Article
Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling
Graphical Abstract Authors Kate L. White, Matthew T. Eddy, Zhan-Guo Gao, ..., A AR A AR-D2.50N Kenneth A. Jacobson, 2A 2A Vsevolod Katritch, Raymond C. Stevens
Na+ Na+ Na+ Na+ Correspondence Na+ Na+ Na+ Na+ [email protected] II II In Brief White and Eddy et al. report agonist- V Na+ I V I bound structures of human A2AAR variants that disrupt allosteric sodium VI VII VII effects. The structures reveal changes in VI hydrogen bonding near a conserved III III activation motif that correspond to VIII VIII striking differences in signaling, providing Na+ Na+ G-protein Na+ Na+ a rationale for increased variant receptor Na+ Na+ stability.
Highlights 2.50 3.39 d X-ray structures of A2AAR variants D N and S A agonist complexes
2.50 d A2AAR-D N shows striking loss of G-protein signaling d Structural changes near activation motif correspond to loss of signaling d D2.50N improves GPCR stability for accelerating drug discovery
White et al., 2018, Structure 26, 1–11 February 6, 2018 ª 2018 Elsevier Ltd. https://doi.org/10.1016/j.str.2017.12.013 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013 Structure Article
Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling
Kate L. White,1,3 Matthew T. Eddy,1,3 Zhan-Guo Gao,2 Gye Won Han,1 Tiffany Lian,1 Alexander Deary,1 Nilkanth Patel,1 Kenneth A. Jacobson,2 Vsevolod Katritch,1 and Raymond C. Stevens1,4,* 1Departments of Biological Sciences and Chemistry, Bridge Institute, USC Michelson Center, University of Southern California, 1002 West Childs Way, Los Angeles, CA 90089, USA 2Laboratory of Bioorganic Chemistry, NIDDK, National Institutes of Health, Bethesda, MD 20892, USA 3These authors contributed equally 4Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.str.2017.12.013
SUMMARY Tera´ n et al., 2013), dopamine receptors (Neve, 1991), and others as reviewed in the literature (Katritch et al., 2014). Sodium ions are endogenous allosteric modulators Allosteric effects of sodium have been found to be largely of many G-protein-coupled receptors (GPCRs). Mu- mediated by the negatively charged residue D2.50 (Ceresa and tation of key residues in the sodium binding motif Limbird, 1994; Fenalti et al., 2014; Katritch et al., 2014; Liu causes a striking effect on G-protein signaling. We et al., 2012; Massink et al., 2015; Werling et al., 1986) located report the crystal structures of agonist complexes in transmembrane helix II (superscripts indicate the Balles- for two variants in the first sodium coordination teros-Weinstein nomenclature; Ballesteros and Weinstein, 1995). D2.50 is one of the most highly conserved amino acids in shell of the human A2A adenosine receptor, 2.50 2.50 3.39 class A GPCRs (Katritch et al., 2014). Replacement of D D52 N and S91 A. Both structures present an with a neutral amino acid diminished the ability of sodium to overall active-like conformation; however, the vari- compete with agonist binding and concurrently affected G-pro- ants show key changes in the activation motif tein signaling for more than 25 different GPCRs (Hishinuma et al., NPxxY. Changes in the hydrogen bonding network 2017; Katritch et al., 2014). In the d-opioid receptor (DOR), a D2.50 in this microswitch suggest a possible mechanism variant switched the efficacy of an antagonist to an arrestin- for modified G-protein signaling and enhanced ther- biased agonist (Fenalti et al., 2014). For the human A2A adeno- 2.50 mal stability. These structures, signaling data, and sine receptor (A2AAR), replacement of D with alanine thermal stability analysis with a panel of pharmaco- completely abolished G-protein-dependent signaling (Massink et al., 2015). logical ligands provide a basis for understanding 2.50 the role of the sodium-coordinating residues on sta- D forms the core of a cluster of residues that coordinate a sodium ion that was first observed in a high-resolution crystal bility and G-protein signaling. Utilizing the D2.50N structure of A2AAR in complex with an antagonist (Liu et al., variant is a promising method for stabilizing class 2012) and subsequently observed in a DOR-antagonist complex A GPCRs to accelerate structural efforts and drug (Fenalti et al., 2014). In those structures, other residues coordi- discovery. nating sodium are S3.39, which also directly coordinates sodium, and W6.48,N7.49,N7.45, and S7.46, which indirectly coordinate so- dium through a network of water molecules (Figure 1). All of these INTRODUCTION sodium-coordinating residues are highly conserved among class
A GPCRs (Katritch et al., 2014). In A2AAR, replacement of any of Endogenous allosteric modulators of G-protein-coupled recep- these sodium pocket residues with alanine altered agonist- tors (GPCRs) are important effectors of receptor signaling and induced G-protein signaling (Massink et al., 2015). include lipids, ions, and intracellular proteins (Changeux and Sodium-coordinating residues also strongly influence thermal Christopoulos, 2016; van der Westhuizen et al., 2015). In partic- unfolding temperatures of GPCRs. Replacement of one or more ular, sodium ions have been proposed to be an endogenous of the sodium-coordinating residues increased denaturation tem- allosteric modulator for many GPCRs (Katritch et al., 2014). Ob- peratures for several GPCRs, including the neurotensin receptor servations in mouse brain extracts over 40 years ago first (NTSR1) (Shibata et al., 2009), k-opioid receptor (KOR) (Schutz demonstrated the allosteric effects of sodium on opioid recep- et al., 2016), and a1a adrenergic receptor (Dodevski and Pluck- tors (Pert et al., 1973). Since those initial observations, sodium’s thun, 2011). For the purinergic P2Y1 receptor (P2Y1R), replace- allosteric effects have been reported from in vitro and in vivo ment of an endogenous D7.49 with asparagine improved assays for over 15 GPCRs, including adrenergic receptors (Cer- protein expression yield and was required for crystallization of a esa and Limbird, 1994), adenosine receptors (Gutie´ rrez-de- P2Y1R-antagonist complexes (Zhang et al., 2015a). Recently,
