Mutations/Polymorphisms in the 55 Kda Subunit of DNA Polymerase Ε in Human Colorectal Cancer
Total Page：16
File Type：pdf, Size：1020Kb
CANCER GENOMICS & PROTEOMICS 6: 297-304 (2009) Mutations/Polymorphisms in the 55 kDa Subunit of DNA Polymerase ε in Human Colorectal Cancer QI ZHOU1, KATI TALVINEN1, JARI SUNDSTRÖM1, ADEM ELZAGHEID1,*, HELMUT POSPIECH2, JUHANI E. SYVÄOJA2,3 and YRJÖ COLLAN1 1Department of Pathology, University of Turku, FIN-20520 Turku; 2Biocenter Oulu and Department of Biochemistry, University of Oulu, FIN-90014 Oulu; 3Department of Biology, University of Joensuu, FIN-80101 Joensuu, Finland; Abstract. Background: Defects of some DNA polymerases associated features, such as Ki-67 score (3). Proliferation, on have shown associations with cancer, but data on DNA the other hand, is intimately linked with DNA polymerases. polymerase ε are limited. This study investigated mutations This is why we wished to compare the genomic status of the in the 55 kDa subunit gene of DNA polymerase ε in second largest (55 kDa) subunit of DNA polymerase ε colorectal cancer. Materials and Methods: DNA from 16 (POLE2) with several prognostic features to get an idea how human colorectal cancer and 9 control samples was studied genomic abnormalities in DNA polymerase ε might be with polymerase chain reaction–single-strand comformation related to clinical presentation or prognosis associated polymorphism analysis and DNA sequencing. Results: DNA features (4-6). polymerase ε gene alterations were identified in 5 out of the DNA polymerases have a central role in the maintenance 16 cases (31.2%). Two samples showed a T-C transition at of genome integrity, as they are the enzymes that actually exon 17 (potential tyrosine to histidine substitution), and an synthesise DNA (7). At least 14 such polymerases have been A-G transition at intron 7; one sample showed an A-G identified in the mammalian cell, but only three of these, α, transition at intron 8. An AATT deletion was observed at δ and ε, are considered to perform the bulk of DNA intron 18 in 3 out of the 16 colon cancer cases (grades 2, 3, synthesis during replication (7). These members of family B and 2, and Dukes’ classes C, D, and C, respectively). DNA polymerases are structurally related enzymes and are Conclusion: Because the AATT deletion has also been found all essential for nuclear DNA replication. They also have in breast cancer, the region may be a mutation hot spot, additional roles in DNA repair and cell cycle control (8). possibly involved in the carcinogenetic path in advanced Information on the association of DNA polymerase colorectal cancer. defects with biological phenomena have been slow to emerge. It has been suggested that defects of mitochondrial The modified Dukes’ class (or TNM classification) is the DNA polymerase are associated with premature aging (9). best general prognosticator for colon cancer (1). However, There are links to cancer with some DNA polymerases, there are still situations in which other prognosticators will especially with β (POLB). POLB mutations or splice variants be able to offer valuable advice for clinicians, e.g. within of POLB mRNA have been found in human colorectal, individual classes. This especially applies to Dukes’ class B prostate and bladder cancer (10-12). Other DNA polymerases cases, and proposals for additional prognosticators have been have been implicated in tumorigenesis. Mutations in the suggested (2). Many potential and proven prognostic features DNA polymerase η (POLH) gene underlie the cancer-prone are negatively or positively associated with proliferation- xeroderma pigmentosum variant syndrome (XP-V) (13, 14). Point mutations were detected in the DNA polymerase δ (POLD) in colon cancer cell lines, and in primary human colorectal cancer (15). This phenotype was also found in *Present address: Department of Pathology, Al-Arab Medical mouse models carrying mutated forms of POLD (16-19). University, Benghazi, Libya, Finland There are no comparable reports of mutation for POLE. This is surprising, since several mutations have been reported for Correspondence to: Yrjö Collan, Department of Pathology, University yeast pole that reduce replication fidelity and cause genomic of Turku, FIN-20520 Turku, Finland. e-mail: [email protected] instability. This underlines the importance of POLE in Key Words: Colorectal cancer, DNA polymerase epsilon (ε), chromosomal replication (20), suggesting the potential genomic changes. pathologic role of human POLE mutations. Human POLE is 1109-6535/2009 $2.00+.40 297 CANCER GENOMICS & PROTEOMICS 6: 297-304 (2009) composed of four subunits, a large catalytic subunit of 261 Table I. The clinical profile of cancer specimens, and the mutationsa of kDa and three associated subunits of 55, 17 and 12 kDa (21). POLE2 found in this study. Histologically, all cases represented Our earlier report demonstrated that POLE2 gene variations adenocarcinomas. were observed in human breast cancer (22). In this study, we Case Gradeb Stagec Mutation further investigate the POLE2 gene variations in human colon cancer. 