Supplementary Material

Algae 2016, 31(4): 303-315 https://doi.org/10.4490/algae.2016.31.10.22 Open Access

Supplementary Table S1. Specific primer sequences of different molecular markers used in this study Region Primer name Primer sequence Reference SSU g01 CACCTGGTTGATCCTGCCAG Rintoul et al. (1999) g07 AGCTTGATCCTTCTGCAGGTTCACCTAC c18s5 GAATTGCCGCTTGTGGTGAA This study c18s3 ACGACTTCTCCTTCCTCTAAACG rbcL Comp1 GAATCTTCTACAGCAACTTGGAC Rintoul et al. (1999) Comp2 GCATCTCTTATTATTTGAGGACC psbA psbAF ATGACTGCTACTTTAGAAAGACG Yoon et al. (2002) psbAR2 TCATGCATWACTTCCATACCTA UPA p23SrV-f1 GGACAGAAAGACCCTATGAA Sherwood and Presting (2007) p23SrV-r1 TCAGCCTGTTATCCCTAGAG

COI Ga2F1 TCAACAAATCATAAAGATATTGG Müller et al. (2001)

Ga2R1 ACTTCTGGATGTCCAAAAAAYCA SSU, small subunit rDNA; rbcL, ribulose-1,5-bisphosphate carboxylase-oxygenase large-subunit gene; psbA, photosystem II reaction center protein D1; UPA, 23S ribosomal RNA gene; COI, cytochrome c oxidase subunit I.

Supplementary Table S2. Specimen information of sequences downloaded from the GenBank database Taxon Distribution Morphology type rbcL COI SSU Reference Compsopogon caeruleus Australia Caeruleus JX028148 JX028189 AY617150 West et al. (2005), (Balbis ex C. Agardh) Necchi et al. (2013) Montagne AT Compsopogon caeruleus Australia Caeruleus AF460220 - - West et al. (2005) AU-W Compsopogon caeruleus Brazil Caeruleus JX028149 - - Necchi et al. (2013) BR-CO Compsopogon caeruleus Brazil Leptoclados JX028165 JX028184 JX511996 Necchi et al. (2013) BR-CI Compsopogon caeruleus Brazil Caeruleus JX028150 JX028172 JX511997 Necchi et al. (2013) BR-ES3 Compsopogon caeruleus Brazil Caeruleus JX028151 JX028173 JX511998 Necchi et al. (2013) BR-ES6 Compsopogon caeruleus Brazil Caeruleus JX028152 JX028174 - Necchi et al. (2013) BR-ES7 Compsopogon caeruleus Brazil Caeruleus JX028153 JX028175 JX511999 Necchi et al. (2013) BR-ES10 Compsopogon caeruleus Brazil Caeruleus JX028154 JX028176 JX512000 Necchi et al. (2013) BR-PE Compsopogon caeruleus Brazil Caeruleus JX028155 JX028177 JX512001 Necchi et al. (2013) BR-PG2 Compsopogon caeruleus Brazil Caeruleus JX028156 JX028178 JX512002 Necchi et al. (2013) BR-SE4 Compsopogon caeruleus Germany Caeruleus DQ308425 - AJ880416 Yoon et al. (2006), DE Hoef-Emden et al. (2005) Compsopogon caeruleus Spain Caeruleus JX028157 JX028191 - Necchi et al. (2013) ES-209 Compsopogon caeruleus Spain Caeruleus JX028158 - - Necchi et al. (2013) ES-210 Compsopogon caeruleus Spain Caeruleus JX028159 - - Necchi et al. (2013) ES-211 Compsopogon caeruleus Guam Caeruleus JX028160 JX028182 - Necchi et al. (2013) GU Compsopogon caeruleus Japan Caeruleus DQ308426 - - Yoon et al. (2006) JP

