Trichoderma Reesei Toni Paasikallio, Anne Huuskonen and Marilyn G

Paasikallio et al. Microb Cell Fact (2017) 16:119 DOI 10.1186/s12934-017-0736-3 Microbial Cell Factories

RESEARCH Open Access Scaling up and scaling down the production of galactaric acid from pectin using Trichoderma reesei Toni Paasikallio, Anne Huuskonen and Marilyn G. Wiebe*

Abstract Background: Bioconversion of d-galacturonic acid to galactaric (mucic) acid has previously been carried out in small scale (50–1000 mL) cultures, which produce tens of grams of galactaric acid. To obtain larger amounts of biologically produced galactaric acid, the process needed to be scaled up using a readily available technical substrate. Food grade pectin was selected as a readily available source of d-galacturonic acid for conversion to galactaric acid. Results: We demonstrated that the process using Trichoderma reesei QM6a Δgar1 udh can be scaled up from 1 L to 1 10 and 250 L, replacing pure d-galacturonic acid with commercially available pectin. T. reesei produced 18 g L− galac- 1 1 taric acid from food-grade pectin (yield 1.00 g [g d-galacturonate consumed]− ) when grown at 1 L scale, 21 g L− 1 1 galactaric acid (yield 1.11 g [g d-galacturonate consumed]− ) when grown at 10 L scale and 14 g L− galactaric acid 1 (yield 0.77 g [g d-galacturonate consumed]− ) when grown at 250 L scale. Initial production rates were similar to those observed in 500 mL cultures with pure d-galacturonate as substrate. Approximately 2.8 kg galactaric acid was precipitated from the 250 L culture, representing a recovery of 77% of the galactaric acid in the supernatant. In addition to scaling up, we also demonstrated that the process could be scaled down to 4 mL for screening of production strains in 24-well plate format. Production of galactaric acid from pectin was assessed for three strains expressing 1 uronate dehydrogenase under alternative promoters and up to 11 g L− galactaric acid were produced in the batch process. Conclusions: The process of producing galactaric acid by bioconversion with T. reesei was demonstrated to be equally efcient using pectin as it was with d-galacturonic acid. The 24-well plate batch process will be useful screening new constructs, but cannot replace process optimisation in bioreactors. Scaling up to 250 L demonstrated good reproducibility with the smaller scale but there was a loss in yield at 250 L which indicated that total biomass extraction and more efcient DSP would both be needed for a large scale process. Keywords: Galactaric acid, Mucic acid, d-Galacturonic acid, Pectin, Trichoderma reesei, Scale-up, Scale-down

Background acid, furandicarboxylic acid (which is being developed Tere is considerable interest in replacing chemicals as a substitute for terephthalic acid) and other platform derived from petroleum with bio-derived chemicals, i.e. chemicals, including anhydrides, diesters and diallyls chemicals obtained by bioconversion and/or chemical which can be used in the synthesis of higher value prod- conversion from renewable biological resources, primar- ucts [1–3]. Both compounds can be prepared by nitric ily plants. Both galactaric and glucaric acids have been acid oxidation of the corresponding monosaccharide identifed as substrates for chemical conversion to adipic (d-glucose or d-galactose) [4]. Although biotechnological conversions may be preferable to nitric acid oxidation, biotechnological conversion of d-glucose to glucaric *Correspondence: [email protected] acid continues to be challenging [5]. However, galactaric VTT Technical Research Centre of Finland Ltd., P.O. Box 1000, 02044 Espoo, Finland acid has been produced from d-galacturonic acid using

© The Author(s) 2017. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/ publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 2 of 11

