1
OHHL
luxR luxI luxCDABEG
Figure 1.1 Regulation of bioluminescence in V. fischeri. The large oval represents a V. fischeri bacterial cell. At high cell densities, when the intracellular concentration of OHHL (circle) reaches a certain threshold, an OHHL-LuxR complex activates transcription of the luxICDABE operon resulting in increased levels of OHHL and bioluminescence. The intracellular concentration of OHHL is dependent on its accumulation in the extracellular environment.
22 Chapter 1
V. fischeri, which symbiotically colonizes the light organs of a range of marine fishes and squids, can reach very high densities of 1010 – 1011 cells per ml. The light organ creates an ideal environment for the accumulation of acyl-HSLs, inducing the production of light, which these nocturnal marine hosts use in the night to match the intensity of the moonlight above, becoming invisible to predators below them. In exchange, the host provides the bacteria with nutrients such as amino acids to support dense populations and luminescence in the light organ (125). During the day, when there is no need for bioluminescence, 90% of the V. fischeri cells are vented out of the host organism to exist as free-living cells in the surrounding seawater (62). At such low densities and with no impediment to diffusion, acyl-HSLs cannot accumulate and bioluminescence is not expressed. It is not necessary to expend energy on the costly production of light especially in environments such as seawater where nutrients are relatively poor.
1.2.2.1 LuxR, the acyl-HSL response regulator
Bacteria that utilize acyl-HSLs usually perceive the signals via cytoplasmic LuxR homologue proteins. LuxR, a 250 amino acid polypeptide, is known to consist of two domains (N and C). In V. fischeri, OHHL is believed to bind to the N- terminal domain of LuxR and this binding causes conformational change in the LuxR protein, which is then subsequently activated. The activated LuxR is believed to then proceed with a productive interaction at the LuxR C-terminal domain with the transcription-initiation complex of the luminescence genes, known as the lux box (47, 136). The lux box is a 20-bp inverted repeat DNA sequence, which lies around 40 bp upstream of the transcriptional start site of luxI (89). From there, transcription of the lux operon is initiated through recruitment of the RNA polymerase complex (346).
The LuxR N-terminus region, which constitutes two thirds of LuxR, is mainly an acyl-HSL binding region in V. fischeri. This conclusion arose from experiments that showed certain mutational amino acid changes within the N-terminus, led to a requirement for higher concentrations of OHHL for induction of bioluminescence (278, 289). In a separate study, a truncated LuxR molecule, lacking its amino-
23 Chapter 1 terminal region, was shown to activate lux genes in an OHHL-independent manner (47), and point mutations mapped throughout the whole LuxR protein were observed to cause such behaviour as well (248, 288). It was suggested that the amino-terminal region and amino acid interactions within the protein are also responsible for the inhibition of luminescence induction, by keeping LuxR in an inactive conformation in the absence of OHHL.
The C-terminal region, which constitutes a third of LuxR, is functionally the DNA binding region of the protein that binds with the lux box-type sequence. It contains a helix-turn-helix motif, that is critical for the binding activity (47). The complex nature of this molecular mechanism is still being elucidated with numerous factors believed to affect the downstream cascade of events, following DNA binding. For example, the presence of GroESL molecular chaperones is required for the stable active folding of the LuxR protein (76), the dependence of a functional alpha-subunit C-terminal domain of RNA polymerase is required for lux-box binding (301); and the necessity of the binding of cyclic AMP receptor protein (cAMP) at -60 bp from the luxR transcription start site, is required for luxR expression (82). Early induction of V. fisheri luminescence was also observed in conditions of low iron and oxygen concentrations showing further influence of global regulatory systems on acyl-HSL mediated gene expression (319).
Homologs of this luxI-luxR system are in fact present in other bacteria constituting quorum-sensing regulatory systems and some of these systems follow a similar mode of action. As common examples, lux box-type sequences preceding quorum-sensing-regulated genes, have also been identified in Agrobacterium tumefaciens, a DNA region critical for TraR (a LuxR homologue from A. tumefaciens) binding activity as well (250). Multimerization of CarR (a LuxR homologue from E. carotovora subspecies carotovora) (339) is also required for the binding of relevant DNA sequences in conjunction with RNA polymerase to activate transcriptional regulatory processes in E. carotovora.
Some LuxR homologs, such as EsaR of Pantoea stewartii, appear to act as transcriptional repressors instead of activators when populations are small (18).
24 Chapter 1
Only at high cell densities, does the association of EsaR with acyl-HSL binding relieve repression, dissociating its transcription factor from its target DNA sequences (6, 329), producing an exopolysaccharide virulence factor that blocks plant xylem vessels and subsequently causes wilting of the plant. In Serratia marcescens and Yersinia pseudotuberculosis, the R proteins have also been shown to act as repressors rather than activators (7, 145).
1.2.2.2 LuxI, the acyl-HSL synthase
The array of bacteria found to produce acyl-HSLs, has grown rapidly over the past twenty years (Table 1.1). Most of the acyl-HSL synthases from these bacteria share similar sequence homology with the luxI gene of V. fischeri (84).
Acyl-HSL molecules synthesized by luxI homologues consist of a homoserine lactone ring that is bound via an amide bond to an acyl chain that can differ in length from 4 to 14 carbon atoms (Fig. 1.2). The third carbon of the acyl chain can also vary in oxidation states and degrees of saturation, such as a carbonyl or hydroxyl group attached to it, or be fully reduced. Double bonds have also been found in some acyl chains although rarely is there more than one (127).
25 Chapter 1
‟
3 1 2
Figure 1.2 Generic representation of acyl-HSLs produced by bacteria. A carbonyl or hydroxyl group can be found at R‟. Acyl chains at R can range from four to 14 carbon atoms, and can contain double bonds. Atoms are numbered for ease of reference by a standard numbering system.
26 Chapter 1
Table 1.1 Some common microbial signal molecules
27 Chapter 1
Since a range of different organisms produces these signal molecules, it is predicted that the substrates used to manufacture the signal molecules are obtained from common metabolites, which are generally found in bacteria. The acyl chain and homoserine lactone ring are synthesized from an acylated acyl carrier protein (ACP) and S-adenosylmethionine (SAM) respectively, intermediates of the methionine-lysine-threonine biosynthetic pathway. For the luxI gene product in V. fischeri, the six-carbon hexanoyl group detaches itself from the appropriately charged ACP and forms an amide bond with the amino group of SAM on the active site of luxI. The release of 5‟-methylthioadenosine from the acyl-SAM intermediate and a lactonisation reaction results in the synthesis of a 3-oxo-hexanoyl-L-HSL (OHHL) (271).
A second autoinducer, octanoyl-L-HSL (OHL), was also found to be produced by V. fischeri, directed by the synthase gene, ainS, which is distinct from luxI with no significant sequence similarity. This autoinducer, in contrast, serves to prevent premature luminescence induction at low V. fischeri population densities. It binds competitively with LuxR, forming a complex that has a markedly lower lux operon-inducing specific activity. It also suppresses luminescence induction at intermediate population densities as OHHL accumulates (166, 167).
1.2.2.3 luxICDABEG, the bioluminescence operon
The luxICDABEG operon is adjacent to, but divergently transcribed, from the luxR gene. The luxA and luxB genes encode the alpha and beta subunits of luciferase, respectively. This enzyme catalyzes the conversion of a long-chain aldehyde, reduced flavin mononucleotide and oxygen to a long-chain fatty acid, flavin mononucleotide, H2O, and light, which manifests as bioluminescence in V. fischeri (19). The genes luxCDE encode products that form a multienzyme complex, responsible for the synthesis of the aldehyde substrate utilized by the luciferase (22). The presence of a lux box-type element located within luxD is believed to repress transcription of luxR when OHHL is abundant, however the mechanism of this autorepression is unknown (277). LuxG encodes a flavin reductase (359), followed by a transcriptional termination site.
28 Chapter 1
1.2.3 Quorum sensing in Gram-negative bacteria
The V. fischeri system has become the paradigm for acyl-HSL regulation in Gram-negative bacteria. It has also led to assumptions made for acyl-HSL regulation in other bacteria (109). Ongoing research in acyl-HSL mediated quorum sensing has revealed complex signalling systems with multiple levels of regulation.
A well-studied example is P. aeruginosa that contains two quorum sensing networks, lasR-lasI and rhlR-rhlI (170, 235, 236, 350). Together, both systems regulate genes of almost 2 – 5 % of its entire genome (348), including exoenzyme synthesis, virulence-factor synthesis, secondary metabolism, and biofilm development (113, 233, 348), demonstrating the global importance of this gene- regulatory mechanism. The las system synthesizes 3-oxo-dodecanoyl-L-HSL (OdDHL) and regulates many different genes (113) but more importantly, also controls the expression of the rhl system (169, 224, 237, 348), which produces the signal molecule, butyryl-L-HSL (BHL). To a lesser extent, promoters of rhl targeted genes are also recognised by lasR, the reverse however, does not happen (169, 242, 325, 347). Quorum sensing is abolished in P. aeruginosa when a mutation event occurs in las genes (101, 150, 198), which exemplifies the dominance of the las system over the rhl system. However, not all genes are controlled by a single acyl-HSL. It has been shown that some genes can be activated in response to either signal specifically or the presence of both (237, 275). A third signal produced by P. aeruginosa, 2-heptyl-3-hydroxyl-4-quinolone (PQS), has also been reported to be part of the quorum sensing hierarchy, whose bioactivity depends on the relative levels of the other two P. aeruginosa signals (201, 204). Some studies suggested that PQS could be a link between the las and rhl quorum sensing systems (204). Recently, phenazines, commonly thought of as virulence factors secreted by P. aeruginosa, have been found to act as intercellular signals that link PQS to regulate genes, such as mexGHI-opmD and PA2274, involved in efflux and redox processes. A study reports phenazine pyocyanin as a terminal signalling molecule in the P. aeruginosa quorum sensing circuitry (70).
29 Chapter 1
To further complicate the system, the completion of the recent P. aeruginosa genome project has revealed the presence of a third luxR homologue, called qscR, adjacent to a cluster of quorum sensing controlled genes, although a third luxI homologue was not identified. The function of qscR is considered to repress quorum sensing in the early stages of growth (103). Clearly, the P. aeruginosa quorum sensing system is highly complex and is affected by many other regulatory systems.
A key example of group behaviours for P. aeruginosa is biofilm formation, a role played by las and rhl quorum sensing systems, in which cells attach to a surface and envelope themselves in secreted polymers at early stages of biofilm formation (65). Biofilms have subsequently been found to display features suggestive of multicellular systems, including co-ordinated dispersal events in order to colonize new environments. Mechanisms by which biofilms regulate dispersal, including enzyme-mediated breakdown of the biofilm matrix (177), and the production of surfactants which loosen cells from the biofilm (64), can also be under the control of quorum sensing systems (258). Dispersal processes are only beginning to be explored and will be an important area of research for the future.
The existence of multiple quorum-sensing systems in bacteria that are organized differently, such as by being coupled to one another or be completely independent, offers an array of knowledge that can be explored further in other bacterial species. This level of complexity with a hierarchical luxI-luxR –type quorum sensing has also been reported for the plant symbiotic bacterium R. leguminosarum (187). A further understanding of how quorum sensing components work cooperatively to control gene expression of certain phenotypes, could provide clues for their biological effects in natural environments or on virulence in human infections.
1.3 Ecological aspects of bacterial intercellular signalling
With an understanding of the underlying molecular mechanisms of communication systems, this part of the review focuses on significant roles that
30 Chapter 1 signalling molecules play in microbial ecology and what is known about how different species of quorum sensing bacteria interact with one another in natural habitats of heterogenous communities. It is important to consider not only the opportunity for cooperative behaviour mediated by quorum sensing among individuals, but also competition arising between species in the same environment.
1.3.1 Intraspecies signalling
As described above, coordinated expression of quorum sensing phenotypes, by a large population size of a critical threshold, is pivotal and advantageous to the success of organisms, especially those with pathogenic behaviour, to survive host defence mechanisms (156). This is observed in the plant pathogen, A. tumefaciens, which relies on the quorum sensing system to regulate the conjugal transfer of oncogenic Ti plasmids to plant cells (108). Results obtained in a study by Piper and Farrand, suggest that a high number of donor cells within a population is beneficial to regulate Ti plasmid conjugal transfer, because of the inefficient manner by which recipient Agrobacterium cells inherit the Ti plasmids (247).
Intraspecies communication is often employed by bacteria to monitor their own population size in complex environments to ensure sufficient organisms have been amassed to express relevant phenotypes. Further, because bacteria are almost always found in multi-species communities, by expressing genes whose products are beneficial to the population, it is also important to ensure these benefits are shared by cells of its own species in the vicinity (24). Hence, to discriminate between signalling molecules produced by their own species and those produced by other bacterial species, a high degree of specificity for the signal for its cognate receptor (LuxR-like protein) would reflect a high density of its own cells in the environment.
31 Chapter 1
1.3.2 Interspecies signalling
Although quorum sensing has predominantly been studied for self species, the widespread occurrence of acyl-HSL-based cell signalling among Gram-negative bacterial species and the restrictive structural diversity of signalling molecules produced by many organisms (346) suggest multispecies quorum sensing is likely to occur in environments that different acyl-HSL-producing bacterial species commonly inhabit (Table 1.2). For example, cell free extracts of wild-type P. aeruginosa were reported to induce the formation of quorum sensing-regulated exoproducts in Burkholderia cepacia, in lung infections of cystic fibrosis patients (202). Similarly, interspecies interactions between Streptococcus gordonii and Veillonella atypica in the human oral cavity boosts nutrient flux through the community, in which one strain produces a signal that alters the metabolism of the other, wherein disruption of balanced sugar metabolism gives rise to tooth decay (90). Numerous studies have also indicated that various luxR homologues, such as that of A. tumefaciens and Chromobacterium violacein, are capable of interacting with non-cognate acyl-HSL molecules of various acyl lengths (281, 350).
1.3.2.1 LuxR interacting with more than one species of luxI homologue gene product
From proteobacterial genome sequencing, there is evidence that there are organisms that possess more LuxR-type proteins than LuxI homologues in their quorum sensing systems (103). For example, as previously indicated, P. aeruginosa contains two quorum sensing systems (lasI/R and rhlI/R) but also contains qscR that can respond to lasI, rhlI-generated signals and even 3-oxo- decanoyl-L-HSL (ODHL) (174, 179). Another example is ExpR from Sinorhizobium meliloti, a LuxR-type protein, which has a major role in regulating the quorum-sensing network in the microbe by responding to acyl-HSL(s) synthesized by the sinRI regulatory pair, a second quorum sensing system harboured by the same organism (143, 241). These additional acyl-HSL receptors could serve as a means to expand its repertoire of environmental sensing controls and integrate multispecies signalling with cohabiting microbes. Similarly, R. leguminosarum bv. viciae has three quorum sensing networks, cin, rai and tra,
32 Chapter 1 with an additional LuxR-type protein, BisR, that does not have a cognate acyl- HSL enzyme. BisR induces the expression of traR, which controls the conjugal transfer of plasmids to potential recipient cells in the presence of 3-oxo- tetradecanoyl-L-HSL (OtDHL), produced by cinI. Since bisR negatively regulates the expression of cin, conjugation can only occur when other OtDHL-producing bacteria (eg. the recipients such as A. tumefaciens), are established at high levels in the environment (63). Thus, there is evidence that cross-talk exists between species that share similar habitats and community functions.
1.3.2.2 Bacterial strains producing more than one luxI gene product
Similarly, luxI homologues may have evolved to direct the synthesis of multiple acyl-HSL molecules, such as the yenI dependent production of both hexanoyl-L- HSL (HHL) and OHHL in Yersinia enterocolitica (316). The swrI gene in Serratia liquefaciens is also responsible for the synthesis of both BHL and HHL, at an approximate ratio of 10:1 (86). Thus cell communication systems can involve sophisticated networks that could be controlled by exogenous signals or the integration of a variety of signals. However, it has been shown that other species of acyl-HSL expressed by another community, block activation of the LuxR homologue even when assayed in the presence of its cognate acyl-HSL (45, 234, 270, 364). This behaviour was observed in the substantial reduction in quorum-sensing regulated exoprotease activity in Aeromonas hydrophila when OdDHL was exogenously added with the ahyI+ parent strain that produces the cognate signal, BHL (310). The production of multiple acyl-HSLs by bacteria could be a strategy to interfere with the ligand binding site on the receptor protein of other bacteria, as a means of providing a competitive edge for themselves in nature, even if they do not utilize these molecules to regulate physiological processes of their own. This phenomenon mirrors the medical application of quorum sensing inhibitors to control infection.
33 Chapter 1
1.3.2.3 The lack of luxI homologues in some bacterial strains that possess luxR homologues
Bacteria that contain a luxR but not luxI homologue have been identified in Salmonella typhimurium and Escherichia coli (2, 334). Both microorganisms have a luxR homolog, sdiA, but do not produce any detectable acyl-HSLs (292, 334). Importantly, even though their receptor proteins do not interact with the AI-2-like molecules produced by the strains themselves (152, 292, 308), sdiA has been shown to respond to exogenous acyl-HSLs and to regulate virulence-related functions in S. typhimurium (2) and biofilm formation in E. coli (152, 173, 292, 334), phenotypes that convey competitive advantages to the population. However, how bacteria evolved to contain incomplete quorum sensing regulatory systems with only luxR homologs in their genome, is uncertain. The suggestion of quorum sensing genetic machinery such as luxR homologues being due to lateral transfer of coding genes is plausible (291), despite the fact that evidence of completed bacterial genomes with only the luxI homologue has not been found (38). Alternatively, the use of the luxR homologs to eavesdrop on quorum sensing performed by competing bacteria in the environment and to modulate interaction with its competitor(s) is one possible reason.
Given that bacteria rarely live in monoculture but rather in complex mixed communities, it would not be surprising that they have evolved the ability to eavesdrop. The ability to sense acyl-HSL production and even confuse the normal communication of the other species would provide an advantage. Hence, interspecies quorum sensing is likely to have an important function, synergistic and competitive, in the dynamics of these microbial communities.
34 Chapter 1
Table 1.2 Examples of multi-species quorum sensing interactions Goals of multi-species Associated bacterial species Reference interactions Synergistic Higher growth rates and Sphingomonas capsulata (285) motilities Methylobacterium sp.
Enhanced biofilm biomass by Microbacterium phyllosphaerae (29) enzyme complementation Shewanella japonica Dokdonia donghaensis Acinetobacter lwoffii
Protection of one or several Microbacterium phyllosphaerae (29) species from eradication even Shewanella japonica when biofilm is exposed to Dokdonia donghaensis external stress factors Acinetobacter lwoffii
Metabolic synergy for P. putida (296) biodegradation of toluene and Acinetobacter sp. related aromatic compounds
DMP1 mitigate inhibitory effects Pseudomonas sp. strain GJ1 (54) of p-cresol on GJ1 B. cepacia
Virulence in lungs of cystic P. aeruginosa (202) fibrosis patients B. cepacia
Sugar metabolism in human oral Streptococcus gordonii (90) cavity Veillonella atypica
Plasmid conjugation R. leguminosarum bv. viciae (63) A. tumefaciens Antagonistic Production of bacteriocins by P. P. tunicata (252) tunicata to compete for Isolated bacteria from the substrates marine plant, Ulva lactuca
Lowering of pH by members of Actinomyces naeslundii (30) the biofilm consortium S. salivarius
35 Chapter 1
1.3.4 Quorum sensing interference
Under alkaline conditions, acyl-HSLs are usually unstable and lactonization of OHHL has been shown to occur in vitro at high pH (84). By actively pumping H+ into plant cells to increase the pH (> 8.2) of its surrounding fluids (10), this response by E. carotovora slows down quorum sensing regulation during early stages of plant infections, to evade the host defence mechanism (32, 216). It represents an example of the ecological relevance of the disruption of intercellular communication in the natural environments.
Similarly, acyl-HSL degradation activity by lactonase enzymes such as AiiA, initially discovered in Bacillus strain 204B1 (77), are possessed by A. tumefaciens (encoded by aiiA homologues, attM and aiiB genes, on plasmids) (37) and known to degrade its own native acyl-HSLs. These could be common strategies that many bacterial pathogens have adopted during evolution to ensure their survival in host-pathogen interactions by exiting quorum sensing-dependent activities during early stages of growth (12). Several well-documented examples of signal degradation mechanisms such as the acylases or lactonases produced by P. aeruginosa (146), Ralstonia strain XJ12B (185) and Arthrobacter strain IBN110 (230) suggest acyl-HSL degradation is relatively widespread among diverse bacteria. Further sequence homology searches for acyl-HSLase activities in genomes of different bacteria, based on the conserved motif identified from known acyl-HSLase genes, were detected in organisms such as Bacillus stearothermophilus, Klebsiella pneumoniae KCTC2241 and archaea, Thermoplasma volcaium GSS1 and Sulfolobus solfataricus P2 (230). Another possibility is that acyl-HSL degradation in such bacterial systems, could also be an effective control of quorum sensing signal turnover, critical to biological processes such as cell cycle progression (360).
Besides acyl-HSL-inactivation enzymes, several natural products were identified that also interfered with the acyl-HSL system. They include the antimicrobial triclosan, that interferes with the pathways involved in HSL biosynthesis in P.
36 Chapter 1 aeruginosa (144). Halogenated furanone compounds produced by marine red alga Delisea pulchra were also found to inhibit acyl-HSL-based quorum sensing by mimicking the native acyl-HSL signal and occupying the binding site on response regulatory proteins (191).
Much can still be learned about the role of such acyl-HSL degrading activities in the natural ecosystem. Other than the likely function to circumvent quorum sensing for a competitive advantage over their acyl-HSL producing competitors, it has been reported that acyl-HSLs provide a nutrient source for carbon and nitrogen for isolates such as Pseudomonas strain PAI-A (146) and Variovorax parodoxus (171). However, it was recently demonstrated that acyl-HSLs may not be the preferred source of substrate for these microbial systems (36). Further, whether the amount of acyl-HSL degradation resulting from growth metabolism is sufficient to impact acyl-HSL signalling remains uncertain (327).
Since acyl-HSL-mediated signalling mechanisms are widespread and play important roles in the control of virulence gene expression in pathogenic bacteria, quorum sensing signals represent potential molecular targets for disease control. For example, quorum quenching serves as an alternative strategy to combat infections caused by antibiotic-resistant bacteria, such as hatchery-bred Vibrio species, which produces virulence factors controlled by their quorum sensing systems. This was successfully shown when brine shrimp larvae had a lower mortality rate when furanones were added to culture water that contained different pathogenic Vibrio isolates to disrupt signal-mediated signalling (68). The use of aiiA expression as a biocontrol strategy for plant infections caused by E. carotovora has also been reported by Zhang and coworkers in transgenic tobacco and potato (78, 79). Expression of the aiiA homologue, aiiD, in P. aeruginosa was found to eliminate acyl-HSL based cell-to-cell communication, biofilm formation and virulence on Caenorhabditis elegans (184). Similarly, strains of P. aeruginosa defective in OdDHL production, form abnormal monospecies biofilms that are sensitive to low concentrations of biocides (65), in contrast to that of wild-type P. aeruginosa biofilms. Signalling can be blocked at the levels of synthesis, stability, and perception of the signal, and integration of signal interference mechanisms in the prevention of disease opens up alternative
37 Chapter 1 prospects to conventional antibiotics, which harm beneficial natural microbial flora and are likely to be responsible for the development of resistant mutants.
1.4 Wastewater treatment process
The use of activated sludge in wastewater treatment processes was developed around 1912 – 1914, to deal with the treatment of sewage and industrial wastewaters. Since its invention, it is the most widely used biological treatment process to remove organic and inorganic compounds from wastewater (53, 245). The process relies on suspended microorganisms, otherwise known as activated sludge, which forms cell aggregates called flocs, that feed on the carbonaceous organic contaminants of wastewater for the production of new cells (123). “Healthy” sludge is dependent upon the occurrence of bioflocculation that allows efficient settling of sludge to achieve an effective solids-liquid separation (349).
Municipal wastewater treatment can be divided into three treatment levels. In primary treatment, large solid particles from the wastewater are removed by filtration before being moved to the first sedimentation tank. Once there, heavy particles, also known as grit, that sink to the bottom, and floating material such as grease and oil that rise to the surface, are removed. The remaining wastewater then moves on to secondary treatment, where activated sludge is used for the removal of organic matter. Tertiary treatment is used for further nutrient removal, particularly of nitrogen and phosphorus. Disinfection, to remove pathogenic organisms, can also occur at this stage. The treated effluent is generally discharged into waterways or used as reclaimed water for non-potable purposes.
Secondary and tertiary treatments of wastewater include biological processes, typically performed by indigenous, water-borne microorganisms. The activated sludge process in secondary treatment generally consists of four basic steps, as illustrated in Figure 1.3. In the first step, the influent wastewater is seeded with activated sludge, to begin the removal of suspended organic matter (123). This process is aerobic and takes place in an aeration tank, where the biomass is kept in suspension, increasing the contact time between the biomass and the wastewater
38 Chapter 1
(176). It promotes the growth of biological flocs that substantially removes organic material. In the second step, the wastewater is moved to a sedimentation tank, where it is allowed to settle, separating the activated sludge from the treated wastewater. This generates an effluent that is removed for further treatment. In the third step, the activated sludge is recycled back into the aeration tank and used to seed the next influx of wastewater. In the final step, the rest of the activated sludge is removed from the system as waste for further treatment prior to disposal.
Tertiary treatment, used for nutrient removal, can take place with some modifications of the basic activated sludge process (123). Nutrient removal is a crucial part of wastewater treatment because it ensures that treated effluent discharged into waterways contains low levels of nitrogen and phosphorus. Without it, the nitrogen and phosphorus levels in the effluent would result in eutrophication of the receiving waterways, causing excessive primary production and decay, and ultimately, leading to reduced oxygen availability and water quality.
In tertiary treatment, nitrogen removal occurs by biological nitrification and denitrification processes. Modified activated sludge processes for biological nutrient removal are different to the basic process, in that the activated sludge is circulated through a series of anaerobic, anoxic and aerobic zones. Each zone has a different electron acceptor (123). In the anoxic zone, nitrate acts as the electron acceptor during denitrification. Finally, in the aerobic zone, where nitrification takes place, oxygen is the electron acceptor. Variations in the design of the process achieve different levels of nutrient removal. Nitrogen removal by nitrification and denitrification processes is described below (1.4.3).
39 Chapter 1
2. Sedimentation Tank 1. Aeration Tank Effluent Clarified water Influent Mixed liquor (a) (b) (c) 4. Waste Activated Sludge 3. Return Activated Sludge
Figure 1.3 Basic steps of the activated sludge process. 1. Activated sludge is mixed with influent wastewater and moved to an aeration tank where organic matter is oxidized aerobically. 2. Treated water is separated from sludge in a sedimentation tank producing effluent that is low in suspended solids and further treated to remove nitrogen and phosphate via (a) anaerobic, (b) anoxic and (c) aerobic zones. 3. Part of the settled sludge is recycled and used to seed the next influx of wastewater. 4. The rest of the settled sludge is removed as waste for further treatment prior to disposal. (Adapted from (211))
40 Chapter 1
1.4.1 Activated sludge
Activated sludge flocs are made up of microbial colonies embedded in extracellular polymeric substances (EPS). The EPS are metabolic products synthesized by microorganisms and excreted by active transport or are cell lysis by-products (212). Among the members of the activated sludge community, which includes protozoa, metazoa, and fungi, bacteria constitute the majority of microorganisms. Although both aerobic and anaerobic bacteria may exist in the activated sludge, the majority of species are facultative, able to live in either the presence or absence of dissolved oxygen (123). Bacteria that require organic compounds for their supply of carbon and energy (heterotrophic bacteria) predominate, whereas bacteria that use inorganic compounds for cell growth (lithotrophic bacteria) occur in proportion to ratios of nitrogen to carbon in the wastewater (124). Floc stability is crucial during wastewater treatment since weak flocs can fall apart due to shear forces of the plant machinery which leads to dispersed bacteria or increased turbidity in the effluent (282). Filamentous organisms grow within a floc and give it structural strength, with few filaments protruding out into the surrounding bulk solution. However, if filamentous organisms occur in high numbers, they can cause bulking of the sludge due to excessive EPS production (183, 194). Floc size and density are also critical parameters that contribute to proper settling of activated sludge. Poor separation properties between effluent and sludge, including sludge bulking and foaming, have commonly been known to be the cause of operational problems at most treatment plants (349).
Protozoa have been shown to be important for the adequate functioning of activated sludge, by preying on dispersed bacteria, producing a good quality effluent (57). The aggregation of microbial cells could be a trigger mechanism to protect bacteria against protozoa predation, since bacterial cells living in a matrix of extracellular polymers are difficult for predators to graze (20).
41 Chapter 1
1.4.2 Organic carbon removal
The metabolism of organic carbon is the most important process in biological wastewater treatment. Organic matter from wastewaters consists of a complex mixture of molecules and hetero-biopolymers of lipids, proteins, sugars, nucleic acids, and humic substances (218). The steps taken to remove organic compounds, after contact with activated sludge, include biosorption, which includes the simultaneous transport of particles into the activated sludge flocs, followed by the adsorption of colloidal organic materials within the flocs (320). This step is followed by hydrolysis of high molecular mass organic compounds by extracellular enzymes (358) and subsequent accumulation of soluble single organic molecules in bacterial cells (131, 340).
The above processes are very fast, generally not exceeding a few minutes (249), and most organic substances are removed from the bulk liquid shortly after contact of wastewater with the activated sludge. The extent of substrate removal by biosorption is dependent upon the amount of contact achieved between the substrate mass and the mass of activated sludge. Biosorption also depends on the microbial community of the activated sludge, favouring good settling flocs with a small constituent of filamentous bacteria (88).
Most of the organic substances available to the cells at the biosorption step are in a form not suitable for intracellular metabolism as the molecules of sorbed organic compounds are too large for them to permeate through cell membranes. These organic polymers, with polysaccharides, lipids and proteins being the most common high molecular mass compounds found in wastewaters, have to be degraded by extracellular enzymes to smaller structures, with only few monomers in the chain or directly to monomers, before their enzymic transport through the cell membrane (34, 101). Hence, extracellular enzymes such as proteases, - amylase, and -glucosidase play essential roles in the biological wastewater treatment processes. The degradation of organic polymers to monomers forms the first part of organic carbon metabolism depicted in Figure 1.4. After the extracellular hydrolysis of organic polymers, the fragments of polymers and
42 Chapter 1 single molecules are taken up by the cells, where they are metabolised by the cell‟s internal enzymic apparatus for energy and carbon sources, leading to the synthesis of new biomass.
Organic ‘Biosorption’ substrate Extracellular hydrolysis
Soluble Hydrolysis substrate products
Cell Wall
Intracellular metabolism
Figure 1.4 Degradation of organic polymers to monomers from wastewater by activated sludge microorganisms. (Modified from (336))
43 Chapter 1
Frolund (1995) (101) suggested that the extracellular hydrolysis of organic polymers to simpler molecules could be the overall rate-limiting step for the removal of organic matter in activated sludge treatment processes. The exoenzymes in activated sludge can originate from the incoming wastewater, activated sludge by cell lysis, or from the secretion of bacterial cells. However, the majority of the extracellular enzymes found in wastewater are immobilised in flocs (102).
The profiles and proportion of exoenzymes present in wastewaters can differ among different wastewater treatment plants. However, the substrate chemical composition is an important indicator for deciphering enzymatic differences in wastewater. This was demonstrated by Nybroe et al. (1992) (223) who measured high levels of leucine aminopeptidase activity, as compared to other enzymes in the Asa (Denmark) treatment plant. That finding corresponded to the results of Raunkjaer et al. (1994) (254) who found proteins to be the most abundant fraction in the wastewater of a similar treatment plant. Another example described how the level of glucosidase activity corresponded to the abundance of heterotrophic bacteria that take up glucose in an aquatic ecosystem (49). It suggests that the enzymatic distribution in sludge flocs is also likely to reflect the microbial community structure in wastewater. Hence, the organic removal process depends on the ability of the microbial species to produce extracellular enzymes that can break down available organic contaminants in the wastewater for oxidative metabolism (223). Other possible causes for short-term enzymatic variations include enzymes from the influent wastewater and the presence of toxic compounds that could affect the livelihood of sludge organisms (101). A better understanding of the distribution of enzymes in different fractions of activated sludge should offer a more thorough understanding of biological processes in wastewater, and lead to even higher removal efficiencies of organic matter or better control over the treatment process.
44 Chapter 1
1.4.3 Nitrogen removal
The removal of nitrogen during the treatment of waste is very important to prevent eutrophication in many of our ecosystems. If not treated properly before release into the environment, nitrogenous wastes have the potential to acidify downstream ecosystems (16), such as soils (165), streams and lakes, groundwater, and oceans (112), causing significant impacts on human health, vegetation and terrestial life.
The first step in the removal of nitrogen during the treatment of waste is biological ammonia oxidation. It involves the conversion of NHx to nitrogenous – oxides (N2O, NO, NO2 ) catalysed by monooxygenase enzymes of chemolithoautotrophic ammonia-oxidizing bacteria (AOB). The nitrogenous – oxides, in turn, are converted to NO3 , carried out by nitrite-oxidizing bacteria (NOB), to complete the oxidation (331). These two aerobic transformations are collectively termed nitrification. Total nitrogen is subsequently removed by denitrification, which converts (or reduces) nitrate to gaseous nitrogen (N2) in the absence of oxygen (124). Examples of chemolithotrophic nitrifying microorganisms found in activated sludge are species mainly belonging to genera of the beta-Proteobacteria. Nitrosomonas and Nitrosococcus (331) are involved in the oxidization of ammonia to nitrite, and Nitrobacter, Nitrospira and Nitrospira- like bacteria, oxidise nitrite to nitrate (150). These microbes utilize energy generated from the oxidation of ammonium, and obtain their main source of carbon from carbon dioxide.
Nitrifying bacteria are slow-growing and require a longer retention time almost an order of magnitude longer than that required by heterotrophic bacteria in sludge, to stay in the system (123). Due to their growth characteristics, nitrifying bacteria can be easily driven to extinction in systems with high loading rates, where sludge retention time is short, resulting in heterotrophs dominating in the competition for nitrogen (215). Hence, it is necessary to adjust sludge operational parameters such as the retention time required to ensure sufficient nitrifying bacteria are retained in the system to allow nitrification to take place for adequate nitrogen removal.
45 Chapter 1
Other parameters that can affect the activity of nitrifying bacteria in the system include oxygen concentration, pH and temperature (87).
The metabolic ability of anaerobic ammonium oxidising bacteria toconvert ammona to form nitrogen gas, had led to the assimilation of up to 60 % of the total nitrogen turnover in the wastewater environment (231, 238). Considering the significant ecological role of these bacteria responsible for nitrogen recycling in the ecosystem, their metabolic activities have become a main focus in wastewater treatment.
1.4.4 Acyl-HSLs and activated sludge
The diversity of the microbial floc community is dominated by the Alpha-, Beta- and Gammaproteobacteria, as well as the Bacteriodetes and the Actinobacteria (331). The high cell density of activated sludge flocs is likely to result in a multitude of interactions between cells but very little is known about these interactions and the impacts they have on activated sludge structure and function.
Acyl-HSL-mediated gene expression is currently known to be used by three out of five classes of Proteobacteria (alpha-, beta- and gamma), with approximately 7 % of genera within these classes containing known acyl-HSL producing representatives (38). Albeit a small proportion of the phylogenetic tree, such acyl- HSL-producers are abundant in the environment, with activated sludge being no exception, highlighting the importance of acyl-HSL-mediated gene expression in these complex ecosystems (193). The direct detection of acyl-HSLs in environments such as river limestone rocks, tomato rhizospheres in unsterile soil and tissue of marine sponges, further support the suggestion that acyl-HSL signalling is important in the environment (205, 299, 312).