Supplementary Table S2. Continued Taxon Distribution Morphology type rbcL COI SSU Reference Compsopogon caeruleus USA Caeruleus JX028161 JX028179 AF087124 Rintoul et al. (1999), US-FL Necchi et al. (2013) Compsopogon caeruleus USA Caeruleus AF087114 - - Rintoul et al. (1999) US-FLa Compsopogon caeruleus USA Caeruleus JX028162 - - Necchi et al. (2013) US-H17 Compsopogon caeruleus USA Caeruleus - HQ423112 - Sherwood et al. (2010) US-Hlm Compsopogon caeruleus USA Caeruleus AF087116 - - Rintoul et al. (1999) US-LAa Compsopogon caeruleus USA Caeruleus JX028163 JX028180 - Necchi et al. (2013) US-VA Compsopogon caeruleus AQUA Leptoclados JX028164 JX028183 - Necchi et al. (2013) AQUA Compsopogon caeruleus Brazil Leptoclados JX028166 JX028185 - Necchi et al. (2013) BR-CL Compsopogon caeruleus Western Pacific Leptoclados JX028167 JX028186 - Necchi et al. (2013) FM Compsopogon caeruleus USA Leptoclados JX028168 JX028187 - Necchi et al. (2013) US-HI11 Compsopogon caeruleus USA Leptoclados AF087115 - AF087125 Rintoul et al. (1999) US-HIk Compsopogon caeruleus USA Leptoclados JX028169 JX028188 AF087128 Necchi et al. (2013) US-LA Compsopogon caeruleus USA Leptoclados AF087120 - AF087123 Rintoul et al. (1999) US-NM Compsopogon caeruleus Vanuatu Leptoclados JF292657 JX028181 - Zuccarello et al. (2011), VU-4530 Necchi et al. (2013) Compsopogon caeruleus Vanuatu Leptoclados - JX028193 - Necchi et al. (2013) VU-4531 Compsopogon caeruleus Australia - JX028170 JX028190 - Necchi et al. (2013) AU-VIC Compsopogon caeruleus Venezuela - JX028171 JX028192 - Necchi et al. (2013) VE Compsopogon caeruleus Saint Lucia, - - - AF087127 Rintoul et al. (1999) Saint Lucia North Pacific Compsopogon caeruleus USA - - - AF342748 Müller et al. (2011) SAG B36.94 Boldia sp. CRON Canada - - HQ699256 AF168631 Müller et al. (2011) Boldia erythrosiphon USA - - - AF055299 Holton et al. (1998) Herndon Porphyridium purpureum - - DQ308439 - - Yoon et al. (2006) (Bory) K. M. Drew & R. Ross strain CCMP1328 Porphyridium sordidum - - DQ308440 - - Yoon et al. (2006) Geitler strain FD Ott O250 Porphyridium aerugineum - - AY119775 - - Yoon et al. (2002) Geitler Batrachospermum Hong- China - HQ677187 KC511071 KC511081 Ji et al. (2014) dongense S. L. Xie & J. Feng Batrachospermum longi- China - HQ677188 KC511072 KC511082 Ji et al. (2014) pedicellatum Hua & Shi Sheathia arcuate (Kylin) China - JN086522 KC511075 KC511083 Ji et al. (2014) Salomaki & M. L. Vis Batrachospermum China - Unpublished Unpublished Unpublished Previous study gelatinosum (Linnaeus) De Candolle Batrachospermum Canada - - - AF026045 Vis et al. (1998) gelatinosum Batrachospermum USA - - - AF026049 Vis et al. (1998) turfosum Bory Batrachospermum USA - - - AF026048 Vis et al. (1998) macrosporum Montagne Kumanoa procarpa (Skuja) Brazil - - - FJ386484 Entwisle et al. (2009) Entwisle, M. L. Vis, W. B. Chiasson, Necchi & A. R. Sherwood

https://doi.org/10.4490/algae.2016.31.10.22 2 Nan et al. Evolutionary History of Compsopogon

Supplementary Table S2. Continued Taxon Distribution Morphology type rbcL COI SSU Reference Kumanoa ambigua (Montagne) French - - - FJ386483 Entwisle et al. (2009) Entwisle, M. L. Vis, W. B. Chias- son, Necchi & A. R. Sherwood Kumanoa curvata (Z. -X. Shi) M. China - KC511077 KC511073 KC511079 Ji et al. (2014) L. Vis, Necchi, W. B. Chiasson & Entwisle Kumanoa intorta (C. -C. Jao) China - JQ028695 KC511074 - Ji et al. (2014) Entwisle, M. L. Vis, W. B. Chias- son, Necchi & A. R. Sherwood Thorea hispida (Thore) Desvaux China - KC511078 KC511076 KC511084 Ji et al. (2014) Thorea sp. China - JN707694 unpublished JN707695 Previous study Thorea violacea Bory USA - - - AF026042 Previous study Bangia sp. Canada - JN028992 - - Previous study Bangia atropurpurea (Mertens - - - - AF169340 Müller et al. (1998) ex Roth) C. Agardh isolate AT22 Cryptomonas sp. Australia - AM051217 HE855366 KF907373 Choi et al. (2013) “-” denotes no related information for the specimen (for UPA and psbA, GenBank accession numbers are labeled next to the taxa in the phylogenetic trees). rbcL, ribulose-1,5-bisphosphate carboxylase-oxygenase large-subunit gene; COI, cytochrome c oxidase subunit I; SSU, small subunit rDNA; UPA, 23S ribosomal RNA gene; psbA, photosystem II reaction center protein D1.