genetically modifed Escherichia coli and Trichoderma needed. T. reesei Δgar1 udh was used in scaling up the reesei at concentrations of 10 [6] to 20 [7] g L−1, which process since it has already been demonstrated to pro- are high enough concentrations for precipitation from duce up to 20 g L−1 galactaric acid from d-galacturonic the culture broth, making biotechnologically derived acid [7]. Since T. reesei does not hydrolyse pectin [9] galactaric acid available for assessment in further chemi- and to facilitate sterilisation of viscous pectin solutions, cal conversions [6]. Te genetically modifed E. coli or T. enzymatic pre-hydrolysis of the pectin was necessary. reesei convert d-galacturonic acid to galactaric acid by An alternative approach would be to develop a consoli- the action of a uronate dehydrogenase (UDH), which is dated process using a production strain such as Asper- expressed in a strain in which normal d-galacturonic acid gillus niger, which produces native pectinases. However, metabolism has been disrupted [6, 8]. In the case of T. A. niger can metabolise galactaric acid [8] and a strain in reesei, deletion of the gene encoding NADPH-dependent which this pathway has been disrupted has only recently d-galacturonate reductase (gar1), the frst step in the fun- become available [10]. A production process with A. niger gal pathway for d-galacturonic acid metabolism, is suf- has not yet been developed. fcient to disrupt the pathway and expression of the A. In addition to scaling up the process of producing tumefaciens udh gene results in a strain which produces galactaric acid to provide galactaric acid for chemical galactaric acid [8]. reactions, we were also interested in providing a scaled Although chemically produced galactaric acid is com- down process, which would enable the screening of new mercially available, biotechnologically produced galac- strains [11]. Galactaric acid production by T. reesei has taric acid will contain diferent impurities and the efect previously been demonstrated in fask cultures [8], but at of these on specifc chemical reactions needs to be much lower concentrations than can be obtained in bio- assessed to provide feedback on the purity requirements reactors [7]. Running and Bansal [12] demonstrated that and consequent implications for downstream processing 24-well plates can have as good or better oxygen trans- (DSP) in the biotechnological process. For this reason fer as shaken fasks, depending on the shaking regime it may be necessary to produce substantial quantities of applied, and 24-well plates are increasingly being used galactaric acid using biotechnology, even though the pro- for the cultivation of flamentous fungi [13–15]. It is cess is not ready for commercialisation. therefore useful to assess whether galactaric acid produc- Te substrate for biotechnological production of galac- tion by T. reesei could be scaled down for production in taric acid is d-galacturonic acid, which can be obtained 24-well plates using pectin as substrate. by hydrolysis of pectin. Zhang et al. [6] demonstrated In this paper we describe the production of galactaric that galactaric acid could be produced from enzymati- acid by T. reesei VTT D-161646 from enzyme hydrolysed cally hydrolysed sugar beet pulp, but noted that the yield pectin at 1, 10 and 250 L scales. We also demonstrate of galactaric acid on sugar beet pulp was relatively low that the process can be scaled down to 4 mL for strain (0.14 g galactaric acid per g sugar beet pulp), refecting screening, for example in considering the efectiveness of the high concentration of other compounds in the pulp, alternative promoters for expression of the uronate dehy- particularly d-glucose and l-arabinose. d-Galacturonic drogenase gene, as shown here. acid is currently available only at high prices (more than €3000 per kg) and is thus not suitable for producing kilo- Results gram amounts of galactaric acid for chemical testing. Scaling down production of galactaric acid in 24‑well However, food grade pectins are commercially available plates at prices in the range of €10–100 per kg, making them Tree transformants of T. reesei were generated in a reasonable source for preparation of large amounts of which the uronate dehydrogenase (udh) gene was galactaric acid. It should be noted that food grade pectin expressed under diferent promoters and these were may be diluted with additives such as sucrose or glucose. cultivated in 24-well plates to assess the suitability of Having received a request to provide a 2 kg sample of bio- the 24-well plate format for galactaric acid produc- technologically produced galactaric acid for use in chem- tion. All transformants which contained the udh gene ical reactions, we decided to use pectin as the source of produced galactaric acid in the 24-well plates. T. reesei d-galacturonic acid in scaling up the process of galactaric VTT D-161646 produced 8.8 g L−1 galactaric acid from acid production with T. reesei Δgar1 udh. An industrial 10.7 g d-galacturonic acid in 6 days and 10.5 g L−1 from process would be expected to use sugar beet pulp, cit- 20 g L−1 pectin (Sigma), hydrolysed to give 11.6 g L−1 rus waste and other pectin-rich waste streams or crude d-galacturonic acid, demonstrating that galactaric acid extractions of pectin from these sources, which would could be produced in the 24-well plates (Fig. 1; Table 1). not compete with the food use of current pectin pro- No galactaric acid was produced by M122, the control duction, but these were not readily available at the scale strain lacking udh, nor in wells which had not been Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 3 of 11

a b 14 18 pCBH1 pCBH1 pPDC1 16 pPDC1 12 pcDNA1 pcDNA1 VTT D-161646 14 VTT D-161646 )

) M122 M122 10 -1 -1 L

L Medium 12 Medium g (g d( 8 i 10 id ac ac ic

ic 8 6 n ar ro ct tu 6 la

4 ac al Ga 4 G 2 2

0 0 050100 150 050100 150 Time (h) Time (h) c 14 d 14 pCBH1 pCBH1 pPDC1 pPDC1 12 pcDNA1 12 pcDNA1 VTT D-161646

) VTT D-161646 1 ) M122 -

-1 M122 10 L 10 L Medium Medium (g (g id

id 8 8 ac ac c ic ni

ar 6

ro 6 ct tu la ac

4 al 4 Ga G

2 2

0 0 050100 150 050100 150 Time (h) Time (h) Fig. 1 Galactaric acid production and d-galacturonic acid consumption in 24-well plates. T. reesei Δgar1 udh strains, in which the udh gene was under control of the CBH1, PDC1, cDNA1 or GPDA (VTT D-161646) promoters, and M122, which contains gar1 and does not contain udh, were grown in 4 mL medium containing pure d-galacturonate (a, b) or hydrolysed pectin (c, d) as substrate in 24-well plates. All values have been adjusted for evaporation, except those for the medium in wells with pure d-galacturonic acid. Values for pCBH1, pPDC1 and pcDNA1 represent mean sem for ± n 3. Where not seen, error bars were smaller than the symbols = inoculated (Fig. 1). Te increase in concentration of under control of the CBH1 (cellobiohydrolase I) pro- d-galacturonic acid (Fig. 1b) and lactose in the uninoc- moter produced signifcantly more (p < 0.05) galactaric −1 ulated wells provided evidence of the extent of evapo- acid (11.2 ± 0.2 g L ) from d-galacturonic acid than the ration in the wells and this data was used to calculate other three strains, but there were no signifcant difer- the actual concentrations of galactaric acid produced ences (p > 0.05) in the amounts produced from Sigma in other wells. Hydrolysis of the pectin was not com- pectin (Fig. 1). Te yield of galactaric acid on d-galactu- plete within 72 h, so changes in the concentrations of ronic acid was between 0.87 and 1.00 g g−1 in the 24-well d-galacturonic acid and lactose in the well with medium plates when d-galacturonic acid was used as the sub- containing d-galacturonate were used to adjust for strate, and between 0.76 and 0.90 g g−1 when pectin was evaporation in the pectin containing wells. used as substrate (Table 1). Production rates between Each of the new transformants produced similar 72 and 120 h were 0.11–0.13 g L−1 h−1 with either pure amounts of galactaric acid to VTT D-161646 and to d-galacturonic acid or with pectin as the source of each other (Fig. 1; Table 1). Te strain expressing udh d-galacturonic acid (Table 1). Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 4 of 11

Table 1 Galactaric acid production by T. reesei expressing udh under promoters pCBH1, pcDNA1, pPDC1 or pGPDA Strain pCBH1 pcDNA1 pPDC1 pGPDAa