As described above, the ability of acyl-HSLs to diffuse through cell membranes means that activation of gene expression by this mechanism is dependent on the number and density of acyl-HSL producing cells, which dictates the acyl-HSL production rate, in the environment. This quorum sensing process also depends on
46 Chapter 1 the ability of the extracellular environment to retard diffusion of acyl-HSLs away from responsive cells. For example, acyl-HSL mediated gene expression is active in biofilms, which is attributed to the spatial structure of this high density biomass (65). Mason and coworkers also showed acyl-HSL responsive cells covered by a layer of cells responded better with acyl-HSL producers mixed in the assemblage than exogenously added acyl-HSLs, reflecting the potential of cells to act as a diffusion barrier to acyl-HSL movement (195). It suggests the possibility that acyl-HSLs could be retained in trapped environments such as activated sludge flocs to perform acyl-HSL-mediated activities.
Acyl-HSL mediated gene expression regulates the secretion of multiple extracellular degradative enzymes such as elastase, chitinase, cellulase and lipase (118), that can cause extensive damage to plants (199), and humans (348). Quorum sensing also controls the synthesis of antibiotics (carbapenem, pyocyanin) in organisms such as E. carotovora to eliminate competing microbial communities in the vicinity. Siderophore production is also known to be modulated by the lasR-lasI regulatory circuit in P. aeruginosa, when cells are grown under iron-limiting conditions (304). The expression of biosurfactants, controlled by acyl-HSLs in S. liquefaciens, serves to condition surfaces prior to swarming to allow colonization of large areas (186). Another quorum sensing regulated example is the conjugal transfer of plasmids by the plant pathogen A. tumefaciens to host plant cells (361). Relatively few studies have been carried out on the functional activities within a floc, that might contribute to sludge properties and to identifying the bacteria and key players responsible for them (219). It is conceivable that all the phenotypes described above have a selective advantage in activated sludge and may therefore have an impact on its structure and function.
Understanding acyl-HSL mediated gene expression in activated sludge is of interest for two reasons. Firstly, it may create opportunities to improve sludge performance by introducing acyl-HSL molecules or optimising growth conditions to favour acyl-HSL producers and their quorum sensing activities, which could facilitate the breakdown of large organic carbon contaminants found in activated sludge. Secondly, it represents an excellent model system for understanding intercellular signalling in mixed species communities. There have been reports of
47 Chapter 1 the isolation of acyl-HSL-producing bacteria in sludge systems, comprising members of the Aeromonas and Pseudomonas genus (93), indicating the likely presence of acyl-HSLs in the ecosystem. Linking possible metabolic activities associated with signalling in sludge was investigated by Valle and coworkers (321) who observed changes in community structure and phenol degradation rates, when sludge was treated daily with OHHL, addressing the impact of intercellular signalling on the ecology of sludge. It was also reported by Batcherlor et al. (15) that acyl-HSL molecules increased the recovery response rate of starved Nitrosomonas biofilms to fresh nutrients. This condition is beneficial to the microbial communities in sludge, where nutrient levels are unstable, and the ability to respond to a sudden increase in concentration of nutrients in a competitive environment is of particular importance. It is not known if acyl-HSLs are produced at biologically relevant concentrations in sludge or what phenotypes might be regulated by acyl-HSL mediated gene expression.
1.5 Bacterial acyl-HSL biosensors
To evaluate the prevalence of quorum sensing in natural bacterial habitats, it is important to demonstrate the presence of acyl-HSL compounds in such environments. Acyl-HSLs from bacterial strains or environmental samples have been identified by physical techniques such as mass spectrometry (MS) (122) and gas chromatography (GC)-MS (42, 147). In addition, biological methods using bacterial sensor systems for acyl-HSL detection have also been developed.
Biological assays used to detect acyl-HSL molecules include the utilization of a biosensor that does not produce acyl-HSL, such as E. coli, as the host for quorum sensing plasmids that contain a functional LuxR-family protein cloned with a target promoter (usually the promoter of the cognate luxI homologue synthase), which positively regulates the transcription of a reporter gene. Examples of quorum sensing plasmids include the bioluminescence sensor plasmid pSB401, controlled by the V. fischeri luxR regulatory system and the luxI promoter (351), and the pKDT17 plasmid, containing the P. aeruginosa LasR transcriptional protein inducing beta-galactosidase activity (lacZ) under the control of a lac
48 Chapter 1 promoter (235). The choice of a background strain used also appeared to be crucial for the efficient functionality of the sensor plasmids. For example, both las- and cep-based sensors worked well in Pseudomonas putida, but not in S. liquefaciens. Conversely, the lux-based sensor cassette functioned well only in the latter strain (299). Bacteria with native quorum sensing systems, for example cviI/R of C. violaceum which produces HHL and regulates violacein production, has also been genetically modified using transposon mutagenesis, to generate a violacein and acyl-HSL-negative mutant CV026, that responds to exogenous acyl- HSLs (197).
Acyl-HSLs produced by different bacteria can vary in terms of length of their acyl chains from C4 to C14, and substitution at position C3, which can be either unmodified or carry an oxo- or hydroxyl group. LuxR-type proteins display preferential binding for the acyl-HSL produced by the cognate LuxI family protein, guaranteeing a good degree of selectivity. To some extent, LuxR-family proteins can also respond to acyl-HSLs of different length and substitution of the acyl-chain moiety, but with less sensitivity the further the acyl-HSL structure diverges from the cognate signal. For example, as compared to its natural acyl- HSL, CV026 responds six fold less to both OHHL and OHL, and has almost no response to OBHL and acyl-HSLs with acyl chains with ten carbon atoms or more (300). CepR from B. cepacia and LuxR from V. fischeri cover acyl-HSLs of medium length (C6 – C8), and LasR from P. aeruginosa responds to long (C10 – 12) acyl chains, together with their 3-oxo derivatives. Both AhyR from A. hydrophila and RhlR from P. aeruginosa are sensitive to short chain length HSLs (C4). However, TraR from A. tumefaciens is known to respond to the broadest range of HSLs of C4 to C12, including 3-unsubstituted and C6 to C10 hydroxyl- HSL, but not BHL (39, 92). Other than TraR, only PhzR of Pseudomonas fluorescens has been shown to be capable of also detecting 3-hydroxy-HSLs, and of the same range by A. tumefaciens (157). Being restrictive to acyl-HSLs of a certain length, could be a limitation in the use of such biological assays. For complete coverage of known acyl-HSLs, it would be necessary to use multiple reporter strains that respond to a wide spectrum of acyl-HSL molecules.
49 Chapter 1
Biosensors have been used to detect and quantify acyl-HSLs in many strains in their natural environments, such as biofilms (323), marine communities (312), soil (28) and plants (299). From the active expression of the lacZ reporter gene, McLean et al. (205) found evidence of acyl-HSL activity in aquatic biofilm- covered rocks, when the environmental sample was incubated next to the reporter strain, A. tumefaciens A136, on agar medium. Bacteria isolated from marine snow were also assessed for their acyl-HSL producing abilities, using similar detection methods on agar and in solution from cultured supernatants (126). Except for violacein production, reporter activity using bioluminescence, green fluorescence and expression of -galactosidase, can be quantified.
1.5.1 Thin-layer chromatography
Acyl-HSL detection methods are typically, preliminary screenings following a biological assay in a thin-layer-chromatography (TLC) overlay format (126, 300), which is widely used to give tentative identities to the types of acyl-HSL molecules in the extract. It involves the extraction of acyl-HSLs from the sample using an organic solvent (eg. acidified ethyl acetate), loading onto C18 reversed- phase plates, with appropriate reference (known acyl-HSL compounds) and separation out into the liquid organic phase. After drying of the plate to remove the solvent, a soft-agar seeded with a biosensor is overlaid and the acyl-HSLs detectable by the reporter activity are identified by their characteristic mobility measured by their Rf values, the migrated distance divided by the length of the migrated front.
Besides the characteristic Rf value, the acyl-HSLs also have a specific shape on the TLC plate depending on the C3-substitution. 3-oxo-HSLs have long tails and diffuse edges, 3-hydroxy-HSLs migrate with the same Rf value as their 3-oxo analogs but without tailing and diffuse edges, and unsubstituted-HSLs migrate with lower Rf values than substituted analogs with equally long carbon chains (197, 281). The most common forms of bacterial acyl-HSL biosensors for the TLC bioassay include C. violacein CV026 and A. tumefaciens A136. Although the identities of the acyl-HSL molecules can only be confirmed by MS, it has
50 Chapter 1
been shown that the Rf values and spot shapes, used to predict the species of the acyl-HSLs by the TLC assay corresponded accurately to results from MS (281).
1.5.2 In situ applications of acyl-HSL biosensors
It is usually difficult to study quorum sensing in complex microbial habitats such as soil, biofilms and in activated sludge, using classical destructive methods, such as extraction of signal molecules (28, 43). Typically this is due to low active acyl- HSL concentrations present in the environment (28). Also, to obtain acyl-HSL extracts from large volumes of environmental samples is problematic. For example, high levels of impurities from environmental samples, such as lipids and proteins, can interfere with the extraction.
The introduction of whole-cell biosensors with fluorescent or bioluminescence reporter genes for in situ monitoring of acyl-HSLs in natural environments is being increasingly used to address this problem. Several groups have developed biosensors that successfully detected bacterial signal molecules in communities such as in the plant rhizosphere (299) and during degradation of litter in soil (28). This technique was also applied for further investigation of physiological conditions in clinical settings. For example, in situ production of acyl-HSLs in the lungs of immunocompromised patients suffering from cystic fibrosis, revealed such signalling compounds to be responsible for the virulence of a prevalent opportunistic pathogen, P. aeruginosa, in humans (354). Gfp-based acyl-HSL sensors have also been used for analysing quorum-sensing inhibition activity by halogenated furanone compounds in swarming colonies of S. liquefaciens MG1 (253).
1.5.3 Advantages of biosensors
The main advantage of whole cell biosensors is that it allows in situ visualization of acyl-HSL-mediated communication between bacteria at the non-destructive single-cell level in their natural environments. More importantly, it reflects the microbial ecology of different niches or microcosms in the specific environment.
51 Chapter 1
Firstly, it is possible to study the localised accumulation of acyl-HSL molecules that would preferentially occur in the environment. An example is the capability of acyl-HSLs produced by bacteria colonizing the rhizosphere to spread over relatively long distances in the rhizosphere, and not just within microcolonies (299). Also, acyl-HSL-mediated gene expression in aggregates of acyl-HSL- producing Pseudomonas syringae cells was observed by Gullen et al. on specific parts of leaf surfaces (81).
Secondly, whole cell biosensors depict complex spatial interactions that could take place in the environment. For example, interpopulation signalling was observed among wheat rhizosphere bacteria (246) and interspecies communication was observed between P. aeruginosa and B. cepacia in lung tissues of infected mice using gfp sensors (259). Finally, the real-time biological availability of acyl-HSLs in a community can also be investigated by using unstable variants of GFP, which transiently expresses fluorescence in the presence of acyl-HSLs, as a biosensor reporter system (4). This can provide new insight into the dynamics of acyl-HSLs in the environment, whose stability can be affected by factors such as degradation and utilization as food by other microorganisms (146, 172). In such highly competitive environments, it is also advantageous to use gfp as a reporter system since it does not require exogenous substrates, needs only very little amounts of oxygen to be expressed, and is not toxic to the bacterial cells (5). Nevertheless, the limitations for the GFP system include the slow maturation time for GFP oxidation, which results in the inability of GFP fluorescence to monitor rapid changes in gene expression (257).
1.6 Evolutionary biology of microbial social behaviour
Microorganisms have been shown to act not as individuals, but to communicate and cooperate in a multicellular way to perform activities such as dispersal, foraging, construction of biofilms, and signalling (56).
Much of social evolution theories, such as altruism and natural selection, developed to explain known cooperative behaviours among living systems, were
52 Chapter 1 largely concerned with the context of insects, mammals, and birds (343). However, the large variety of social behaviours discovered in microbes, offer numerous opportunities to test how generally those theories can be applied. Even though microbes were not the subject of the development of the theories, their social behaviours are suggested to be similar to those performed by insects, vertebrates and humans. For example, the social motility of M. xanthus cells across surfaces in search of bacterial prey resembles that of the predatory behaviour of hunting wolf packs (71). The enclosed structure of biofilms that encapsulates a population of bacterial cells in a polysaccharide matrix, have been likened in nature to ant nests or beehives (56).
This part of the literature review aims to explain the social behaviour of microbes in an evolutionary perspective and to provide experimental studies in microbe systems that test these social evolution theories.
1.6.1 Costs of cell-cell communication
In many situations, a group venture is not worth considering, unless there are a sufficient number of collaborators to make it worthwhile. Hence, cell density dependent behaviours such as acyl-HSL-mediated gene expression can be explained as an evolutionary adaptation to an environment where it is favourable for cells to cooperate for a selective advantage at a population level (138).
Public goods, such as acyl-HSLs, are cooperative products (71) that are manufactured by an individual and can be utilized by the individual or its neighbours. Other public goods include extracellular products for nutrient acquisition (74), antibiotics (261), immune-modulation molecules (25), antibiotic- degrading molecules (for example, beta-lactamases) (80) and biosurfactants (for example, rhamnolipids) for motility (324). This extra metabolic burden on the cell to produce such public goods would create an opportunity for cheats to evolve in the population who do not contribute to the behaviour (since it already exists) but exploit the exoproduct production of others and benefit from the population.
53 Chapter 1
Without expending resources, cheats have a growth advantage but this decreases the average fitness of individuals within a population (26).
To demonstrate the problem of cooperation in a microbial context, iron- scavenging molecules called siderophores, are considered public goods that are produced by many bacteria, such as P. aeruginosa (342). Siderophore production is beneficial when iron is limiting, as shown by the fact that the wild type that produces siderophores outcompetes a mutant that does not, when the strains are grown in pure culture. However, siderophore production is also metabolically costly, as demonstrated by the fact that mutants outcompete wild-type strains in an iron-rich environment. Consequently, in mixed populations where both wild- type and mutant bacteria are present, the mutants can gain the benefit of siderophore production without paying the cost, and hence increase in frequency (130).
In the context of quorum sensing, there is a theoretical cost to producing a signal molecule and responding to a signal, and it is likely that the cost of responding is far more expensive metabolically (156). An example is the higher growth yields of P. aeruginosa quorum sensing mutants, as compared to the wild-type (72). Given high costs, quorum sensing signalling or response could be potentially exploitable by quorum sensing cheats (156). In theory, cheats could take the form of either (a) a signal-negative (luxI-) strain that does not make the molecule but can respond to it, and so benefits from monitoring the local cell density, without investing effort into the dissemination of this information or (b) a signal-blind (luxR-) strain that may (or may not) overproduce a signal but, more importantly, does not respond to it, hence coercing its neighbours into greater production of public goods (72). Both types of mutants can be constructed, and signal-blind (lasR–) mutants are often isolated from clinical infections of P. aeruginosa (290).
Consequently, there must be benefits that outweigh the costly production and response to a signal – otherwise, the system would essentially be ineffective.
54 Chapter 1
1.6.2 Explaining cooperation
The prevalence of diverse microbial species using signalling systems to sense and respond to population density, strongly suggests that quorum sensing is a regulatory mechanism selected for in many bacteria. However, as natural selection appears to favour selfish and uncooperative individuals (134), what makes cooperative behaviours evolutionarily stable in response to the possible invasion of cheats in a population? Why should an individual carry out a behaviour that is costly to perform, but benefits other individuals or the local group? (342)
The incentive for performing any behaviour is theoretically based on the beneficial effects it has on the fitness of the cell, directly and indirectly. The measurement of fitness refers to the reproductive success of the individual directly, and the impact it has on related individuals such as its relatives, indirectly.
1.6.2.1 Mutual benefits
A possible explanation for stable signalling is that there must be some mechanism that provides the same interest in cooperation for both producer and recipient of the signal (265). An example of this would be if the waste product of one species provided a benefit to individuals of a second species (by-product benefit), and hence, the second species could adaptively alter its own behaviour to cooperatively help individuals of the first species in order to increase the by- product benefits (344). Such a cooperative act mutually benefits the fitness of both species and more importantly, outweighs the costs of performing it. Many biofilms are composed of multiple species with huge potential for cooperation or conflict between species; the 500 species of bacteria found to colonize human teeth and the oral mucosa is a particular example (161). Studies on two early colonizers of the dental enamel, Streptococcus oralis and Actinomyces naeslundii, suggest that cooperation between these species allows both of them to grow,
55 Chapter 1 where neither can survive alone (227). Another example is the utilization of indole produced by E. coli to enhance biofilm formation in P. aeruginosa, which in turn produces acyl-HSL that influences cell motility and acid resistance in E. coli (173).
Shared interests in maintaining cooperative behaviours could also be examined between microbial symbionts and their hosts. An example is the interaction between leguminous plants, and the rhizobial bacteria that fix N2 within the root nodules of the host plant. N2 fixation benefits the plant by supplying nitrogen needed for growth and photosynthesis, but this act is energetically costly to the bacteria, reducing resources that can be allocated to bacterial growth and reproduction (345). It has been shown that cooperation is favoured, because if the rhizobia in a nodule do not provide nitrogen to their host, the plant punishes them by decreasing the O2 supply to that nodule, thus severely reducing the growth rate of the bacteria (158). Similarly, the marine bacterium V. fischeri expensively provides luminescence in the light organ of their host squid, in exchange for nutrients supplied by the marine host. V. fischeri mutants that are defective in the regulation of light production are less competitive in colonization of the light organs, than their luminescent counterparts (326), an example whereby a mechanism exists to prevent the spread of cheating in the population, stabilizing cooperation across species and enhancing the productivity of the group (99).
1.6.2.2 Kin selection
An alternative solution to the problem of cooperation is kin selection theory (196), which describes the altruistic act of an individual indirectly helping a close relative to reproduce by passing on its own genes to the next generation. This theory is formalized by Hamilton‟s rule, which states that altruistic cooperation is favoured when rb – c > 0, where c is the fitness cost to the altruist; b is the fitness cost to the beneficiary; and r is their genetic relatedness. This rule predicts that individuals should be more likely to cooperate when social partners are more closely related (higher r). In the context of microorganisms, relatedness can be extremely high in a population if neighbours are restricted from dispersal in the
56 Chapter 1 environment, and also, clonal reproduction of microorganisms can lead to individuals interacting over a small local area being predominantly clone-mates (134).
Such a form of kin selection has been suggested to be important for the producers of public goods that are dispersed on a local scale (342). For example, wild-type siderophore-producing P. aeruginosa cells cultured from a single clone (relatively high relatedness) could outcompete the mutant, but not when they are cultured from two clones (relatively low relatedness) (130). Another example is Dictyostelium discoideum, a solitary single-celled amoebae which when experiencing starvation, aggregates to form a multicellular slug that migrates to the surface of the soil to form a fruiting body, consisting of spores and nonviable stalk cells (305). This altruistic act of becoming nonviable stalk cells (which accounts for 20% of the body), to support the fruiting body was found to result in less conflict when the slug was formed from one lineage of cells. Slugs that were formed from multiple lineages were shown to consist of a higher proportion of spore cells, demonstrating the lack of aid towards the overall population (96). Such uncooperative behaviour would naturally lower the fitness of the group as evidenced by the slower movement of the slug (97).
A further selection towards closer relatives is kin discrimination whereby an individual can distinguish relatives from non-relatives and preferentially direct aid towards the relatives (134). This is easily observed from the feeding of one‟s offspring in breeding vertebrate species (129). However, to detect within-species diversity in microbes is less obvious and one form of kin discrimination that could take place in microorganisms is through specificity (344). For example, selection would favour the production of highly specific public goods that other lineages (clones) could not utilize. An example of specificity observed within species include the identification of >25 bacteriocins produced by E. coli. Individuals from the same lineage are protected from the toxic effects of the bacteriocins due to a genetic linkage between the bacteriocin gene and an immunity gene which encodes a factor that deactivates the bacteriocin (260). Hence, a cell from a different lineage is likely to be susceptible to the toxins. Another example was observed in Staphylococcus aureus, a primary pathogen for human infections,
57 Chapter 1 which regulates virulence gene expression via the production of an autoinducing signal peptide (AIP) (74). Out of the four reported variants of AIP produced by S. aureus (222), only AIP-1 has been shown to be specifically recognised by AIP-1- producing strains to induce virulence, but not in the other AIP-producing strains (198). Other examples include strains of P. aeruginosa displaying reduced abilities of iron uptake when chelated by pyoverdines produced by strains of lower relatedness (209). Therefore, this higher level of specificity within species is selected to provide an indirect fitness benefit to individuals by reducing competition among relatives.
1.6.3 Other forms of cooperation
Recently, it was discovered that a small sub-population of cells that do not grow at the normal rate but develop into a dormant, nongrowing state at any point of time, known as persister cells (181), are able to tolerate unfavourable conditions such as antibiotic treatments, in order to preserve the population (55).
Persistence can be considered as a cooperative act since it produces a phenotype that survives catastrophes and at the same time, provides a benefit at a population level by reducing local competition for resources. However, persistence is also costly because it reduces the short-term growth rates of bacterial cells. Based on the direct fitness benefits on survival and the indirect benefits of helping relatives preserve the population, this social trait is assumed to be favoured under the circumstances of high relatedness between competing bacteria. It has also been predicted that a higher level of persistence will be favoured when there is greater competition for resources in the population (343).
1.6.4 Multi-species cooperation in activated sludge
Does that mean heterogenous communities such as activated sludge, and naturally occurring biofilms that usually consist of a number of species, are more
58 Chapter 1 susceptible to cheats? After all, cooperative behaviours have been found to induce beneficial services such as breaking down of sewage (321).
In fact, it was suggested that diversity within a microbial community enhanced cooperation in certain circumstances such as in environments with fewer available resources (23), for example activated sludge. This is because different groups could select for the use of different resources in the face of local resource competition. Further, cooperators with specialized functions may be harder to exploit since they are less common in a multi-species community (343). In experiments on biofilm formation in P. fluorescens, where a group of clonal lineages represented the diversity of the microbial population, productivity was found to be higher in the group and the mixed community was less susceptible to invasion by cheats (23). This supports a study that described the ability of cheats to trade off exploitation on cooperators that specialize on different resources (154), otherwise resulting in fewer resources available for the cheats (180, 200). Hence, under nutrient limited conditions, the benefits of diversity may exceed the costs of cheating and favour the spread of cooperation.
Activated sludge is made up of dense microbial aggregates, and social interactions within such bacterial aggregates would take place over a limited spatial scale due to low dispersal. Within such confined spaces, clonal growth of microorganisms would allow public goods, such as exopolysaccharides, produced by an individual to benefit a strongly related recipient, despite the presence of multiple species in the spatial scale (343). Hence, kin selection can still play an important role in such cases of multi species cooperation, when performed locally. The transfer of cooperative genes (carried by mobile elements such as conjugative plasmids) between different bacterial lineages is also suggested to be a way of maintaining cooperative behaviour in a population with cheats (291). However, selection of the recipient hosts for reintroduction of the cooperative genes takes into account factors such as cheater frequency (361) and complementary effects (291), a mechanism that requires further investigation.
Overall, there is opportunity for cooperation to be maintained in a somewhat contained multi-species community such as activated sludge flocs. This
59 Chapter 1 cooperation is attributed to the advantage of having a diversification of functions from multiple species that utilize resources more efficiently (274), without reducing the social relatedness of the resident cooperators.
1.7 Aims and objectives
Activated sludge is reliant on the biological activities of its indigenous organisms to break down organic compounds such as lipids, to achieve a safe effluent standard suitable for discharge into the environment. In order to increase the efficiency of wastewater treatment, knowledge of the microbial activities in activated sludge is important to understand how growth conditions can be manipulated to favour the growth of targeted useful organisms with desirable metabolic activities beneficial to the treatment process. Because of the high cell densities found in activated sludge, the initial aim of this project was to determine if quorum sensing, a cell-density dependent behaviour, was prevalent in the environment by the detection of biologically relevant concentrations of acyl-HSL compounds (Chapter 2).
Quorum sensing has been commonly observed among many bacterial communities in many environments (91, 104, 346) and shown to increase the functional stability of its ecosystem. It is also recognized as a major regulatory system used by bacteria to respond to changing conditions in their ecosystem. This is because cell density dependent gene regulation enables bacteria to optimize their fitness, particularly in symbiotic or pathogenic relationships with plants and animals, and survive within the constraints of the growth environment (66). For example, acyl-HSL-mediated quorum sensing was reported to be an important feature in the complex ecosystem of the gastrointestinal tract (311). Bioluminescence from the light organs of marine squids is also regulated by bacterial quorum sensing for camouflage from predators during the night.
As a consequence of the findings that in situ acyl-HSL production occurs in activated sludge, this addresses some of the ecological roles that these bioactive compounds may have in environmental settings. This includes the production of
60 Chapter 1 enzymes, which is of greatest value within a floc community enclosed by a glycocalyx layer (Chapter 3 and 4). A broader understanding of how quorum sensing mechanisms are involved in the functioning of activated sludge would provide excellent opportunities to improve the efficiency of wastewater treatment systems such as the addition of acyl-HSL compounds or acyl-HSL producers, and the manipulation of growth conditions that can enhance the survival of acyl-HSL producers in activated sludge. As acyl-HSL production is believed to be a costly cooperative act, part of this thesis also aims to investigate if cheaters (quorum sensing mutants) were likely to evolve among communities in competitive environments such as activated sludge (Chapter 6).
1.7.1 Chapter synopses
Chapter 2 describes the construction of a whole-cell biosensor, and its deployment in activated sludge to examine the occurrence and localization of acyl-HSL like molecules. The detection of biologically relevant concentrations of acyl-HSL like molecules in the flocs of activated sludge, but not in the bulk solution, suggested that acyl-HSL concentrations are highest in flocs. Whole cell biosensors were also demonstrated to be suitable tools for studying quorum sensing in complex environments, after attempts to extract and identify quorum sensing signals directly from activated sludge were not successful.
With evidence of quorum sensing in activated sludge, there is the possibility that any cell within a floc that can respond to the types of acyl-HSLs present would be actively expressing their acyl-HSL dependent phenotypes. Acyl-HSL producers and isolates capable of expressing known acyl-HSL mediated phenotypes (lipase, cellulase, chitinase, elastase, surfactant and anti-microbial production) which are plausibly associated with sludge function, were identified from the cultivable activated sludge community (Chapter 3). This allowed determination of the diversity and physiology of quorum sensing controlled enzyme producing bacteria in the environment. Acyl-HSL producers appeared to dominate both the entire community (77%), and isolates that were positive for the sludge phenotypes. Prominent sludge members that were part of a significant trend for the production
61 Chapter 1 of a particular quorum sensing-regulated phenotype or acyl-HSL profile are discussed. In addition, with a large proportion of acyl-HSL producers isolated from activated sludge, this is in agreement with the detection of acyl-HSL in activated sludge flocs given that a high acyl-HSL degradation rate was observed in activated sludge.
Because the effects of microbes in natural habitats are often synergistic, understanding them at the community level is perhaps most ecologically meaningful. The results of manipulative experiments, where acyl-HSLs were added to activated sludge and the effects on the acyl-HSL mediated phenotypes and rates of nitrification were measured at a community level are described in Chapter 4. Chitinase production was upregulated while nitrification seemed to be negatively affected. The rationale for the observed effects is discussed.
Density dependent cooperative behaviours usually bring about beneficial community functions. However, with the act of cooperating being costly for the individual, the population is usually susceptible to the invasion of cheats, decreasing the fitness of the group. A long-term growth experiment was carried out to study the costs of acyl-HSL production in V. fischeri by monitoring the generation of mutants in the V. fischeri culture with daily subculturing (Chapter 5). The data suggested that the cost of acyl-HSL production in V. fischeri is compensated for by an unknown selective advantage.
Chapter 6 provides a summary and general discussion of the results presented in the previous chapters, and suggests a number of possible directions for future research.
62 Chapter 2
2 Detection of acyl-HSL-like activity in activated sludge
2.1 Introduction
Wastewater treatment processes commonly rely on the biological activity of microorganisms in activated sludge to consume organic materials (mainly C, N, and P) and converting them into biomass. This biomass, in the form of flocs, can then settle and be removed from the system, to generate a clean effluent of minimal biological solids. Activated sludge is of interest to environmental microbiologists because it represents a model ecosystem for studying microbial interactions. It is a widely used biotechnology, improvements to which could have widespread benefits.
Flocs in activated sludge are composed of a dense microbial consortium in a matrix of extracellular polymeric substances (EPS), produced primarily from lysed cell components (protein, humic substances, carboyhydrates, nucleic acids and lipids) and adsorbed wastewater particles (102), resembling physiological traits of biofilms despite the lack of surface association. Molecular analyses revealed that the dominant bacterial species in the floc community belong to the Bacteroidetes, Firmicutes and Proteobacterial groups (331). With such high biodiversity and cell density, there is great potential for a multitude of interactions to occur between the cells in the microbial floc environment. However, the knowledge about these interactions and the impacts they have on activated sludge and function, is limited.
Acyl-HSL mediated gene expression is characterized as a cell density dependent activity. It involves the production of small diffusible metabolites, N-acyl-L- homoserine lactones (acyl-HSLs), by an acyl-HSL synthase (LuxI homologue), interacting with its cognate receptor protein (LuxR homologue), when a threshold acyl-HSL concentration accumulates in the local environment (352), triggering
63 Chapter 2 gene expression in neighbouring cells. Currently, other than the cyanobacterial genus, Gloeothece (280), the use of the acyl-HSL regulatory system is known to be restricted to only three out of five classes of one bacterial phylum, the Proteobacteria (alpha-, beta- and gamma). Further, acyl-HSL producing representatives consist of approximately 7% of genera within these classes (38), constituting a small fraction of the phylogenetic tree. However, the fact that acyl- HSL-producers are abundant in the environment with activated sludge being no exception, suggests the relevance of acyl-HSL-mediated gene expression and the selective advantage it can provide in complex ecosystems (193).
The ability of acyl-HSLs to move across cell membranes means that activation of gene expression by this mechanism is dependent on the number and density of acyl-HSL producing cells, which dictates the acyl-HSL production rate, in the environment. Another important factor to consider in this process, termed quorum sensing, is also the ability of the extracellular environment to retard diffusion of acyl-HSLs away from responsive cells. For example, acyl-HSL mediated gene expression is active in biofilms, which is attributed to the spatial structure of this high density biomass (65). Mason and coworkers obtained evidence, suggesting that even thin layers of cells can retard acyl-HSL diffusion to an extent that affects gene expression (195).
It is not known if acyl-HSLs are produced at biologically relevant concentrations in sludge or the role of acyl-HSL mediated gene expression in activated sludge. Recent studies reported the isolation of acyl-HSL-producing bacteria in sludge systems, comprising members of the Aeromonas and Pseudomonas genus, indicating the likely presence of acyl-HSLs in the ecosystem. Acyl-HSLs were also recently found on membranes from membrane bioreactors (355). Further, acyl-HSLs detected in natural environments such as river limestone rocks, tomato rhizospheres in unsterile soil and the tissue of marine sponges, provides indications that acyl-HSL signalling is important and widespread in the environment (205, 299, 312).
64 Chapter 2
Chapter 2 describes the construction of an acyl-HSL reporter strain using activated sludge isolates and deployed to demonstrate activation of acyl-HSL mediated gene expression in activated sludge flocs.
65 Chapter 2
2.2 Material and Methods
2.2.1 Bacterial strains and culture conditions
The bacterial strains and plasmids used are listed in Table 2.1. Escherichia coli harbouring the plasmid pJBA357 was a gift from M. Givskov (University of Copenhagen). The plasmid encodes the V. fischeri lux machinery with an unstable variant of the green fluorescent protein reporter gene fused to the acyl-HSL inducible PluxI promoter. Sludge organisms were grown in R2A medium, unless otherwise specified. Strains used in acyl-HSL bioassays were grown in LB medium or ABT minimal medium (AB per liter: 0.4 g (NH4)2SO4, 0.6 g
Na2HPO4, 0.3 g KH2PO4, 0.3 g NaCl, 1 mM MgCl2, 0.1 mM CaCl2, 0.01 mM
FeCl3 (51) containing 2.5 mg/L thiamine), supplemented with 0.5% (w/v) glucose and 0.2% (w/v) casamino acids. Activated sludge samples were incubated in artificial wastewater (AWW) containing (per litre of deionized water), 0.2 g of
NH4Cl, 0.15 g of CaCl2.2H2O, 0.33 g of KCl, 0.3 g of NaCl, 3.15 g of
MgCl2.6H2O, 1.26 g of K2HPO4, 0.42 g of KH2PO4, 0.25 g of yeast extract, 1 ml of trace elements, and 1 ml of vitamin solution, supplemented with 0.5% (w/v) glucose. Vitamin and trace element solutions were prepared as previously described (294). All cultures were incubated at 30°C with shaking at 160 rpm. The following concentrations of antibiotics were used as appropriate: kanamycin, 50 µg/ml; tetracycline, 4.5 µg/ml; ampicillin 100 µg/ml; and gentamycin 20 µg/ml. N-oxohexanoyl-L-homoserine lactone (OHHL) was purchased from Sigma and stored as a 1 mM stock at -20°C in 99.9% dimethyl sulfoxide (DMSO).
66 Chapter 2
Table 2.1 Bacterial strains and plasmids Strain or plasmid Relevant characteristic(s) Reference Bacterial strains Escherichia coli SM10 Thi thr leu tonA lacy supE resA::RP4- (286) 2-Tc::Mu Km
Escherichia coli pir+, mob+ host/donor or (208) BW20767 RP4-2-tet:Mu-1kan::Tn7 integrant leu- 63::IS10 recA1 creC510 hsdR17 endA1 zbf-5 uidA(∆MluI):pir+ thi
Sludge isolate Wild-type isolate from activated This study (non-acyl-HSL producing sludge Aeromonas strain)
Chromobacterium cviI::mini-Tn5 derivative of ATCC (205) violaceum CV026 31532, Kanr, acyl-HSL-
Agrobacterium Ti-; Tcr (107) tumefaciens A136
Escherichia coli Acyl-HSL-inducible gfp production pJBA357
Escherichia coli Pseudomonas shuttle vector carrying (140) r r pMHLAS PlasB-gfp(ASV) Plac-lasR; Amp , Gm
Vibrio fischeri MJ1 Wild-type, acyl-HSL+ (262)
Plasmids pJBA132 pME6031-luxR-PluxI-RBSII-gfp(ASV)- (5) r T0-T1; Tc pBBR1MCS2 Broad-host range plasmid; lacZalpha; (163) Kanr pBBLuxR pBBR1MCS2 carrying luxR-PluxI- This study r RBSII-gfp(ASV)-T0-T1; Kan from pJBA132 Abbreviations: Ampr, ampicillin resistance, Gmr, gentamycin resistance; Kanr, kanamycin resistance; Tcr, tetracycline resistance
67 Chapter 2
2.2.2 Activated sludge sampling
Activated sludge was sampled from St. Marys Sewage Treatment Plant in St. Marys, Australia. St. Marys Sewage Treatment Plant is operated by Sydney Water to treat municipal waste up to tertiary treatment level, including additional phosphorus and nitrogen removal and disinfection. A sludge sample (1.2 L) was collected from the aerobic stage of the plant in a 2 L bottle for transport back to the laboratory. On arrival in the laboratory the bottle was kept at 4°C for 20 h before experiments were carried out.