Supplementary Table S3. Substitution models obtained for each gene sequence using Modeltest 3.7 analysis Molecular marker Model selected Base frequency Rate matrix rbcL GTR + I + G freqA = 0.2834 R(a)[A-C] = 2.1125 -lnL = 5,873.5200 freqC = 0.1641 R(b)[A-G] = 6.4252 K = 10 freqG = 0.2252 R(c)[A-T] = 10.4602 (I) = 0.4907 freqT = 0.3272 R(d)[C-G] = 3.2922 R(e)[C-T] = 20.7474 R(f)[G-T] = 1.0000 (G) = 7.5943

COI K81uf + G freqA = 0.2746 R(a)[A-C] = 1.0000 -lnL = 2,767.8594 freqC = 0.1371 R(b)[A-G] = 6.3946 K = 6 freqG = 0.1686 R(c)[A-T] = 2.7199 (I) = 0 freqT = 0.4198 R(d)[C-G] = 2.7199 R(e)[C-T] = 6.3946 R(f)[G-T] = 1.0000 (G) = 0.3249

SSU TrN + G freqA = 0.2394 R(a)[A-C] = 1.0000 -lnL = 9,362.4746 freqC = 0.2097 R(b)[A-G] = 1.9169 K = 6 freqG = 0.2870 R(c)[A-T] = 1.0000 (I) = 0 freqT = 0.2639 R(d)[C-G] = 1.0000 (G) = 0.3885 R(e)[C-T] = 3.5018 R(f)[G-T] = 1.0000

Combination GTR + G freqA = 0.2567 R(a)[A-C] = 1.1499 -lnL = 11,211.8916 freqC = 0.1846 R(b)[A-G] = 3.0320 K = 9 freqG = 0.2529 R(c)[A-T] = 4.0834 (I) = 0 freqT = 0.3057 R(d)[C-G] = 1.8298 R(e)[C-T] = 7.2158 R(f)[G-T] = 1.0000 (G) = 0.3594

UPA GTR + I + G freqA = 0.2637 R(a)[A-C] = 0.6887 -lnL = 1,688.7517 freqC = 0.1824 R(b)[A-G] = 11.9902 K = 10 freqG = 0.2969 R(c)[A-T] = 15.0786 (I) = 0.3800 freqT = 0.2570 R(d)[C-G] = 1.4730 R(e)[C-T] = 41.1570 R(f)[G-T] = 1.0000 (G) = 0.9387

psbA GTR + I + G freqA = 0.2633 R(a)[A-C] = 0.7737 -lnL = 6,705.5586 freqC = 0.1584 R(b)[A-G] = 6.0969 K = 10 freqG = 0.1992 R(c)[A-T] = 7.2964 (I) = 0.5144 freqT = 0.3791 R(d)[C-G] = 2.0741 R(e)[C-T] = 16.7819 (G) = 2.2373 R(f)[G-T] = 1.0000 rbcL, ribulose-1,5-bisphosphate carboxylase-oxygenase large-subunit gene; COI, cytochrome c oxidase subunit I; SSU, small subunit rDNA; UPA, 23S ribosomal RNA gene; psbA, photosystem II reaction center protein D1.

3 http://e-algae.org Algae October 22, 2016 [Epub ahead of print]

Supplementary Fig. S1. Phylogenetic tree based on the rbcL sequences. rbcL, ribulose-1,5-bisphosphate carboxylase-oxygenase large- subunit gene.

Supplementary Fig. S2. Phylogenetic tree based on the COI sequences. COI, cytochrome c oxidase subunit I.

https://doi.org/10.4490/algae.2016.31.10.22 4 Nan et al. Evolutionary History of Compsopogon

Supplementary Fig. S3. Phylogenetic tree based on the SSU sequences. SSU, small subunit rDNA.

Supplementary Fig. S4. Phylogenetic tree based on the UPA sequences. UPA, 23S ribosomal RNA gene.

5 http://e-algae.org Algae October 22, 2016 [Epub ahead of print]

Supplementary Fig. S5. Phylogenetic tree based on the psbA sequences. psbA, photosystem II reaction center protein D1.