24-well plates—d-galacturonate 1 Galactaric acid (g L− ) 11.1 0.2 9.4 0.4 9.8 0.1 8.8 1 1 ± ± ± Galactaric acid production rate (72–120 h) (g l− h− ) 0.13 0.01 0.12 0.00 0.12 0.00 0.11 1 ± ± ± Yield galactaric/d-galacturonic (g g− ) 0.95 0.02 0.87 0.02 0.89 0.00 0.89 ± ± ± 24-well plates—pectin 1 Galactaric acid (g L− ) 11.6 0.2 11.5 0.3 11.4 0.1 10.5 1 1 ± ± ± Galactaric acid production rate (72–120 h) (g L− h− ) 0.12 0.04 0.11 0.00 0.11 0.00 0.13 1 ± ± ± Yield galactaric/d-galacturonic (g g− ) 0.84 0.03 0.90 0.03 0.89 0.03 0.76 ± ± ± 0.5 L bioreactors—d-galacturonate 1 Galactaric acid (g L− ) 15.7 13.6 16.0 19.7 1 1 Galactaric acid production rate (0–72 h) (g L− h− ) 0.22 0.21 0.09 0.19 1 Yield galactaric/d-galacturonic (g g− ) 0.90 0.82 1.11 0.85 1 Maximum biomass (g L− ) 9.5 0.2 9.0 0.3 6.5 0.5 7.9 0.3 ± ± ± ± Galactaric acid production (titre, rate of production and yield on d-galacturonic acid) in 24-well plates and in 0.5 L bioreactors using either d-galacturonic acid or pectin (Sigma) as substrate, with lactose as co-substrate. Maximum biomass in bioreactors was observed at 50 (pCBH1, pcDNA1, pGPDA) or 72 (pPDC1) h after which time biomass decreases (see also Fig. 3). Values are mean sem for three replicates ± a Strain VTT D-161646

In lactose-d-galacturonic acid fed-batch cultures (0.5 L, Table 2 Carbohydrate composition (% dry matter) of pec- using the optimised process described by [7]) transfor- tin mants expressing udh under the gpdA (glyceraldehyde- Pectin Sigma P1935 Meridianstar 3-phosphate dehydrogenase, strain VTT D-161646), rapid set CBH1, cDNA1 (unidentifed hypothetical protein), and d-Galacturonate 65.6 43.0 PDC1 (pyruvate decarboxylase) promoters produced 20, d-Glucose 1.7 35.5 16, 14 and 16 g L−1 galactaric acid, respectively (Table 1). l-Arabinose 1.2 1.5 Yields were 0.85, 0.90, 0.82 and 1.11 g galactaric acid d-Galactose d-xylose 11 4 [g d-galacturonate consumed]−1, respectively. However, + 1 Pectin was hydrolysed by addition of 0.5–1.0 mL L− Pectinex Ultra with the strain producing galactaric acid under the pdc1 pro- 1 0.1 mL L− Pectinex Smash and incubation at 40 °C. d-Galactose and d-xylose moter grew slower than the other strains, producing less were not separated on the HPLC column used biomass, and the initial production rate (between 0 and 72 h) of d-galactaric acid (0.09 g L−1 h−1) was slower than that of the other three strains (0.19–0.20 g L−1 h−1, galactaric acid production. Terefore both 1 and 250 L Table 1). cultures were carried out using Meridianstar pectin. When Sigma pectin replaced d-galacturonic acid in Production of galactaric acid from pectin at 1, 10 and 250 L the T. reesei galactaric acid production process, 21 g L−1 scale galactaric acid was produced with a yield of 1.11 g galac- Strain VTT D-161646 was used in the scaling up experi- taric acid [g d-galacturonic acid]−1, assuming that the ments since production conditions have been developed pectin had been fully hydrolysed. Te yield of galactaric specifcally for this strain [7] and there was no improve- acid on pectin was 0.73 g g−1. Te production rate dur- ment in galactaric acid production with the new strains ing the frst 140 h (0.14 g L−1 h−1) was comparable to under these conditions. In order to scale up produc- that observed previously with pure d-galacturonic acid tion of galactaric acid, d-galacturonic acid was replaced during the same time interval (0.15 g L−1 h−1; Fig. 3) [7] with pectin, using either Sigma or Meridianstar pec- and the process generally showed good reproducibility tin (Table 2). A process scheme for the production of with the 500 mL scale production from d-galacturonic galactaric acid from pectin is shown in Fig. 2. Te 10 L acid. No accumulation of d-galacturonic acid or other culture was carried out using Sigma pectin while wait- carbohydrates (lactose, glucose, galactose or arabinose) ing for the Meridianstar pectin to arrive. Because of the was observed during the feeding phase. Biomass pro- high d-glucose content in the Meridianstar pectin it was duction on pectin with lactose was a bit higher than on necessary to adjust the process at 1 L scale to assess the d-galacturonic acid with lactose, even though the lactose extent to which the high d-glucose content would repress concentration had been reduced to take into account the Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 5 of 11

Fungal Mineral Galactaric Water HCl Water cells salts acid Cell separation Sterilisation Feed Supernatant Pectin Reactor Crystalisation vessel

Biomass Pectinase YE YE Pectin Pectinase (45°C) Washing Liquid Lactose Separation waste

Fig. 2 Process scheme for production of galactaric acid from pectin. Input concentrations are given in the methods and outputs are described in “Results”. Process steps carried out here are indicated with solid lines. Broken lines illustrate the potential for an additional biomass extraction step, with liquid recycling. Filtration was used for cell separation and for collection of galactaric acid crystals

14 D-Galacturonate 0.5 L Sigma Pectin 10 L 20 12 Meridianstar pectin 1 L Meridianstar pectin 300 L

) 10

-1 15 ) L 1 - g gL

d( 8 ( i s ac s a c

i 10 6 ar om ct Bi la a D-Galacturonate 0.5 L 4 G 5 Sigma Pectin 10 L Meridianstar pectin 1 L 2 Meridianstar pectin 300 L 0 0 050 100 150 200 050100 150200 Time (h) Time (h)

1.4 120 ) -1 ] ) d i c ut

a 1.2 np c 100 ni %i ro u t as

c 1 a l 80 on ga b D- 0.8 ar [g tc 60 id pu ac 0.6 ut c (o ri e ta 40 c nc a 0.4 D-Galacturonate 0.5 L Sigma Pectin 10 L la gal