2.2.3 Isolation of bacterial strains from activated sludge
Activated sludge (1 ml) flocs were harvested by centrifugation and serially diluted tenfold in R2A medium, and 100 µl aliquots were plated onto R2A agar (Difco). Plates were incubated for 24 hours at 30°C. Single colonies were further purified and acyl-HSL bioassays were performed.
To identify activated sludge isolates, 16S rRNA gene fragments were amplified using primers 8f (5‟-AGAGTTTGATCCTGGCTCAG-3‟) and 926r (5‟- CCGTCAATTCCTTTRAGTTT-3‟) (188) and sequenced with an ABI Prism BigDye kit (Perkin-Elmer Applied Biosystems, Foster City, Calif.) and an ABI model 310 genetic analyser (Perkin-Elmer Applied Biosystems). Oligonucleotides were synthesized by Sigma-Aldrich. The resulting sequences have been deposited in the GenBank database (GU136494 – GU136545).
2.2.4 Assays for detection of acyl-HSL molecules
2.2.4.1 Screening for acyl-HSL in agar systems
Activated sludge isolates were screened for acyl-HSL production by cross- streaking against acyl-HSL biosensors, Chromobacterium violaceum CV026, and Agrobacterium tumefaciens A136 on ABT medium (51) with 0.7% (w/v) agar as
68 Chapter 2 previously described (197). The ABT-agar for A. tumefaciens A136 was supplemented with 50 µg/ml X-gal. For the C. violaceum CV026 inhibition assay, ABT agar was supplemented with 500 nM OHHL. C. violaceum CV026 can only respond to short-chain acyl-HSLs (between 4 to 8 carbon atoms), by producing the characteristic purple pigment violacein. Although long-chain acyl-HSLs (with 10 to 14 carbon atoms) are unable to induce a response in C. violaceum CV026, if an activating acyl-HSL (eg. 6 carbon) is incorporated into the agar, these long- chain acyl-HSLs can be detected by their ability to inhibit violacein production (197). This inhibition bioassay, which is simple and inexpensive, serves to detect long-chain acyl-HSLs from the culture supernatants.
2.2.4.2 Screening for acyl-HSLs in liquid systems
Culture supernatants of activated sludge isolates were tested for acyl-HSL activity using E. coli (pJBA357) and E. coli (pMHLAS). Sludge isolates, E. coli (pJBA357) and E. coli (pMHLAS) were grown in ABT medium (51) with the appropriate antibiotics, for 16 h at 30°C. E. coli (pJBA357) and E. coli (pMHLAS) were diluted (1:5) in fresh ABT medium (51), incubated with shaking for 30 min at 30°C, and then each strain was dispensed in 100 µl aliquots into wells of a flat-bottomed microtiter plate (Sarstedt Australia). Cell-free supernatants of sludge isolates were prepared by filtration of the culture supernatants through a 0.22 µm Millex filter unit (Millipore, Billerica, MA, USA) to remove the cells. A 100 µl portion of the cell-free culture supernatants were incubated each with E. coli (pJBA357) and E. coli (pMHLAS) with shaking for 3 h. Fluorescence measurements were taken hourly using a microtiter plate fluorometer (Wallac Victor2) (excitation, 485 nm; emission, 535 nm). Fluorescence values were corrected for autofluorescence.
2.2.5 Construction of acyl-HSL monitor strain
An Aeromonas sludge isolate, tested for the absence of endogenous acyl-HSL production, was chosen as a host for the construction of an acyl-HSL monitor
69 Chapter 2 strain. For cloning and reporter strain construction, routine protocols for plasmid DNA purifications and DNA fragment isolation were followed (267) using the QIAprep spin miniprep kit (Qiagen) and QIAquick gel extraction kit, according to the protocols of the supplier. Enzymes were purchased from New England Biolabs (Beverly, Mass). To create pBB-LuxR, a 2.8-kb “BamHI”-“EcoRV” fragment of pJBA132, containing the luxR-PluxI-gfp(ASV)-T0-T1 cassette, was ligated to a stable broad-host range vector pBBR1MCS2 via compatible restriction sites. The ligated construct was then chemically transformed into competent E. coli BW20767 cells which were used as the donor for conjugal transfer of the construct into an activated sludge strain via the filter mating technique (69). Kanamycin resistant sludge isolates were selected on R2A agar containing Kan (50 µg/ml) and Amp (20 µg/ml) (isolate is inherently Ampr). Kanr isolates were then further screened for a response to OHHL by fluorometry as described below (2.2.6)
2.2.6 Characterization of acyl-HSL monitor strain
Characterization of the dose response of the monitor strain constructed in this study to OHHL was similar to the acyl-HSL assay as described above (2.2.4.2). After pre-incubation and dilution, 100 µl aliquots of the monitor strain were treated with 0 – 100 nM OHHL or Vibrio fischeri cells in the logarithmic phase of growth in ABT medium (OD600 = 0.18) and fluorescence measurements were taken hourly using a microtiter plate fluorometer (Wallac Victor2) (excitation, 485 nm; emission, 535 nm). Aliquots of treated samples were also taken and visualized under the epifluorescence microscope as described (2.2.8.1) for analysis of single-cell responses to OHHL.
2.2.7 Masking effects
The impact of the density of non-fluorescing cells on the apparent fluorescence output as detected by the fluorometer was assessed in the same format as the acyl- HSL assay as previously described (2.2.4.2). After pre-incubation and dilution,
70 Chapter 2
100 µl aliquots of the monitor strain were treated with varying densities of E. coli monSM10 cells, together with 25 nM OHHL. With shaking for 3 h, fluorescence measurements were taken hourly using a microtiter plate fluorometer (Wallac Victor2) (excitation, 485 nm; emission, 535 nm).
2.2.8 Acyl-HSL detection in sludge samples
Overnight cultures of the acyl-HSL monitor strain were diluted (1:5) in fresh AWW medium, and 100 µl aliquots (6 x 106 cells/ml) were added to microtiter plate wells. Sludge samples were washed in AWW medium and 100 µl added to wells containing the acyl-HSL monitor strain. OHHL (20 nM) was added to wells sampled as positive controls. Autoclaved sludge incubated overnight at pH 9 in AWW medium and washed in AWW medium with pH 7 was used as a negative control.
2.2.8.1 Epifluorescence microscopy
Green fluorescence in monitor cells was observed using an axioplan epifluorescence microscope (Leica model DMR). The microscope was equipped with a 100 W mercury lamp, and a fluorescein isothiocyanate optical filter (filter set no. 10, Carl Zeiss) to visualize GFP (excitation, 488 nm). Bright-field images were taken from the same field of view. A slow-scan charge-coupled device (CCD) camera CH250 (Photometrics) equipped with KAF 1400 chip (pixel size 608 x 608 µm) was used for capturing digital images. All images were captured using automatic exposure, without further processing. The samples were mounted on a microscope slide with a cover-slip, and examined immediately. The results shown are representative of at least three independent experiments.
2.2.9 Extraction of activated sludge supernatant
An activated sludge volume of 200 ml was extracted with an equivalent volume of ethyl acetate (acidified by supplementing with 0.5 % formic acid). The mixture
71 Chapter 2 was shaken vigorously for 30 s and the phases allowed to separate. The shaking was repeated three times before the ethyl acetate containing fraction was removed. The whole extraction process was repeated twice. Water was removed from the combined ethyl acetate fractions by filtering it through anhydrous Na2SO4. Solvents were placed into a round-bottom flask and evaporated to 5 ml in vacuo using a rotor vapour and transferred in glass vials. The extract was allowed to evaporate to dryness, and reconstituted in 2 ml acidified ethyl acetate and stored at -20°C. Known amounts of OHHL were added before extraction of activated sludge samples to be used as positive controls.
2.2.9.1 Acyl-HSL screening of sludge extract using agar systems
Sludge extracts were cross-streaked against acyl-HSL biosensors, Chromobacterium violaceum CV026, and Agrobacterium tumefaciens A136 on ABT medium (51) with 0.7% (w/v) agar as previously described (197). The ABT- agar for A. tumefaciens A136 was supplemented with 50 µg/ml X-gal.
2.2.9.2 Acyl-HSL screening of sludge extract using thin-layer chromatography (TLC)
Between 1 and 20 µl of sludge extracts were applied to reversed phase C18 TLC plates (TLC aluminium sheets 10 X 10 cm2, RP-18, Merck Darmstadt, Germany) on a baseline. The plates were developed in 15 ml 60:40 (v/v) methanol/Millipore water in a developing jar, until the solvent front reached the top (approximately 1 h). The TLC plate was allowed to dry for at least 10 min, while an agar cover layer of either C. violaceum or A. tumefaciens A136 was prepared. A preculture was grown in LB for 24 h at 30°C with aeration and 1 ml of the preculture was used to inoculate 50 ml ABT-agar (0.8% agar) maintained at 46°C. The culture- agar solution was immediately poured on top of the TLC-plates and left to incubate for 2 days at 30°C. All media was supplemented with relevant antibiotics and the ABT-agar for A. tumefaciens A136 was supplemented with 50 µg/ml X- gal.
72 Chapter 2
2.3 Results
2.3.1 Construction of acyl-HSL monitor strain
A LuxR dependent Gfp-based acyl-HSL sensor plasmid was constructed from the ligation of EcoRV and BamHI restriction enzyme fragments from plasmid pJBA132 into the broad host range vector pBBR1MCS2 (Table 2.1). The plasmid generated, pBB-LuxR utilizes the lux quorum sensing machinery of Vibrio fischeri, which responds to OHHL as the cognate signalling molecule.
To analyse acyl-HSL production in activated sludge, the sensor plasmid pBB- LuxR was transferred to a strain capable of colonizing activated sludge flocs. Mobilizable broad-host-range vectors used for the sensor plasmid provided an advantage for efficient transfer to an acyl-HSL-negative Aeromonas strain (Accession no. GU136514 (GC_R2A_S_22)) isolated from activated sludge flocs.
2.3.2 Characterization of the acyl-HSL monitor strain
The response of the acyl-HSL monitor strain to various OHHL concentrations and also to the presence of the known OHHL producer, Vibrio fischeri, was characterized. Gfp fluorescence of the cultures was measured in a microtiter dish assay as described in Materials and Methods.
A linear increase in fluorescence of the monitor strain was observed with increases in OHHL concentration of up to 20 nM (Fig. 2.1). Beyond this concentration, the fluorescence response became saturated. To determine the detection limits of the monitor strain for single-cell analysis, green fluorescence cells were also observed by epifluorescence microscopy (Fig. 2.2). OHHL concentrations of 10 nM and above generated detectable fluorescence. The sensor plasmid was also stable in the host strain, displaying no plasmid loss after 48 h in the absence of antibiotic selection (data not shown).
73 Chapter 2
The use of the unstable version of the green fluorescent protein, Gfp(ASV), meant that the high turnover rate of the reporter protein, allowed the online monitoring of transient acyl-HSL expression in sludge.
74 Chapter 2
Figure 2.1 Dose response of the monitor strain (pBB-LuxR) to N-3-oxo- hexanoyl-L-homoserine lactone (OHHL). The monitor strain was grown in the presence of different OHHL concentrations and the green fluorescence of the cultures was quantified hourly for a total of 4 hours using a microtiter plate fluorometer at an emission wavelength of 535 nm. Fluorescence derived from each OHHL concentration increased almost every hour. Fluorescence readings for Figure 2.1 were taken at its peak at the 3rd hour, since fluorescence started to reach a plateau or drop at its 4th hour (data not shown). Triplicate cultures were measured. Error bars represent standard deviation.
75 Chapter 2
(A)
(B)
(C)
(D)
76 Chapter 2
(E)
Figure 2.2 Epifluorescence (right) and light (left) microscopy images of acyl- HSL monitor strain Aeromonas sp. (pBB-Lux) in the absence (A) and presence of 10 nM (B), 25 nM (C), 50 nM (D) OHHLs, and Vibrio fischeri cells (E). The monitor strain generated green fluorescence in the presence but not absence of OHHL. Images are representative.
77 Chapter 2
2.3.3 Masking effects
Aeromonas sp. (pBB-LuxR) monitor cells (102 cells/ml) were mixed with increasing densities of E. coli cells and 25 nM synthetic OHHL, to investigate the effect of interfering, non-fluorescent cells, on detection of the green fluorescence generated by the monitor strain. As illustrated in Figure 2.3, the fluorometer gave no detectable signal when the E. coli cell density exceeded 106 cells/ml. In contrast, fluorescent cells could be visualised by epifluorescence microscope (data not shown). Hence, given the high cell density of activated sludge (1011 cells/ml) (15), epifluorescence microscopy rather than fluorometry was used to detect acyl- HSL-like activity in activated sludge.
78 Chapter 2
Figure 2.3 Masking effects of biomass on fluorescence measurements. Increasing E. coli cell densities were added to a constant number of acyl-HSL monitor cells Aeromonas sp. (pBB-Lux) incubated with 25 nM OHHL. Relative fluorescence units were plotted against cell density of E. coli added in respective wells. Five replicate cultures were measured. Error bars represent standard deviation.
79 Chapter 2
2.3.4 Detection of acyl-HSLs in sludge
Epifluorescence images of unamended activated sludge without the addition of OHHL revealed a low level of autofluorescence in flocs that was unlikely to interfere with detection of fluorescing monitor cells. Approximately four hours after inoculation of the monitor strain into activated sludge, green fluorescent cells were detected associated with flocs as shown in Figure 2.4. There was a variation in the intensity of the fluorescence in different flocs independent of their size.
As expected, no signals (or acyl-HSLs or compounds with acyl-HSL-like activity) were detected when the sensor strains were inoculated alone or from activated sludge samples whose microbial activity was eliminated by autoclaving and also when subject to high pH conditions (to inactivate any existing acyl-HSLs). Fluorescence was not induced in the monitor strain in cell free activated sludge supernatant that had not been autoclaved or subject to pH adjustment.
These experiments suggested that acyl-HSLs are produced at concentrations high enough by bacteria colonizing activated sludge flocs, to activate the monitor strain.
80 Chapter 2
(A)
(B)
(C)
(D)
Figure 2.4 Detection of production of acyl-HSL-like activity in sludge. Epifluorescence (right) and light (left) microscopy images of activated sludge in the presence and absence of the acyl-HSL monitor strain Aeromonas sp. (pBB-
81 Chapter 2
LuxR). Panel A shows live activated sludge with the exogenous addition of 25 nM OHHL, augmented with the monitor strain. Panel B shows activated sludge without augmentation with the monitor strain. Panel C shows autoclaved sludge with prior incubation at pH 9 augmented with the monitor strain. Panel D shows live activated sludge augmented with the monitor strain. Images are representative.
82 Chapter 2
2.3.5 Identification of acyl-HSL profiles in activated sludge
As illustrated in Figure 2.5, sludge extracts induced a positive response with A. tumefaciens A136 in the agar plate assays, with similar evidence of acyl-HSL activity as seen when A. tumefaciens A136 was cultivated with 75 nM OHHL as a positive control. However, the sludge extracts failed to stimulate a response with C. violaceum CV026, compared with the violacein-producing positive control. Both biosensor negative controls for the agar plate assays with ethyl acetate streaked next to it, or alone, remained uninduced.
The negative result obtained from the C. violaceum CV026 assay indicates either 1. The absence of short-chain acyl-HSLs; 2. The likely presence of short-chain acyl-HSLs but their detection is masked by the presence of long-chain acyl-HSLs; or 3. The likely presence of long-chain acyl-HSLs in the sludge extract.
To determine if long-chain acyl-HSLs are present in the sludge extract, two assays could be used, the A. tumefaciens A136 assay, or the C. violaceum CV026 inhibition assay which was not used in this section. The positive result from the A. tumefaciens A136 assay indicates the likely presence of long-chain acyl-HSLs in the sludge extract. Further characterisation of the types of long-chain acyl-HSLs present in the system was performed using TLC with biosensor, A. tumefaciens A136. However, the extract failed to produce any detectable phenotypic response from the TLC overlay assay. The extract obtained from sludge that was spiked with OHHL as a positive control, gave a positive response on the TLC plate, with a Rf-value similar to that found by Shaw et al. (1997) (281) (data not shown).
83 Chapter 2
(A) (F)
(B) (G)
(C) (H)
(D) (I)
(E) (J)
Figure 2.5 Agar plate assays for screening of presence of acyl-HSL in activated sludge extracts using A. tumefaciens A136 (A-E) and C. violaceum CV026 (F-J). Panels A and F were treated with sludge extracts. Panels B and G, and Panels E and J, are positive controls with 5 nM OHHL and acyl-HSL- producing organisms streaked next to the biosensor, respectively. Panels C and H are negative controls with ethyl acetate. Panels D and I contain biosensor alone.
84 Chapter 2
2.4 Discussion
Acyl-HSL producing bacteria have been isolated from a multitude of environments, including activated sludge, however in situ acyl-HSL production has only been demonstrated in a limited number of these environments. Activated sludge is a heterogenous environment containing dense bacterial aggregates, called flocs, known to be responsible for the biological treatment of wastewater. Due to the complexity of the bacterial aggregates (flocs), to study the production of acyl-HSL molecules in sludge, whole-cell biosensors were employed for effective visualization of quorum sensing occurrence and localisation. A floc forming Aeromonas strain indigenous to activated sludge was used to host a broad host range plasmid, carrying the genetic machinery encoding quorum sensing in V. fischeri, fused to an unstable variant of the green fluorescent protein (gfp) reporter gene. This quorum sensing monitor strain expresses one of the most sensitive and broad-spectrum acyl-HSL receptors (LuxR), and allows real-time studies of acyl-HSL production and degradation in activated sludge.
Acyl-HSL production was detected at biologically relevant concentrations (eg. concentrations that induce gene expression, in this case, the GFP reporter gene in the monitor cells), in activated sludge as determined by fluorescing cells from the epifluorescence microscope (Fig. 2.4(d)). The level of fluorescence observed using the monitor strain in activated sludge was comparable to that observed in the monitor strain incubated with 10 nM synthetic OHHL (Fig. 2.2(b)). The monitor strain fluoresced in association with activated sludge flocs and not in the planktonic phase, suggesting that acyl-HSL concentrations are highest in the flocs. This situation is likely to be the result of acyl-HSLs being produced in flocs and may reflect the ability of the spatial structure of flocs to retain acyl-HSLs. This is consistent with studies that stated the spatial distribution of the production cells could be more critical for quorum sensing, than their cell density (139, 195). Recently, the relevance of cell-cell signalling in wastewater treatment was simultaneously investigated by Yeon et al. (2009) (355), who detected the presence of signalling molecules from the biological material deposited on membrane wastewater bioreactors and by Yong and Zhong (2009) (356) who
85 Chapter 2 surprisingly could detect acyl-HSLs from municipal wastewater supernatants that had biological material filtered out from the samples.
In the work described here, biosensor cells integrated with different flocs produced varying levels of fluorescence, with no correlation to the size of the microcolony. This was unexpected since it was assumed that acyl-HSL production is greater as a function of size, due to an increase of both growth activity and capacity to retain metabolites in the floc, with the accumulation of extracellular macromolecules that form a matrix around the cells serving as a barrier for acyl- HSLs to diffuse away from the cells and out of the biofilm, over the course of floc development (220). Several factors could lead to this observation such as floc age. Flocs get bigger with age and the thick EPS could limit the accessibility of growth substrates to reach within the floc to feed the microbial population (313), reducing microbial activity such as acyl-HSL production. However, smaller younger flocs may not have accumulated sufficient sludge particles, to make up a dense tight floc structure for acyl-HSL accumulation, or bacteria growth for acyl-HSL production. Each floc may also have a different bacterial composition (which may be age dependent) and this may influence, whether the floc contains acyl-HSLs or not. It has been previously reported that Betaproteobacteria often grow in larger colonies while Alphaproteobacteria grow in smaller colonies (175). The floc developmental stage may also influence metabolic interactions within the flocs, including the breakdown of molecules. For example, the majority of cells in mature flocs could have actively turned on acyl-HSL degrading metabolic programs or acyl-HSL consumers may only colonize flocs, only after the floc starts producing acyl-HSLs.
Based on the agar assay systems, solvent extractions of activated sludge induced a clear positive response in A. tumefaciens A136 but did not stimulate the sensor of C. violaceum CV026. Neither monitor systems may respond to the same acyl- HSLs or at least, not respond to the same extent to the same acyl-HSLs at the concentrations of acyl-HSLs produced by sludge. However, A. tumefaciens A136 has been known to have the most sensitive and broadest range of acyl-HSL detection limits (300).
86 Chapter 2
Attempts to identify the acyl-HSLs present in the sludge, through separation by TLC with A. tumefaciens A136, were unsuccessful. It suggests that the average concentration of specific acyl-HSLs in activated sludge is too low to be identified by the methods applied in this study. A larger sample size is required to obtain a more concentrated acyl-HSL extract but with activated sludge having a high organic content, this could affect the purity of the sludge extract. An extract with high concentrations of various organic impurities can alter Rf values and spot definition, interfere with detection steps, or worse, show up as artefacts (100). There is the potential for further work to be carried out to selectively purify and separate the acyl-HSLs in the sludge extract using silica column fractionation (9). This purification technique involves the absorption of organic molecules by a silica gel column before being eluted out separately, based on the polarity of the molecules and solvent (303). This method has been used for the successful identification of the OHHL compound in Erwinia carotovora culture supernatants (9), as well as the profiling of quinone patterns from activated sludge (142). Yeon and co-workers (355) identified HHL and OHL as among the abundant acyl-HSL species found in the biocake of wastewater membrane bioreactors. Acyl-HSL profiles produced by the microbial community in activated sludge would provide insightful information regarding acyl-HSL producers that could dominate or contribute to the functionality of the wastewater ecosystem.
Attempts to carry out acyl-HSL characterization were not successful, hence not much data could be generated to further strengthen the conclusions of acyl-HSL production in activated sludge. However, this appears to be the first report of the localisation of acyl-HSLs in activated sludge flocs using a sludge-based acyl-HSL biosensor. From this it can be assumed that any cell within a floc that can respond to the type of acyl-HSLs present, will be actively expressing their acyl-HSL dependent phenotypes that may play significant roles in influencing the bacterial life in parts of the sludge environment and function. The use of whole-cell biosensors has also been demonstrated to be a suitable tool for examining the ecology of microbial habitats, such as activated sludge flocs, with small spatial scales and heterogeneity.
87 Chapter 3
3 Testing for acyl-HSL activity and acyl-HSL regulated phenotypes in activated sludge isolates
3.1 Introduction
The behaviour of microorganisms within activated sludge flocs underlies the functioning of wastewater treatment plants. This includes, interactions among microbes within flocs, which can influence the impact of particular microbes in the ecosystem. A comprehensive understanding of the population structure and ecology of microbial communities is thus critical to the development of novel strategies for improvement of wastewater treatment plants, and for ensuring efficiency and environmental safety.
In addition to structural characterization of the community, clarification of the phenotypic traits of individual microbes, within the community is important to understand physiological processes that might serve as practical indicators of sludge ecology. Various phenotypic traits of bacteria have been shown to be expressed via quorum sensing systems, which allow bacteria to monitor the local density of their population, and (or) physical confinement via the production and detection of small, diffusible signal molecules, such as N-acyl-L-homoserine lactones (acyl-HSLs) (105, 106).
Acyl-HSL mediated gene expression regulates numerous physiological traits that play important roles in many environments. For example, the production of multiple extracellular degradative enzymes by Erwinia carotovora (199) and Pseudomonas aeruginosa (348), can cause extensive damage to plants and humans, respectively. Quorum sensing also controls the synthesis of antibiotics (violacein) in organisms such as Chromobacterium violaceum, which eliminate competing microbial communities in its vicinity (213). Under iron-limiting conditions, P. aeruginosa cells produce iron-scavenging molecules, siderophores,
88 Chapter 3 which are known to be modulated by the lasR-lasI regulatory circuit (304). The expression of biosurfactants, controlled by acyl-HSLs in Serratia liquefaciens, serves to condition surfaces prior to swarming to allow colonization of large areas (186). The conjugal transfer of plasmids by the plant pathogen Agrobacterium tumefaciens, to host plant cells (361), is another quorum sensing regulated example. Quorum sensing behaviours have received little attention in the context of activated sludge bacteria. Further, the biological activities within a floc that could contribute to the functioning of sludge have not been well understood. Much work still needs to be performed, such as identifying the bacteria and key microbial groups responsible for sludge properties (219), to improve our understanding of the application of microbial communities to benefit wastewater treatment. It is possible that all the phenotypes mentioned above represent a selective advantage in activated sludge and may therefore have an impact on the community dynamics and hence function, of sludge.
Acyl-HSL producing isolates, from the genus Pseudomonas and Aeromonas, have already been commonly isolated from sludge from previous studies. Hence, a thorough screening of sludge isolates was not necessary to know that acyl-HSL producers already exist in sludge. However, in situ acyl-HSL detection in sludge remains to be investigated. Chapter 2 results gave convincing evidence that using our detection methods, acyl-HSL was produced at biologicall relevant concentrations. This result justified the next step at taking a closer look at identifying the major acyl-HSL producing species contributing to the observation and specifically, their acyl-HSL associated phenotypes.
The objective of the experiments presented in this chapter was to characterize the composition and producers of quorum-sensing related signal molecules among culturable bacteria within the sludge community. Extracellular enzymes play essential roles in the biological wastewater treatment processes, hydrolysing major organic contaminants such as proteins, polysaccharides, and lipids to smaller units. The secretion of digestive enzymes is controlled by quorum sensing in many taxa, but has not been investigated in the context of activated sludge. Quorum sensing control of exochitinase activity has been determined for S. liquefaciens (119), C. violaceum (44), P. aeruginosa (95) and many Vibrio
89 Chapter 3 species (182). Many known proteobacterial species require quorum sensing for the release of extracellular protease including Serratia proteamaculans (48), and P. aeruginosa (221). It can be assumed that any cell within a floc that can respond to the types of acyl-HSLs present will actively express their acyl-HSL dependent phenotypes. Hence, this work also had the aim of screening acyl-HSL producing and non-acyl-HSL producing isolates, from activated sludge for extracellular enzyme activities (cellulase, lipase, elastase and chitinase) and acyl-HSL regulated phenotypes (biosurfactant, antimicrobials) related to sludge function, to determine if there is a potential correlation between the role of quorum sensing and the functioning of wastewater treatment.
90 Chapter 3
3.2 Materials and methods
3.2.1 Bacterial strains and culture conditions
The bacterial strains and plasmids used are listed in Table 3.1. Strains used in acyl-HSL bioassays were grown in LB medium or ABT minimal medium as described in Chapter 2 (2.2.1). Activated sludge samples were incubated in artificial wastewater (AWW) medium as described above (2.2.1). Sludge isolates and strains used in phenotypic assays were routinely grown on R2A medium or plates containing 1.5 % agar. All cultures were incubated at 30°C with shaking at 160 rpm. The following concentrations of antibiotics were used as appropriate for the strains indicated in Table 3.1: kanamycin, 50 µg/ml; tetracycline, 4.5 µg/ml; ampicillin 100 µg/ml; and gentamycin 20 µg/ml. N-oxohexanoyl-L-homoseine lactone (OHHL) was purchased from Sigma and stored as a 1 mM stock at – 20°C in dimethyl sulfoxide (DMSO).
91 Chapter 3
Table 3.1 Bacterial strains and plasmids Strain or plasmid Relevant characteristic(s) Reference Bacterial strains Escherichia coli ESS ß-lactam super-sensitive (8)
Serratia liquefaciens Wild-type; Ampr, Tcr (119, 186) MG1
Chromobacterium cviI::mini-Tn5 derivative of ATCC (205) violaceum CV026 31532, Kanr, acyl-HSL-
Agrobacterium Ti-; Tcr (107) tumefaciens A136
Escherichia coli Acyl-HSL-inducible gfp production (pJBA357)
Escherichia coli Pseudomonas shuttle vector (140) (pMHLAS) carrying PlasB-gfp(ASV) Plac-lasR; Ampr, Gmr Abbreviations: Ampr, ampicillin resistance, Gmr, gentamycin resistance; Kanr, kanamycin resistance; Tcr, tetracycline resistance
92 Chapter 3
3.2.2 Activated sludge collection
As for the experiments described in Chapter 2, activated sludge was collected from St. Marys Sewage Treatment Plant in St. Marys, Australia. A 2 L Schott bottle was filled with the sludge from the aerobic stage of the wastewater treatment plant, for transport to the laboratory where the experiment was immediately set up.
3.2.3 Isolation and identification of bacterial strains from activated sludge
Activated sludge (1 ml) was serially diluted tenfold in AWW medium, and 100 µl aliquots were plated onto R2A agar (Difco). Plates were incubated for 24 h at 30°C. Single colonies were further purified by re-streaking onto individual R2A agar plates.
To identify activated sludge isolates, 16S rRNA genes were amplified using primers 8f (5‟-AGAGTTTGATCCTGGCTCAG-3‟) and 926r (5‟- CCGTCAATTCCTTTRAGTTT-3‟) (188). The DNA of the isolate was extracted by suspending one colony in 200 µl of deionized, distilled, sterile water and boiling the mixture for 10 min. The colony PCR reaction contained 5 µl 10x buffer (Applied Biosystems), 3 µl of a 25 mM MgCl2 solution (Applied Biosystems), 10 pmol each of the forward and reverse primers, 7.5 µl of a 2 mM mix of all four deoxynucleoside triphosphates, 0.2 µl AmpliTaq™ DNA polymerase (2.5 U/µl) (Applied Biosystems, United Kingdom), and molecular grade H2O (Eppendorf, Australia) to a volume of 50 µl. The PCR conditions used were an initial denaturation at 95°C for 10 min, followed by 25 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s, and a final extension cycle of 10 min at 72°C. The PCR products were checked in a 1 % agarose gel for purity of the desired band before being cleaned using the QIAquick® PCR Purification Kit (QIAGEN Pty. Ltd., Australia) and quantified using a Nanodrop. A sequencing reaction was set up for one of the primers which contained at least 100 ng of PCR
93 Chapter 3 products, 1 µl BigDye Terminator 3.1 (Applied Biosystems, United Kingdom), 10 pmol of primer, 3.5 µl 5x buffer (Applied Biosystems, United Kingdom) and molecular grade H2O (Eppendorf, Australia) to a total of 20 µl. The conditions used for the sequencing reaction were an initial step at 96°C for 1 min, followed by 25 cycles of 96°C for 10 s, 50°C for 5 s and 60°C for 4 min. The sequencing reactions were cleaned up by ethanol precipitation and sequenced with an ABI Prism BigDye kit (Perkin-Elmer Applied Biosystems, Foster City, Calif.) and an ABI model 310 genetic analyser (Perkin-Elmer Applied Biosystems) at The Clive & Vera Ramaciotti Centre for Gene Function Analysis at the University of New South Wales, Sydney, Australia. Oligonucleotides were synthesized by Sigma- Aldrich. The resulting sequences have been deposited in the GenBank database (GU136494 – GU136545).
Analysis of the DNA sequences ranging from 750 to 900 bases and homology searching were performed with standard DNA sequencing programs and the BLAST server of the National Centre for Biotechnology Information (NCBI) (www.ncbi.nlm.nih.gov) using the BLAST (blastn) algorithm (3).
3.2.4 Assays for detection of acyl-HSL molecules
3.2.4.1 Screening of acyl-HSL in agar systems
Activated sludge isolates were screened for acyl-HSL production by cross- streaking against acyl-HSL biosensors, Chromobacterium violaceum CV026, and A. tumefaciens A136 on ABT medium (51) with 0.7% (w/v) agar as previously described (197). The ABT-agar for A. tumefaciens A136 was supplemented with 50 µg/ml X-gal. For the C. violaceum CV026 inhibition assay, ABT agar was supplemented with 500 nM OHHL. The presence of long chained acyl-HSLs was detected by inhibition of the induced C. violaceum CV026.
94 Chapter 3
3.2.4.2 Screening of acyl-HSL in liquid systems
Culture supernatants of activated sludge isolates were tested for acyl-HSL activity using E. coli (pJBA357) and E. coli (pMHLAS). Sludge isolates, E. coli (pJBA357) and E. coli (pMHLAS) were grown in ABT medium (51) with the appropriate antibiotics, for 16 h at 30°C. E. coli (pJBA357) and E. coli (pMHLAS) were diluted (1:5) in fresh ABT medium (51), incubated with shaking for 30 min at 30°C, and then each strain was dispensed in 100 µl aliquots into wells of a flat-bottomed microtiter plate (Sarstedt Australia). Cell-free supernatants of sludge isolates were prepared by filtration through a 0.22 µm Millex filter unit (Millipore, Billerica, MA, USA). A 100 µl portion of the cell- free culture supernatants were incubated each with E. coli (pJBA357) and E. coli (pMHLAS) with shaking for 3 h. Fluorescence measurements were taken hourly using a microtiter plate fluorometer (Wallac Victor2) (excitation, 485 nm; emission, 535 nm). Fluorescence values were corrected for autofluorescence.
3.2.5 Phenotypic characterization of sludge isolates
Sludge isolates were grown overnight in R2A medium for 24 h at 30°C and the supernatants were further subjected to the following assays as described. The expression of signal-medaited genes is triggered only after acyl-HSLs have accumulated to a certain threshold, in the culture. Hence, it is likely that the presence of any enzymatic activities in bacterial cultures could be detected after reaching late exponential growth phase, which occurs after approximately 24 hours of growth. All phenotypic activities were determined in triplicates.
3.2.5.1 Cellulase assay
Cellulase activity was tested by adding 100 µl of culture supernatant to small wells cut from 0.8 % agar plates containing 0.1 % w/v soluble carboxymethyl cellulose sodium (CMC-Na) (Sigma) substrate and 0.004 % w/v Congo red (Sigma). After 48 h incubation at 37°C, the agar medium was flooded twice with
95 Chapter 3 an aqueous solution of 1 M NaCl for 15 min to destain, and zones of hydrolysis were visualized by changes in dye colour (from red to orange) around the well, indicating enzymatic activity.
3.2.5.2 Lipase assay
Lipolytic activity was determined by the opacity zones formed around the wells of 0.8 % agar containing 2 % v/v Tween80® (Sigma) and 0.01 % w/v Victoria Blue B dye (Sigma), with 100 µl culture supernatant, after 48 h incubation at 30 °C.
3.2.5.3 Chitinase assay
Chitinase activities were assayed by measuring spectrophotometric changes in solutions of 4-Nitrophenyl N-acetyl-beta-D-glucosaminide (405 nm) as described by the protocol supplied for the Chitinase Assay Kit (CS9080, Sigma-Aldrich Pty. Ltd, Australia). The assay mixture consisted of 50 µl of sample (enzyme) solution and 50 µl 4-Nitrophenyl N-acetyl-beta-D-glucosaminide (1 mg/ml) in 50 mM
KH2PO4 buffer (pH 6.6). After 2 h incubation at 37°C, the reaction was terminated by adding 200 µl Na2CO3 (1 g in 24 ml H2O) and the solution was measured at absorbance 405 nm (Smartspec3000 Spectrophotometer; Bio-rad) after 10 min.
3.2.5.4 Elastase assay
The level of the elastolytic activity within the supernatant of sludge isolates was determined using the Elastin-Congo red assay performed as described by Sigma (Enzymatic assay of Elastin-Congo red). Culture supernatants (100 µl) of each strain was added to 6 ml 200 mM Tris HCl buffer (pH 8.8), containing 5 mg Elastin-Congo red substrate (Sigma-Aldrich). The mixture was incubated for 3 days at 37°C with constant shaking before being filtered through a 0.45 µm Millex filter unit (Millipore, Billerica, MA, USA). The released Congo red dye
96 Chapter 3 was measured at absorbance 590 nm (SmartSpec3000 Spectrophotometer; Bio- rad).
3.2.5.5 Surfactant production
The drop-collapsing test was performed as described previously (186). Briefly, surfactant production was assessed through observation of the collapse of a 10 µl aliquot of bacterial culture supernatant placed on the lid of a petri dish, when compared to Serratia liquifaciens MG1 (positive control) and culture media (negative control).