1 2 B 2 2 C Materials and Methods 3 2 B 4 2 C AATT deletion in intron 18, at nt. 25115-118 5 2 B Studied samples. Fresh colon tumor tissues from 16 patients were 6d 2 A T-C transition in exon 17, at nt. 31705 collected at the Turku University Central Hospital and Turku City (amino acid substitution tyrosine-histidine) Hospital (Table I). All samples were immediately transferred to our A-G transition in intron 7, at nt. 47656 laboratory in liquid nitrogen, and processed for RNA and DNA G-A transition in exon 7, at nt. 47680 isolations. Corresponding normal colon tissues at a distance of 2-5 cm (amino acid substitution glutamine-glutamine) from the tumor were obtained from 8 patients at the same time. A 7 2 C normal human placental sample was collected at Turku University 8e 1 D Central Hospital. The histological grades and Dukes’ stages are shown 9 1 A in Table I. 10f 3 D AATT deletion in intron 18, at nt. 25115-118 11 2 B PCR amplification. The 19 sets of intronic primers shown in Table II 12 2 C were designed to amplify the entire coding region of the POLE2 DNA 13 2 B sequence reported by Huang et al. (23). The SP6 promoter sequence, 14 2 C T-C transition in exon 17, at nt. 31705 (amino acid substitution tyrosine-histidine) GACACTATAGAATAC, and T7 promoter sequence, CGACTC A-G transition in intron 7, at nt. 47656 ACTATAGGG, were attached to the 5’ end of each upstream and A-G transition in intron 8, at nt. 46351 downstream primer, respectively. The polymerase chain reaction G-A transition in exon 7, at nt. 47680 (PCR) was run for 35 cycles, each consisting of denaturing for 1 min (amino acid substitution glutamine-glutamine) at 94˚C, or at 95˚C for exon 1, 11 and 12, annealing at different C-A transition in exon 8, at nt. 46469 temperatures (Table II) for 1 min, and extension for 1 min at 72˚C. (amino acid substitution valine-valine) PCR was performed in a Perkin Elmer Cetus DNA Thermal Cycler 15 2 B 480 (Perkin Elmer, USA). The second pair of Cy5-labelled primers 16 2 C AATT deletion in intron 18, at nt. 25115-118 (SP6 5’: TTTAGGTGACACTATAGAATAC and T7 5’:GTAA TACGACTCACTATAGGG) were used for subsequent secondary aReference sequence: published sequence of genomic DNA for human PCR and to produce Cy5-labelled PCR products. The 30 cycles chromosome 14 DNA sequence BAC R-83 from ref. 20 (GenBank included 30 s denaturation at 94˚C (except exon 1 at 96˚C), 30 s accession number AL591767). bGrade: 1, well differentiated; 2, annealing at 55˚C and 30 s extension at 72˚C. The PCR products were moderately differentiated; 3, poorly differentiated. cDukes’ class. d,fThe electrophoresed on 2.5% agarose gel. sequencing changes were also found in corresponding normal tissue. eCancer was located in the rectum. Single-strand comformation polymorphism (SSCP) analysis. The Cy5- labelled PCR products were mixed with an equal volume (4.5 μl) of denaturing solution containing 100% deionized formamide, and 0.05% bromophenol. The mixture was heated at 95˚C for 4 min, ALFexpress II DNA sequencer (Pharmacia Biotech). The sequence thereafter chilled on ice. Two undenatured samples (one from among data were collected by ALFwin software and analyzed by sequence the cancer cases, one from among controls, no heating at 95˚C) along Analyser 2.00 (Pharmacia Biotech). The sequencing results were with the denatured test samples were studied with SSCP. A volume compared with chromosome 14 genomic sequence data from of 2.5 μl of the mixture was loaded on a 6% polyacrylamide gel bacterial artificial chromosome (BAC) clones (24). (acrylamide:bisacrylamide, 99:1) in an ALFexpress II with Cool kit (Pharmacia Biotech, Sweden). The running conditions for the gel Immunohistochemistry. Her-2 (ErbB2): A monoclonal mouse antibody electrophoresis were 35 W for 10 h at 12˚C with external cooling. was used (clone CB11; Novocastra Laboratories Ltd, Newcastle upon The SSCP data were collected by ALFwin software and analyzed by Tyne, UK) diluted 1:50, with microwave treatment 600 W, 2×7 mins in fragment analyzer 1.02 (Pharmacia Biotech). citrate buffer at pH 6. Both membranous and cytoplasmic staining were evaluated from highest intensity areas, and in the area Sequence analysis. Samples displaying variant bands on SSCP were representing average staining as judged subjectively. Intensity of additionally analyzed by sequencing. DNA Samples were amplified staining was scored as 0, 1, 2, or 3, and the immunohistochemical by PCR as described above. The amplification products were purified staining index calculated according to the formula: with a GFX™ PCR DNA and Gel Band Purification Kit (Amersham staining index=0*f0 + 1*f1 + 2*f2 + 3*f3 Biosciences, Sweden). Purified PCR products were sequenced using where f0 – f3 refer to the fractions of cells staining with intensities Thermo Sequenase Cy™5 Dye Terminator Kit according to protocols 0-3 (25).