Sigma Pectin 10 L ba

(g Meridianstar pectin 1 L

S 20 / 0.2 Meridianstar pectin 1 L on P b d r Meridianstar pectin 300 L

el Meridianstar pectin 300 L i Ca Y 0 0 050 100 150 200 050100 150200 Time (h) Time (h) Fig. 3 Galactaric acid and biomass production at 0.5, 1, 10 and 250 L scale. T. reesei Δgar1 udh VTT D-161646 was provided d-galacturonic acid (0.5 L, [7]) or hydrolysed pectin (1, 10 and 250 L) as substrate with lactose as co-substrate. The approximate yield of galactaric acid on d-galacturonic acid and the overall carbon balance are also shown. Values for production from d-galacturonic acid at 0.5 L scale are mean sem for 4 independent ± cultivations. Error bars for biomass measurements at 1, 10 and 300 L scale are sem for duplicate measurements ± Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 6 of 11

carbohydrates introduced with the pectin (Fig. 3). d-Glu- Based on the results at the 1 L scale, T. reesei VTT cose remained limiting throughout the feeding phase. D-161646 was grown in a 300 L bioreactor and 256 L Te culture broth was collected at the end of the culti- of 14 g L−1 galactaric acid was produced. Te initial vation and the biomass separated by fltration, generat- (0–73 h) production rate of 0.15 g L−1 h−1 was only sus- ing 8.8 L clear liquid and 282 g wet biomass. Precipitating tained for 72 h, after which time both the rate of galac- and collecting the crystals of galactaric acid resulted in taric acid production and the yield of galactaric acid on 154 g galactaric acid, representing 85% of the galactaric d-galacturonic acid decreased. Te fnal yield was 0.77 g acid produced (Table 3). galactaric acid [g D-galacturonic acid]−1 or 0.32 g [g pec- Using Meridianstar Rapid Set pectin, 19 g L−1 galac- tin]−1 (Fig. 3). Crystals were observed among the mycelia taric acid was produced with a yield of 1.00 g galac- under the microscope and were also present in the foam taric acid [g d-galacturonic acid]−1, assuming complete which had been produced in the bioreactor. After precip- hydrolysis of the pectin (Fig. 3). Te yield of galactaric itation, collection and drying, 2.81 kg galactaric acid was acid on Meridianstar pectin was 0.41 g g−1. Feeding was obtained, or 73% of the amount present in the superna- not started until all d-glucose and lactose had been con- tant (Table 3). Biomass was not extracted. sumed, but this resulted in d-galacturonic acid limitation during the batch phase and reduced the initial galactaric Discussion acid production rate. Te initial production rate (0–70 h) Te process of producing galactaric acid using T. reesei was only 0.10 g L−1 h−1, but during the feeding phase was scalable both up and down, with little loss in produc- (90–150 h) it increased to 0.13 g L−1 h−1. Although there tivity, even with the substitution of pectin for d-galac- was no accumulation of d-glucose during the feeding turonic acid. Pectin was found to be a suitable substrate phase, there was initial accumulation of d-galacturonic for galactaric acid production, although for T. reesei this acid (up to 4.3 g L−1) in the culture supernatant and the required the addition of commercial pectinases. Addition feed rate was reduced to allow more complete conversion of pectinases also facilitated sterilisation of the pectin feed, to d-galactaric acid. More biomass was produced when so even though T. reesei could be engineered to express a T. reesei VTT D-161646 was grown on Meridianstar full range of pectinases to reduce the cost of enzyme addi- pectin than on Sigma pectin and the biomass concentration, a fully consolidated process may not be desirable. Te tion was maintained during the feeding phase (Fig. 3). only other adjustment required for the use of pectin was a Approximately 89% of the galactaric acid was recovered reduction in the amount of added co-substrate, since co- by precipitation in acid (Table 3). substrates were provided with the pectin, particularly in

Table 3 Process parameters for galactaric acid production at 0.5, 1, 10 and 250 L

a d-Galacturonic acid Meridianstar pectin Sigma pectin Meridianstar pectin

Reactor volume (L) 0.5 1 10 250 Process time (h) 242 215 185 168 Inputs 1 Lactose (g L− ) 28 10 14 9 1 Galacturonic acid (g L− ) 21 1 Pectin (g L− ) 48.4 29.2 45.9 1 Pectinase(s) (mL L− ) 1 1 2 1 Fungal cells (g L− ) 1 1 1 1 Air (vvm) 1.4 0.5 0.5 0.5 Output 1 Galactaric acid (g L− ) 21 2 18 21 15 1 ± Yield (g [g galacturonate]− ) 1.0 0.2 1.0 1.1 0.8 1 ± Yield (g [g pectin]− ) 0.41 0.73 0.32 1 b Biomass (g L− ) 4 1 9 0.1 4 0.1 8 0.2 ± ± ± ± Product recovery (kg) 0.014 0.15 2.8 Product recovery (%) 68 7 89 85 73 ± a Data from [7]. Values are mean sem for four cultivations ± b Biomass measurements are mean sem for 2–3 replicates, except for 0.5 L cultivations (mean sem for 4 cultivations), at end of cultivation ± ± Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 7 of 11