3.2.5.6 Antimicrobial assay
A pre-culture of the beta-lactam supersensitive E. coli ESS strain (kindly provided by Dr. A. L. Demain) was grown in R2A medium for 24 h at 37°C with aeration, before 1 ml of the pre-culture was used to inoculate 100 ml of R2A agar maintained at 46°C. The agar-culture solution was immediately poured as 20 ml portions to petri dishes and wells were punched in the solidified agar. Cell-free supernatants filtered through a 0.22 µm membrane (Millipore) were immediately added into the well and allowed to grow for 24 h at 37°C. Zones of growth inhibition around the wells indicated the presence of antimicrobial substances in the supernatant.
97 Chapter 3
3.3 Results
3.3.1 Characterisation of sludge floc community
Activated sludge flocs were plated on R2A agar and 80 colonies were randomly selected and characterized based on 16S rRNA gene sequencing and acyl-HSL production profiles. Of the 80 isolates selected, 52 of them were distinct with respect to phylogeny or phenotype.
Partial sequencing of the 16S rRNA genes of the isolates revealed they mostly belonged to gammaproteobacteria (Aeromonas, Citrobacter, Acinetobacter, Klebsiella, Pseudomonas, Shigella, Pantoea) and betaproteobacteria (Neisseria, Vitreoscilla, Chitinimonas, Malikia, Acidovorax, Raoultella). In addition, bacteria that belong to the Flavobacteria group (Wautersiella), and Gram-positive bacteria of the Actinomycetes (Gordonia, Microbacterium) and Firmicutes (Paenibacillus, Enterococcus), were also identified. These sequences have been deposited in the GenBank database (GU136494 – GU136545). The genus Aeromonas was isolated most frequently (17 isolates; 32.7% of total isolates). Among the other genera isolates, Acinetobacter (6 isolates; 11.5% of total) was most common, followed by Citrobacter (5 isolates; 9.6% of total).
3.3.2 Identification of acyl-HSL-producers in the collection of isolates
Isolating acyl-HSL producers from activated sludge plated agar seeded with a reporter strain, will restrict the detection of bacterial strains to only those that produces acyl-HSLs that are strongly responsive to the ligand binding site of the reporter strain LuxR homologue. For example, a sludge strain which does not respond to the A. tumefaciens A136 reporter strain in the agar, could be producing short-chained acyl-HSLs that can only be detected using C. violaceum CV026. Further, identifying acyl-HSL producers from the original agar with a reporter
98 Chapter 3 strain would be biased to fast-growing bacteria. This would not be desirable when screening for non-acyl-HSL producing strains for our monitor strain. A good screen would include testing bacterial strains with a range of receptors, and this is achievable if strains were initially singly isolated from the original agar.
Activated sludge isolates were tested for acyl-HSL like activity using five bioassays based on four acyl-HSL receptor enzymes, CviR, LuxR, TraR and LasR, from indicator strains, C. violaceum CV026, E.coli(pJBA357) with V. fischeri lux quorum sensing system, A. tumefaciens A136 and E.coli(pMHLAS) with P. aeruginosa las quorum sensing system, respectively. The results are presented in Table 3.2. A positive detection of acyl-HSLs could be seen as a change in colour from beige to blue for A. tumefaciens A136, due to the degradation of X-gal (107) in response to longer chain acyl-HSLs, or to violet for C. violaceum CV026 due to the production of violacein in the monitor strain (350), in response to shorter chain acyl-HSLs. Long chained acyl-HSLs will also inhibit the production of violacein in the C. violaceum CV026 inhibition assay supplemented with OHHL in the agar. Acyl-HSLs in supernatants of bacterial cultures was tested using E. coli (pJBA357) and E. coli (pMHLAS) which produce fluorescence in response to medium and long chain acyl-HSLs respectively, measured using a fluorimeter as described above (3.2.4.2). Based on these assays, acyl-HSL production from strains that were consistently detected using either one or more monitor strains were selected for further analysis.
By comparison to the 16S rRNA gene sequences available in the BLAST database, acyl-HSL-producing strains belonged to the genera of Aeromonas, Citrobacter, Acinetobacter, Klebsiella, Pseudomonas, Neisseria, Shigella, Microbacterium, Chitinimonas, Malikia, Pantoea, Raoultella, and Paenibacillus (Table 3.2).
Of the 52 unique strains isolated, only 12 (23 %) did not produce acyl-HSLs or acyl-HSL like activity detectable in the bioassays used. Of the 40 isolates that displayed acyl-HSL like activity, 28 (70 %) were positive in more than one assay. Fourteen distinct acyl-HSL production profiles were observed with the most common profile (excluding non-acyl-HSL producers) activating LasR and
99 Chapter 3 inhibiting CviR. This was observed in six isolates, including the two Pseudomonas isolates, and is indicative of long chain acyl-HSL production. The second most common profile, observed in five isolates, activated CviR, TraR and LuxR, indicative of shorter chain acyl-HSLs such as OHHL. All five isolates with this profile were Aeromonads.
100 Chapter 3
Table 3.2 Sludge flocs isolates and their acyl-HSL activities in various bioassays. Closest match with a phylogenetic affiliation CviR LuxR TraR LasR CviR-
Aeromonas sp. 17m clone G09 + + + - -
Aeromonas sp. „CDC 862-83‟ - - - - -
Aeromonas punctata strain VITSCA01 str 1 + + + - -
Aeromonas punctata strain VITSCA01 str 2 - - - + -
Aeromonas sp. TH088 gene str 1 + + - - -
Aeromonas sp. TH088 gene str 2 - - - - +
Aeromonas sp. TH088 gene str 3 - - + - +
Aeromonas sp. TH095 gene str 1 - - - + +
Aeromonas sp. TH095 gene str 2 - - - - -
Aeromonas hydrophila + + + - -
Aeromonadaceae bacterium NJ-40 str 1 - - + - -
Aeromonadaceae bacterium NJ-40 str 2 - - + - -
Aeromonadaceae bacterium NJ-40 str 3 - - - - +
Aeromonadaceae bacterium NJ-40 str 4 - - - + -
Aeromonas allosaccharophila strain PIC2 + + + - -
Aeromonas media + + + - -
Aeromonas media strain pW28 - - + - -
Citrobacter sp. AzoR-4 str 1 - + + - +
Citrobacter sp. AzoR-4 str 2 - - - + +
Citrobacter sp. AzoR-4 str 3 - + + + +
Citrobacter sp. AzoR-4 str 4 - + + - +
Citrobacter sp. AzoR-4 str 5 - + - + +
Acinetobacter johnsonii strain CONC8 str 1 - + - - -
Acinetobacter johnsonii strain CONC8 str 2 - + - + -
Acinetobacter johnsonii strain CONC8 str 3 - - - - -
Acinetobacter johnsonii strain CONC8 str 4 - + - + -
Acinetobacter sp. Hi7 clone G07 - - - - -
101 Chapter 3
Acinetobacter johnsonii strain FR2_89con - - - - -
Klebsiella sp. - - - - -
Klebsiella sp. 141 clone D03 - + + + +
Klebsiella sp. clone TM2_6 - + - + +
Klebsiella oxytoca clone C06 - + + + +
Neisseria sp. GRW59 str 1 - - - + -
Neisseria sp. GRW59 str 2 - - - + -
Pseudomonas sp. XQ3e - - - + +
Pseudomonas sp. R-35723 - - - + +
Shigella sp. 4096 - + - + +
Vitreoscilla stercoraria - - - - -
Gordonia australia str A554 - - - - -
Klebsiella sp. 141 - - - - +
Enterococcus faecalis str D023 - - - - -
Microbacterium paraoxydans str M2 - + - + +
Chitinimonas taiwanensis str fA3 - + - - -
Uncultured ß-proteobacterium clone DFAW-011 - - - - -
Malikia spinosa gene str 1 - - - + +
Malikia spinosa gene str 2 - + - + +
Pantoea agglomerans str 3I2 - + + + -
Acidovorax sp. PPs-5 - - - - -
Raoultella terrigena isolate m 30 - + + + +
Microbacterium sp. KSL5401-069 - + - + -
Wautersiella falsenii genomovar 1 - - - - -
Paenibacillus sp. P33 - - - + +
Total Positive 6 23 16 23 21
Percentage Positive 12 44 31 44 40
Assay strains: CviR – C. violaceum CV026, LuxR – E. coli (pJBA357), TraR – A. tumefaciens A136, LasR – E. coli (pMHLAS)
102 Chapter 3
3.3.3 Phenotypic characterization of sludge isolates
Motivated by the biological detection of acyl-HSL activity in activated sludge flocs and isolates and to gain insight into possible phenotypes regulated by acyl- HSLs in activated sludge, the isolate collection was tested for six known acyl- HSL regulated phenotypes.
Extracellular lipase and cellulase activity were detected through observation of zones of influence on agar plates. Extracellular surfactant activity was observed by the collapse of the meniscus of a drop of culture supernatant on a petri dish. Extracellular antimicrobial production was observed as a zone of clearing of a lawn of E. coli ESS on agar plates. Examples of positive and negative results from these assays are shown in Figure 3.1. Elastase and chitinase activity were detected using colourimetric assays, monitored by spectrophotometric changes due to substrate hydrolysis. These exoproducts are known to be induced by acyl-HSL production and serve to provide growth substrates for microbial growth or increased virulence for growth advantage. The results from all six assays for the 52 different strains isolated are presented in Table 3.3.
Thirteen out of 52 unique isolates (25 %) showed no activity in any of the assays. All other unique isolates were active in up to four of the assays. Thirty of the 52 isolates (58 %) produced acyl-HSLs and expressed known acyl-HSL regulated phenotypes. Nine non-acyl-HSL producers expressed at least one of the known acyl-HSL phenotypes tested, suggesting that these bacterial strains regulate these phenotypes in some other manner or respond to acyl-HSLs produced by neighbouring cells. There were ten acyl-HSL producing isolates that did not express any of the phenotypes tested, suggesting that acyl-HSL mediated gene expression in these isolates regulates an unidentified phenotype in the producing organism or modulates gene expression in other organisms. The most common phenotypes detected were lipase production (33 % of isolates tested positive), elastase production (29 % of isolates tested positive) and surfactant production (27 % of isolates tested positive).
103 Chapter 3
Fourteen out of the 17 Aeromonad strains isolated, produced lipase whilst 11 of the 17 produced chitinase. Of the five Aeromonads displaying the same acyl-HSL production profile (activating CviR, TraR and LuxR), all of them produced lipase and four of them produced chitinase. Given the abundance of Aeromonads in the culture collection, this result suggested that shorter chain acyl-HSLs such as OHHL may regulate production of extracellular lipase and chitinase by Aeromonds in activated sludge. The five Citrobacter strains isolated did not produce any of the extracellular degradative enzymes tested for, but two of them did produce surfactant. Similarly, of the six Acinetobacter strains isolated, only one produced extracellular degradative enzymes. Both Neisseria strains produced cellulase and both Pseudomonas strains produced elastase. Neither of the Malikia strains activated any of the assays tested.
Interestingly, an isolate closely related to the known endochitinolytic bacterium Chitinimonas taiwanensis did not activate the chitinase assay, possibly a consequence of the use in this study of a substrate specific for extracellular chitinase activity (159).
Almost equal proportion (~ 17 – 33 %) of the sludge floc isolates expressed at least one of the phenotypes, with 60 – 80 % being acyl-HSL producers for each category. Although this result suggests acyl-HSLs could play a significant role in sludge function, no dominant known acyl-HSL mediated phenotype is identified.
104 Chapter 3
(A) (B)
(C) (D)
(E)
(F)
Figure 3.1 Examples of qualitative phenotypic assays. Panels A and B exemplify positive and negative results respectively for extracellular lipase activity using Tween 80 as a substrate and Victoria Blue B as an indicator. Panels C and D exemplify positive and negative results respectively for extracellular cellulase activity using CMC as substrate and congo red as indicator. Panel E shows a positive result (zone of growth inhibition) for the production of antimicrobials using Escherichia coli ESS. Panel F shows a positive (left) and negative (right) result for the drop collapsing test for extracellular surfactant production.
105 Chapter 3
Table 3.3 Phenotypic characterisation of sludge floc isolates Genus (Species) Lipase Cellulase Elastase Chitinase Anti- Surfact. microb
Aeromonas sp. 17m clone G09 + X X + X X
Aeromonas sp. „CDC 862-83‟ + X X + + +
Aeromonas punctata strain VITSCA01 str 1 + + X + X X
Aeromonas punctata strain VITSCA01 str 2 + X + X X X
Aeromonas sp. TH088 gene str 1 + X X X X X
Aeromonas sp. TH088 gene str 2 X X X X X +
Aeromonas sp. TH088 gene str 3 + X X + X +
Aeromonas sp. TH095 gene str 1 X X X X X X
Aeromonas sp. TH095 gene str 2 + X X + X X
Aeromonas hydrophila + X X X X +
Aeromonadaceae bacterium NJ-40 str 1 + X + + + X
Aeromonadaceae bacterium NJ-40 str 2 + X X X + X
Aeromonadaceae bacterium NJ-40 str 3 + X X + + X
Aeromonadaceae bacterium NJ-40 str 4 X + + + X +
Aeromonas allosaccharophila strain PIC2 + X X + X X
Aeromonas media + X X + X X
Aeromonas media strain pW28 + X X + + X
Citrobacter sp. AzoR-4 str 1 X X X X X X
Citrobacter sp. AzoR-4 str 2 X X X X X X
Citrobacter sp. AzoR-4 str 3 X X X X X X
Citrobacter sp. AzoR-4 str 4 X X X X X +
Citrobacter sp. AzoR-4 str 5 X X X X X +
Acinetobacter johnsonii strain CONC8 str 1 X X X X X X
Acinetobacter johnsonii strain CONC8 str 2 X X X X X X
Acinetobacter johnsonii strain CONC8 str 3 X X X X + X
Acinetobacter johnsonii strain CONC8 str 4 X X X X X +
Acinetobacter sp. Hi7 clone G07 X X X X X X
106 Chapter 3
Acinetobacter johnsonii strain FR2_89con + X + X X X
Klebsiella sp. X + + X + X
Klebsiella sp. 141 clone D03 X X + X + X
Klebsiella sp. clone TM2_6 X + + X X +
Klebsiella oxytoca clone C06 X X X X X +
Neisseria sp. GRW59 str 1 X + + X X X
Neisseria sp. GRW59 str 2 X + X X X X
Pseudomonas sp. XQ3e X X + X + X
Pseudomonas sp. R-35723 X X + X X +
Shigella sp. 4096 X X + X X X
Vitreoscilla stercoraria X X X X X X
Gordonia australia str A554 X X + X X X
Klebsiella sp. 141 + X X X X X
Enterococcus faecalis str D023 X X + X + X
Microbacterium paraoxydans str M2 X X X X X X
Chitinimonas taiwanensis str fA3 X + X X X X
Uncultured ß-proteobacterium clone DFAW-011 + X + X X X
Malikia spinosa gene str 1 X X X X X X
Malikia spinosa gene str 2 X X X X X X
Pantoea agglomerans str 3I2 X X + X X +
Acidovorax sp. PPs-5 X X X X X +
Raoultella terrigena isolate m 30 X + X X X +
Microbacterium sp. KSL5401-069 X X X X X X
Wautersiella falsenii genomovar 1 X X X X X X
Paenibacillus sp. P33 X + X X X X
Total Positive (out of 52) 17 9 15 11 10 14
Percentage Positive 33 17 29 21 19 27
107 Chapter 3
3.4 Discussion
There is increasing interest to understand microbial community composition and functions directly within their respective environments. The identification of the abundant organisms in the environments and their physiological differences may suggest ecological importance in the maintenance of the communities.
The detection of acyl-HSL activity in activated sludge flocs is consistent with the finding that 77 % of bacterial strains isolated from sludge tested positive in one or more acyl-HSL bioassays. These results indicated that the four bacterial monitor systems, which included A. tumefaciens A136, C. violaceum CV026, E. coli (pJBA357) and E. coli (pMHLAS) were useful when screening for acyl-HSL producing sludge isolates and that they probably cover most of the spectra of acyl- HSLs produced (255). The majority of isolates belonged to the Betaproteobacteria (Neisseria, Vitreoscilla, Chitinimonas, Malikia, Acidovorax, Raoultella) and Gammaproteobacteria (Aeromonas, Citrobacter, Acinetobacter, Klebsiella, Pseudomonas, Shigella, Pantoea). A minority of isolates belonged to the Flavobacteria (Wautersiella), Actinomycetes (Gordonia, Microbacterium) and Firmicutes (Paenibacillus, Enterococcus). Close relatives of all bacteria cultured in this study have been isolated previously from activated sludge (192, 203, 266, 287, 315, 353), with the exception of isolates GC43 (Chitinimonas taiwanensis), GC49 (Raoultella terrigena) and GC51 (Wautersiella falsenii) which have previously been observed in freshwater (41, 52) or clinical settings (151).
Some of the acyl-HSL producing strains isolated and identified in this study belonged to genera with known acyl-HSL producers such as Citrobacter, Klebsiella (333), Acinetobacter (269), Aeromonas (149) and Pseudomonas (232), and are usually pathogenic isolates with acyl-HSL mediated phenotypes associated with exoprotease production or biofilm formation. However, no isolates from the genera, Chitinimonas, Malikia and Raoultella, have previously been known to produce acyl-HSLs. Further, members of the genera from Microbacterium and Paenibacillus, known to possess acyl-HSL degrading activity (206, 214), and Shigella, known to respond to, but not produce, acyl-
108 Chapter 3
HSLs (306), were also among the isolates showing acyl-HSL like activity. Interestingly, there was a lot of variation in acyl-HSL production between closely related strains. Solvent extraction and direct chemical identification of the active molecules would be required to investigate this phenomenon further. A possibility is that production of active compounds by specific strains, which can bind to the receptor enzymes, can result in a false positive response. For example, alga species Chlamydomonas reinhardtii (314) and the plant organism Medicago truncatula (114) were found to produce compounds that mimic the activity of acyl-HSL signal molecules that have stimulatory effects on lasR and cepR reporters. Other quorum sensing signals that could potentially act as mimics, include gamma-butyrolactones and modified polypeptides produced by Gram- positive bacteria (284, 337). Nevertheless, our unusual results found here suggest new potential in the diversity of participation or competition with known acyl- HSL-mediated bacterial quorum sensing. The proportion of acyl-HSL positive isolates (77 %) in this study is very high compared to other reports on samples from environments, such as soil and plants (8 – 24 %) (28, 67, 246). This phenomenon could be due to the high selection of acyl-HSL producers in sludge or the easy isolation of Proteobacteria, a large number of which are acyl-HSL producers (85), from wastewater. However, compared to other sludge studies that also screened for acyl-HSL producers (93, 321), a more comprehensive range of reporter stains used here, could account for the extensive detection of acyl-HSL molecules produced by the isolates.
To further investigate the role of acyl-HSLs in activated sludge, the production of the exoenzymes lipase, cellulase, elastase and chitinase and the production of antimicrobial activity and surfactants by isolates, were examined because there are examples of them being regulated by acyl-HSL mediated gene expression (186, 210, 237, 350). As bacterial density is generally high in sludge, and with a nutrient status that varies widely in the sludge environment, there is high competition among the organisms present for food. The exoenzymes, mentioned above, enable access to growth substrates for the microbes by breaking down complex carbohydrates, fats or proteins found in dead insect or plant material. Antimicrobial substances produced by microbes can provide a growth advantage for them in competitive environments. Biosurfactants are also known to enhance
109 Chapter 3 the spreading of microbial growth over a biofilm (253), possibly facilitating the structural development and strength of sludge flocs.
Of the acyl-HSL producing isolates, 75 % expressed one or more of the phenotypes tested. The most common phenotype observed was lipase production, followed by elastase and surfactant production. Lipase and chitinase production were the most common amongst the most abundant members of the culture collection, the Aeromonads. Note that the data does not exclude the possibility that other untested phenotypes are regulated by acyl-HSLs in sludge and the identification of isolates that produce enzymes is limited by the substrates chosen for the phenotypic assays. An example is the unresponsiveness of the known endochitinolytic bacterium, Chitinimonas taiwanensis, to the chitinase assay, possibly a consequence of the use in this study of a substrate specific for extracellular chitinase activity (159). Nevertheless, specific strains have been known to have diverse physiological behaviours under different environmental and laboratory conditions (13, 276). Hence it is useful to note that the individual screening of the isolate collection, might vary from those from past studies and is a preliminary test that requires further investigation. Based on the qualitative test assays performed, there was no dominant type of acyl-HSL-associated phenotype observed among the individual sludge isolates. Hence, it was not possible to correlate sludge activity that could possibly be controlled by quorum sensing. However, each phenotype had a significant proportion of acyl-HSL producers (60 – 88 %), suggesting the significance of signal molecules for its phenotypic expression in sludge.
Characterization of bacterial populations in mixed microbial environmental samples has been hindered by the limitations of traditional culture-dependent techniques, often detecting only a minor portion of the naturally occurring bacteria in the community (226). It means the strains identified here do not represent the actual abundance of isolates or acyl-HSL producers from sludge and subsequent overall expression of quorum sensing associated phenotypes tested. Several studies of microbial community structures using the probe-based rRNA approach in activated sludge showed the dominating group to be usually Betaproteobacteria followed by Alphaproteobacteria, Gammaproteobacteria and
110 Chapter 3
Deltaproteobacteria (293). However, when comparing the data presented here, it indicates dominance of the gamma subclass of the Proteobacteria instead. It could be due to the cultivation technique, used in our study, that had been reported to underestimate the beta members of the Proteobacteria group, whilst members of the gamma subclass of Proteobacteria, in particular the genus Acinetobacteria and Aeromonas, were overestimated (330). While acyl-HSLs have been detected in activated sludge, the screening of strains capable of producing acyl-HSLs and quorum sensing control of specific bacterial behaviours is currently an approach obtainable only from isolated pure cultures. Further, although only about 15 % or less of all sludge bacteria are cultivable, Gram-negative bacteria are generally more cultivable than others, and Gram-negative proteobacteria are thought to dominate sludge communities (330). A metagenomic analysis of the community may link the presence of genes encoding for acyl-HSL production to strain identity, however there is very little sequence homology in the luxR and luxI homologues and a metagenomic analysis will not necessarily allow for their identification.
The goal of this research was to examine quorum sensing control of extracellular enzyme production among bacteria isolated from sludge and to quantify the fraction of isolates that are capable of producing acyl-HSLs detectable by one of the whole cell acyl-HSL biosensors. With acyl-HSL production and acyl-HSL regulated phenotypes being common amongst sludge isolates, this supports the hypothesis that acyl-HSL mediated gene expression is important in the ecology of the activated sludge environment.
111 Chapter 4
4 Acyl-HSL responses in activated sludge
4.1 Introduction
It was described in Chapter 2 that acyl-HSLs are present at biologically relevant concentrations in sludge. In Chapter 3, the results of the analysis of activated sludge isolates for acyl-HSL production and expression of known acyl-HSL regulated phenotypes revealed that many cultivable bacteria from this environment produce acyl-HSL like activity and express known acyl-HSL regulated phenotypes. The current chapter reports on experiments testing the impact of acyl-HSL addition to activated sludge on the phenotypes considered in Chapter 3 (surfactant, antimicrobials, chitinase, elastase, lipase, and cellulase production) as well as the process of ammonia oxidation.
Different bacteria exhibit different functional features within a natural bacterial community. Multiple factors such as interspecific interactions, environmental conditions, as well as chemical and physical constraints, can affect the bacterial community composition and behaviours. The combination of these effects will hence, shape community functions within an ecosystem in different ways.
With biodiversity in environments such as sludge consisting of different bacterial, archaeal and eukaryotic species, a complex network of quorum sensing controlled interspecies interactions may exist, underlying many environmentally important functions. A critical threshold of signal concentration can also result in changes in global gene expression and behaviours. For example, a study by Valle and coworkers (321) observed changes in community structure and phenol degradation rates when sludge was treated daily with N-3-oxo-hexanoyl-L- homoserine lactone (OHHL), addressing the impact of intercellular signalling on the function of sludge.
One of the sludge activities addressed in this chapter was ammonia oxidation rate. Biological ammonia oxidation is the first step in the removal of nitrogen during
112 Chapter 4
the treatment of waste. It involves the conversion of NHx to nitrogenous oxides - (N2O, NO, NO2 ) by chemolithoautotrophic ammonia-oxidizing bacteria (AOB), - which are in turn converted to NO3 by nitrite oxidation carried out by nitrite- oxidizing bacteria (NOB) (331). Total nitrogen is subsequently removed by denitrification, which converts (or reduces) nitrate to atmospheric nitrogen (N2) (123).
Global cycling of nitrogen in the environment is very important to prevent eutrophication in many of our ecosystems. Recently, increased amounts of ammonia (NH3) have been generated in our environments due to agricultural and industrial activities required to sustain an increasing human population and per capita use of resources (17, 111). This increase in nitrogenous wastes has the potential to acidify downstream ecosystems, such as soils (165), streams and lakes, groundwater, and oceans (112). If these wastes are not treated or removed properly before being released into the environment, they can cause significant impacts on human health, vegetation and terrestrial life.
The slow growing nature of nitrifying bacteria and their sensitivity to fluctuating conditions (e.g., pH, O2, and temperature) in the wastewater environment (115), makes it challenging to optimally control nitrification in wastewater treatment plants (331). In order to achieve reliable nitrification, biofilm formation is important because it provides a sufficiently long biomass retention time for AOB during the treatment process. The protective structure of biofilms also provides a good shield for AOB from externally harsh conditions in the wastewater (1, 225).
Quorum sensing has been known to play a major role in the development and cellular structure of biofilms for members of the Proteobacteria (65). Whether nitrifying bacteria make use of quorum sensing to regulate their activity remains to be elucidated, but bacterial density-dependent behaviours have been suggested to play a role in regulating nitrogen-cycling in soil (67), highlighting the possibility that the same might be occurring in activated sludge.
Proteins involved in nitrification have been known to be induced in the biofilms of P. aeruginosa during its maturation stage (297). Recently, an AOB from
113 Chapter 4 activated sludge, Nitrosomonas europaea, was found to produce acyl-HSL molecules (C6, C8, and C10-HSL) (31), suggesting the ability of the organism to perform acyl-HSL-mediated gene expression. It was reported by Batcherlor et al. (15) that acyl-HSL molecules increased the recovery response rate of starved Nitrosomonas cells in biofilms, to fresh nutrients. This condition is beneficial to microbial communities in sludge where nutrient levels are unstable and the ability to respond to sudden increased concentrations of nutrients in a competitive environment is of particular importance. Part of the objective for this study is to determine if nitrification activity is affected by acyl-HSL addition in sludge. A better understanding of the ecology of nitrifying bacteria in wastewater treatment biofilms would be useful for improving process performance and control of nitrogen removal in sludge systems.
114 Chapter 4
4.2 Materials and Methods
4.2.1 Bacterial strains
A. tumefaciens A136 used in the acyl-HSL well-diffusion assay was grown in ABT minimal medium as described (2.2.1) and incubated at 30°C with shaking at 160 rpm. Activated sludge samples were incubated in artificial wastewater (AWW) medium as described (2.2.1) and constantly stirred at room temperature. Tetracycline was used at a concentration of 4.5 µg/ml. N-oxohexanoyl-L- homoseine lactone (OHHL) was purchased from Sigma and stored as a 1 mM stock at – 20°C in dimethyl sulfoxide (DMSO).
4.2.2 Activated sludge collection
As for the experiments described in Chapter 2 and 3, the activated sludge for these experiments was collected from St. Marys Sewage Treatment Plant in St. Marys, Australia. A 2 L Schott bottle was filled with activated sludge from the aerobic stage of the wastewater treatment plant for transport to the laboratory, where the experiment was immediately set up.
4.2.3 Measurement of acyl-HSL stability in sludge (using well- diffusion assay)
OHHL (10 µM) was added at the start of the experiment into sludge and the raw sludge supernatant obtained by centrifugation. Controls for both treatments were also set up without OHHL. Activated sludge samples (100 µl) were taken every half hour, centrifuged and the supernatant was added into the well of an agar plate in which A. tumefaciens A136 was inoculated. The agar plates were prepared as previously described (2.2.9.2). Standards consisting of a range of OHHL concentrations (50 nM – 20 µM) were prepared and a standard curve created by
115 Chapter 4 comparing the amount of acyl-HSL to the radius of the induced zones on the agar plate.
4.2.4 Phenotypic analysis of community function with OHHL addition
Sludge was incubated shaking at room temperature and supernatant samples were taken from sludge alone, or sludge treated with 10 µM OHHL every hour and tested for the phenotypes of interest as described in Chapter 3 (3.2.5). Changes were made to the lipase assay, whereby 10 µl p-nitrophenyl butyrate (50 mM) (Sigma) was used as the substrate that was incubated for 30 min with 1 ml of sludge supernatant before a measurement was taken spectrophotometrically at 400 nm (SmartSpec3000 Spectrophotometer; Bio-rad). For the chitinase assay, sludge was initially washed with AWW media, allowed to shake for 8 h before washing again with fresh AWW media (with 10 µM OHHL for the treatment) and the assay was performed as previously described. All assays were conducted in triplicate.
4.2.5 Quantification of nitrate
Six 500 ml Schott bottles were filled with 200 ml of aerobic sludge, covered with cotton and foil and kept at room temperature on a shaker at 150 rpm. Three reactors were chosen as controls, operating without OHHL, and three reactors as treatments, in presence of OHHL (10 µM). Both control and treatment reactors were augmented with 12 mM (NH4)2SO4. In order to determine the concentration of nitrate in the activated sludge, 10 ml samples were taken every 2 h for 8 h, filtered through a 0.2 µm membrane (Millipore) and stored at 4°C until processing.
Nitrate concentrations in the activated sludge samples were determined by ion chromatography by the University Analytical Laboratory in the School of Chemistry at the University of New South Wales, Sydney, Australia.
116 Chapter 4
4.3 Results
4.3.1 Rate of acyl-HSL degradation in sludge
In order to assess the impact of added acyl-HSL on activated sludge, it was essential to determine its fate in sludge. A. tumefaciens A136 produces a blue pigment in response to acyl-HSLs, when the medium is supplemented with X-gal. From the data in Figure 4.1, it can be seen that increasing amounts of synthetic OHHL caused an increase in the radius of the blue zones surrounding the wells in the A. tumefaciens A136 well assays. Standard curves were created by comparing the amount of acyl-HSL to the radius of the zones (Fig. 4.2). Based on the standard curve, the concentration of OHHL in sludge over time, could be estimated by measuring the spread of blue coloration induced by the sludge supernatant. It was found that 10 µM OHHL spiked into activated sludge gave rise to a ten fold decrease in OHHL concentration every hour, compared to activated sludge supernatant, which took 6 h for a similar ten fold magnitude of OHHL degradation (Figure 4.3). This drop in OHHL concentration is likely to be due to degradation, rather than adsorption within the flocs, since Guellil and coworkers (131) reported the movement of soluble organic matter, such as OHHLs from wastewater to activated sludge flocs, reached a steady state after 40 min of constant mixing. Hence, with OHHLs supposedly reaching an equilibrium concentration inside and outside the floc structure within 40 min, the exponential disappearance of OHHL activity observed in activated sludge every hour (Fig. 4.3) would presumably be due to degradation. The experiment was carried out in triplicate for each time point. The consistency in the OHHL degradation rate was observed in three separate occasions.
It is also not possible that the presence of added acyl-HSL in sludge induces increased production of acyl-HSL, since any increase in OHHL production was not observed 15 minutes after the addition of 10 µM of OHHL into sludge. Also, even if the added acyl-HSLs induce increased production of acyl-HSL, it will not be significant to affect the overall rate of degradation (10x/hour) in the sludge experiment. Further, the added acyl-HSLs could also increase the production of
117 Chapter 4 acyl-HSL degradation enzymes, cancelling out the effect of induced increased production of acyl-HSLs.
The well assay is not selective, as other acyl-HSL compounds other than OHHL product will induce the monitor strain. However, OHHL is anticipated to be the only acyl-HSL contributing to the radius of the induced zones, as it was the only compound added and the assay was negative without it.
Figure 4.1 A. tumefaciens A136 well diffusion assay. 3-oxo-hexanoyl-L- homoserine lactone (OHHL) was added to wells in ABT agar containing A. tumefaciens A136 and X-gal. Blue zones of OHHL-induced beta-galactosidase production are seen surrounding the wells.
118 Chapter 4
Figure 4.2 Standard curve comparing the concentration of acyl-HSL to the radius of A. tumefaciens A136 response to OHHL-induced beta-galactosidase production.
Figure 4.3 Rate of OHHL degradation in activated sludge (squares) and activated sludge supernatant (crosses). OHHL concentration in samples was measured over time using the well diffusion assay and comparing it to a standard curve.
119 Chapter 4
4.3.2 Phenotypic analysis of community function with OHHL addition
From previous results (3.3.3), bacterial strains producing acyl-HSLs and expressing known acyl-HSL regulated phenotypes are common amongst the cultivable fraction, though no phenotype was particularly dominant with respect to frequency. In this chapter, the effects of OHHL addition on the functioning of sludge as a community, was investigated by assessing the extracellular production of lipase, cellulase, chitinase, elastase, biosurfactant, and antimicrobials, based on sludge extracts. Extracts from sludge without the exogenous addition of OHHLs were used as controls to assess the changes in exoenzyme activity.
Having characterised the degradation rate of OHHLs in sludge, it was necessary to repeatedly administer hourly OHHL doses, in order to maintain an artificially elevated OHHL concentration of 10 µM. Equivalent volumes of solvent used to dissolve OHHL were added to negative control incubations.
After an hour in the presence of OHHL, a ten fold increase in chitinase activity was observed (Fig. 4.4). From a standard curve, the concentration of chitinase in the activated sludge supernatant was 2.5 mU/ml at its peak after 1.5 h compared to the control, with a low maximal enzyme concentration of only 0.8 mU /ml observed after 2 h. One unit of enzyme will liberate 1.0 mg of N-acetyl-L- gluocosamine from chitin per hour at pH 6.0 at 25ºC. After two hours the chitinase activity began to decrease and resembled the untreated control after 4 h. The drop in chitinase production could be the result of nutrient depletion in the batch culture or upregulation of acyl-HSL degrading enzymes, in response to the exogenous acyl-HSL addition (50). None of the remaining phenotypes tested showed any response to exogenous OHHL addition.
120 Chapter 4
Figure 4.4 Extracellular chitinase activity in activated sludge in the presence (diamonds) and absence (squares) of 10 µM 3-oxo-hexanoyl-L-homoserine lactone (OHHL) added hourly throughout the duration of the experiments. Treatments were performed in triplicate. Absorbance ( = 340nm) (y-axis) refers to spectrophotometric changes derived from the hydrolysis of the (yellow) chitin substrate. The change in spectrophotometric readings, based on a standard curve created previously (data not shown), was correlated to Units/ml (secondary y- axis) of enzyme produced. Error bars represent standard deviation.
121 Chapter 4
4.3.3 Quantification of nitrate with OHHL addition
An experiment aimed to determine the effects of artificially elevating the OHHL concentration in activated sludge on ammonia oxidization activity in a time- dependent fashion was carried out. At the start of the experiment, 12 mM
(NH4)2SO4 was added into 200 ml of sludge as substrate and the nitrate concentrations were measured every 2 h during the experiment.