Supplementary Fig. S6. Divergence time estimation tree based on the SSU sequences. SSU, small subunit rDNA.

https://doi.org/10.4490/algae.2016.31.10.22 6 Nan et al. Evolutionary History of Compsopogon

REFERENCES Rintoul, T. L., Sheath, R. G. & Vis, M. L. 1999. Systematics and biogeography of the Compsopogonales (Rhodophyta) Choi, B., Son, M., Kim, J. I. & Shin, W. 2013. Taxonomy and with emphasis on the freshwater families in North phylogeny of the genus Cryptomonas (Cryptophyceae, America. Phycologia 38:517-527. Cryptophyta) from Korea. Algae 28:307-330. Sherwood, A. R., Kurihara, A., Conklin, K. Y. & Presting, G. Entwisle, T. J., Vis, M. L., Chiasson, W. B., Necchi, O. Jr. & Sher- C. 2010. The Hawaiian Rhodophyta Biodiversity Sur- wood, A. R. 2009. Systematics of the Batrachospermales vey (2006-2010): a summary of principal findings. BMC (Rhodophyta): a synthesis. J. Phycol. 45:704-715. Plant Biol. 10:258. Hoef-Emden, K., Shrestha, R. P., Lapidot, M., Weinstein, Y., Sherwood, A. R. & Presting, G. G. 2007. Universal primers Melkonian, M. & Arad, S. M. 2005. Actin phylogeny and amplify a 23s rDNA plastid marker in eukaryotic algae intron distribution in bangiophyte red algae (Rhodo- and cyanobacteria. J. Phycol. 43:605-608. plantae). J. Mol. Evol. 61:360-371. Vis, M. L., Saunders, G. W., Sheath, R. G., Dunse, K. & Entwisle, Holton, R. W., Boele-Bos, S. A. & Stam, W. T. 1998. Phyloge- T. J. 1998. Phylogeny of the Batrachospermales (Rho- netic relationships of the freshwater alga Boldia erythro- dophyta) inferred from rbcL and 18S ribosomal DNA siphon (Compsopogonales, Rhodophyta) based on 18S gene sequences. J. Phycol. 34:341-350. rRNA gene sequences. J. Phycol. 34:555-557. West, J. A., Zuccarello, G. C., Scott, J., Pickett-Heaps, J. & Kim, Ji, L., Xie, S. -L., Feng, J., Chen, L. & Wang, J. 2014. Molecular G. H. 2005. Observations on Purpureofilum apyrenoi- systematics of four endemic Batrachospermaceae (Rho- digerum gen. et sp. nov. from Australia and Bangiopsis dophyta) species in China with multilocus data. J. Syst. subsimplex from India (Stylonematales, Bangiophyceae, Evol. 52:92-100. Rhodophyta). Phycol. Res. 53:49-66. Müller, K. M., Oliveira, M. C., Sheath, R. G. & Bhattacharya, D. Yoon, H. S., Hackett, J. D. & Bhattacharya, D. 2002. A single 2001. Ribosomal DNA phylogeny of the Bangiophycidae origin of the peridinin- and fucoxanthin-containing (Rhodophyta) and the origin of secondary plastids. Am. plastids in dinoflagellates through tertiary endosymbio- J. Bot. 88:1390-1400. sis. Proc. Natl. Acad. Sci. U. S. A. 99:11724-11729. Müller, K. M., Sheath, R. G., Vis, M. L., Crease, T. J. & Cole, K. Yoon, H. S., Müller, K. M., Sheath, R. G., Ott, F. D. & Bhat- M. 1998. Biogeography and systematics of Bangia (Ban- tacharya, D. 2006. Defining the major lineages of red al- giales, Rhodophyta) based on the Rubisco spacer, rbcL gae (Rhodophyta). J. Phycol. 42:482-492. gene and 18S rRNA gene sequences and morphometric Zuccarello, G. C., Yoon, H. S., Kim, H., Sun, L., de Goër, S. L. analyses. 1. North America. Phycologia 37:195-207. & West, J. A. 2011. Molecular phylogeny of the upright Necchi, O. Jr., Fo, A. S. G., Salomaki, E. D., West, J. A., Aboal, erythropeltidales (Compsopogonophyceae, Rhodophy- M. & Vis, M. L. 2013. Global sampling reveals low genet- ta): multiple cryptic lineages of Erythrotrichia carnea. J. ic diversity within Compsopogon (Compsopogonales, Phycol. 47:627-637. Rhodophyta). Eur. J. Phycol. 48:152-162.

7 http://e-algae.org