the case of the food-grade pectin, which contained a high Tis suggests that galactaric acid crystals may have been concentration of d-glucose. Earlier results had indicated included with inadequately washed biomass in the dry that d-glucose-limited fed-batch culture was less efective weight determination, or that some d-galacturonate con- than lactose-limited fed-batch culture for galactaric acid tributed to CO 2 production through an unknown path- production with T. reesei VTT D-161646 [7], but this did way. Up to around 7% galactaric acid was expected to be not appear to be the case when d-glucose was supplied removed with the biomass, but is expected to be washed with hydrolysed pectin in the feed. of during rinsing for the dry weight determination. Pectin was also used in the 24-well plates, with no However, when harvesting the 250 L culture we observed apparent problems with mixing. Evaporation could be a a decrease in galactaric acid concentration during the problem at this scale, however, as seen in the increasing fltration process, which indicated that galactaric acid concentration of substrates in uninoculated wells, and crystals were trapped as more biomass accumulated in needed to be taken into account. Production from hydro- the flter. Te concentration of galactaric acid was deter- lysed pectin was comparable to that observed when pure mined after fltration. Large scale extraction of the bio- d-galacturonic acid was provided. Production of galac- mass was not possible at this time, but it is clear that this taric acid was much higher in these 4 mL batch cultures would be needed to obtain the maximum galactaric acid than has previously been reported for fask cultures with output from a scaled up process. flamentous fungi (around 4 g L−1; [8, 10]). Te medium In spite of the low yield at the 250 L scale, around 3.8 kg in the 24-well plates contained spent grain extract, which galactaric acid was produced and 2.8 kg was recovered by was expected to induce the CBH1 promoter [16], but acid precipitation. Poor mixing and inadequate cooling not necessarily other promoters. Spent grain extract also in the vessels used for the crystallisation step will have provides organic nitrogen, resulting in a richer medium, contributed to the recovery of only 73% of the galactaric which may contribute to the good conversion of d-galac- acid. Tis was adequate for supplying material for further turonic acid into galactaric acid. Kuivanen et al. [10] chemical conversions, but highlights the need for further recently found that providing yeast extract and peptone DSP development. to a A. niger galactaric acid producing strain, resulted in improved galactaric acid production, although the Conclusions amounts were still low. Te process of producing galactaric acid by bioconver- Production of galactaric acid by three new strains sion with T. reesei was demonstrated to be equally ef- was compared in the 24-well plates, but production of cient using hydrolysed pectin as d-galacturonic acid as all strains was found to be similar. Tis suggested that the substrate, and d-glucose present with the pectin did the amount of uronate dehydrogenase produced under not inhibit the process. Scaling up to 250 L demonstrated the control of each of the promoters tested (pCBH1, good reproducibility with the smaller scale but there was pcDNA1, pPDC1 and the original pGPDA) was adequate a loss in yield at 250 L which indicated that both total to catalyse the conversion of d-galacturonic acid to biomass extraction and more efcient DSP would be galactaric acid at the rate at which it was taken up under needed for a large scale process. It would also be neces- these conditions. Te efectiveness of these strains in sary to obtain higher production titres and production producing galactaric acid was confrmed in 0.5 L biore- rates before a biotechnological process for producing actors, however, the bioreactor cultures also revealed a galactaric acid would be considered for commercial pro- slow growth (and production) phenotype for the strain duction. However, the low solubility of galactaric acid [7] expressing udh under the PDC1 promoter, which was not made it feasible to produce kilogram amounts of galac- observed in the microtiter plates. Te PDC promoter is taric acid with the currently available strains so that expected to be particularly well induced when d-glucose assessment on purity requirements and further chemi- is the main carbon source, and conversion of d-galactu- cal transformations can proceed in parallel with further ronic to galactaric acid may be better with d-glucose as strain engineering. Te 24-well plate batch process will co-substrate [17], rather than lactose, as used here. Te be useful in screening new constructs, but cannot replace provision of better aeration and substrate-limited feeding process optimisation in bioreactors. in the bioreactors may also contribute to the phenotype. Te yield of galactaric acid on d-galacturonate was Methods close to the theoretical yield of 1.08 g g−1 in the 1 and Strains 10 L cultures, but in the 250 L culture the yield decreased Trichoderma reesei QM6a (VTT D-071262T, to 0.8 g galactaric acid [g d-galacturonate consumed]−1 ATCC13631), M122 (RutC-30 mus53-), M1123 (M122 after 72 h. Te carbon balance (Fig. 3) indicated that all pyr4-) and VTT D-161646 were obtained from VTT’s of the input carbon was accounted for in the output. strain collections. Spore suspensions were prepared Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 8 of 11