After four hours, the concentration of nitrate in the reactors remained low, at approximately 5 mg/L for the negative control (lacking OHHL but treated with equal volume of solvent, DMSO, as the treatment reactor), and 0.1 mg/L for the treatment (with OHHL dissolved in DMSO) (Fig. 4.5). The nitrate concentration in the treatment reactor increased slightly at the end of the sampling period (8 h) to less than 0.25 mg/L, whilst the negative control showed significantly higher nitrate concentrations of 70 mg/L. Thus, the presence of OHHL appeared to inhibit nitrification activity in activated sludge. However, this is a preliminary result warranting further investigation since results of nitrate levels from control and treatment reactors of subsequent batches of activated sludge were not consistent. This could be attributed to different batches of activated sludge being subjected to varying periods of storage before sampling. The optimization of the experimental setup with standardized time storage periods and sufficient replicates for the subsequent batches of activated sludge could not be achieved due to limited resources and time, and hence do not provide a good and sound comparison with that from Figure 4.5.
122 Chapter 4
Figure 4.5 Quantification of nitrate in activated sludge in the presence (crosses) and absence (squares) of 10 µM 3-oxo-hexanoyl-L-homoserine lactone (OHHL) added hourly throughout the duration of the experiments. Treatments were performed in triplicate. Error bars represent standard deviation. However, similar experiments carried out with different batches of activated sludge samples did not deliver consistent results.
123 Chapter 4
4.4 Discussion
Following the successful detection of acyl-HSL-like activity in sludge (Chapter 2), the stability of acyl-HSL molecules in this environment was investigated. The concentration of OHHL in activated sludge decreased from 10 µM to 1 µM in an hour. Interestingly, this rapid OHHL degradation was observed only in sludge with flocs, and not in the supernatant. If the degradation observed was a consequence of a property of the supernatant, such as pH, then sludge without biomass would have mediated degradation. However, this was not the case. Acyl- HSL-production was measured using a well-diffusion assay, which simplified the measurements compared to chemical analysis. The results suggest that hydrolytic enzymes such as lactonases, produced by Gram-positive bacteria residing primarily in flocs, could be responsible for the disappearance of the acyl-HSL molecules (77). Other bacteria found in the Proteobacterial genus are also known to use acyl-HSLs as nutrients (146, 171).
Based on the effective concentrations produced by acyl-HSL-producing bacteria in activated sludge, the amount of acyl-HSL degradation activity could readily interfere with endogenous acyl-HSL signalling. Hence, to observe induction of the Aeromonas sp. (pBB-LuxR) acyl-HSL monitor strain in flocs after four hours (Chapter 2), it is possible that a dynamic community of acyl-HSL producers is required in sludge to sustain a minimal useful acyl-HSL concentration in the floc environment. This finding is in agreement with a high proportion (77 %) of cultivable sludge floc isolates responding positively to acyl-HSL production (Chapter 3). Jared Leadbetter‟s group (335) analysed diverse soil samples for acyl-HSL inactivation using radiolabelled acyl-HSL substrates and also observed high acyl-HSL degradation activity in soil with no lag time, suggesting that the process could be active in many natural environments. Overall, the data suggests that the standing acyl-HSL pool in sludge represents a dynamic system of production, dilution, and degradation of signals. Alternatively, the rapid rate of acyl-HSL degradation could be the result of the upregulation of acyl-HSL degrading enzymes, in response to elevated levels of exogenous acyl-HSL addition in sludge (50).
124 Chapter 4
As described in Chapter 3, a high proportion of sludge isolates was found to express acyl-HSL regulated phenotypes but there was no dominant type of acyl- HSL-regulated phenotype observed among the individual sludge isolates, based on qualitative test assays for lipase, cellulase, elastase, chitinase, surfactant and antimicrobial production. The effects of acyl-HSL addition on the functioning of sludge as a community from sludge extracts was investigated. Chitinase production was the only phenotype upregulated upon addition of OHHL to activated sludge, with an approximately three-fold difference in maximal activity, that was produced four times more rapidly. The declining production after two hours, despite hourly replenishment of OHHL, could be due to nutrient depletion in the batch culture or upregulation of acyl-HSL degrading enzymes, in response to exogenous acyl-HSL addition (50). Further research in this direction, for example using the continuous supply of media with acyl-HSLs to feed the sludge, would be needed to clarify whether nutrient limitations and/or some other events triggered this enzyme deactivation. Note that these results do not necessarily correspond to the true situation in activated sludge because of the artificially high acyl-HSL concentrations introduced.
Fungal cell wall debris and residual crustacean shells of insects are sources of chitin, that can be found in activated sludge (207). Gooday (121) and Barboza- Corona et al. (14) suggested that, in general chitin plays a secondary nutritional role for bacteria growth. For example, the green nonsulfur bacteria and organisms from the Cytophaga-Flavobacterium-Bacteroides division comprise a group of sludge bacteria commonly associated with chitin utilization (160). They are generally not considered to exhibit acyl-HSL-mediated quorum sensing but the diversity of previously unknown acyl-HSL-producing taxa found here, suggests a complex network of quorum sensing control of sludge populations that is unexplored and could be capable of participating in quorum sensing cross-talk in activated sludge.
The stimulated chitinase activity would be consistent with a direct role in the biological functioning of sludge, based on the behaviour of quorum sensing. Subsequently, from Table 3.4, the greatest number of chitinolytic bacteria from
125 Chapter 4 the activated sludge strain collection was from the Aeromonas genus. Of the eleven Aeromonads displaying chitinase producing abilities, nine of them were positive in one or more of the acyl-HSL assays, out of which four of them observed the same acyl-HSL production profile activating CviR, TraR and LuxR (Table 3.2), indicative of shorter chain acyl-HSLs such as OHHL. It strongly suggests that Aeromonas species produce extracellular chitinase in activated sludge flocs in response to acyl-HSL accumulation. Note that the Aeromonas strain used for the construction of the monitor strain in Chapter 2, does not produce chitinase activity.
Chitin, as well as chitosan, a derivative of deacetylated chitin, are commonly used as flocculants for efficient coagulation of suspended particles in wastewater treatment systems (11, 46, 132). A model whereby the aggregation of particles of chitin and acyl-HSL producing chitinolytic bacteria such as Aeromonads in activated sludge, is followed by acyl-HSL accumulation in the aggregates and the consequential expression of genes encoding extracellular chitinase activity, could be proposed. This in turn would lead to the liberation of carbon and energy from chitin and a resulting increase in floc biomass. Such a process could be important in the formation of activated sludge flocs and have desirable settling properties. The activity of acyl-HSL-mediated chitinase production by floc binding chitinolytic bacteria to access carbon sources from chitin when they experience starvation within the densely populated floc community would also serve as a survival advantage for the population.
It has previously been shown that chitin degradation by pure cultures of chitinolytic bacteria can be enhanced by augmentation with non-chitinolytic bacteria. This finding was attributed to the release of „stimulatory growth factors‟ by the non-chitinolytic populations (239, 240). Chemical signals such as acyl- HSLs produced by one bacterium could be used by an unrelated species to regulate gene transcription. Interpopulation signalling via acyl-HSLs was demonstrated by McKenny et al. who showed that acyl-HSLs produced by Pseudomonas aeruginosa enhance virulence factor production in Burkholderia cepacia (202). It highlights the potential importance of interspecies interactions for acyl-HSL mediated gene expression in a mixed species community.
126 Chapter 4
Next, it was of interest to look at the effects of quorum sensing molecules on nitrification in the system. Interestingly, the addition of exogenous OHHL to activated sludge resulted in a significant decrease in nitrification rates (Fig. 4.5), almost eliminating its activity in the system. Recent studies reported quorum sensing negatively regulating denitrification enzymes in Pseudomonas aeruginosa (318) with quorum sensing mutants generating a higher level of denitrifying activity (357), although the denitrification regulation by quorum sensing remains to be investigated. To our knowledge, there appears to be no data concerning the regulation of nitrification by quorum sensing but this repression of nitrification by OHHLs may provide new insight into how acyl-HSLs affect the overall nitrogen cycling in wastewater treatment.
Exogenous acyl-HSL addition might not have the same effect as natural accumulation of acyl-HSLs, and signals above normal levels could cause down- regulation of quorum sensing (61, 335). Interactions between acyl-HSLs and within other groups of heterotrophic bacteria in sludge could also indirectly affect the activities of microbial nitrification in the ecosystem. For example, it was reported that the mineralization of nitrogen in the rhizosphere was facilitated by the quorum sensing mediated production of chitinase by soil populations that breaks down complex nitrogen-rich chitin to simple organic nitrogen in the plant (67). The stimulation of chitinase production could also provide nutrients that favour fast growing strains, outnumbering slow growing nitrifying bacteria and its activities. Clearly, factors other than quorum sensing can also affect nitrogen cycling in sludge, including the presence of organisms that produce nitrifying enzymes, substrate availability such as C:N ratios (133), and the composition of mixed autotrophic-heterotrophic populations in the community (229).
While acyl-HSL addition was a useful way to initiate an investigation of the effect of quorum sensing on nitrification in sludge, it is clear that this is only the beginning of the story. More work would need to be done to further characterize the regulation of nitrification by the quorum-sensing system. Levels of nitrifying enzyme activities or nitrifying genes, regulated at the transcriptional level could be measured from sludge in the presence of varying concentrations of acyl-HSLs.
127 Chapter 4
Changes in bacterial community structure induced by acyl-HSLs can also be analysed using molecular techniques such as PCR-DGGE or FISH to examine the presence/absence of nitrifier species during the incubation of acyl-HSLs in sludge. It is also necessary to obtain information on interference in quorum-sensing components, such as lactonases or furanones, to disrupt normal quorum-sensing functions in sludge to confirm our hypothesis.
The results suggest quorum sensing could have indirect, negative impacts on sludge nitrification and shifts in extracellular enzyme activity in sludge, but the controls for the effects are not well understood. There is very little work carried out and reported on acyl-HSLs and its role in activated sludge in the literature, and hence, with limited scientific information and support, the speculations in this discussion provides a pathway for further work to be taken into consideration, especially in this study, which is at its most fundamental. Nevertheless, data presented here suggests that the utilization of quorum sensing systems by sludge bacteria serves as a key control point for global regulatory mechanisms that coordinate the behaviour of the sludge community. In particular, this project has highlighted the possibility that acyl-HSLs could play a role in floc growth, through control of production of extracellular degradative enzymes like chitinase, which degrades available carbon reserves found in flocs, for community growth.
128 Chapter 5
5 Exploring the evolutionary advantage of acyl- HSL synthase in V. fischeri
5.1 Introduction
Quorum sensing, referred to as the communication between organisms in microbial communities, has been known to stimulate a range of cooperative behaviours that will benefit the bacterial population (156). This includes the regulation of bioluminescence, virulence factor induction, competence development and antibiotic synthesis (9, 217, 233, 244). These interactions between organisms usually involve chemical signalling molecules, specific compounds produced by microorganisms, to communicate among one another that effect a reaction in a population of cells that is distinct from the manner in which the cells would behave individually (298).
This cell density dependent behaviour can be explained as an evolutionary adaptation to an environment where it is favourable to cooperate and behave as multicellular organisms for a survival advantage at a population level (279, 338). However, why should an individual carry out an altruistic behaviour that is costly to perform, but benefits another individual or the local group? There is no incentive for a cell to carry out any cooperative behaviour if the overall beneficial effects on the group are not proportional to the fitness costs invested by the individual cell for enzymes that can be produced by its neighbours. This creates an opportunity for cheats to evolve or invade the population. These selfish individuals will not cooperate or expend resources into communicating this information, but exploit the signal and/or exoproduct production of others and gain a competitive growth advantage (134, 196).
Public goods are described as costly for the individual to produce but benefit the individuals in the group (98). Quorum sensing in bacteria represents two levels of public good production, the first level being the production of signals and the second being phenotype expression in response to signal accumulation. lf signal-
129 Chapter 5 or acyl-HSL production were a resource cost to individual bacterial cells in highly competitive environments such as activated sludge, one might expect the evolution of acyl-HSL deficient lineages. This might ultimately result in the loss of quorum sensing in the system unless there was a mechanism in place to retain it.
One example that demonstrates the problem of the resource cost of cooperative behaviour is the production of iron-scavenging molecules, called siderophores, produced by bacteria such as P. aeruginosa. Siderophore production is beneficial to the population during iron-limiting conditions, as observed by the faster growth rates of wild-type strains compared to mutant strains that cannot produce siderophores. However, in an iron-rich environment, siderophore production is demonstrated to be costly, when the mutants were observed to grow faster than wild-type strains. Consequently, when both wild-type and mutant bacteria were mixed in the same population, the mutants were able to invade the population since they could gain the benefit from others cooperating without paying the cost and therefore increase in numbers (130). This raises questions as to how genes encoding cooperative traits are retained over time and how such phenomena could possibly evolve in the first place.
P. aeruginosa is a commonly used organism in this field of study to investigate costs related to quorum sensing. An example is the reported higher growth yields of P. aeruginosa quorum sensing mutants, as compared to the wild-type (72). The natural occurrence of quorum sensing deficient variants of P. aeruginosa has also been frequently isolated amongst clinical isolates (33, 135, 295). For instance, cystic fibrosis patients infected by P. aeruginosa showed no acyl-HSLs in 4 out of 12 sputum samples tested (40). Cytotoxic isolates from acute keratitus infections also displayed low acyl-HSL and protease activities (363). Although luxR mutations are more commonly found among clinical isolates of P. aeruginosa (141), luxI deficient mutants have also been reported, such as in corneal infections (362). During mixed infection with an acyl-HSL-producing Burkholderia cepacia strain, which possibly provided the necessary signalling molecules for expression of virulence factors, it was observed that acyl-HSL production in a co-resident P. aeruginosa strain was greatly reduced (116, 259). There are certainly group
130 Chapter 5 benefits that P. aeruginosa cells can enjoy from having a quorum sensing machinery, but in certain situations, a quorum sensing mutant can be fitter than the parental wild-type.
This chapter explores the resource cost of acyl-HSL production in the model quorum sensing organism V. fischeri, a marine bacterium that expresses the acyl- HSL-mediated bioluminescence phenotype when confined at high cell densities in light organs of marine fishes and squids. The luxI gene in V. fischeri directs the synthesis of the signal molecule, 3-oxo-hexanoyl-L-HSL (OHHL), which binds to the receptor protein, LuxR, after a minimal population of cells or critical threshold signal concentration is achieved in the environment. The OHHL-LuxR complex induces the transcription of the luxICDABE operon, which encodes enzymes involved in luminescence and the synthesis of more of the luxI gene product, OHHL, generating a positive feedback system for the quorum-sensing phenotype (270). A second autoinducer, octanoyl-L-HSL (OHL), was also found to be produced by V. fischeri, directed by the synthase gene, ainS. This autoinducer, at threshold densities, interacts with AinR, and triggers a downstream cascade of events that upregulates luxR expression (94). OHL, in contrast, serves to prevent premature luminescence induction at low and intermediate V. fischeri population densities by binding competitively with LuxR as OHHL accumulates (166, 167).
The known substrates used for acyl-HSL synthases (LuxI-type proteins) are S- adenosyl-methionine (SAM) for homoserine lactone ring synthesis, and an acyl- carrier protein that delivers the acyl chain from lipid metabolism (106). Since this signal production pathway represents some degree of metabolic burden on the cell, how then does it remain evolutionarily stable over time? It was hypothesized that if signal-production is believed to be a resource cost, acyl-HSL production may serve another non-signalling role in individual cells that assists in its retention over evolutionary time. This could possibly explain how acyl-HSL mediated gene expression evolved in the first place. In this study, the fitness of an acyl-HSL deficient mutant is compared with a wild type strain and the evolution and characterisation of quorum sensing deficient mutants are explored in the absence of selection pressure for the acyl-HSL regulated phenotype (bioluminescence) in a long term experimental evolution study.
131 Chapter 5
5.2 Materials and Methods
5.2.1 Bacterial strains and media
Strains used in all experiments were grown in LB, LB20 or AB(VH) medium (128) consisting of per liter: 0.3 M NaCl, 0.05 M MgSO4.7H2O, 2 g/L casamino acids
(0.2 %), 10 mM KH2PO4, 1 mM L-arginine, 2 % v/v glycerol, 10 ng/ml riboflavin and 1 µg/ml thiamine. Chloramphenicol was used at concentrations of 20 µg/ml for E. coli, and 2 µg/ml for V. fischeri. All cultures were maintained in a rotary shaker at 30°C and 160 rpm.
132 Chapter 5
Table 5.1 Bacterial strains and plasmids Strain or plasmid Relevant characteristic(s) Reference Bacterial strains Escherichia coli SM10 Thi thr leu tonA lacy supE resA::RP4- (286) 2-Tc::Mu Km
Vibrio fischeri MJ1 Wild-type, Acyl-HSL+ (262)
Vibrio fischeri MJ211 luxI (166)
Plasmids pLS6 Cmr, lacZ expression vector derived (328) from pSUP102 pJBA132 pME6031-luxR-PluxI-RBSII-gfp(ASV)- (5) r T0-T1; Tc Abbreviations: Cmr, chloramphenicol resistance; Tcr, tetracycline resistance
Table 5.2 Primers used for sequencing of V. fischeri bioluminescence- associated genes and construction of functional luxR plasmid.
Primer Name 5‟ Composition 3‟ LuxR Lux8-F: TTCCTGGTTCAGAGCCTCAT Lux1445-R: GCACTCTGTTGACCAAGCAA
LuxI Lux1220-F: GCAATTCCATCGGAGGAGTA Lux2019-R: CACTTTTCCATCGTTGACCA
AinR Ain20-F: CACGACGAGAACCAAGACCT Ain1243-R: AACGAATTGCTTCGCATACC
AinS Ain1064-F: TGGCTCTTCTTTGACGGTTT AinS+R-R: AGCTTAAAGAAATTAATGCTCGTCAG
LuxR-SacI-F: TTGCCGAGCTC TTTTGCCCAACAGAAAAAGC LuxR-KpnI-R: TTTGCCGGTACC CTCCCTTGCGTTTATTCGAC
133 Chapter 5
5.2.2 Growth studies of V. fischeri strains
Single colonies of V. fischeri strains, wild-type MJ1 and luxI- mutant MJ211, were grown in 100 ml LB20 media with or without 5 µM OHHLs in 250 ml flasks.
Growth rates were monitored based on measurements of OD600 starting from 0.01, with a SmartSpec3000 spectrophotometer (Bio-rad). All growth studies were conducted in triplicate.
5.2.3 Competition between V. fischeri luxI– mutant and wild type
A single clone of both V. fischeri wild-type MJ1 and luxI- mutant MJ211 were each grown overnight in 5 ml LB20 at 30°C, 160 rpm in blue-capped 30 ml bottles (Labserv). Mixed cultures of MJ1 and MJ211 were prepared in fresh 5 ml LB20 medium at two different starting ratios, 50:50 and 10:90, with each mixed culture having a final OD reading of 0.01. The mixed cultures were subcultured every 24 h in fresh 5 ml LB20 medium by transferring 0.1 ml from the stationary- phase culture into 5 ml of fresh medium. Final cell densities of each competitor were determined every 24 h from cell counts plated out on LB20 agar after appropriate dilution. Bioluminescent colonies on agar plates were considered to be derived from wild type MJ1 cells. Three replicate competition experiments were performed for each ratio.
5.2.4 Stress-induced response of V. fischeri strains
At OD600 0.18, 11.3 µl of 30 % w/v H2O2 solution was added to 5 ml cultures of bright and dark V. fischeri lineages from 5.3.4, amounting to a final H2O2 concentration of 20 µM. Growth yields were determined by taking OD600 readings of V. fischeri cultures with or without H2O2 every hour using a SmartSpec 3000 spectrophotometer (Bio-rad). One hour after H2O2 addition, ten aliquots of 200 µl for each lineage were dispensed into wells of 96-well plates and luminescence measurements were taken using a microtiter plate luminometer (Wallac Victor2) (excitation, 485 nm; emission, 535 nm), with normalization.
134 Chapter 5
5.2.5 Long-term evolution of bioluminescence in V. fischeri
Wild-type V. fischeri strain MJ1 was streaked from a frozen glycerol stock onto an LB20 agar plate. Ten random colonies were chosen to be cultured overnight in 5 ml LB20 media and subsequent subcultures were routinely carried out every 24 h for each V. fischeri lineage by transferring 0.1 ml from the stationary-phase culture into 5 ml of fresh AB(VH) medium. Every 10 – 20 days at OD600 0.18, luminescence measurements were taken as described above (5.2.4).
Dark V. fischeri cultures were plated out and colonies were randomly picked for sequencing of the luxR, luxI, ainR and ainS genes using the primer sets shown in Table 5.2. The PCR conditions used for the amplification of genes were an initial denaturation at 95°C for 10 min, followed by 25 cycles of 95°C for 15 s, 56°C for 30 s, and 68°C for 2 min, and a final extension cycle of 5 min at 68°C. The PCR products were checked in a 1 % agarose gel for purity of the desired band before being cleaned using the QIAquick® PCR Purification Kit (QIAGEN Pty. Ltd., Australia) and quantified using a Nanodrop spectrophotometer. Sequencing was performed as described above (3.2.3).
5.2.6 Construction of functional luxR plasmid inserted into V. fischeri luxR– mutant
To complement evolved luxR mutations in dark lineages of V. fischeri, the wild- type luxR gene was amplified using pJBA132 as the template and primers (LuxR- SacI and LuxR-KpnI) as described (Table 5.2) to incorporate the two restriction enzyme sites at the end of the 1.1 kb PCR product. The functional luxR plasmid, pLS6LuxR, was constructed by ligation of a 5 kb SacI-KpnI fragment from pLS6 containing a chloramphenicol resistant gene, to the SacI-KpnI digested amplified PCR fragment (1.1 kb) containing the luxR gene. The ligated construct was then chemically transformed into competent E. coli SM10 cells, and used as the donor
135 Chapter 5 for conjugal transfer of the construct into recipient V. fischeri lineage 10 (luxR–) cells via the filter mating technique (62).
Briefly, overnight 5 ml cultures of E. coli SM10 (pLS6LuxR) in LB10 (Cm20) and V. fischeri lineage 10 (luxR–) in LB20 were harvested, washed four times, and suspended in an equal volume of their respective medium without antibiotics. Both cultures were allowed to shake for a further 2.5 h, with donor cells E. coli SM10 (pLS6LuxR) left incubating statically for the last 30 min, before both cultures were centrifuged at 4200 rpm and resuspended in 1/10 volume of its respective medium. Routinely, 0.01 ml of donor cells E. coli SM10 (pLS6LuxR) was mixed with 0.04 ml of V. fischeri lineage 10 (luxR–) recipient cells and collected onto a 25 mm-diated, 0.45 µm-pore size nitrocellulose filter (Millipore), which was placed onto an LB20 agar plate. After 24 h of incubation at 22°C, filters were placed in a test tube with 1 ml of LB20, and the growth was suspended in the medium by vortexing. Appropriate dilutions were plated on LB20 agar containing Cm (2 µg/ml) and chloramphenicol resistant V. fischeri lineage 10 isolates were selected based on bioluminescent colonies (predicted to have the functional luxR plasmid). Cmr V. fischeri isolate, V. fischeri 10 (pLS6LuxR), was further confirmed for its identity and presence of LS6LuxR plasmid via 16S sequencing as described (3) and restriction digestion of plasmids isolated with the Spin Miniprep kit (Qiagen).
5.2.7 Testing for luxI– mutants
V. fischeri 10 (pLS6LuxR) colonies, consisting of V. fischeri lineage 10 (luxR–) cells with the functional luxR plasmid (pLS6LuxR), was inoculated into 5 ml
AB(VH) media, allowed to grow overnight and subcultured every 24 h by transferring 0.1 ml of stationary-phase culture into 5 ml of fresh AB(VH) medium. Every 14 days, appropriate dilutions were plated out on LB20 (Cm2) agar plates to observe for luxI– mutants, indicated by dark colonies.
136 Chapter 5
5.3 Results
5.3.1 Growth of V. fischeri variants
The growth of V. fischeri wild-type MJ1 was compared with V. fischeri luxI– mutant MJ211, in LB20 media. This was done with and without addition of 5 µM OHHL to enable distinction between growth impacts that relate to production of light and those that are unrelated to light production. In the presence of 5 µM OHHL, the mutant culture is bioluminescent and therefore comparable to the wild-type. Figure 5.1 shows that without the stimulation of bioluminescence production, the growth curves of both V. fischeri luxI– mutant MJ211 and wild- type strain MJ1 were indistinguishable. The addition of 5 µM OHHL in the cultures at the start of the experiment did not show any difference in growth activities (Fig. 5.2). This suggests that the production of acyl-HSL molecules and the expression of acyl-HSL-regulated bioluminescence in V. fischeri do not have significant fitness impacts on the cell under the culturing conditions.
137 Chapter 5
Figure 5.1 Growth curves of V. fischeri variants, wild-type MJ1, and luxI– mutant MJ211, in LB20 media. Each growth study was performed in triplicate. Error bars represent standard deviation.
Figure 5.2 Growth curves of V. fischeri variants, wild-type MJ1, and luxI– mutant MJ211, in LB20 media in the presence of 5 µM OHHL. Each growth study was performed in triplicate. Error bars represent standard deviation.
138 Chapter 5
5.3.2 Competition between wild-type and luxI– mutant
Taking the finding that both V. fischeri wild type MJ1 and luxI– mutant MJ211 has comparable growth curves, the relative fitness of both strains were compared in a competitive growth experiment in a mixed culture under similar culturing conditions. Note that in mixed culture, both the wild-type and the acyl-HSL deficient mutant express the bioluminescence phenotype owing to the production of OHHL by the wild-type.
Mixed populations were initiated with a 50:50 ratio of V. fischeri wild-type MJ1 cells (luminescent) and luxI– mutant MJ211 cells (non-luminescent) with daily subculturing. Interestingly, within 5 days, luminescent cells (enumerated as luminescent colonies) increased in frequency from 50 % to 90 % in the mixed culture (Fig. 5.3). Consequently, a similar experiment with a smaller initial proportion of V. fischeri wild-type MJ1 cells (10 %) in the mixed population also consistently showed a rapid displacement of non-luminescent cells by luminescent cells. The acyl-HSL producing strain occupied 90 % of the population after 6 days (Fig. 5.4).
To ensure an accurate displacement of cells and not just the mutant cells responding to the LuxI for the wild type, two separate experiments with three replicates, each, were carried out for the two starting ratios, and consistent results were obtained. The mutant cells did not luminesce even when their colonies were next to the wild-type colonies. This was clearly demonstrated at the start of the experiment, when 10% out of the total 200 colonies on the agar plate were observed to be from the wild-type strain for the 10:90 mixed V. fischeri populations, when serially diluted from both cultures, indicating the mutant cells did not respond to the LuxI of the wild type. Further, in order to directly compare the competitive advantage of the luxI gene product between both wild-type and mutant cell, and not further create assumptions with additional mutations (eg. luxR) in the cells, a luxI- strain was chosen for this experiment, rather than a luxI- luxR- double mutant.
139 Chapter 5
The results reveal that the wild-type strain has a competitive advantage over the luxI- mutant strain when grown under these conditions. It suggests that the luxI gene confers a fitness advantage to V. fischeri without any apparent selection related to bioluminescence.
140 Chapter 5
Figure 5.3 Competitive growth study between V. fischeri wild-type MJ1 and luxI– mutant MJ211 at starting ratios of 50:50 in a mixed culture. The proportion of wild-type MJ1 cells in the population was determined by counts of glowing colonies. Triplicate cultures were measured. Error bars represent standard deviation.
Figure 5.4 Competitive growth study between V. fischeri wild-type MJ1 and luxI– mutant MJ211 at starting ratios of 10:90 in a mixed culture. The proportion of wild-type MJ1 cells in the population was determined by counts of glowing colonies. Triplicate cultures were measured. Error bars represent standard deviation.
141 Chapter 5
5.3.3 Stress-induced response of V. fischeri lineages
Aerobic respiration generates reactive oxygen species such as hydrogen peroxide that can cause nucleic acid damage in microorganisms. Defensive systems have evolved in microbial cells that are known to detect and counteract the harmful effects of oxidative stress (283). It was postulated that the effects of oxidative stress could have an impact on quorum sensing governed bioluminescence expression in V. fischeri (190, 317). To test this hypothesis, the bioluminescence and growth effects of a bright and dark lineage when exposed to a non-toxic concentration of 20 µM H2O2, during mid-log growth phase, were monitored. Both the dark and light lineages are originally MJ1 strains that were subcultured daily and evolved during the course of the experiment (5.3.4) to become intermittently dark (light lineage) or permanently dark (dark lineage). The results generated demonstrated that regardless of light output, there were no significant differences in growth between the non-treated (control) and H2O2-treated samples for each lineage as shown in Figure 5.5. However, a higher level of bioluminescence was expressed in response to H2O2 treatment for the bright lineage, as compared to the dark lineage (Table 5.3). The low bioluminescence readings from the dark lineages are equivalent to background levels derived from negative controls (media alone), indicative of no bioluminescence production. It suggests the elevated bioluminescence levels in response to H2O2, and not due to the altered growth of the V. fischeri cells, could be an adaptive mechanism governed by functional lux genes to cope with the stressful environmental conditions.
142 Chapter 5
Table 5.3 Bioluminescence effects of hydrogen peroxide added in V. fischeri lineages (bright and dark) during late-logarithmic growth phase OD600=0.18. Readings were the average of ten samples taken from each culture after one hour.
Treatment Lineage (Bioluminescence readings) Bright Dark
Without H2O2 112107 2171 13 3
With H2O2 410511 11888 36 7
Bright lineage Dark lineage
Figure 5.5 Growth effects of V. fischeri lineages (bright and dark) with (clear bars) or without (closed bars) hydrogen peroxide added during late- logarithmic growth phase OD600=0.18. Triplicate spectrophotometric readings were obtained from each of the cultures during bioluminescence measurements.
143 Chapter 5
5.3.4 Long-term evolution of V. fischeri mutants
To further explore the selective advantage associated with acyl-HSL production, a long-term evolutionary study was carried out to determine the frequency of spontaneous luxI mutations in the absence of selection for the bioluminescent phenotype. Ten V. fischeri wild-type colonies were grown in minimal media in batch culture and subcultured every 24 hours for 325 days. The bioluminescence of each culture was measured every 10 – 20 days in the mid-log growth phase. It was anticipated that mutations in the machinery encoding acyl-HSL mediated gene expression would result in a decrease in the luminescence output from the culture and that these dark lineages could be sequenced for mutations in the luxI gene.
Over 325 days all ten V. fischeri lineages displayed wide variations in luminescence output (Fig. 5.6 to Fig. 5.15). Interestingly, the bioluminescence of each lineage was observed to decrease by several orders of magnitude at different points in time and following this, also increase by several orders of magnitude, sometimes up to the original luminescence output. During the course of the experiment five lineages permanently lost the luminescence phenotype (Lineages 4, 5, 6, 8 and 10). The remaining five lineages displayed low or erratic levels of luminescence up until the point at which the experiment was terminated.
144 Chapter 5
Figure 5.6 Measurements of bioluminescence taken from Vibrio fischeri lineage 1 over 325 days at OD600=0.18 after daily subculturing.
Figure 5.7 Measurements of bioluminescence taken from Vibrio fischeri lineage 2 over 325 days at OD600=0.18 after daily subculturing.
145 Chapter 5
Figure 5.8 Measurements of bioluminescence taken from Vibrio fischeri lineage 3 over 325 days at OD600=0.18 after daily subculturing.
Figure 5.9 Measurements of bioluminescence taken from Vibrio fischeri lineage 4 over 325 days at OD600=0.18 after daily subculturing.
146 Chapter 5
Figure 5.10 Measurements of bioluminescence taken from Vibrio fischeri lineage 5 over 325 days at OD600=0.18 after daily subculturing.
Figure 5.11 Measurements of bioluminescence taken from Vibrio fischeri lineage 6 over 325 days at OD600=0.18 after daily subculturing.
147 Chapter 5
Figure 5.12 Measurements of bioluminescence taken from Vibrio fischeri lineage 7 over 325 days at OD600=0.18 after daily subculturing.
Figure 5.13 Measurements of bioluminescence taken from Vibrio fischeri lineage 8 over 325 days at OD600=0.18 after daily subculturing.
148 Chapter 5
Figure 5.14 Measurements of bioluminescence taken from Vibrio fischeri lineage 9 over 325 days at OD600=0.18 after daily subculturing.
Figure 5.15 Measurements of bioluminescence taken from Vibrio fischeri lineage 10 over 325 days at OD600=0.18 after daily subculturing.
149 Chapter 5
To assess whether the loss of luminescence was the result of mutations in genes encoding quorum sensing machinery, the luxR, luxI, ainS and ainR genes were sequenced from at least five random colonies on days 253, 283 and 305 for each of the lineages. It was observed that four out of the five permanently dark lineages had base pair substitutions or deletions in the luxR gene. No mutations were observed for the luxI, ainS and ainR genes in all the lineages. The result suggested there was strong selection against the luxR gene under the growth conditions tested. The same could not be said for the luxI gene, suggesting that expression of the luxI gene and activity of its product represents an unknown selective advantage to the cell.
It was also reasoned that the absence of luxI– mutants in the ten V. fischeri lineages may have been the result of competition from luxR– mutants. Cells not responding to the signal would be expected to have a greater selective advantage than cells not producing the signal but still encoding a functional response. To address this question, a plasmid (pLS6LuxR) with a functional luxR gene was inserted into a single clone from the permanently dark V. fischeri lineage 10 (luxR– mutant) and subcultured daily for at least 150 days. The culture was assessed for luxI– mutants by plating cells and assessing the luminescence of the resulting colonies. No acyl-HSL synthase mutants were observed during the course of the experiment.
150 Chapter 5
5.4 Discussion
Bacterial intercellular signalling is of interest in an evolutionary context both because it facilitates coordinated behaviours amongst individuals that would otherwise be expected to be in direct competition with each other (134, 178), and because signalling molecules may offer unknown selective advantages beyond their role as signals.
This project seeks to investigate whether acyl-HSL production is a resource cost to a cooperative cell that could lead to individuals (cheats) who will exploit the quorum sensing behaviour of others while avoiding the costs associated with it.
According to reports by Diggle and coworkers (72), signal molecules are metabolically costly as shown by the higher growth yield of Pseudomonas aeruginosa quorum sensing mutant lasI–, as compared to the wild-type. Further, the addition of signal molecules significantly decreased the growth yield in the lasI– mutant, due to the costly production of signal-dependent exoproducts. Bioluminescence is considered an energetically costly process with an expenditure of approximately six ATP molecules for each photon (62). Taking the findings from our growth studies on V. fischeri cells, our results contradict these reports. Both V. fischeri strains, wild-type MJ1 and luxI– mutant MJ211, had indistinguishable growth curves with or without the addition of signal molecules (Fig. 5-1, 5-2), indicating the insignificant fitness costs associated with signal production in the context of V. fischeri and its bioluminescence phenotype under the culturing conditions. This discrepancy could be due to the fact that 6 – 10 % of the genome of P. aeruginosa is regulated by the quorum sensing system (275), which explains the higher growth consequences in the cell in contrast to V. fischeri.
Furthermore, acyl-HSL production seemed to confer a selective advantage to the V. fischeri cells when it was demonstrated that the frequency of V. fischeri wild- type cells rose from a minority in the population to dominate a culture that was mixed with signalling deficient mutants (luxI–) strains (Fig. 5.4), under similar
151 Chapter 5 culturing conditions. In another study, bright V. harveyi lux+ bacteria were also able to outcompete dark luxA– mutants in mixed cultures when pulsed with UV irradiation (59), suggesting the luminescence systems could have a selective advantage for the cells when coping with stressful environmental conditions. However, in the mixed culture, all cells, whether they produced acyl-HSLs or not, are able to benefit from the availability of the signalling molecules produced by the wild-type cells and hence would be able to express the luminescene phenotype. Therefore, this result suggests that acyl-HSL production is advantageous for V. fischeri cells beyond the benefits that bioluminescence may offer.