by cultivating the fungus on potato-dextrose agar (BD, kit (KAPABiosystems) using the primers listed in Table 4. Sparks, Maryland, USA) for 5–7 days, after which the Te selection marker pyr4 was obtained from an exist- spores were harvested, suspended in a bufer containing ing plasmid with NotI digestion. All PCRs and digestions 0.8% NaCl, 0.025% Tween-20 and 20% glycerol, fltered were separated with agarose gel electrophoresis and cor- through cotton and stored at −80 °C. Saccharomyces cer- rect fragments were extracted with a gel extraction kit evisiae strain H3488 (FY834, obtained from Jay C. Dun- (Qiagen). lap) was used to clone expression construct plasmids. Te appropriate purifed DNA fragments were trans- Escherichia coli TOP10 (Invitrogen) was used for propa- formed to S. cerevisiae FY834 using the method described gation of the plasmids. in Gietz and Woods [19]. Te plasmids obtained through homologous recombination reactions were isolated from Expression vectors S. cerevisiae, amplifed in E. coli and checked by restric- Expression plasmids contained the 5′ and 3′ fanking tion enzyme digestions and sequencing. regions of T. reesei d-galacturonic acid reductase (gar1, [18]), T. reesei promoter (cbh1, cDNA1 or pdc1), Agro- Strain generation bacterium tumefasciens UDH gene, Aspergillus trpC ter- Expression plasmids (10 µg) were digested with MssI, minator, T. reesei pyr4 selection marker with a loop-out resulting in approximately 6 µg of released expression fragment for marker removal, and the pRS426 plasmid as cassette from each. To generate 3′ single stranded over- vector backbone. hangs and thus to improve transformation efciency, Plasmid pRS426 (ATCC77107), used in cloning expres- digestion mixtures were further treated with T7 exonu- sion construct plasmids in yeast, was obtained from clease [20] and used without further purifcation. Jay C. Dunlap. For cloning, pRS426 was digested with Strain M1123 was transformed with each of the three restriction enzymes EcoRI and XhoI. A plasmid con- expression constructs and positive transformants were taining A. tumefasciens d-galacturonic acid dehydro- selected on minimal medium as described previously [21, genase (udh gene, GenBank no. BK006462.1) codon 22]. Transformants were sub-cultured onto agar-solidi- optimised for Aspergillus niger, [8] was digested with fed minimal medium containing 1 mL L−1 Triton X-100. NcoI and SacII to release the udh gene from the vector Te isolates were screened by PCR to verify correct inte- backbone. Te 5′ and 3′ fank (1572 and 1500 bp) frag- gration at the gar1 locus and a few correctly integrated ments of gar1, the three promoters (cbh1, cDNA1 and transformants were purifed as single spore isolates. pdc1) and 285 bp of the gar1 3′ fank as a direct repeat Deletion of gar1 was verifed by PCR. for looping out the selection marker were obtained by PCR using strain QM6a as template. Te Aspergillus Media trpC terminator (773 bp) was obtained by PCR from a Te low phosphate medium described by [7] was used plasmid containing the element. PCR amplifcation was for 24-well plate, fask and bioreactor cultivations, with performed with a KAPA HiFi HotStart ReadyMix PCR d-galacturonic acid, pectin and lactose provided as Table 4 Primers used to generate fragments for cloning by PCR amplifcation Product Primer Sequence Product size (bp) gar1 5′fank (tre22004) MU01_gar1_5f_for GGTAACGCCAGGGTTTTCCCAGTCACGACGGTTTAAACTTATATCCACCGTGTCCCAG 1610 MU02_gar1_5f_rev GACGCAGTTGTTTGAGCAAC trpC terminator (Aspergillus) MU03_trpCt_for GTGGATAACCCCATCTTCAAGCAGTCCTGAGATCCACTTAACGTTACTGAAATCA 803 MU04_trpCt_rev GAGTGGAGATGTGGAGTGGG gar1 3′direct repeat (tre22004) MU05_gar1_3dr_for TGTGTAAGCGCCCACTCCACATCTCCACTCGGCGCGCCTTGCATTGGTCAGAGCGGTA 361 MU06_gar1_3dr_rev CGAGAGCAGAGCAGCAGTAGTCGATGCTAGGCGGCCGCCCGACTTGGAGAAGCTCGTC gar1 3′fank (tre22004) MU07_gar1_3f_for CCAGCTGCGATTGATGTGTATCTTTGCATGGCGGCCGCTTGCATTGGTCAGAGCGGTA 1576 MU08_gar1_3f_rev AGCGGATAACAATTTCACACAGGAAACAGCGTTTAAACAAGCAGTGGATGACTTGCTG cbh1 promoter (tre123989) MU09_cbh1p_for AGGTTAGTAGGTTGCTCAAACAACTGCGTCGGCCGGCCTGTGGCAACAAGAGGCCAGA 1646 MU10_cbh1p_rev GGCAGCGCCGGTGACGAGCAGGCGCTTCATGATGCGCAGTCCGCGGTTGA cDNA1 promoter (tre123515) MU11_cDNA1p_for AGGTTAGTAGGTTGCTCAAACAACTGCGTCGGCCGGCCGAATTCGGTCTGAAGGACGT 1231 MU12_cDNA1p_rev GGCAGCGCCGGTGACGAGCAGGCGCTTCATGTTGAGAGAAGTTGTTGGATTGA pdc1 promoter (tre121534) MU13_pdc1p_for AGGTTAGTAGGTTGCTCAAACAACTGCGTCGGCCGGCCAAAGGAGGGAGCATTCTTCG 1370 MU14_pdc1p_rev GGCAGCGCCGGTGACGAGCAGGCGCTTCATGATTGTGCTGTAGCTGCGCT

The gene identifers (tre-numbers) refer to Joint Genome Institute T. reesei assembly release version 2.0 Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 9 of 11

carbon sources, as indicated. Medium for 24-well plate for the 24-well plates to ensure adequate culture volume cultivations contained 15 g L−1 lactose with 10 g L−1 for continued incubation. d-galacturonate or 10 g L−1 lactose with 20 g L−1 pectin Pre-cultures for bioreactor inocula were started in (Sigma P1935, Table 2). Immediately before inoculation, Erlenmeyer fasks (500–2000 mL containing 20% volume −1 5 −1 1 mL L Pectinex Ultra SP-L (Novozymes) was added medium) inoculated with ~1 × 10 spores mL (fnal to pectin-containing medium. All 24-well plate medium concentration) to provide a 10% v/v inoculum for 1, 10 also contained 100 mM PIPPS and 1 g L−1 spent grain or 32 L reactors. Te 32 L reactor (New Brunswick 32 L extract, with the pH adjusted to 5.5. BioFlo 510, Eppendorf) was used to provide inoculum Pre-cultures for bioreactors were grown in low phos- for the 300 L reactor. Flasks were incubated at 30 °C with phate medium with 20 g L−1 lactose and 1 g L−1 yeast 200 rpm agitation for approximately 45 h before being extract. transferred directly to bioreactors to provide an initial Media for bioreactors contained 15 g L−1 lactose and biomass of about 1 g L−1. 7.5 g L−1 Sigma pectin or 9 g L−1 lactose and 11 g L−1 Bioreactor cultures were grown in Multifors (Infors Meridianstar Rapid set pectin (Table 2) in the batch HT, Switzerland, max. working volume 0.5 L), Biostat phase, plus 3 g L−1 yeast extract. Filter sterilised Pectinex Q (Sartorius AG, Germany, 1 L max. working volume), Ultra SP-L (1 mL L−1) was added to the reactors after Biostat C (Sartorius AG, Germany, 10 L max. work- sterilisation at 1 and 10 L scale, but unsterilized enzyme ing volume), BioFlo 510 (Eppendorf) or New Brunswick was added before sterilisation for the 250 L pilot. Feed for Scientifc IF400 (Eppendorf, 350 L max. working vol- the fed-batch cultivations contained 1 g L−1 yeast extract ume) bioreactors. Cultures were maintained at 35 °C, and either 50 g L−1 Sigma pectin with 6 g L−1 lactose with 500–900 rpm (0.5 L), 350–500 rpm (1 L), 400 rpm or 78 g L−1 Meridianstar pectin. Pectin in the feed was (10 L), 200 rpm (32 L) or 125–200 rpm (350 L reactor) hydrolysed by the addition of 1.0 mL L−1 Pectinex Ultra agitation and approximately 0.5 volume gas (volume cul- SP-L with 0.1 mL L−1 Pectinex Smash (Novozymes) and ture)−1 min−1 (vvm). Culture pH was kept constant at pH incubation at ~45 °C, with agitation, prior to sterilisa- 4.0 by the addition of sterile 2–4 M NaOH or 1 M H3PO4. tion. Hydrolysis was allowed to proceed until the vis- Gas concentration (CO2, O2, N2 and Ar) was analysed cosity had been reduced to allow adequate sterilisation. continuously using a Prima Pro Process mass spectrom- Te d-galacturonic acid concentration was assessed by eter (Termo Scientifc, UK) calibrated with 3% CO2 in HPLC and if hydrolysis was not yet complete, additional Ar, 5% CO 2 with 0.99% Ar and 15% O 2 in N 2, 20% O 2 plus sterile Pectinex Ultra SP-L was added after sterilisation 20% Ar in N 2, and 0.04% ethanol in N 2. Fed-batch cul- to ensure the availability of d-galacturonic acid for the tures were provided feed at a constant rate after at least process. 5 g L−1 biomass had been produced. Te start of feeding for the 1 L culture was delayed to allow complete utilisa- Culture conditions tion of the lactose, but this appeared to reduce produc- Twenty-four-well plates (Whatman 10 mL round bottom tivity and the feed for the 250 L culture (using the same Uniplate) contained 4 mL medium per well, with either substrate) was started with about 2 g L−1 lactose still pre- 10 g L−1 d-galacturonate or 20 g L−1 pectin (Sigma), sent in the medium, as was the 10 L culture. which was enzymatically hydrolysed simultaneously with the cultivation, as the substrate and lactose as the carbon Chemical analyses source for growth. Wells were inoculated with approxi- Te concentrations of d-glucose, lactose, d-galactose, 5 4 mately 10 spores in 10 µL suspension (~2.5 × 10 spores d-galacturonic acid, and galactaric acid were deter- mL−1 fnal concentration). One well for each medium mined by HPLC using a Fast Acid Analysis Column was not inoculated and used as a control. Tree wells (100 × 7.8 mm, BioRad Laboratories, Hercules, CA) were inoculated with each new transformant (express- linked to an Aminex HPX-87H organic acid analysis col- ing udh under the CBH1, PDC1 and cDNA1 promot- umn (300 × 7.8 mm, BioRad Laboratories) with 5 mM −1 ers) and one well each with M122 (negative control) and H2SO4 as eluent and a fow rate of 0.3 or 0.5 mL min . VTT D-161646. Te plates were covered with adhesive, Te column was maintained at 55 °C. Peaks were breathable rayon fbre flm for culture plates (VWR) and detected using a Waters 410 diferential refractom- incubated at 28 °C, 800 rpm (Infors HT Microtron, Swit- eter and a Waters 2487 dual wavelength UV (210 nm) zerland), 85% relative humidity for up to 7 days. Samples detector. (100 µL) were taken daily after 72 h using wide-mouth Samples were diluted with eluent to give expected con- 200 µL pipette tips and either diluted and analysed imme- centrations of galactaric acid between 1 and 3 g L−1 and diately or stored at −20 °C. Sample size was minimised heated at 100 °C for 1 h to solubilise crystals of galactaric acid prior to HPLC analysis. Samples from 24-well plates Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 10 of 11