A long-term evolutionary experiment was performed to further investigate the selective advantages associated with acyl-HSL production in V. fischeri. Ten populations of V. fischeri were subcultured daily for 325 days and experienced cycles of starvation during stationary phase before the next transfer into fresh medium. This allowed the adaptive evolution of the cells for competitive fitness for approximately 3300 generations. As reported previously by Scheerer and coworkers (272), luminescence was observed to decrease in all lineages. In four of the lineages maintained in this study, mutations had occurred in the luxR gene and this conferred a fitness advantage, enabling the mutants to become dominant in the population as indicated by the permanent loss of the bioluminescence phenotype in the cultures. In contrast, during the course of the experiment, the luxI synthase gene for acyl-HSL production remained intact in all of the lineages.
Apparently, luxR-type mutations are more common than luxI-type mutations (141), perhaps because loss of LuxI-type function can be compensated by acyl- HSLs from co-colonizing acyl-HSL producers and therefore, luxI-type mutations would not have phenotypic consequences in mixed cultures containing a sufficient number of wild-type cells. By contrast, loss of LuxR-type function directly disrupts the quorum sensing system (of both response to and production of acyl- HSL), even when acyl-HSL signal molecules are present in the environment, and therefore it is likely that the cost of retaining the luxR-type gene is far more expensive metabolically than the maintenance of the luxI-type gene. Hence, luxI– synthase mutants could be at a lower frequency than signal-blind (luxR–) mutants
152 Chapter 5 when in the same population and probably harder to detect within the population (264). Therefore, the selection of luxI– mutants from a V. fischeri clone that was already luxR defective, was further tested. A plasmid containing a luxR functional gene was stably maintained in the clone, to retain the LuxR function, and subcultured under the same conditions and evolutionary time frame. LuxI– mutants that evolved from the cultures can be easily screened as dark colonies when plated out on agar every 2 weeks. Interestingly, it was still not possible to detect any luxI– synthase mutants in the population. This provided further evidence that the cost of acyl-HSL synthesis to the individual V. fischeri cell is compensated for by an unknown selective advantage.
It has been found that signalling molecules can have multiple functions, such as serving as iron-scavenging molecules (73, 155), as potent immune modulators (110) or involvement in riboflavin synthesis (35). Signal molecule production and secretion have also been linked to the modification of membrane properties or the formation of outer membrane vesicles (273), activities that could facilitate the delivery of biomolecules intercellularly or alternatively, known to affect adherence of bacterial cells on eukaryotic hosts (148). A computer simulation had demonstrated that once the cooperation reward was adjusted below a minimum threshold value, cooperators was almost completely taken over by cheats in a population (58). Since acyl-HSLs are not currently known to play a central role in bacterial metabolism as V. fischeri luxI– mutants are still viable under typical culturing conditions (193), the evolutionary advantage of maintaining such acyl- HSL systems at an individual level remains unknown.
The fluctuating bioluminescence levels observed in the ten V. fischeri lineages was unexpected. The proposed model for this observation is that the fall in bioluminescence levels in the lineages resulted from an increase in abundance of luxR– mutants (or other mutations that affected bioluminescene) within the lineages, and that the rise in luminescence resulted from the rise in abundance of other mutant lineages (of which there would be many) with rapid growth rates and wild-type bioluminescence genotypes. Ultimately, mutations in the luxR gene represent a growth advantage under these conditions, so eventually there will be no mutant lineage without a luxR mutation. Based on this proposed model, it can
153 Chapter 5 be assumed that the remaining five intermittently bioluminescent lineages in this investigation would have become permanently dark given enough time. Diverse genotypic variants of mutants can occur with different combinations of defective loci targeting signal response, signal production or bioluminescence. Compensatory mutations that have been known to restore quorum sensing behaviour, as seen in P. aeruginosa lasR– mutants, could also occur (322).
It is surprising that in competitive growth conditions in which different strains compete for dominance, one would predict that by gaining a mutation in acyl- HSL activity, a dark strain of V. fischeri might achieve a slight growth advantage. For this reason, the apparent selectivity for luxI+ strains in nature suggested that maintaining the ability to produce acyl-HSLs might be of value not only to the population but to the individual cell as well. The AB(VH) media selected for long- term growth of V. fischeri in this evolutionary study (5.2.5) was recommended for bioluminescence production (128). However, further work will be carried out to repeat the experiment under environmentally relevant nutrient conditions resembling the oceans, eg. with lower carbon concentrations, since the media utilized in the study is rich in glycerol and hence, there is less energetic burden to signal and light production. The stable maintenance of signalling systems conserved across a wide range of microorganisms also suggests that the role of quorum sensing molecules could provide some other form of function before it evolved to be that of signalling. With the completion of the entire V. fischeri ES114 genome sequence (263), global gene profiling of the cultures using microarrays or high throughput sequencing at various stages of its irregular light output profile, could be an initial step to elucidate changes in gene expression levels or to detect single nucleotide polymorphisms between its mutator types. Using high throughput sequencing technology, differences in physiological properties between the wild-type and luxI– mutant of V. fischeri could also be determined to identify various activities other than luminescence controlled by the acyl-HSL quorum sensing regulon, that might extend the significance of its competitive behaviour in V. fischeri. Nevertheless, this study allows experimental testing in V. fischeri of previous theoretical models that suggest the evolutionary selection of components of the signalling system in the presence of quorum sensing (58, 268).
154 Chapter 6
6 Summary and general discussion
The research presented in this thesis reported the detection of biologically relevant concentrations of acyl-HSL in activated sludge that were accumulated locally in flocs. A large proportion of cultivable activated sludge isolates responded positively to acyl-HSL production, including some of which are outside the Proteobacteria, and known to possess acyl-HSL degradative properties. This study also improved our understanding of the role of quorum sensing in sludge function. Consequently, the addition of 10 µM OHHL in activated sludge resulted in an increased chitinase activity, but decreased nitrification, demonstrating the complexity of the quorum sensing process that could occur in sludge. Furthur, this research explored the selective advantage of maintaining an acyl-HSL synthase gene in the model quorum sensing organism V. fischeri.
6.1 Bacterial signalling in the sludge environment
The activated sludge process has been the biological method to treat wastewater for the past 100 years. This process relies on the microbial activities of suspended bacterial biomass, otherwise known as activated sludge, which forms aggregates called flocs, which feed on organic contaminants such as carbon, nitrogen and phosphorus, to generate more biomass. The success of the system is also dependent on how rapid activated sludge flocs settle in the sedimentation tank, allowing efficient separation and removal of the effluent with minimal biological solids. The settled sludge is then returned to the beginning of the process to seed the next influx of wastewater or disposed as waste (123).
The action of hydrolytic exoenzymes is required to degrade complex polymeric substances in the wastewater into low molecular-weight intermediates, for sludge organisms to utilize for carbon and energy sources. This metabolic reaction, being the overall rate-limiting step for the mineralization of organic matter in activated sludge, is crucial (117). Hence, strategies to improve the enzyme activity in activated sludge would be useful. With activated sludge flocs comprising of a
155 Chapter 6 dense microbial consortium, it was investigated if quorum sensing via acyl-HSL mediated gene expression could play a role in activated sludge function.
Past studies have shown that acyl-HSL producing bacteria have been isolated from activated sludge and it has been observed that elevated levels of acyl-HSLs brought about changes in the microbial function and community structure in the ecosystem (93, 321). To further understand the role of acyl-HSLs in wastewater treatment, the presence of biologically relevant concentrations of acyl-HSLs in the sludge environment was first confirmed, using biosensors.
6.1.1 Acyl-HSL detection and degradation in activated sludge
Acyl-HSL production was detected at biologically relevant concentrations in sludge as determined by a whole-cell biosensor specifically constructed using an indigenous sludge bacterium in this study. It was found that these acyl-HSL molecules accumulated locally only in flocs, since induced biosensor cells were not detected in the planktonic sludge environment (Chapter 2). This finding suggests flocs offer an effective diffusion barrier for acyl-HSLs to be retained in the environment, as also reflected in the spatial structure of biofilms (65) and natural closed habitats such as rhizospheres (67). This result also indicates biosensors using unstable gfp reporter genes are suitable for visualisation of the quorum sensing process in intact complex environments such as sludge, that contain localised levels of signal concentration.
In this study, it was also observed that concentrations of exogenously added acyl- HSL rapidly decreased in activated sludge (Chapter 4). From Chapter 3, the high abundance of acyl-HSL producers isolated from sludge (77 % of isolate collection) could explain the maintenance of biologically relevant acyl-HSL concentrations in sludge. Regardless, it appears as if the spatially heterogenous increases in acyl-HSL concentrations in sludge could result from a dynamic interplay between production, dilution and degradation.
156 Chapter 6
The ability of an unanticipated phylogenetic range of bacteria that had previously not been known to be capable of bacterial quorum sensing to respond positively to at least one of the acyl-HSL biosensors in our study, suggests the diversity of known quorum sensing signalling bacteria is broader than expected. The range includes Gram-positive species, some of which have been known to possess acyl- HSL degradative properties. Because there are very few examples of acyl-HSL production outside the Proteobacteria, these biosensor based observations need to be confirmed through an analytical chemistry approach.
6.1.2 Sludge behaviours performed by the microbial sludge community strongly linked to quorum sensing
Enzymes such as lipases (117, 118) and chitinases (44, 164), have previously been found in sludge, and it was reported that enzymatic activity was found to be much higher in the sludge floc matrix (101). This supports the idea that quorum sensing within flocs, could play a role in the regulation of enzymes such as those mentioned above, by cells that can respond to the types of acyl-HSLs present. Next, to gain insight into possible phenotypes regulated by acyl-HSLs in activated sludge, bacterial isolates were tested for six known acyl-HSL regulated phenotypes, lipase, cellulase, elastase, chitinase, surfactant and antimicrobial production. Out of the acyl-HSL producing isolates identified, 75 % expressed one or more of the known acyl-HSL regulated phenotypes tested (Chapter 3). This suggests the possible role and importance of the acyl-HSL-mediated activity in the ecology of the activated sludge environment.
6.1.2.1 Increased chitinase activity
In this project, it was additionally observed that exogenous addition of an acyl- HSL to activated sludge resulted in an increased chitinase activity in the sludge supernatant (Chapter 4). In Chapter 3, it was shown that chitinolytic bacterial isolates predominantly belonged to the most abundant members of the culture collection, the Aeromonads. Of the Aeromonads isolated, almost all displayed acyl-HSL producing capabilities and more than half of them activated the CviR,
157 Chapter 6
TraR and LuxR sensors, leaving little doubt that they produce acyl-HSLs. From this result, it is speculated that shorter chain acyl-HSLs, such as OHHL, regulate production of extracellular chitinase enzymes by Aeromonads in activated sludge.
Chitin, as well as chitosan, a derivative of deacetylated chitin, are commonly used as flocculants for efficient coagulation of suspended particles in wastewater treatment systems (46). Fungal cell wall, crustacean and insect debris are also sources of chitin in wastewater (207). A model whereby the aggregation of particles of chitin and acyl-HSL producing chitinolytic bacteria such as Aeromonads in activated sludge, is followed by acyl-HSL accumulation in the aggregates and the consequential expression of genes encoding extracellular chitinase activity via the acyl-HSL dependent quorum sensing mechanism, could be proposed. This in turn would lead to the liberation of carbon and energy from chitin and a resulting increase in floc biomass. This process could be important in the formation of activated sludge flocs and have desirable settling properties. Note that the data presented here does not exclude the possibility that other untested phenotypes are regulated by acyl-HSLs or other untested acyl-HSLs regulate the phenotypes tested in activated sludge. But overall, these experiments highlight the potential importance of interspecies interactions for acyl-HSL mediated gene expression in a mixed species community.
6.1.2.2 Reduced nitrification
Nitrifying bacteria are commonly associated with biofilms (1, 225) in the environment with activated sludge being no exception. The fact that acyl-HSLs accumulate in aggregated biomass and the recent discovery that nitrifying species produce acyl-HSLs (eg. Nitrosomonas europeae), suggests that nitrification, an important activated sludge function, could be influenced by an unknown mechanism by acyl-HSL-mediated gene expression (31). Batchelor et al. (15) have shown that acyl-HSL molecules increase the recovery response rate of starved Nitrosomonas biofilms to fresh nutrients, a situation expected to be beneficial to competitive communities in sludge when faced with unstable nutrient levels in the environment. In the current project, addition of OHHL to
158 Chapter 6 activated sludge resulted in a clear reduction in nitrate concentration (Chapter 4). To our knowledge, there appears to be no report concerning the role of acyl-HSLs on nitrifying activities, but recent studies reported the down-regulation of denitrification enzymes in P. aeruginosa by quorum sensing (318). This suggested how acyl-HSLs could affect the overall nitrogen cycling in wastewater treatment, but more work needs to be done to investigate the mechanisms responsible for the effects observed on nitrification.
The results presented in this work provided a new insight into the complexity of the quorum sensing process that could occur in sludge, illustrating the potential significance of acyl-HSL mediated gene expression as a key control point in the functioning of sludge. This also serves as a starting point to investigate acyl-HSL regulated interactions that could be restricted to certain groups in the community, leading to ecosystem-level effects in wastewater treatment.
6.2 Signal production drives cooperation in a V. fischeri population
The metabolic burden of producing signalling molecules, such as acyl-HSLs, that can be utilized by neighbouring cells to measure the population density of clone- mates in the environment before expressing cooperative genes, makes communication systems vulnerable to cheaters that could exploit the benefits of cooperation but not contribute to the effort (344). Quorum sensing cheats, without the metabolic burden associated with the assimilation of information for a cooperative behaviour, could evolve and possess a competitive growth advantage in a population (344). This being the case, it is not clear how intercellular signalling mechanisms are preserved within bacterial lineages (346).
There are two possible explanations for the retention of quorum sensing systems over evolutionary time. Firstly, in environments with fewer available resources, different groups within a microbial community could select for the use of different resources in the face of local resource competition. However, for a group invaded by cheats and had therefore lost a specialized group dependent trait (for example,
159 Chapter 6 acyl-HSL mediated chitinase production) will be outcompeted by a predominantly cooperative group (that can still access resources from chitin) that reproduce faster. This is supported by a report that described siderophore-producing P. aeruginosa cells outgrew mutant cells that do not produce siderophores, in iron- limiting conditions (130). Secondly, the components of the signalling system could be selected against mutation by playing important roles in the physiology of the individual cell. Interestingly, different components of the signalling system may be protected by different mechanisms.
6.2.1 luxI synthase gene in V. fischeri observed to be stable in long-term evolutionary study
Chapter 5 of the project explored the nature of the selection pressure maintaining an acyl-HSL synthase gene in a model quorum sensing organism. Specifically, the spontaneous evolution of quorum sensing cheats in batch cultures of wild-type acyl-HSL-producing V. fischeri cells were monitored in a long-term evolutionary study. We hypothesised that if signal-production represents a resource cost to the individual cell, then signal deficient mutants should evolve over time in the absence of selection for the regulated phenotype (bioluminescence). The appearance of signal deficient mutants would have indicated that signal production represents a resource cost to the individual cell that must be recouped through cooperative behaviour. The absence of signal deficient mutants, as was observed here, would suggest that the gene is directly beneficial to the individual cell.
Half of the ten lineages maintained in this experiment lost the ability to luminesce and sequencing results attributed this to the spontaneous evolution of luxR– mutants in four of the lineages. In the case of P. aeruginosa, it is more common to find lasR– mutants than lasI– mutants, though both quorum sensing deficient types are observed (290). This is explained by the fact that mutants deficient in signal production will still express the signalling regulated phenotype in the presence of signal producing (wild-type) cells, whilst mutants deficient in a response to signals will not express the phenotype. Expression of the phenotype represents a
160 Chapter 6 greater physiological burden than does signal production, therefore lasR– mutants have an advantage over lasI– mutants.
In contrast to observations made on P. aeruginosa, no acyl-HSL synthase mutants were observed in V. fischeri in this study, despite a concerted effort to detect them. This was the case in ten distinct V. fischeri lineages subcultured daily over a 325 day period and in a single V. fischeri lineage forced through genetic engineering to maintain the luxR gene and subcultured daily over 150 days. The evolutionary stability of the luxI gene, in the absence of selection for the phenotype it regulates, suggests that acyl-HSL production may offer unknown selective advantages to the individual cell beyond their role as signals.
6.2.2 Selective advantages of the luxI synthase gene
The selective advantage of the luxI gene was also evident from the rapid dominance of wild type V. fischeri cells when mixed in a population with acyl- HSL deficient mutants in the absence of selection for the bioluminescent phenotype. It is possible that the bioluminescent phenotype was selected for under the conditions used in this study. Previous work has suggested light production (bioluminescence) has been shown to benefit bacterial cells directly by recycling reducing equivalents and repairing DNA at photoreactivating wavelengths (21, 60) or could be a defensive mechanism for coping with oxidative stress in the cell (332). Another competitive growth study with V. harveyi cells, when subjected to UV stress, also produced a similar result of luminescent wild type cells taking over the population (59). However, this would not explain why the V. fischeri wild-type was more competitive than the luxI– mutant because both lineages would have been expressing the bioluminescent phenotype as a result of the wild- type supplying acyl-HSL to the mutant in the co-culture. Additionally, the fact that bioluminescence was lost in half of the lineages maintained in the long-term evolution experiments suggests bioluminescence was indeed a burden under the culture conditions imposed. It is maintained, therefore, that the luxI gene confers a selective advantage to V. fischeri cells.
161 Chapter 6
Beneficial cellular functions that signal molecules have been associated with other than quorum sensing, such as riboflavin synthesis (35), serving as iron-scavenging molecules (73, 155), and potent immune modulators (110), have been suggested. Since acyl-HSLs are not currently known to play a role in central bacterial metabolism and because V. fischeri luxI– mutants are still viable under typical culturing conditions (193), the evolutionary advantage to the individual of producing acyl-HSLs remains unknown.
The fluctuating bioluminescence levels observed in the ten V. fischeri lineages was unexpected. Compensatory mutations that restore quorum sensing behaviour have been observed in P. aeruginosa lasR– mutants and it is possible that a similar phenomenon was occurring here (322). It is considered more likely, however, that the fall in bioluminescence levels in the lineages resulted from an increase in abundance of luxR– mutants (or other mutations that affected bioluminescene) within the lineages, and that the rise in luminescence resulted from the rise in abundance of other mutant lineages (of which there would be many) with rapid growth rates and wild-type bioluminescence genotypes. Ultimately, mutations in the luxR gene represent a growth advantage under these conditions, so eventually there will be no mutant lineage without a luxR mutation. Based on this proposed model, it can be assumed that the remaining five intermittently bioluminescent lineages in this investigation would have become permanently dark given enough time.
The findings in this project contradict some theoretical and empirical studies which have indicated cooperative behaviours are not selected for at the level of the individual cell (72, 264). Whilst the observations made here could be specific to V. fischeri, it is reasonable to conclude that molecular components of cooperative behaviours can be selected for at the individual level. Nevertheless, the stable maintenance of the acyl-HSL synthase gene in V. fischeri and the quorum sensing systems evolutionarily conserved in a wide range of organisms, provide good indications that signalling molecules could provide selective advantages and multiple functions for the cell.
162 Chapter 6
6.2.3 Relationship between a beneficial stable luxI gene and activated sludge
The previous chapters address how quorum sensing could be beneficial to the functioning of activated sludge. However, quorum sensing has been suggested to be costly, since the production of acyl-HSLs can be utilized and exploited by selfish individual (cheaters) or its neighbours within the population, without expending resources. The likelihood for cooperative behaviours (quorum sensing) to persist in multi-species environments, where kin selection is rare, is also believed to be lower. Hence, this selfish behaviour could be adverse to environments, like activated sludge, where quorum sensing mutants could have a competitive advantage in the community and take over the population. Chapter 5 describes how the acyl-HSL synthase is stably maintained in the cell, despite long-term evolutionary experiments where adaptive evolution of the cells for competitive fitness occurred. This suggests there could be a competitive advantage to retain components of the signalling system even in environments with fluctuating nutrient levels and high competition, such as activated sludge.
6.3 Future directions
The work described in this thesis has answered many questions, but has also created others worthy of further investigation:
1. Changes in microbial community composition can result in large-scale changes in the function of the ecosystem. With increased chitinase production in response to OHHL addition, identification of any subsequent changes in the microbial community composition in sludge using DGGE could provide a link to the key players responsible for the observed effects. This would determine if the hypothesized Aeromonads are a functionally important group of chitinolytic bacteria for acyl-HSL mediated quorum sensing in sludge, or Bacteroidetes, a group of sludge bacteria commonly associated with chitin utilization, could be responsive to acyl-HSL gene regulation as well.
163 Chapter 6
2. Nitrifying effects were almost abolished with the addition of OHHLs in sludge. There are many possible explanations for this occurrence: The downregulation of nitrifying enzymes, reduced cell activity of slow- growing nitrifying bacteria due to the OHHL-induced dominance of heterotrophic organisms in the population, altered conditions (such as pH) in the sludge environment, exogenous addition of acyl-HSL concentrations above normal levels caused the downregulation of quorum sensing. Answering these questions would provide an insight into whether acyl- HSLs have a role in nitrification, and would increase our understanding of the use of acyl-HSLs in sludge.
3. Quorum sensing has shown to induce changes in sludge behaviour. By introducing acyl-HSL degrading compounds, such lactonases or furanones, in sludge, the impact of quorum sensing signal disruption in sludge could be assessed to confirm our findings.
4. The physiological processes that control the fluctuating bioluminescence levels in a V. fischeri lineage during the long-term evolutionary study are still unclear. Global gene profiling using high throughput sequencing could be used to track changes in expression levels or to detect single nucleotide polymorphisms of bioluminescence associated genes in the population, to study the molecular mechanisms of the evolving mutant types responsible for expressing the irregular light output profile in the lineage.
5. Using high throughput sequencing technology, differences in physiological properties between the wild-type and luxI– mutants of V. fischeri could also be determined to identify various activities other than luminescence controlled by acyl-HSL quorum sensing regulon, that might extend the significance of its competitive behaviour in V. fischeri.
164 References
References
1. Aakra, A., M. Hesselsoe, and L. R. Bakken. 2000. Surface attachment of ammonia-oxidizing bacteria in soil. Microb. Ecol. 39:222-235. 2. Ahmer, B. M. M., J. van Reeuwijk, C. D. Timmers, P. J. Valentine, and F. Heffron. 1998. Salmonella typhimurium encodes an SdiA homolog, a putative quorum sensor of the LuxR family, that regulates genes on the virulence plasmid. J. Bacteriol. 180:1185-1193. 3. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. 4. Andersen, J. B., C. Sternberg, L. K. Poulsen, S. P. Bjorn, M. Givskov, and S. Molin. 1998. New unstable variants of green fluorescent protein for studies of transient gene expression in bacteria. Appl. Environ. Microbiol. 64:2240-2246. 5. Anderson, J. B., A. Heydorn, M. Hentzer, L. Eberl, O. Geisenberger, B. B. Christensen, S. Molin, and M. Givskov. 2001. gfp-based N-acyl homoserine-lactone sensor systems for detection of bacterial communication. Appl. Environ. Microbiol. 67:575-585. 6. Andersson, R. A., A. R. Eriksson, R. Heikinheimo, A. Mae, M. Pirhonen, V. Koiv, H. Hyytiainen, A. Tuikkala, and E. T. Palva. 2000. Quorum sensing in the plant pathogen Erwinia carotovora subsp. carotovora: the role of expR(Ecc). Mol. Plant Microbe Interact. 13:384- 393. 7. Atkinson, S., J. P. Throup, G. S. Stewart, and P. Williams. 1999. A hierarchical quorum-sensing system in Yersinia pseudotuberculosis is involved in the regulation of motility and clumping. Mol. Microbiol. 33:1267-1277. 8. Bainton, N. J., B. W. Bycroft, S. R. Chhabra, P. Stead, L. Gledhill, P. J. Hill, C. E. D. Rees, M. K. Winson, G. P. C. Salmond, and G. S. Stewart. 1992. A general role for the lux autoinducer in bacterial cell signalling: control of antibiotic biosynthesis in Erwinia. Gene 116:87-91. 9. Bainton, N. J., P. Stead, S. R. Chhabra, B. W. Bycroft, G. P. C. Salmond, G. S. Stewart, and P. Williams. 1992. N-(3-Oxohexanoyl)-L- homoserine lactone regulates carbapenem antibiotic production in Erwinia carotovora. Biochem. J. 288:997-1004. 10. Baker, C. J., N. Mock, M. M. Atkinson, and S. W. Hutcheson. 1990. Inhibition of the hypersensitive response in tobacco by pectate lyase digests of cell wall and of polygalacturonic acid. Physiol. Mol. Plant Pathol. 37:133-167. 11. Barany, S., and A. Szepesszentgyorgyi. 2004. Flocculation of cellular suspensions by polyelectrolytes. Adv. Colloid Interface Sci. 111:117-129. 12. Barber, C. E., J. L. Tang, J. X. Feng, M. Q. Pan, T. J. G. Wilson, H. Slater, J. M. Dow, P. Williams, and M. J. Daniels. 1997. A novel regulatory system required for pathogenicity of Xanthomonas campestris is mediated by a small diffusible signal molecule. Mol. Microbiol. 24:555- 566.
165 References
13. Barberio, C., and R. Fani. 1998. Biodiversity of an Acinetobacter population isolated from activated sludge. Res. Microbiol. 149:665-673. 14. Barboza-Corona, J. E., J. C. Contreras, R. Velazquez-Robledo, M. Bautista-Justo, M. Gomez-Ramirez, R. Cruz-Camarillo, and J. E. Ibarra. 1999. Selection of chitinolytic strains of Bacillus thuringiensis. Biotechnol. Lett. 21:1125-1129. 15. Batchelor, S. E., M. Cooper, S. R. Chhabra, L. A. Glover, G. S. Stewart, P. Williams, and J. I. Prosser. 1997. Cell density-regulated recovery of starved biofilm populations of ammonia-oxidizing bacteria. Appl. Environ. Microbiol. 63:2281-2286. 16. Beiderbeck, V. O., C. A. Campbell, H. Ukrainetz, D. Curtin, and O. T. Bouman. 1996. Soil microbial and biochemical properties after ten years of fertilization with anhydrous ammonia. Can. J. Soil Sci. 76:7-14. 17. Bobbink, R., M. Hornung, and J. G. M. Roelofs. 1998. The effects of air-borne nitrogen pollutants on species diversity in natural and semi- natural European vegetation. J. Ecol. 86:717-738. 18. Bodman, S. B., D. R. Majerczak, and D. L. Coplin. 1998. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc. Natl. Acad. Sci. USA 95:7687-7692. 19. Bose, J. L., U. Kim, W. Bartkowski, R. P. Gunsalus, A. M. Overley, N. L. Lyell, K. L. Visick, and E. V. Stabb. 2007. Bioluminescence in Vibrio fischeri is controlled by the redox-responsive regulator ArcA. Mol. Microbiol. 65:538-553. 20. Bossier, P., and W. Verstraete. 1996. Triggers for microbial aggregation in activated sludge? Appl. Microbiol. Biotechnol. 45:1-6. 21. Bourgois, J.-J., F. E. Sluse, F. Baguet, and J. Mallefet. 2001. Kinetics of light emission and oxygen consumption by bioluminescent bacteria. J. Bioenerg. Biomembr. 33:353-363. 22. Boylan, M., C. M. Miyamoto, L. Wall, A. Grahm, and E. A. Meighen. 1989. Lux C, D, and E genes of the Vibrio fischeri luminescence operon code for the reductase, transferase, and synthetase enzymes involves in aldehyde biosyntheses. Photochem. Photobiol. 49:681-688. 23. Brockhurst, M. A., M. E. Hochberg, T. Bell, and A. Buckling. 2006. Character displacement promotes cooperation in bacterial biofilms. Curr. Biol. 16:2030-2034. 24. Brookfield, J. F. Y. 1998. Quorum sensing and group selection. Evolution 52:1263-1269. 25. Brown, S. P. 1999. Cooperation and conflict in host-manipulating parasites. Proc. R. Soc. Lond. B 266:1899-1904. 26. Brown, S. P., and R. A. Johnstone. 2001. Cooperation in the dark: signalling and collective action in quorum-sensing bacteria. Proc. R. Soc. Lond. B 268:961-965. 27. Burmolle, M., L. H. Hansen, G. Oregaard, and S. J. Sorensen. 2003. Presence of N-acyl homoserine lactones in soil detected by a whole-cell biosensor and flow cytometry. Microb. Ecol. 45:226-236. 28. Burmolle, M., L. H. Hansen, and S. J. Sorensen. 2005. Use of whole- cell biosensor and flow cytometry to detect AHL production by an Indigenous soil community during decomposition of litter. Microb. Ecol. 50:221-229.
166 References
29. Burmolle, M., J. S. Webb, D. Rao, L. H. Hansen, S. J. Sorensen, and S. Kjelleberg. 2006. Enhanced biofilm formation and increased resistance to antimicrobial agents and bacterial invasion are caused by synergistic interactions in multispecies biofilms. Appl. Environ. Microbiol 72:3916- 3923. 30. Burne, R. A., and R. E. Marquis. 2000. Alkali production by oral bacteria and protection against dental caries. FEMS Microbiol Lett 193:1- 6. 31. Burton, E. O., H. W. Read, M. C. Pellitteri, and W. J. Hickey. 2005. Identification of acyl-homoserine lactone signal molecules produced by Nitrosomonas europaea strain Schmidt. Appl. Environ. Microbiol. 71:4906-4909. 32. Byers, J. T., C. Lucas, G. P. C. Salmond, and M. Welch. 2002. Nonenzymatic turnover of an Erwinia carotovora quorum-sensing signaling molecule. J. Bacteriol. 184:1163-1171. 33. Cabrol, S., A. Olliver, G. B. Pier, A. Andremont, and R. Ruimy. 2003. Transcription of quorum-sensing system genes in clinical and environmental isolates of Pseudomonas aeruginosa. J. Bacteriol. 185:7222-7230. 34. Cadoret, A., A. Conrad, and J. C. Block. 2002. Availability of low and high molecular weight substrates to extracellular enzymes in whole and dispersed activated sludges. Enzyme Microb. Technol. 31:179-186. 35. Callahan, S. M., and P. V. Dunlap. 2000. LuxR- and acyl-homoserine- lactone-controlled non-lux genes define a quorum-sensing regulon in Vibrio fischeri. J. Bacteriol. 182:2811-2822. 36. Carlier, A., R. Chevrot, Y. Dessaux, and D. Faure. 2004. The assimilation of gamma-butyrolactone in Agrobacterium tumefaciens C58 interferes with the accumulation of the N-acyl-homoserine lactone signal. Mol. Plant Microbe Interact. 17:951-957. 37. Carlier, A., S. Uroz, B. Smadja, R. Fray, X. Latour, Y. Dessaux, and D. Faure. 2003. The Ti plasmid of Agrobacterium tumefaciens harbors an attM-paralogous gene, aiiB, also encoding N-acyl homoserine lactonase activity. Appl. Environ. Microbiol. 69:4989-4993. 38. Case, R. J., M. Labbate, and S. Kjelleberg. 2008. AHL-driven quorum- sensing circuits: their frequency and function among the Proteobacteria. ISME J. 2:345-349. 39. Cha, C., P. Gao, Y. C. Chen, P. D. Shaw, and S. K. Farrand. 1998. Production of acyl-homoserine lactone quorum-sensing signals by gram- negative plant-associated bacteria. Mol. Plant Microbe Interact. 11:1119- 1129. 40. Chambers, C. E., M. B. Visser, U. Schwab, and P. A. Sokol. 2005. Identification of N-acylhomoserine lactones in mucopurulent respiratory secretions from cystic fibrosis patients. FEMS Microbiol. Lett. 244:297- 304. 41. Chang, S.-C., J.-T. Wang, P. Vandamme, J.-H. Hwang, P.-S. Chang, and W.-M. Chen. 2004. Chitinimonas taiwanensis gen. nov., sp. nov., a novel chitinolytic bacterium isolated from a freshwater pond for shrimp culture. Syst. Appl. Microbiol. 27:43-49. 42. Charlton, T. S., R. de Nys, A. Netting, N. Kumar, M. Hentzer, M. Givskov, and S. Kjelleberg. 2000. A novel and sensitive method for the
167 References
quantification of N-3-oxoacyl homoserine lactones using gas chromatography-mass spectrometry: application to a model bacterial biofilm. Environ. Microbiol. 2:530-541. 43. Chaudri, A. M., B. P. Knight, V. L. Barbosa-Jefferson, S. Preston, G. I. Paton, K. Killham, N. Coad, F. A. Nicholson, B. J. Chambers, and S. P. McGrath. 1999. Detection of acute Zn toxicity in pore water from soils previously treated with sewage sludge using bioluminescence assays. Environ. Sci. Technol. 33:1880-1885. 44. Chernin, L. S., M. K. Winson, J. M. Thompson, S. Haran, B. W. Bycroft, I. Chet, P. Williams, and G. S. Stewart. 1998. Chitinolytic activity in Chromobacterium violaceum: substrate analysis and regulation by quorum sensing. J. Bacteriol. 180:4435-4441. 45. Chhabra, S. R., P. Stead, N. J. Bainton, G. P. C. Salmond, G. S. Stewart, P. Williams, and B. W. Bycroft. 1993. Autoregulation of carbapenem biosynthesis in Erwinia carotovora ATCC 39048 by analogues of N-(3-oxohexanoyl)-L-homoserine lactone. J. Antibiot. 46:441-454. 46. Chi, F. H., and W. P. Cheng. 2006. Use of chitosan as coagulant to treat wastewater from milk processing plant. J. Polym. Environ. 14:411-417. 47. Choi, S. H., and E. P. Greenberg. 1991. The C-terminal region of the Vibrio fischeri LuxR protein contains an inducer-independent lux gene activating domain. Proc. Natl. Acad. Sci. USA 88:11115-11119. 48. Christensen, A. B., K. Riedel, L. Eberl, L. R. Flodgaard, S. Molin, L. Gram, and M. Givskov. 2003. Quorum-sensing-directed protein expression in Serratia proteamaculans B5a. Microbiology-Sgm 149:471- 483. 49. Chrost, R. J. 1989. Characterization and significance of beta-glucosidase activity in lake water. Limnol. Oceanogr. 34:660-672. 50. Chu, I. M., C. Lee, and T. S. Li. 1992. Production and degradation of alkaline protease in batch cultures of Bacillus subtilis ATCC 14416. Enzyme Microb. Technol. 14:755-761. 51. Clark, J. D., and O. Maaloe. 1967. DNA replication and the division cycle in Escherichia coli. J. Mol. Biol. 23:99-112. 52. Claus, H., T. Bausinger, I. Lehmler, N. Perret, G. Fels, U. Dehner, J. Preub, and H. Konig. 2006. Transformation of 2,4,6-trinitrotoluene (TNT) by Raoultella terrigena. Biodegradation 18:27-35. 53. Cooper, P. F., and A. L. Downing. 1998. Milestones in the development of the activated-sludge process over the past eighty years (abridged). Water and Environ. J. 12:303-313. 54. Cowan, S. E., E. Gilbert, D. Liepmann, and J. D. Keasling. 2000. Commensal interactions in a dual-species biofilm exposed to mixed organic compounds. Appl. Environ. Microbiol 66:4481-4485. 55. Cozens, R. M., E. Tuomanen, W. Tosch, O. Zak, J. Suter, and A. Tomasz. 1986. Evaluation of the bactericidal activity of beta-lactam antibiotics on slowly growing bacteria cultured in the chemostat. Antimicrob. Agents Chemother. 29:797-802. 56. Crespi, B. J. 2001. The evolution of social behaviour in microorganisms. Trends Ecol. Evol. 16:178-183. 57. Curds, C. R. 1973. The role of protozoa in the activated sludge process. Integr. Comp. Biol. 13:161-169.
168 References
58. Czaran, T., and R. F. Hoekstra. 2009. Microbial communication, cooperation and cheating: quorum sensing drives the evolution of cooperation in bacteria. PLoS ONE 4:6655-6664. 59. Czyz, A., K. Plata, and G. Wegrzyn. 2002. Stimulation of DNA repair as an evolutionary drive for bacterial luminescence. Luminescence 18:140- 144. 60. Czyz, A., B. Wrobel, and G. Wegrzyn. 2000. Vibrio harveyi bioluminescence plays a role in stimulation of DNA repair. Microbiology 146:283-288. 61. d'Angelo-Picard, C., D. Faure, I. Penot, and Y. Dessaux. 2005. Diversity of N-acyl homoserine lactone-producing and -degrading bacteria in soil and tobacco rhizosphere. Environ. Microbiol. 7:1796-1808. 62. da Silva Nunes-Halldorson, V., and N. L. Duran. 2003. Bioluminescent bacteria: lux genes as environmental biosensors. Brazilian J. Microbiol. 34:91-96. 63. Danino, V. E., A. Wilkinson, A. Edwards, and J. A. Downie. 2003. Recipient-induced transfer of the symbiotic plasmid pRL1JI in Rhizobium leguminosarum bv. viciae is regulated by a quorum-sensing relay. Mol. Microbiol. 50:511-525. 64. Davey, M. E., N. C. Caiazza, and G. A. O'Toole. 2003. Rhamnolipid surfactant production affects biofilm architecture in Pseudomonas aeruginosa PAO1. J. Bacteriol. 185 :1027-1036. 65. Davis, D. G., M. R. Parsek, J. P. Pearson, B. H. Iglewski, J. W. Costerton, and E. P. Greenberg. 1998. The involvement of cell-to-cell signals in the development of a bacterial biofilm. Science 280:295-298. 66. de Kievit, T. R., and B. H. Iglewski. 2002. Bacterial quorum sensing in pathogenic relationships. Infect. Immun. 68:4839-4849. 67. DeAngelis, K. M., S. E. Lindow, and M. K. Firestone. 2008. Bacterial quorum sensing and nitrogen cycling in rhizosphere soil. FEMS Microbiol. Ecol. 66:197-207. 68. Defoirdt, T., R. Crab, T. K. Wood, P. Sorgeloos, W. Verstraete, and P. Bossier. 2006. Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii and Vibrio parahaemolyticus isolates. Appl. Environ. Microbiol 72:6419-6423. 69. DeLorenzo, V., M. Herrero, U. Jakubzik, and K. Timmis. 1990. Mini- Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in Gram-negative eubacteria. J. Bacteriol. 172:6568-6572. 70. Dietrich, L. E. P., A. Price-Whelan, A. Petersen, M. Whiteley, and D. K. Newman. 2006. The phenazine pyocyanin is a terminal signalling factor in the quorum sensing network of Pseudomonas aeruginosa. Mol. Microbiol. 61:1308-1321. 71. Diggle, S. P., A. Gardner, S. A. West, and A. S. Griffin. 2007. Evolutionary theory of bacterial quorum sensing: when is a signal not a signal? Phil. Trans. R. Soc. B 362:1241-1249. 72. Diggle, S. P., A. S. Griffin, G. S. Campbell, and S. A. West. 2007. Cooperation and conflict in quorum-sensing bacterial populations. Nat. Lett. 450:411-414.
169 References
73. Diggle, S. P., S. Matthijs, V. J. Wright, M. P. Fletcher, S. R. Chhabra, I. L. Lamont, X. Kong, R. C. Hider, P. Cornelis, M. Camara, and P. Williams. 2007. The Pseudomonas aeruginosa 4-quinolone signal molecules HHQ and PQS play multifunctional roles in quorum sensing and iron entrapment. Chem. Biol. 14:87-96. 74. Dinges, M. M., P. M. Orwin, and P. M. Schlievert. 2000. Exotoxins of Staphylococcus aureus. Clin. Microbiol. Rev. 13:16-34. 75. Doggett, R. G., G. M. Harrison, R. N. Stillwell, and E. S. Wallies. 1966. An atypical Pseudomonas aeruginosa associated with cystic fibrosis of the pancreas. J. Pediatr. 68:215-221. 76. Dolan, K. M., and E. P. Greenberg. 1992. Evidence that GroEL, not sigma32, is involved in transcriptional regulation of the Vibrio fischeri luminescence genes in Escherichia coli. J. Bacteriol. 174:5132-5135. 77. Dong, Y. H., A. R. Gusti, Q. Zhang, J. L. Xu, and L. H. Zhang. 2002. Identification of quorum quencing N-acyl homoserine lactonases from Bacillus species. Appl. Environ. Microbiol 68:1754-1759. 78. Dong, Y. H., L. H. Wang, J. L. Xu, H. B. Zhang, X. F. Zhang, and L. H. Zhang. 2001. Quenching quorum-sensing-dependent bacterial infection by an N-acyl homoserine lactonase. Nature 411:813-817. 79. Dong, Y. H., X. F. Zhang, J. L. Xu, and L. H. Zhang. 2004. Insecticidal Bacillus thuringiensis silences Erwinia carotovora virulence by a new form of microbial antagonism - signal interference. Appl. Environ. Microbiol. 70:954-960. 80. Dugatkin, L. A., M. Perlin, J. S. Lucas, and R. Atlas. 2005. Group- beneficial traits, frequency-dependent selection and genotypic diversity: an antibiotic resistance paradigm. Proc. R. Soc. Lond. B 272:79-83. 81. Dulla, G., and S. E. Lindow. 2008. Quorum size of Pseudomonas syringae is small and dictated by water availability on the leaf surface. Proc. Natl. Acad. Sci. USA 105:3082-3087. 82. Dunlap, P. V., and E. P. Greenberg. 1988. Control of Vibrio fischeri lux gene transcription by a cyclic AMP receptor protein-LuxR protein regulatory circuit. J. Bacteriol. 170:4040-4046. 83. Dunny, G. M., and B. A. Leonard. 1997. Cell-cell communication in gram-positive bacteria. Annu. Rev. Microbiol. 51:527-564. 84. Eberhard, A., A. L. Burlingame, C. Eberhard, G. L. Kenyon, K. H. Nealson, and N. J. Openheimer. 1981. Structural identification of autoinducer of Photobacterium fischeri. Biochemistry 20:2444-2449. 85. Eberl, L. 1999. N-Acyl homoserinelactone-mediated gene regulation in gram-negative bacteria. Syst. Appl. Microbiol. 22:493-506. 86. Eberl, L., M. K. Winson, C. Sternberg, G. S. Stewart, G. Christiansen, S. R. Chhabra, B. W. Bycroft, P. Williams, S. Molin, and M. Givskov. 1996. Involvement of N-acyl-L-homoserine lactone autoinducers in controlling the multicellular behaviour of Serratia liquefaciens. Mol. Microbiol. 20:127-136. 87. Eckenfelder, W. W., and Y. Argaman. 1991. Principles of biological and physical/chemical nitrogen removal. CRC Press LLC, Boca Raton. 88. Eckenfelder, W. W., and P. Grau. 1998. Activated sludge process design and control: theory and practice, Second edition ed, vol. 1. Technomic Publishing Company, Inc., Lancaster, Pennsylvania USA.
170 References
89. Egland, K. A., and E. P. Greenberg. 1999. Quorum sensing in Vibrio fischeri: elements of the luxI promoter. Mol. Microbiol. 31:1197-1204. 90. Egland, P. G., R. J. Palmer, and P. E. Kolenbrander. 2004. Interspecies communication in Streptococcus gordonii-Veillonella atypica biofilms: signalling in flow conditions requires juxtaposition. Proc. Natl. Acad. Sci. USA 101:16917-16922. 91. Erickson, D. L., V. L. Nsereko, D. P. Morgavi, L. B. Selinger, L. M. Rode, and K. A. Beauchemin. 2002. Evidence of quorum sensing in the rumen ecosystem: detection of N-acyl homoserine lactone autoinducers in ruminal contents. Can. J. Microbiol. 48:374-378. 92. Farrand, S. K., Y. Qin, and P. Oger. 2002. Quorum-sensing system of Agrobacterium plasmids: analysis and utility. Methods Enzymol. 358:452- 484. 93. Fernando, M., N. Boon, S. Dobbelaere, T. Defoirdt, and W. Verstraete. 2005. Production of acylated homoserine lactones by Aeromonas and Pseudomonas strains isolated from municipal activated sludge. Can. J. Microbiol. 51:924-933. 94. Fidopiastis, P. M., C. M. Miyamoto, M. G. Joblinb, E. A. Meighen, and E. G. Ruby. 2002. LitR, a new transcriptional activator in Vibrio fischeri, regulates luminescence and symbiotic light organ colonization. Mol. Microbiol. 45:131-143. 95. Folders, J., J. Algra, M. S. Roelofs, L. C. van Loon, J. Tommassen, and W. Bitter. 2001. Characterization of Pseudomonas aeruginosa chitinase, a gradually secreted protein. Journal of Bacteriology 183:7044- 7052. 96. Fortunato, A., J. E. Strassmann, L. Santorelli, and D. C. Queller. 2003. Co-occurence in nature of different clones of the social amoeba, Dictyostelium discoideum. Mol. Ecol. 12:1031-1038. 97. Foster, K. R., A. Fortunato, J. E. Strassmann, and D. C. Queller. 2002. The costs and benefits of being a chimera. Proc. R. Soc. Lond. B 269:2357-2362. 98. Frank, S. A. 1998. Foundations of social evolution Princeton University Press, Princeton. 99. Frank, S. A. 1995. Mutual policing and repression of competition in the evolution of cooperative groups. Nature 377:520-522. 100. Fried, B., and J. Sherma. 1999. Thin-layer chromatography, p. 223-233, Fourth ed, vol. 81. CRC Press. 101. Frolund, B., K. Keiding, and P. H. Nielsen. 1995. Enzymatic activity in the activated sludge flocs matrix. Appl. Microbiol. Biotechnol. 43:755- 761. 102. Frolund, B., R. Palmgren, K. Keiding, and P. H. Nielsen. 1996. Extraction of extracellular polymers from activated sludge using a cation exchange resin. Water Res. 30:1749-1758. 103. Fuqua, C. 2006. The QscR quorum-sensing regulon of Pseudomonas aeruginosa: an orphan claims its identity. J. Bacteriol. 188:3169-3171. 104. Fuqua, C., and E. P. Greenberg. 2002. Listening in on bacteria: acyl- homoserine lactone signalling. Nat. Rev. Mol. Cell Biol. 3:685-695. 105. Fuqua, C., and E. P. Greenberg. 1998. Self perception in bacteria: quorum sensing with acylated homoserine lactones. Curr. Opin. Microbiol. 1:183-189.
171 References
106. Fuqua, C., M. R. Parsek, and E. P. Greenberg. 2001. Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu. Rev. Genet. 35:439-468. 107. Fuqua, C., and S. C. Winans. 1996. Conserved cis-acting promoter elements are required for density-dependent transcription of Agrobacterium tumefaciens conjugal transfer genes. J. Bacteriol. 178:435- 440. 108. Fuqua, W. C., and S. C. Winans. 1994. A LuxR-LuxI type regulatory system activates Agrobacterium Ti plasmid conjugal transfer in the presence of a plant tumour metabolite. J. Bacteriol. 176:2796-3806. 109. Fuqua, W. C., S. C. Winans, and E. P. Greenberg. 1994. Quorum sensing in bacteria: the LuxR-LuxI family of cell-density responsive transcriptional regulators. J. Bacteriol. 176:269-275. 110. Gallo, R. L. 2008. Sounding the alarm: multiple functions of host defense peptides. J. Invest. Dermatol. 128:5-6. 111. Galloway, J. N. 1995. Acid deposition: perspectives in time and space. Water Air Soil Pollut 85:15-24. 112. Galloway, J. N., W. H. Schlesinger, H. Levy II, A. Michaels, and J. L. Schnoor. 1995a. Nitrogen fixation: Anthropogenic enhancement- environmental response. Global Biogeochem. Cycles 9:235-252. 113. Gambello, M. J., and B. H. Iglewski. 1991. Cloning and characterization of the Pseudomonas aeruginosa lasR gene, a transcriptional activator of elastase expression J. Bacteriol. 173:3000-3009. 114. Gao, M.-S., M. Teplitski, J. B. Robinson, and W. D. Bauer. 2003. Production of substances by Medicago truncatula that affect bacterial quorum sensing. Mol. Plant Microb. Interact. 16. 115. Geets, J., N. Boon, and W. Verstraete. 2006. Strategies of aerobic ammonia-oxidizing bacteria for coping with nutrient and oxygen fluctuations. FEMS Microbiol. Ecol. 58:1-13. 116. Geisenberger, O., M. Givskov, K. Riedel, N. Hoiby, B. Tummler, and L. Eberl. 2000. Production of N-acyl-homoserine lactones by Pseudomonas aeruginosa isolates from chronic lung infections associated with cystic fibrosis. FEMS Microbiol. Lett. 184:273-278. 117. Gessesse, A., T. Dueholm, S. B. Petersen, and P. H. Nielsen. 2003. Lipase and protease extraction from activated sludge. Water Res. 37:3652- 3657. 118. Givskov, M., L. Eberl, and S. Molin. 1997. Control of exoenzyme production, motility and cell differentiation in Serratia liquefaciens. FEMS Microbiol. Lett. 148:115-122. 119. Givskov, M., L. Olsen, and S. Molin. 1988. Cloning and expression in Escherichia coli of the gene for extracellular phospholipase A1 from Serratia liquefaciens. J. Bacteriol. 170:5855-5862. 120. Gonzalez, J. E., and M. M. Marketon. 2003. Quorum sensing in nitrogen-fixing rhizobia. Microbiol. Mol. Biol. Rev. 67:574-592. 121. Gooday, G. W. 1990. Physiology of microbial degradation of chitin and chitosan. Biodegradation 1:177-190. 122. Gould, T. A., J. Herman, J. Krank, R. C. Murphy, and M. E. A. Churchill. 2006. Specificity of acyl-homoserine lactone synthases examined by mass spectrometry. J. Bacteriol. 188:773-783.
172 References
123. Grady Jr, C. P. L., G. T. Daigger, and H. C. Lim. 1999. Activated sludge. In: Biological Wastewater Treatment New York, Marcel Dekker, Inc.:377-486. 124. Grady Jr, C. P. L., G. T. Daigger, and H. C. Lim. 1999. Biological wastewater treatment, Second edition ed. Dekker, NY. 125. Graf, J., and E. G. Ruby. 1998. Host-derived amino acids support the proliferation of symbiotic bacteria. Proc. Natl. Acad. Sci. USA 95. 126. Gram, L., H. Grossart, A. Schlingloff, and T. Kiorboe. 2002. Possible quorum sensing in marine snow bacteria: production of acylated homoserine lactones by Roseobacter strains isolated from marine snow. Appl. Environ. Microbiol. 68:4111-4116. 127. Gray, K. M., J. P. Pearson, J. A. Downie, B. E. A. Boboye, and E. P. Greenberg. 1996. Cell-to-cell signalling in the symbiotic nitrogen-fixing bacteirum Rhizobium leguminosarum: autoinduction of a stationary phase and rhizosphere-expressed genes. J. Bacteriol. 178:372-376. 128. Greenberg, E. P., J. W. Hastings, and S. Ulitzer. 1979. Induction of luciferase synthesis in Beneckea harveyi by other marine bacteria. Arch. Microbiol. 120:87-91. 129. Griffin, A. S., and S. A. West. 2003. Kin discrimination and the benefit of helping in cooperatively breeding vertebrates. Science 302:634-636. 130. Griffin, A. S., S. A. West, and A. Buckling. 2004. Cooperation and competition in pathogenic bacteria. Nature 430:1024-1027. 131. Guellil, A., F. Thomas, J. C. Block, J. L. Bersillon, and P. Ginestet. 2001. Transfer of organic matter between wastewater and activated sludge flocs. Water Res. 35:143-150. 132. Guerrero, L., F. Omil, R. Mendez, and J. M. Lema. 1998. Protein recovery during the overall treatment of wastewaters from fish-meal factories. Bioresource Technol. 63:221-229. 133. Hall, E. R., and K. L. Murphy. 1985. Sludge age and substrate effects on nitrification kinetics. Journal - Water Pollution Control Federation 57:413- 418. 134. Hamilton, W. D. 1964. The genetical evolution of social behaviour, I & II. J. Theor. Biol. 7:1-52. 135. Hamood, A. N., J. A. Griswold, and J. Colmer. 1996. Characterization of elastase-deficient clinical isolates of Pseudomonas aeruginosa. Infect. Immun. 64:3154-3160. 136. Hanzelka, B. L., and E. P. Greenberg. 1995. Evidence that the N- terminal region of the Vibrio fischeri LuxR protein constitutes an autoinducer-binding domain. J. Bacteriol. 177:815-817. 137. Hastings, J. W., K. H. Nealson, and T. Platt. 1970. Cellular control of the synthesis and activity of the bacterial luminescent system. J. Bacteriol. 104:313-322. 138. Henke, J. M., and B. L. Bassler. 2004. Bacterial social engagements. Trends Cell Biol. 14:648-656. 139. Hense, B. A., C. Kuttler, J. Muller, M. Rothballer, A. Hartmann, and J. U. Kreft. 2007. Does efficiency sensing unify diffusion and quorum sensing? Nat. Rev. Microbiol. 5:230-239. 140. Hentzer, M., K. Riedel, T. B. Rasmussen, A. Heydorn, J. B. Andersen, M. R. Parsek, A. R. Scott, L. Eberl, S. Molin, N. Hoiby, S. Kjelleberg, and M. Givskov. 2002. Inhibition of quorum sensing in Pseudomonas
173 References
aeruginosa biofilm bacteria by a halogenated furanone compound. Microbiology 148:87-102. 141. Heurlier, K., V. Denervaud, and D. Haas. 2006. Impact of quorum sensing on fitness of Pseudomonas aeruginosa. Int. J. Med. Microbiol. 296:93-102. 142. Hiraishi, A., Y. Ueda, and J. Ishihara. 1998. Quinone profiling of bacterial communities in natural and synthetic sewage activated sludge for enhanced phosphate removal. Appl. Environ. Microbiol. 64:992-998. 143. Hoang, H. H., A. Becker, and J. E. Gonzalez. 2004. The LuxR homolog ExpR, in combination with the Sin quorum sensing system, plays a central role in Sinorhizobium meliloti gene expression. J. Bacteriol. 186:5460- 5472. 144. Hoang, T. T., and H. P. Schweizer. 1999. Characterization of Pseudomonas aeruginosa enoyl-acyl carrier protein reductase (FabI): a target for the antimicrobial triclosan and its role in acylated homoserine lactone synthesis. J. Bacteriol. 181:5489-5497. 145. Horng, Y. T., S. C. Deng, M. Daykin, P. C. Soo, J. R. Wei, K. T. Luh, S. W. Ho, S. Swift, H. C. Lai, and P. Williams. 2002. The LuxR family protein SpnR functions as a negative regulator of N-acylhomoserine lactone-dependent quorum sensing in Serratia marcescens. Mol. Microbiol. 45:1655-1671. 146. Huang, J. J., J. I. Han, L. H. Zhang, and J. R. Leadbetter. 2003. Utilization of acyl-homoserine lactone quorum signals for growth by a soil pseudomonad and Pseudomonas aeruginosa PAO1. Appl. Environ. Microbiol. 69:5941-5949. 147. Huang, Y., J. Ki, O. Lee, and P. Qian. 2009. Evidence for the dynamics of acyl homoserine lactone and AHL-producing bacteria during subtidal biofilm formation. ISME J. 3:296-304. 148. Ismaili, A., J. B. Meddings, S. Ratnam, and P. M. Sherman. 1999. Modulation of host cell membrane fluidity: a novel mechanism for preventing bacterial adhesion. Am. J. Physiol. Gastrointest. Liver. Physiol. 277:G201-G208. 149. Jangid, K., R. Kong, M. S. Patole, and Y. S. Shouche. 2007. luxRI homologs are universally present in the genus Aeromonas. BMC Microbiol. 7:93-103. 150. Juretschko, S., G. Timmermann, M. Schmid, K. H. Schleifer, A. Pommerening-Roser, H. P. Koops, and M. Wagner. 1998. Combined molecular and conventional analysis of nitrifying bacteria diversity in activated sludge: Nitrosococcus mobilis and Nitrospira-like bacteria as dominant populations. Appl. Environ. Microbiol. 64:3042-3050. 151. Kampfer, P., V. Avesani, M. Janssens, J. Charlier, T. De Baere, and M. Vaneechoutte. 2006. Description of Wautersiella falsenii gen. nov., sp. nov., to accommodate clinical isolates phenotypically resembling members of the genera Chryseobacterium and Empedobacter. Int. J. Syst. Evol. Microbiol. 56:2323-2329. 152. Kanamaru, K., I. Tatsuno, T. Tobe, and C. Sasakawa. 2000. SdiA, an Escherichia coli homologue of quorum-sensing regulators, controls the expression of virulence factors in enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 38:805-816.
174 References
153. Kaplan, H. B., and E. P. Greenberg. 1985. Diffusion of autoinducer is involved in regulation of the Vibrio fischeri luminescence system. J. Bacteriol. 163:1210-1214. 154. Kassen, R. 2002. The experimental evolution of specialists, generalists, and the maintenance of diversity. J. Evol. Biol. 15:173-190. 155. Kaufmann, G. F., R. Sartorio, S.-H. Lee, C. J. Rogers, M. M. Meijler, J. A. Moss, B. Clapham, A. P. Brogan, T. J. Dickerson, and K. D. Janda. 2005. Revisiting quorum sensing: discovery of additional chemical and biological functions for 3-oxo-N-acylhomoserine lactones. Proc. Natl. Acad. Sci. USA 102:309-314. 156. Keller, L., and M. G. Surette. 2006. Communication in bacteria: an ecological and evolutionary perspective. Nat. Rev. Microbiol. 4:249-258. 157. Khan, S. R., D. V. Mavrodi, G. J. Jog, H. Suga, L. S. Thomashow, and S. K. Farrand. 2005. Activation of the phz operon of Pseudomonas fluorescens 2-79 requires the LuxR homolog PhzR, N-(3-OH-Hexanoyl)- L-homoserine lactone produced by the LuxI homolog, PhzI, and a cis- acting phz box. J. Bacteriol. 187:6517-6527. 158. Kiers, E. T., R. A. Rousseau, S. A. West, and R. F. Denison. 2003. Host sanctions and the legume-rhizobium mutualism. Nature 425:78-81. 159. Kim, B.-Y., H.-Y. Weon, S.-H. Yoo, W.-M. Chen, S.-W. Kwon, S.-J. Go, and E. Stackebrandt. 2006. Chitinimonas koreensis sp. nov., isolated from greenhouse soil in Korea. Int. J. Syst. Evol. Microbiol. 56:1761- 1764. 160. Kindaichi, T., T. Ito, and S. Okabe. 2004. Ecophysiological interaction between nitrifying bacteria and heterotrophic bacteria in autotrophic nitrifying biofilms as determined by microautoradiography-fluorescence in situ hydridization. Appl. Environ. Microbiol. 70:1641-1650. 161. Kolenbrander, P. E., R. N. Andersen, D. S. Blehert, P. G. Egland, J. S. Foster, and R. J. Palmer. 2002. Communication among oral bacteria. Microbiol. Mol. Biol. Rev. 66:486-505. 162. Kong, K. F., C. Vuong, and M. Otto. 2006. Staphylococcus quorum sensing in biofilm formation and infection. Int. J. Med. Microbiol. 296:133-139. 163. Kovach, M. E., P. H. Elzer, D. S. Hill, G. T. Robertson, M. A. Farris, R. M. Roop, I. I, and K. M. Peterson. 1995. Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistant cassettes. Gene 166:175-176. 164. Kragelund, C., C. Levantesi, A. Borger, K. Thelen, D. Eikelboom, V. Tandoi, Y. Kong, J. van der Waarde, J. Krooneman, S. Rossetti, T. R. Thomsen, and P. H. Nielsen. 2007. Identitiy, abundance and ecophysiology of filamentous Chloroflexi species present in activated sludge treatment plants. FEMS Microbiol. Ecol. 59:671-682. 165. Krupa, S. V. 2003. Effects of atmospheric ammonia (NH3) on terrestrial vegetation: a review. Environ. Pollut. 124:179-221. 166. Kuo, A., N. V. Blough, and P. V. Dunlap. 1994. Multiple N-Acyl-L- Homoserine Lactone autoinducers of luminescence in the marine symbiotic bacterium Vibrio fischeri. J. Bacteriol. 176:7558-7565. 167. Kuo, A., S. M. Callahan, and P. V. Dunlap. 1996. Modulation of luminescence operon expression by N-Octanoyl-L-Homoserine Lactone in ainS mutants of Vibrio fischeri. J. Bacteriol. 178:971-976.
175 References
168. Lakretz, A., E. Z. Ron, and H. Mamane. 2010. Biofouling control in water by various UVC wavelengths and doses. Biofouling 26:257-267. 169. Latifi, A., M. Foglino, K. Tanaka, P. Williams, and A. Lazdunski. 1996. A hierarchical quorum-sensing cascade in Pseudomonas aeruginosa links the transcriptional activators LasR and RhlR (VsmR) to expression of the stationary-phase sigma factor RpoS. Mol. Microbiol. 21:1137-1146. 170. Latifi, A., M. K. Winson, M. Foglino, B. W. Bycroft, G. S. Stewart, A. Lazdunski, and P. Williams. 1995. Multiple homologues of LuxR and LuxI control expression of virulence determinants and secondary metabolites through quorum sensing in Pseudomonas aeruginosa PAO1. Mol. Microbiol. 17:333-343. 171. Leadbetter, J. R., and E. P. Greenberg. 2000. Metabolism of acyl- homoserine lactone quorum-sensing signals by Variovorax paradoxus. J. Bacteriol. 182:6921-6926. 172. Leadbetter, J. R., and E. P. Greenberg. 2000. Metabolism of acyl- homoserine lactone quorum-sensing signals by Variovorax paradoxus. J. Bacteriol. 182:6921-6926. 173. Lee, J., A. Jayaraman, and T. K. Wood. 2007. Indole is an interspecies biofilm signal mediated by SdiA. BMC Microbiol. 7:42. 174. Lee, J. H., Y. Lequette, and E. P. Greenberg. 2006. Activity of purified QscR, a Pseudomonas aeruginosa orphan quorum-sensing transcription factor. Mol. Microbiol. 59:602-609. 175. Lee, N., J. La Cour Janssen, H. Aspegren, M. N. P. H. Henze, and M. Wagner. 2002. Population dynamics in wastewater treatment plants with enhanced biological phosphorus removal operated without nitrogen removal. Water Sci. Technol. 46:163-170. 176. Lee, N. M. 1996. Parameters affecting microorganisms and the process performance in biological wastewater treatment. Lund University, Lund, Sweden. 177. Lee, S. F., Y. H. Li, and G. H. Bowden. 1996. Detachment of Streptococcus mutans biofilm cells by an endogenous enzymatic activity. Infect. Immun. 64:1035-1038. 178. Lehmann, L., and L. Keller. 2006. The evolution of cooperation and altruism - a general framework and a classification of models. J. Evol. Biol. 19:1365-1376. 179. Lequette, Y., J. H. Lee, F. Ledgham, A. Lazdunski, and E. P. Greenberg. 2006. A distinct QscR regulon in the Pseudomonas aeruginosa quorum-sensing circuit. J. Bacteriol. 188:3365-3370. 180. Levine, J. M. 2000. Species diversity and biological invasions: Relating local process to community pattern. Science 288:852-854. 181. Lewis, K. 2007. Persister cell, dormancy and infectious disease. Nat. Rev. Microbiol. 5:48-56. 182. Li, X. B., and S. Roseman. 2004. The chitinolytic cascade in Vibrios is regulated by chitin oligosaccharides and a two-component chitin catabolic sensor/kinase. Proc. Natl. Acad. Sci. USA 101:627-631. 183. Liao, B. Q., D. G. Allen, I. G. Droppo, G. G. Leppard, and S. N. Liss. 2001. Surface properties of sludge and their role in bioflocculation and settleability. Water Res. 35:339-350. 184. Lin, Y. H., J. L. Xu, J. Hu, L. H. Wang, S. L. Ong, J. R. Leadbetter, and L. H. Zhang. 2003. Acyl-homoserine lactone acylase from Ralstonia
176 References
str. XJ12B represents a novel and potent class of quorum quenching enzymes. Mol. Microbiol. 47:849-860. 185. Lin, Y. H., J. L. Xu, J. Hu, L. H. Wang, S. L. Ong, J. R. Leadbetter, and L. H. Zhang. 2003. Acyl-homoserine lactone acylase from Ralstonia strain XJ12B represents a novel and potent class of quorum-quenching enzymes. Mol. Microbiol. 47:849-860. 186. Lindum, P. W., U. Anthoni, C. Christophersen, L. Eberl, S. Molin, and M. Givskov. 1998. N-Acyl-L-Homoserine lactone autoinducers control production of an extracellular lipopeptide biosurfactant required for swarming motility of Serratia liquefaciens MG1. . J. Bacteriol. 180:6384-6388. 187. Lithgow, J. K., A. Wilkinson, A. Hardman, B. Rodelas, F. Wisniewski- Dye, P. Williams, and J. A. Downie. 2000. The regulatory locus cinRI in Rhizobium leguminosarum controls a network of quorum-sensing loci. Mol. Microbiol. 37:81-97. 188. Liu, W., T. L. Marsh, H. Cheng, and L. J. Forney. 1997. Characterization of microbial diversity by determining terminal restriction fragment length polymorphisms of genes encoding 16S rRNA. Appl. Environ. Microbiol. 63:4516-4522. 189. Losick, R., and D. Kaiser. 1997. Why and how bacteria communicate. Sci. Am. 276:68-73. 190. Makemson, J. C. 1986. Luciferase-dependent oxygen consumption by bioluminescent vibrios. J. Bacteriol. 165:461-466. 191. Manefield, M., R. de Nys, K. Naresh, R. Roger, M. Givskov, P. Steinberg, and S. Kjelleberg. 1999. Evidence that halogenated furanones from Delisea pulchra inhibit acylated homoserine lactone (AHL)- mediated gene expression by displacing the AHL signal from its receptor protein. Microbiology 145:283-291. 192. Manefield, M., R. I. Griffiths, M. B. Leigh, R. Fisher, and A. S. Whiteley. 2005. Functional and composition comparison of two activated sludge communities remediating coking effluent. Environ. Microbiol. 7:715-722. 193. Manefield, M., and A. S. Whiteley. 2007. Acylated homoserine lactones in the environment: chameleons of bioactivity. Phil. Trans. R. Soc. B. 362:1235-1240. 194. Martins, A. M., K. Pagilla, J. J. Heijnen, and M. C. van Loosdrecht. 2004. Filamentous bulking sludge - a critical review. Water Res. 38:793- 817. 195. Mason, V. P., G. H. Markx, I. P. Thompson, J. S. Andrews, and M. Manefield. 2005. Colonial architecture in mixed species assemblages affects AHL mediated gene expression. FEMS Microbiol. Lett. 244:121- 127. 196. Maynard Smith, J. 1964. Group selection and kin selection. Nature 201:1145-1147. 197. McClean, K. H., M. K. Winson, L. Fish, A. Taylor, S. R. Chhabra, M. Camara, M. Daykin, J. H. Lamb, S. Swift, B. W. Bycroft, G. S. A. B. Stewart, and P. Williams. 1997. Quorum sensing and Chromobacterium violaceum: exploitation of violaceum production and inhibition for the detection of N-acylhomoserine lactones. Microbiology 143:3703-3711.
177 References
198. McDowell, P., Z. Affas, C. Reynolds, M. T. Holden, S. J. Wood, S. Saint, A. Cockayne, P. J. Hill, C. E. Dodd, B. W. Bycroft, W. C. Chan, and P. Williams. 2001. Structure, activity and evolution of the group I thiolactone peptide quorum-sensing system of Staphylococcus aureus. Mol. Microbiol. 41:503-512. 199. McGowan, S. J., M. Sebaihia, S. Jones, B. Yu, N. J. Bainton, and P. F. Chan. 1995. Carbapenem antibiotic production in Erwinia carotovora is regulated by CarR, a homologue of the LuxR transcriptional activator. Microbiology 141:541-550. 200. McGrady-Steed, J., P. M. Harris, and P. J. Morin. 1997. Biodiversity regulates ecosystem predictability. Nature 390:162-165. 201. McGrath, S. P., D. S. Wade, and E. C. Pesci. 2004. Duelling quorum sensing systems in Pseudomonas aeruginosa control the production of the Pseudomonas quinolone signal (PQS). FEMS Microbiol. Lett. 230:27-34. 202. McKenny, D., K. E. Brown, and D. G. Allison. 1995. Influence of Pseudomonas aeruginosa exoproducts on virulence factor production in Burkholderia cepacia: evidence of interspecies communication. J. Bacteriol. 177:6989-6992. 203. McKinney, R. E., and R. G. Weichlein. 1953. Isolation of floc- producing bacteria from activated sludge. Appl. Environ. Microbiol. 1:259. 204. McKnight, S. L., B. H. Iglewski, and E. C. Pesci. 2000. The Pseudomonas quinolone signal regulates rhl quorum sensing in Pseudomonas aeruginosa. J. Bacteriol. 182:2702-2708. 205. McLean, R. J. C., M. Whiteley, D. J. Stickler, and C. Fuqua. 1997. Evidence of autoinducer activity in naturally occurring biofilms. FEMS Microbiol. Lett. 154:259-263. 206. Medina-Martinez, M. S., M. Uyttendaele, A. Rajkovic, P. Nadal, and J. Debevere. 2007. Degradation of N-acyl-L-homoserine lactones by Bacillus cereus in culture media and pork extract. Appl. Environ. Microbiol. 73:2329-2332. 207. Merzendorfer, H. 2006. Insect chitin synthases: a review. J. Comp. Physiol. B. 176:1-15. 208. Metcalf, W. W., W. Jiang, L. L. Daniels, S. Kim, A. Haldimann, and B. L. Wanner. 1996. Conditionally replicative and conjuative plasmids carrying lacZalpha for cloning, mutagenesis and allele replacement in bacteria. Plasmid 35:1-13. 209. Meyer, J. M., A. Stintzi, D. De Vos, P. Cornelis, R. Tappe, K. Taraz, and H. Budzikiewicz. 1997. Use of siderophores to type pseudomonads: the three Pseudomonas aeruginosa pyoverdine systems. Microbiology 143:35-43. 210. Miller, M. B., and B. L. Bassler. 2001. Quorum sensing in bacteria. Annu. Rev. Microbiol. 55:165-199. 211. Moreno, A. M. 2008. Understanding bacteria-protozoa interactions: from grazing resistance mechanisms to carbon flow in bacteria-protozoa food webs. University of New South Wales, Sydney. 212. Morgan, J. W., C. F. Forster, and L. Evison. 1990. A comparative study of the nature of biopolymers extracted from anaerobic and activated sludges. Water Res. 24:743-750.