were diluted without separation of biomass and super- Funding This research was supported by the VTT BioEconomy Programme. natant, heated at 100 °C for 0.5–1 h, then centrifuged at room temperature to remove biomass. Publisher’s Note Springer Nature remains neutral with regard to jurisdictional claims in pub- Downstream processing lished maps and institutional afliations. Culture broth was collected from the 1, 10 and 250 L Received: 14 April 2017 Accepted: 6 July 2017 cultures and the mycelium separated from the supernatant by fltration. At the 1 and 10 L scale, the mycelium was fltered through thick cleaning cloth under vacuum. Te 250 L culture was warmed to 45 °C before biomass was separated from the liquid using Seitz K300 References 1. Boussie TR, Dias EL, Fresco ZM, Murphy VJ, Shoemaker J, Archer R, et al. depth flter sheets (Pall Corporation) in a Seitz 40–30A4 Adipic acid composition. 2011; Patent WO2011/109051 A1. flter press to obtain approximately 250 L fltrate and 2. Thomas D, Asikainen M, Harlin A. Method for producing muconic acids 20 kg wet biomass. Te supernatant was transferred and furans from aldaric acids. 2015; Patent WO2015189481 A1. 3. Lavilla C, Alla A, Martínez de Ilarduya A, Benito E, García-Martín MG, Galbis during fltration to 2 large vessels (165 and 85 L) which JA, Muñoz-Guerra S. Carbohydrate-based polyesters made from bicyclic were cooled via cold jackets operated with water circu- acetalized galactaric acid. Biomacromolecules. 2011;12:2642–52. lated from a chiller to give temperatures between 7 and 4. Kiely DE, Kirk RHS. Method of oxidation using nitric acid. 2010; Patent US7692041 B2. 12 °C. One and 10 L volumes were stored at 4 °C. HCl 5. Liu Y, Gong X, Wang C, Du G, Chen J, Kang Z. Production of glucaric acid was added to all culture supernatants to reduce the pH from myo-inositol in engineered Pichia pastoris. Enzym Microb Technol. to between 1.5 and 2.2. Supernatants with precipitating 2016;91:8–16. 6. Zhang H, Li X, Su X, Ang EL, Zhang Y, Zhao H. Production of adipic acid galactaric acid crystals were mixed periodically by shak- from sugar beet residue by combined biological and chemical catalysis. ing (1 and 2 × 5 L) or stirring with a paddle (165 and ChemCatChem. 2016;8:1500–6. 85 L) until it was convenient to collect the crystals of 7. Barth D, Wiebe MG. Enhancing fungal production of galactaric acid. Appl Microbiol Biotechnol. 2017;101:4033–40. galactaric acid. 8. Mojzita D, Wiebe M, Hilditch S, Boer H, Penttilä M, Richard P. Metabolic Galactaric acid crystals were collected by fltration engineering of fungal strains for conversion of d-galacturonate to meso- through Whatman GF/A flter paper. For large volumes, galactarate. Appl Environ Microbiol. 2010;76:169–75. 9. Wiebe MG, Mojzita D, Hilditch S, Ruohonen L, Penttilä M. Bioconversion the crystals were frst allowed to settle to the bottom of of d-galacturonate to keto-deoxy-l-galactonate (3-deoxy-l-threo-hex- the container and the clear liquid decanted to a clean ves- 2-ulosonate) using flamentous fungi. BMC Biotechnol. 2010;10:63. sel. Te decanted liquid was expected to contain some 10. Kuivanen J, Wang Y-MJ, Richard P. Engineering Aspergillus niger for galactaric acid production: elimination of galactaric acid catabolism by using galactaric acid and was returned to the cold to allow fur- RNA sequencing and CRISPR/Cas9. Microb Cell Fact. 2016;15:210. ther crystal formation, precipitation and collection. Te 11. Formenti LR, Nørregaard A, Bolic A, Hernandez DQ, Hagemann T, Heins process was repeated twice for the 1 L culture superna- AL, Larsson H, Mears L, Mauricio-Iglesias M, Krühne U, Gernaey KV. Chal- lenges in industrial fermentation technology research. Biotechnol J. tant and four times for the 10 and 250 L volumes. 2014;9:727–38. 12. Running JA, Bansal K. Oxygen transfer rates in shaken culture ves- Biomass determination sels from Fernbach fasks to microtiter plates. Biotechnol Bioeng. 2016;113:1729–35. Mycelia were collected by fltration through Whatman 13. Linde T, Hansen NB, Lübeck M, Lübeck PS. Fermentation in 24-well plates GF/B flters under vacuum and washed twice with an is an efcient screening platform for flamentous fungi. Lett Appl Micro- biol. 2014;59:224–30. equal or greater volume of distilled H 2O. Mycelia were 14. Dana CM, Dotson-Fagerstrom A, Roche CM, Kal SM, Chokhawala HA, dried to a constant weight at 105 °C. Blanch HW, Clark DS. The importance of pyroglutamate in cellulase Cel7A. Authors’ contributions Biotechnol Bioeng. 2014;111:842–7. AH carried out all work related to scaling down the process (transformations 15. Landowski CP, Mustalahti E, Wahl R, Croute L, Sivasiddarthan D, Wester- and 24-well plate cultivations). TP carried out the scaling up cultivations. MW holm-Parvinen A, Sommer B, Ostermeier C, Helk B, Saarinen J, Saloheimo designed the study, supervised the scaling-up and carried out HPLC analysis M. Enabling low cost biopharmaceuticals: high level interferon alpha-2b and DSP. MW and AH drafted the manuscript. All authors read and approved production in Trichoderma reesei. Microb Cell Fact. 2016;15:104. the fnal manuscript. 16. Nguyen EV, Imanishi SY, Haapaniemi P, Yadav A, Saloheimo M, Corthals GL, Pakula TM. Quantitative site-specifc phosphoproteomics of Tricho- derma reesei signaling pathways upon induction of hydrolytic enzyme Acknowledgements production. J Proteome Res. 2016;15:457–67. We thank Merja Aarnio for technical assistance. 17. Li J, Wang J, Wang S, Xing M, Yu S, Liu G. Achieving efcient protein expression in Trichoderma reesei by using strong constitutive promoters. Competing interests Microb Cell Fact. 2012;11:84. The authors declare that they have no competing interests. 18. Kuorelahti S, Kalkkinen N, Penttilä M, Londesborough J, Richard P. Iden- tifcation in the mold Hypocrea jecorina of the frst fungal d-galacturonic Availability of data and materials acid reductase. Biochemistry. 2005;44:11234–40. The datasets used and analysed during the current study are available from 19. Gietz RD, Woods RA. Transformation of yeast by lithium acetate/single- the corresponding author on reasonable request. stranded carrier DNA/polyethylene glycol method. Guid Yeast Genet Mol Cell Biol Pt B. 2002;350:87–96. Paasikallio et al. Microb Cell Fact (2017) 16:119 Page 11 of 11

20. Korppoo A. Development of the CRISPR/Cas9 method for use in T. reesei. 22. Penttilä M, Nevalainen H, Rättö M, Salminen E, Knowles J. A versatile University of Helsinki; 2017. https://helda.helsinki.f/bitstream/han- transformation system for the cellulolytic flamentous fungus Tricho- dle/10138/175220/developm.pdf?sequence 1. Accessed 19 Mar 2017. derma reesei. Gene. 1987;61:155–64. 21. Gruber F, Visser J, Kubicek CP, Degraaf LH. The= development of a heter- ologous transformation system for the cellulolytic fungus Trichoderma reesei based on a pyrg-negative mutant strain. Curr Genet. 1990;18:71–6.

Submit your next manuscript to BioMed Central and we will help you at every step: • We accept pre-submission inquiries • Our selector tool helps you to ﬁnd the most relevant journal • We provide round the clock customer support • Convenient online submission • Thorough peer review • Inclusion in PubMed and all major indexing services • Maximum visibility for your research

Submit your manuscript at www.biomedcentral.com/submit