178 References
213. Morohoshi, T., M. Kato, K. Fukamachi, N. Kato, and T. Ikeda. 2007. N-acylhomoserine lactone regulates violacein production in Chromobacterium violaceum type strain ATCC 12472. FEMS Microbiol. Lett. 279:124-130. 214. Morohoshi, T., N. Someya, and T. Ikeda. 2009. Novel N- acylhomoserine lactone-degrading bacteria isolated from the leaf surface of Solanum tuberosum and their quorum-quenching properties. Biosci. Biotechnol. Biochem. 73:2124-2127. 215. Muller, E. B., A. H. Stouthamer, and H. W. van Verseveld. 1995. A novel method to determine maximal nitrification rates by sewage sludge at a non-inhibitory nitrite concentration applied to determine maximal rates as a function of the nitrogen load. Water Res. 29:1191-1197. 216. Nachin, L., and F. Barras. 2000. External pH: an environmental signal that helps to rationalize pel gene duplication in Erwinia chrysanthemi. Mol. Plant Microb. Interact. 13:882-886. 217. Nealson, K. H., T. Platt, and J. W. Hastings. 1970. Cellular control of the synthesis and activity of the bacterial luminescent system. J. Bacteriol. 104:313-322. 218. Nielsen, P. H., K. Raunkjaer, N. H. Norsker, N. A. Jensen, and T. Hvitved-Jacobsen. 1992. Transformation of wastewater in sewer systems - a review. Wat. Sci. Technol. 25:17-31. 219. Nielsen, P. H., T. R. Thomsen, and J. L. Nielsen. 2004. Bacterial composition of activated sludge - importance for floc and sludge properties. Water Sci. Technol. 49:51-58. 220. Nilsson, P., A. Olofsson, M. Fagerlind, T. Fagerstrom, S. A. Rice, S. Kjelleberg, and P. Steinberg. 2001. Kinetics of the AHL regulatory system in a model biofilm system: how many bacteria constitute a "quorum"? J. Mol. Biol. 309:631-640. 221. Nouwens, A. S., S. A. Beatson, C. B. Whitchurch, B. J. Walsh, H. P. Schweizer, J. S. Mattick, and S. J. Cordwell. 2003. Proteome analysis of extracellular proteins regulated by the las and rhl quorum sensing systems in Pseudomonas aeruginosa PAO1. Microbiology-Sgm 149:1311-1322. 222. Novick, R. P. 2003. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol. Microbiol. 48:1429-1449. 223. Nybroe, O., P. E. Jorgensen, and M. Henze. 1992. Enzyme activities in wastewater and activated sludge. Water Res. 26:579-584. 224. Ochsner, U. A., and J. Reiser. 1995. Autoinducer-mediated regulation of rhamnolipid biosurfactant synthesis in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 92:6424-6428. 225. Okabe, S., and Y. Watanabe. 2000. Structure and function of nitrifying biofilms as determined by in situ hybridization and the use of microelectrodes. Water Sci. Technol. 42:21-32. 226. Pace, N. R. 1997. A molecular view of microbial diversity and the biosphere. Science 276:734-740. 227. Palmer, R. J., K. Kazmerzak, M. C. Hansen, and P. E. Kolenbrander. 2001. Mutualism versus independence: strategies of mixed-species oral biofilms in vitro using saliva as the sole nutrient source. Infect. Immun. 69:5794-5804.
179 References
228. Pamp, S. J., C. Sternberg, and T. Tolker-Nielsen. 2009. Insight into the microbial multicellular lifestyle via flow-cell technology and confocal microscopy. Cytometry A 75:90-103. 229. Pan, P., and W. W. Umbreit. 1972. Growth of mixed cultures of autotrophic and heterotrophic organisms. Can. J. Microbiol. 18:153. 230. Park, S.-Y., S. J. Lee, T.-K. Oh, J.-W. Oh, B.-T. Koo, D.-Y. Yum, and J.-K. Lee. 2003. AhlD, an N-acylhomoserine lactonase in Arthrobacter sp., and predicted homologues in other bacteria. Microbiology 149:1541- 1550. 231. Parkin, G. F., and P. L. McCarty. 1981a. A comparison of the characteristics of soluble organic nitrogen in untreated and activated- sludge treated wastewaters. Water Res. 15:139-149. 232. Passador, L., J. M. Cook, M. J. Gambello, L. Rust, and B. H. Iglewski. 1993. Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science 260:1127-1130. 233. Passador, L., J. M. Cook, M. J. Gambello, L. Rust, and B. H. Iglewski. 1993. Expression of Pseudomonas aeruginosa virulence genes requires cell-to-cell communication. Science 260:1127-1130. 234. Passador, L., K. D. Tucker, K. R. Guertin, M. P. Journet, A. S. Kende, and B. H. Iglewski. 1996. Functional analysis of the Pseudomonas aeruginosa autoinducer PAI. J. Bacteriol. 178:5995-6000. 235. Pearson, J. P., K. M. Gray, L. Passador, K. D. Tucker, A. Eberhard, B. H. Iglewski, and E. P. Greenberg. 1994. Structure of the autoinducer required for expression of Pseudomonas aeruginosa virulence genes. Proc. Natl. Acad. Sci. USA 91:197-201. 236. Pearson, J. P., L. Passador, B. H. Iglewski, and E. P. Greenberg. 1995. A second N-acyl-homoserine lactone signal produced by Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 92:1490-1494. 237. Pearson, J. P., E. C. Pesci, and B. H. Iglewski. 1997. Roles of Pseudomonas aeruginosa las and rhl quorum-sensing systems in the control of elastase and rhamnolipid biosynthesis genes. J. Bacteriol. 179:5756-5767. 238. Pehlivanoglu, E., and D. L. Sedlak. 2004. Bioavailability of wastewater- derived organic nitrogen to the alga Selenastrum capricornutum. Water Res. 38:3189-3196. 239. Pel, R., and J. C. Gottschal. 1989. Interspecies interaction based on transfer of a thioredoxin-like compound in anaerobic chitin-degrading mixed cultures. FEMS Microbiol. Lett. 62:349-357. 240. Pel, R., G. Hessels, H. Aalfs, and J. C. Gottschal. 1988. Chitin degradation by Clostridium sp. strain 9.1 in mixed cultures with saccharolytic and sulfate-reducing bacteria. FEMS Microbiol. Lett. 62:191-200. 241. Pellock, B. J., M. Teplitski, R. P. Boinay, W. D. Bauer, and G. C. Walker. 2002. A LuxR homolog controls production of symbiotically active extracellular polysaccharide II by Sinorhizobium meliloti. J. Bacteriol. 184:5067-5076. 242. Pesci, E. C., J. P. Pearson, P. C. Seed, and B. H. Iglewski. 1997. Regulation of las and rhl quorum sensing in Psedomonas aeruginosa. J. Bacteriol. 179:3127-3132.
180 References
243. Pestova, E. V., L. S. Havarstein, and D. A. Morrison. 1996. Regulation of competence for genetic transformation in Streptococcus pneumoniae by an auto-induced peptide pheromone and a two-component regulatory system. Mol. Microbiol. 21:853-862. 244. Peterson, S. N., C. K. Sung, R. Cline, B. V. Desai, E. C. Snesrud, P. Luo, J. Walling, H. Li, M. Mintz, G. Tsegaye, P. C. Burr, Y. Do, S. Ahn, J. Gilbert, R. D. Fleischmann, and D. A. Morrison. 2004. Identification of competence pheromone responsive genes in Streptococcus pneumoniae by use of DNA microarrays. Mol. Microbiol. 51:1051-1070. 245. Petropoulos, P., and K. A. Gilbride. 2005. Nitrification in activated sludge batch reactors is linked to protozoan grazing of the bacterial population. Can. J. Microbiol. 51:791-799. 246. Pierson, E. A., D. W. Wood, J. A. Cannon, F. M. Blachere, and L. S. Pierson. 1998. Interpopulation signaling via N-acyl-homoserine lactones among bacteria in the wheat rhizosphere. Mol. Plant Microb. Interact. 11:1078-1084. 247. Piper, K. R., and S. K. Farrand. 2000. Quorum sensing but not autoinduction of Ti plasmid conjugal transfer requires control by the opine regulon and the antiactivator TraM. J. Bacteriol. 182:1080-1088. 248. Poellinger, K. A., J. P. Lee, J. V. Parales Jr, and E. P. Greenberg. 1995. Intragenic suppression of a LuxR mutation: Characterization of an autoinducer-independent LuxR. FEMS Microbiol. Lett. 129:97-102. 249. Pujol, R., and J. P. Canler. 1992. Biosorption and dynamics of bacterial populations in activated sludge. Water Res. 26:209-212. 250. Qin, Y., Z. Q. Luo, A. J. Smyth, P. Gao, S. Beck von Bodman, and S. K. Farrand. 2000. Quorum-sensing signal binding results in dimerization of TraR and its release from membranes into the cytoplasm. EMBO J. 19:5212-5221. 251. Rajasekar, A., B. Anandkumar, S. Maruthamuthu, Y. P. Ting, and P. K. Rahman. 2010. Characterization of corrosive bacterial consortia isolated from petroleum-product-transporting pipelines. Appl. Microbiol. Biotechnol. 85:1175-1188. 252. Rao, D., J. S. Webb, and S. Kjelleberg. 2005. Competitive interactions in mixed-species biofilms containing the marine bacterium Pseudoalteromonas tunicata. Appl. Environ. Microbiol 71:1729-1736. 253. Rasmussen, T. B., M. Manefield, J. B. Andersen, L. Eberl, U. Anthoni, C. Christophersen, P. Steinberg, S. Kjelleberg, and M. Givskov. 2000. How Delisea pulchra furanones affect quorum sensing and swarming motility in Serratia liquefaciens MG1. Microbiology 146:3237-3244. 254. Raunkjaer, K., T. Hvitved-Jacobsen, and P. H. Nielsen. 1994. Measurements of pools of protein, carbohydrate and lipid in domestic wastewater. Water Res. 28:251-262. 255. Ravn, L., A. B. Christensen, S. Molin, M. Givskov, and L. Gram. 2001. Methods of detecting acylated homoserine lactones produced by Gram-negative bacteria and their application in studies of AHL-production kinetics. J. Microbiol. Methods 44:239-251. 256. Redfield, R. J. 2002. Is quorum sensing a side effect of diffusion sensing? TRENDS Microbiol. 10:365-370.
181 References
257. Reid, B. G., and G. C. Flynn. 1997. Chromophore formation in green fluorescent protein. Biochemistry 22:6786-6791. 258. Rice, S. A., K. S. Koh, S. Y. Queck, M. Labbate, K. W. Lam, and S. Kjelleberg. 2005. Biofilm formation and sloughing in Serratia marcescens are controlled by quorum sensing and nutrient cues. J. Bacteriol. 187 :3477-3485. 259. Riedel, K., M. Hentzer, O. Geisenberger, B. Huber, A. Steidle, H. Wu, N. Hoiby, M. Givskov, S. Molin, and L. Eberl. 2001. N-acylhomoserine- lactone-mediated communication between Pseudomonas aeruginosa and Burkholderia cepacia in mixed biofilms. Microbiology 147:3249-3262. 260. Riley, M. A., and D. M. Gordon. 1999. The ecological role of bacteriocins in bacterial cooperation. Trends Microbiol. 7:129-133. 261. Riley, M. A., and J. E. Wertz. 2002. Bacteriocins: evolution, ecology and application. Annu. Rev. Microbiol. 56:117-137. 262. Ruby, E. G., and K. H. Nealson. 1976. Symbiotic association of Photobacterium fischeri with the marine luminous fish Monocentris japonica; a model of symbiosis based on bacterial studies. Biol. Bull. 151:574-586. 263. Ruby, E. G., M. Urbanowski, J. Campbell, A. Dunn, M. Faini, R. Gunsalus, C. P. Lostroh, C. Lupp, J. McCann, D. Millikan, A. L. Schaefer, E. Stabb, A. Stevens, K. L. Visick, C. Whistler, and E. P. Greenberg. 2005. Complete genomes sequence of Vibrio fischeri: A symbiotic bacterium with pathogenic congeners. Proc. Natl. Acad. Sci. USA 102:3004-3009. 264. Rumbaugh, K. P., S. P. Diggle, C. M. Watters, A. Ross-Gillespie, A. S. Griffin, and S. A. West. 2009. Quorum sensing and the social evolution of bacterial virulence. Curr. Biol. 19:341-345. 265. Sachs, J. L., U. G. Mueller, T. P. Wilcox, and J. J. Bull. 2004. The evolution of cooperation. Q. Rev. Biol. 79:135-160. 266. Sakai, K., E. Kudoh, M. Wakayama, and M. Moriguchi. 2000. Analysis of the microbial community in an activated sludge enriched with an inorganic nitrite medium. Microb. Environ. 15:103-112. 267. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 268. Sandoz, K. M., S. M. Mitzimberg, and M. Schuster. 2007. Social cheating in Pseudomonas aeruginosa quorum sensing. Proc. Natl. Acad. Sci. USA 104:15876-15881. 269. Sarkar, S., and R. Chakraborty. 2008. Quorum sensing in metal tolerance of Acinetobacter junii BB1A is associated with biofilm production. FEMS Microbiol. Lett. 282:160-165. 270. Schaefer, A. L., B. L. Hanzelka, A. Eberhard, and E. P. Greenberg. 1996. Quorum sensing in Vibrio fischeri: Probing autoinducer-LuxR interactions with autoinducer analogs. J. Bacteriol. 178:2897-2901. 271. Schaefer, A. L., D. L. Val, B. L. Hanzelka, J. E. Cronan, and E. P. Greenberg. 1996. Generation of cell-to-cell signals in quorum sensing: acyl homoserine lactone synthase activity of a purified Vibrio fischeri LuxI protein. Proc. Natl. Acad. Sci. USA 93:9505-9509.
182 References
272. Scheerer, S., F. Gomez, and D. Lloyd. 2006. Bioluminescence of Vibrio fischeri in continuous culture: Optimal conditions for stability and intensity of photoemission. J. Microbiol. Methods 67:321-329. 273. Schertzer, J. W., M. L. Boulette, and M. Whiteley. 2009. More than a signal: non-signaling properties of quorum sensing molecules. Trends Microbiol. 17:189-195. 274. Schluter, D. 2000. Ecological character displacement in adaptive radiation. Am. Nat. 156:S4-S16. 275. Schuster, M., C. P. Lostroh, T. Ogi, and E. P. Greenberg. 2003. Identification, timing and signal specificity of Pseudomonas aeruginosa quorum-controlled genes: a transcriptome analysis. J. Bacteriol. 185:2066- 2079. 276. Selvakumaran, S., A. Kapley, V. C. Kalia, and H. J. Purohit. 2008. Phenotypic and phylogenic groups to evaluate the diversity of Citrobacter isolates from activated biomass of effluent treatment plants. Bioresource Technol. 99:1189-1195. 277. Shadel, G. S., and T. O. Baldwin. 1992. Identification of a distantly located regulatory element in the luxD gene required for negative autoregulation of the Vibrio fischeri luxR gene. J. Biol. Chem. 267:7690- 7695. 278. Shadel, G. S., R. Young, and T. O. Baldwin. 1990. Use of regulated cell lysis in a lethal genetic selection in Escherichia coli: Identification of the autoinducer-binding region of the LuxR protein from Vibrio fischeri ATCC7744. J. Bacteriol. 172:3980-3987. 279. Shapiro, J. A. 1998. Thinking about bacterial populations as multicellular organisms. Annu. Rev. Microbiol. 52:81-104. 280. Sharif, D. I., J. Gallon, C. J. Smith, and E. Dudley. 2008. Quorum sensing in cyanobacteria: N-octanoyl-homoserine lactone release and response, by the epilithic colonial cyanobacterium Gloeothece PCC6909. ISME J. 2:1171-1182. 281. Shaw, P. D., G. Ping, S. L. Daly, C. Cha, J. E. Cronan, K. L. Rinehart, and S. K. Farrand. 1997. Detecting and characterising N-acyl- homoserine lactone signal molecules by thin-layer chromatography. Proc. Natl. Acad. Sci. USA 94:6036-6041. 282. Sheng, G., H. Yu, and X. Li. 2006. Stability of sludge flocs under shear conditions: roles of extracellular polymeric substances (EPS). Biotechnol. Bioeng. 93:1095-1102. 283. Shin, D.-H., Y.-S. Choi, and Y.-H. Cho. 2008. Unusual properties of catalase A (KatA) of Pseudomonas aeruginosa PA14 are associated with its biofilm peroxide resistance. J. Bacteriol. 190:2663-2670. 284. Shiner, E. K., K. P. Rumbaugh, and S. C. Williams. 2005. Interkingdom signaling: Deciphering the language of acyl homoserine lactones. FEMS Microbiol. Rev. 29:935-947. 285. Simoes, L. C., M. Simoes, and M. J. Vieira. 2007. Biofilm interactions between bacterial genera isolated from drinking water. Appl. Environ. Microbiol 73:6192-6200. 286. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range of mobilization system for in vivo genetic engineering: Transposon mutagenesis in Gram-negative bacteria. Biotechnology 1:784-794.
183 References
287. Simpson, J. M., P. G. Stroot, S. Gelman, I. Beydilli, S. Dudley, and D. B. Oerther. 2006. 16S ribosomal RNA tools identify an unexpected predominance of Paenibacillus-like bacteria in an industrial activated sludge system suffering from poor biosolids separation. Water Environ. Res. 78:864-871. 288. Sitnikov, D. M., G. S. Shadel, and T. O. Baldwin. 1996. Autoinducer- effects on the two Lux promoters of Vibrio fischeri. Mol. Gen. Genet. 252:622-625. 289. Slock, J., D. van Riet, D. Kolibachuk, and E. P. Greenberg. 1990. Critical regions of the Vibrio fischeri LuxR protein defined by mutational analysis. J. Bacteriol. 172:3974-3979. 290. Smith, E. E., D. G. Buckley, Z. Wu, C. Saenphimmachak, L. R. Hoffman, D. A. D'Argenio, S. I. Miller, B. W. Ramsey, D. P. Speert, S. M. Moskowitz, J. L. Burns, R. Kaul, and M. V. Olson. 2006. Genetic adaptation by Pseudomonas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad. Sci. USA 103:8487-8492. 291. Smith, J. 2001. The social evolution of bacterial pathogenesis. Proc. R. Soc. London Ser. B. 268:61-69. 292. Smith, J. N., and B. M. Ahmer. 2003. Detection of other microbial species by Salmonella: expression of the SdiA regulon. J. Bacteriol. 185:1357-1366. 293. Snaidr, J., R. Amann, I. Huber, W. Ludwig, and K. H. Schleifer. 1997. Phylogenetic analysis and in situ identification of bacteria in activated sludge. Appl. Environ. Microbiol. 63:2884-2896. 294. So, C. M., and L. Y. Young. 1999. Isolation and characterization of a sulfate-reducing bacterium that anaerobically degrades alkanes. Appl. Environ. Microbiol. 65:2969-2976. 295. Sokurenko, E. V., V. Tchesnokova, A. T. Yeung, C. A. Oleykowski, E. Trintchina, K. T. Hughes, R. A. Rashid, J. M. Brint, S. L. Moseley, and S. Lory. 2001. Detection of simple mutations and polymorphisms in large genomic regions. Nucleic Acids Res. 29:E111. 296. Soren, M., C. Sternberg, J. B. Andersen, B. B. Christensen, J. L. Ramos, and M. Givskov. 1998. In situ gene expression in mixed-culture biofilms: evidence of metabolic interactions between community members. Appl. Environ. Microbiol 64:721-732. 297. Southey-Pillig, C. J., D. G. Davies, and K. Sauer. 2005. Characterization of temporal protein production in Pseudomonas aeruginosa biofilms. J. Bacteriol. 187:8114-8126. 298. Spoering, A. L., and M. S. Gilmore. 2006. Quorum sensing and DNA release in bacterial biofilms. Curr. Opin. Microbiol. 9:133-137. 299. Steidle, A., K. Sigl, R. Schuhegger, A. Ihring, M. Schmid, S. Gantner, M. Stoffels, K. Riedel, M. Givskov, A. Hartmann, C. Langebartels, and L. Eberl. 2001. Visualization of N-Acylhomoserine Lactone- Mediated Cell-Cell Communication between Bacteria Colonizing the Tomato Rhizosphere. Appl. Environ. Microbiol. 67:5761-5770. 300. Steindler, L., and V. Venturi. 2007. Detection of quorum-sensing N-acyl homoserine lactone signal molecules by bacterial biosensors. FEMS Microbiol. Lett. 266:1-9. 301. Stevens, A. M., N. Fujita, A. Ishihama, and E. P. Greenberg. 1999. Involvement of the RNA polymerase alpha-subunit C-terminal domain in
184 References
LuxR-dependent activation of the Vibrio fischeri luminescence genes. J. Bacteriol. 181:4704-4707. 302. Stickler, D. J. 2008. Bacterial biofilms in patients with indwelling urinary catheters. Nat. Clin. Pract. Urol. 5:598-608. 303. Still, W. C., M. Kahn, and A. Mitra. 1978. Rapid chromatographic technique for preparative separations with moderate resolution. J. Org. Chem. 43:2923-2925. 304. Stintzi, A., K. Evans, J. M. Meyer, and K. Poole. 1998. Quorum-sensing and siderophore biosynthesis in Pseudomonas aeruginosa: lasR/lasI mutants exhibit reduced pyoverdine biosynthesis. FEMS Microbiol. Lett. 166:341-345. 305. Strassmann, J. E., Y. Zhu, and D. C. Queller. 2000. Altruism and social cheating in the social amoeba Dictyostelium discoideum. Nature 408:965- 967. 306. Subramoni, S., and V. Venturi. 2009. LuxR-family 'solos': bachelor sensors/regulators of signalling molecules. Microbiology 155:1377-1385. 307. Suntharalingam, P., and D. G. Cvitkovitch. 2005. Quorum sensing in streptococcal biofilm formation. Trends Microbiol. 13:3-6. 308. Surette, M. G., and B. L. Bassler. 1999. Regulation of autoinducer production in Salmonella typhimurium. Mol. Microbiol. 31:585-595. 309. Surette, M. G., M. B. Miller, and B. L. Bassler. 1999. Quorum sensing in Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes responsible for autoinducer production. Proc. Natl. Acad. Sci. USA 96:1639-1644. 310. Swift, S., M. J. Lynch, L. Fish, D. F. Kirke, J. M. Tomas, G. S. Stewart, and P. Williams. 1999. Quorum sensing-dependent regulation and blockade of exoprotease production in Aeromonas hydrophila. Infect. Immun. 67:5192-5199. 311. Swift, S., E. E. Vaughan, and W. M. de Vos. 2000. Quorum sensing within the gut ecosystem. Microb. Ecol. in Health and Disease 12:81-92. 312. Taylor, M. W., P. J. Schupp, H. J. Baillie, T. S. Charlton, R. de Nys, S. Kjelleberg, and P. D. Steinberg. 2004. Evidence for Acyl Homoserine Lactone Signal Production in Bacteria Assoicated with Marine Sponges. Appl. Environ. Microbiol. 70:4387-4389. 313. Teal, T. K., D. P. Lies, B. J. Wold, and D. K. Newman. 2006. Spatiometabolic stratification of Shewanella oneidensis biofilms. Appl. Environ. Microbiol. 72:7324-7330. 314. Teplitski, M., H.-C. Chen, S. Rajamani, M.-S. Gao, M. Merighi, R. T. Sayre, J. B. Robinson, B. G. Rolfe, and W. D. Bauer. 2004. Chlamydomonas reinhardtii secretes compounds that mimic bacterial signals and interfere with quorum sensing regulation in bacteria. Plant Physiology 134:137-146. 315. Thompson, I. M., and C. F. Forster. 2005. Nutrient conditions in relation to bacterial flocculation, extracellular polymer production and sludge settlement. Biotechnol. Lett. 5:761-766. 316. Throup, J. P., M. Camara, G. S. Briggs, M. K. Winson, S. R. Chhabra, B. W. Bycroft, P. Williams, and G. S. Stewart. 1995. Characterization of the yenI/yenR locus from Yersinia enterocolitica mediating the synthesis of two N-acylhomoserine lactone signal molecules. Mol. Microbiol. 17:345-356.
185 References
317. Timmins, G. S., S. K. Jackson, and H. M. Swartz. 2001. The evolution of bioluminescent oxygen consumption as an ancient oxygen detoxification mechanism. J. Mol. Evol. 52:321-332. 318. Toyofuku, M., N. Nomura, T. Fujii, N. Takaya, H. Maseda, I. Sawada, T. Nakajima, and H. Uchiyama. 2007. Quorum sensing regulates denitrification in Pseudomonas aeruginosa PAO1. J. Bacteriol. 189:4969- 4972. 319. Ulitzer, S., and P. V. Dunlap. 1995. Regulatory circuitry controlling luminescence autoinduction in Vibrio fischeri Photochem. Photobiol. 62:625-632. 320. Ullrich, A. H., and M. W. Smith. 1951. The biosorption process of sewage and waste treatment. Sew. Ind. Wastes 23:1248-1253. 321. Valle, A., M. J. Bailey, A. S. Whiteley, and M. Manefield. 2004. N- acyl-L-homoserine lactones (AHLs) affect microbial community composition and function in activated sludge. Environ. Microbiol. 6:424- 433. 322. Van Delden, C., E. C. Pesci, J. P. Pearson, and B. H. Iglewski. 1998. Starvation selection restores elastase and rhamnolipid production in a Pseudomonas aeruginosa quorum-sensing mutant. Infect. Immun. 66:4499-4502. 323. Van Houdt, R., A. Aertsen, A. Jansen, A. L. Quintana, and C. W. Michiels. 2004. Biofilm formation and cell-to-cell signalling in Gram- negative bacteria isolated from a food processing environment. J. Appl. Microbiol. 96:177-184. 324. Velicer, G. J., and Y. N. Yu. 2003. Evolution of novel cooperative swarming in the bacterium Myxococcus xanthus. Nature 425:75-78. 325. Venturi, V. 2006. Regulation of quorum sensing in Pseudomonas. FEMS Microbiol. Rev. 30:274-291. 326. Visick, K. L., J. S. Foster, J. Doino, M. J. McFall-Ngai, and E. G. Ruby. 2000. Vibrio fischeri lux genes play an important role in colonization and development of the host light organ. J. Bacteriol. 182:4578-4586. 327. Visick, K. L., and C. Fuqua. 2005. Decoding microbial chatter: cell-cell communication in bacteria. J. Bacteriol. 187:5507-5519. 328. Visick, K. L., and E. G. Ruby. 1997. New genetic tools for use in the marine bioluminescent bacterium Vibrio fischeri. In J. W. Hastings, L. J. Kricka, and P. E. Stanley (ed.), Bioluminescence and chemiluminescence. John Wiley and Sons, New York, N. Y. 329. von Bodman, S. B., D. R. Majerczak, and D. L. Coplin. 1998. A negative regulator mediates quorum-sensing control of exopolysaccharide production in Pantoea stewartii subsp. stewartii. Proc. Natl. Acad. Sci. USA 95:7687-7692. 330. Wagner, M., R. Amann, H. Lemmer, and K. H. Schleifer. 1993. Probing activated sludge with oligonucleotides specific for proteobacteria: inadequacy of culture-dependent methods for describing microbial community structure. Appl. Environ. Microbiol. 59:1520-1525. 331. Wagner, M., and A. Loy. 2002. Bacterial community composition and function in sewage treatment systems. Curr. Opin. Microbiol. 13:218-227. 332. Wagner, V. E., D. Bushnell, L. Passador, A. I. Brooks, and B. H. Iglewski. 2003. Microarray analysis of Pseudomonas aeruginosa quorum-
186 References
sensing regulons: effects of growth phase and environment. J. Bacteriol. 185:2080-2095. 333. Wang, H., T. Cai, M. Weng, J. Zhou, H. Cao, Z. Zhong, and J. Zhu. 2006. Conditional production of acyl-homoserine lactone-type quorum- sensing signals in clinical isolates of enterobacteria. J. Med. Microbiol. 55:1751-1753. 334. Wang, X. D., P. A. de Boer, and L. I. Rothfield. 1991. A factor that positively regulates cell division by activating transcription of the major cluster of essential cell division genes of Escherichia coli. EMBO J. 10:3363-3372. 335. Wang, Y.-J., and J. R. Leadbetter. 2005. Rapid acyl-homoserine lactone quorum signal biodegradation in diverse soils. Appl. Environ. Microbiol. 71:1291-1299. 336. Wanner, J. 1997. Microbial community analysis: the key to the design of bilogical wastewater, p. 35-57. In T. E. Cloete and N. Y. O. Muyima (ed.), Microbial population dynamics in biological wastewater treatment plants. International Association on Water Quality, London. 337. Waters, C. M., and B. L. Bassler. 2005. Quorum sensing: Cell-to-cell communication in bacteria. Annu. Rev. Cell Develop. Biol. 21:319-346. 338. Webb, J. S., M. Givskov, and S. Kjelleberg. 2003. Bacterial biofilms: prokaryotic adventures in multicellularity. Curr. Opin. Microbiol. 6:578- 585. 339. Welch, M., D. E. Todd, N. A. Whitehead, S. J. McGowan, B. W. Bycroft, and G. P. C. Salmond. 2000. N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia. EMBO J. 19:631-641. 340. Wentzel, M. C., A. Mbewe, and G. A. Ekama. 1995. Batch test for measurement of readily biodegradable COD and active organism concentrations in municipal wastewaters. Wat. SA 21:117-124. 341. Werthen, M., L. Henriksson, P. O. Jensen, C. Sternberg, M. Givskov, and T. Bjarnsholt. 2010. An in vitro model of bacterial infections in wounds and other soft tissues. APMIS 118:156-164. 342. West, S. A., and A. Buckling. 2003. Cooperation, virulence and siderophore production in bacterial parasites. Proc. R. Soc. London Ser. B 270:37-44. 343. West, S. A., S. P. Diggle, A. Buckling, A. Gardner, and A. S. Griffin. 2007. The social lives of microbes. Annu. Rev. Ecol. Evol. Syst. 38:53-77. 344. West, S. A., A. S. Griffin, A. Gardner, and S. P. Diggle. 2006. Social evolution theory for microorganisms. Nat. Rev. Microbiol. 4:597-607. 345. West, S. A., E. T. Kiers, E. L. Simms, and R. F. Denison. 2002. Sanctions and mutualism stability: why do rhizobia fix nitrogen? Proc. R. Soc. Lond. B 269:685-694. 346. Whitehead, N. A., A. M. L. Barnard, H. Slater, N. J. L. Simpson, and G. P. C. Salmond. 2001. Quorum-sensing in Gram-negative bacteria. FEMS Microbiol. Rev. 25. 347. Whiteley, M., and E. P. Greenberg. 2001. Promoter specificity elements in Pseudomonas aeruginosa quorum-sensing-controlled genes. J. Bacteriol. 183:5529-5534.
187 References
348. Whiteley, M., K. M. Lee, and E. P. Greenberg. 1999. Identification of genes controlled by quorum sensing in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 96:13904-13909. 349. Wilen, B., D. Lumley, A. Mattsson, and T. Mino. 2008. Relationship between floc composition and flocculation and settling properties studied at a full scale activated sludge plant. Water Res. 42:4404-4418. 350. Winson, M. K., M. Camara, A. Latifi, M. Foglino, S. R. Chhabra, M. Daykin, M. Bally, V. Chapon, G. P. C. Salmond, and B. W. Bycroft. 1995. Multiple N-acyl-L-homoserine lactone signal molecules regulate production of virulence determinants and secondary metabolites in Pseudomonas aeruginosa. Proc. Natl. Acad. Sci. USA 92:9427-9431. 351. Winson, M. K., S. Swift, L. Fish, J. P. Throup, F. Jorgensen, S. R. Chhabra, B. W. Bycroft, P. Williams, and G. S. Stewart. 1998. Construction and analysis of luxCDABE-based plasmid sensors for investigating N-acyl homoserine lactone-mediated quorum sensing. FEMS Microbiol. Lett. 163:185-192. 352. Withers, H., S. Swift, and P. Williams. 2001. Quorum sensing as an integral component of gene regulatory networks in gram-negative bacteria. Curr. Opin. Microbiol. 4:186-193. 353. Wong, M.-T., T. Mino, R. J. Seviour, M. Onuki, and W.-T. Liu. 2005. In situ identification and characterization of the microbial community structure of full-scale enhanced biological phosphorus removal plants in Japan. Water Res. 39:2901-2914. 354. Wu, H., Z. Song, M. Hentzer, J. B. Anderson, A. Heydorn, K. Mathee, C. Moser, L. Eberl, S. Molin, N. Hojby, and M. Givskov. 2000. Detection of N-acylhomoserine lactones in lung tissues of mice infected with Pseudomonas aeruginosa. Microbiology 146:2481-2493. 355. Yeon, K.-M., W.-S. Cheong, H.-S. Oh, W.-N. Lee, B.-K. Hwang, C.-H. Lee, H. Beyenal, and Z. Lewandowski. 2009. Quorum sensing: a new biofouling control paradigm in a membrane bioreactor for advanced wastewater treatment. Environ. Sci. Technol. 43:380-385. 356. Yong, Y.-C., and J.-J. Zhong. 2009. A genetically engineered whole-cell pigment-based bacterial biosensing system for quantification of N-butyryl homoserine lactone quorum sensing signal. Biosens. Bioelectron. 25:41- 47. 357. Yoon, S. S., R. F. Hennigan, G. M. Hilliard, U. A. Ochsner, K. Parvatiyar, M. C. Kamani, H. L. Allen, T. R. DeKievit, P. R. Gardner, U. Schwab, J. J. Rowe, B. H. Iglewski, T. R. McDermott, R. P. Mason, D. J. Wozniak, R. E. Hancock, M. R. Parsek, T. L. Noah, R. C. Boucher, and D. J. Hassett. 2002. Pseudomonas aeruginosa anaerobic respiration in biofilms: relationships to cystic fibrosis pathogenesis. Dev. Cell 3:593-603. 358. Yu, G., P. He, L. Shao, and D. Lee. 2007. Enzyme activities in activated sludge flocs. Appl. Microbiol. Biotechnol. 77:605-612. 359. Zenno, S., and K. Saigo. 1994. Identification of the genes encoding NAD (P) H-flavin oxidoreductases that are similar in sequence to Escherichia coli Fre in four species of luminous bacteria: Photorhabdus luminescens, Vibrio fischeri, Vibrio harveyi, and Vibrio orientalis. J. Bacteriol. 176:3544-3551.
188 References
360. Zhang, H. B., L. H. Wang, and L. H. Zhang. 2002. Genetic control of quorum-sensing signal turnover in Agrobacterium tumefaciens. Proc. Natl. Acad. Sci. USA 99:4638-4643. 361. Zhang, L. H., P. J. Murphy, A. Kerr, and M. E. Tate. 1993. Agrobacterium conjugation and gene regulation by N-acyl-L-homoserine lactones. Nature 362:446-448. 362. Zhu, H., R. Bandara, T. C. R. Conibear, S. J. Thuruthyil, S. A. Rice, S. Kjelleberg, M. Givskov, and M. D. P. Willcox. 2004. Pseudomonas aeruginosa with LasI quorum-sensing deficiency during corneal infection. Invest. Ophthalmol. Vis. Sci. 45:1897-1903. 363. Zhu, H., S. J. Thuruthyil, and M. D. P. Willcox. 2002. Determination of quorum-sensing signal molecules and virulence factors of Pseudomonas aeruginosa isolates from contact lens-induced microbial keratitis. J. Med. Microbiol. 51:1063-1070. 364. Zhu, J., J. W. Beaber, M. I. More, C. Fuqua, A. Eberhard, and S. C. Winans. 1998. Analogues of the autoinducer 3-oxooctanoyl-homoserine lactone strongly inhibit activty of the TraR protein of Agrobacterium tumefaciens. J. Bacteriol. 180:5398-5405.
189