Structure 26, 1–11, February 6, 2018 ª 2018 Elsevier Ltd. 1 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
AB to directly coordinate the sodium ion (Figure 1)(Liu et al., 2012). Thus, we focused on variants of these two residues in the current
study. We measured ligand binding with A2AAR and the variants A2AAR D52N and A2AAR S91A with the antagonist ZM241385 and agonist NECA (Table 1). A2AAR, A2AAR D52N, and A2AAR S91A all showed similar affinity for the antagonist ZM241385 and agonists CGS21680 and UK432097 (Table 1 and Figure 2A). Affinity of the agonist NECA was slightly higher
for the A2AAR D52N variant (KD 9.16 nM, logKD 8.03 ± 0.10) relative to A2AAR (KD 23.4 nM, logKD 7.63 ± 0.11) and A2AAR S91A (KD 132 nM, logKD 6.88 ± 0.08). To investigate the allosteric role of sodium on agonist binding, we performed the same binding assays in the presence of a physiologically relevant sodium concentration (150 mM). The presence of so- Figure 1. Allosteric Sodium Binding Pocket and Sodium-Coordi- dium decreased the affinity of the agonist NECA for A AR and ˚ 2A nating Residues in the 1.8 A A2AAR Crystal Structure had no effect on agonist affinity for A2AAR D52N and (A) Side view of the overall crystal structure of A2AAR in complex with the A2AAR S91A (Table 1). antagonist ZM241385. A2AAR is shown as a cartoon representation and ZM241385 is shown as a blue stick representation (PDB: 4EIY) (Liu et al., We examined G-protein signaling for the A2AAR variants by 2012). Water molecules are shown as red spheres and sodium is shown as a measuring cAMP accumulation via receptor activation upon blue sphere. stimulation with the agonist UK432097. A2AAR D52N evi- (B) Expansion of the allosteric sodium pocket. Sodium is shown near the denced no cAMP accumulation upon UK432097 stimulation, center as a blue sphere and water molecules are shown as red spheres. similar to what was observed with A2AAR D52A in an earlier Residues coordinating with the sodium ion or nearby water molecules are labeled. Dashed lines indicate polar contacts and helices are labeled with report (Massink et al., 2015), while A2AAR S91A had similar Roman numerals. activity to A2AAR (Figure 2B and Table 1). While A2AAR S91A signaling was previously found to have higher basal and lower
Emax signaling upon CGS21680 agonist stimulation (Massink observations in A2AAR by nuclear magnetic resonance (NMR) et al., 2015), differences reported here may be due to using spectroscopy showed that replacement of D2.50 with asparagine different cell types, agonists, and assay conditions (for example, drastically altered conformational dynamics at the A2AAR intracel- adenosine deaminase was included in our experiments to elimi- lular surface without altering the receptor’s conformation at the nate the influence of endogenous adenosine). extracellular surface (Eddy et al., 2017).
Motivated by these numerous observations, we sought to pro- Crystal Structures of A2AAR Sodium-Site Variants in vide a structural basis for how the sodium-coordinating residues Complex with an Agonist Present an Overall Active-like regulate G-protein signaling and affect denaturation tempera- Conformation tures of human A2AAR. A2AAR is a validated drug target for Par- We determined the crystal structures of A2AAR D52N and kinson’s disease (Cieslak et al., 2008) and chronic obstructive A2AAR S91A in complex with the full agonist UK432097. To pulmonary disease (Bonneau et al., 2006) and a promising target compare these structures with the previously published crystal for cancer co-immunotherapies (Leone et al., 2015). Thus, the structure of A2AAR in complex with the agonist UK432097 role of the allosteric sodium site in A2AAR drug discovery is of (A2AAR UK432097; PDB: 3QAK) (Xu et al., 2011), we employed relevant interest. We determined crystal structures of A2AAR a nearly identical construct, where the A2AAR third intracellular variants D2.50N and S3.39A in complex with the full agonist loop (ICL3) was replaced with T4 lysozyme (T4L) to facilitate UK432097 at 2.6 and 2.9 A˚ resolution, respectively (Figure 2). crystallization (Xu et al., 2011). The only change effected to this Comparison of the structures was complemented by protein earlier construct was the single amino acid replacement, D52N thermal stability and cAMP signaling assays, which showed sig- or S91A. To ensure the crystallization constructs have binding af- nificant differences among the A2AAR variants. As the residues finities similar to those of A2AAR and A2AAR variants without the comprising the allosteric sodium pocket are highly conserved, T4L ICL3 fusion, we determined the affinity of the agonists these data likely provide fresh insights into regulation of G-pro- CGS21680 and UK432097 prior to crystallization. A2AAR, tein signaling by allosteric sodium-coordinating residues for A2AAR D52N T4L, and A2AAR S91A T4L all had very similar many class A GPCRs and provide new tools for GPCR drug dis- affinities (KD) for CGS21680, 13.6 ± 3.1, 12.0 ± 3.6, and covery. Our results suggest utility for the D2.50N variant as an 10.0 ± 4.9 nM, respectively (Table 1). The agonist UK432097, exciting approach for accelerated crystallization and drug- co-crystallized in complex with each construct, also showed screening efforts for class A GPCRs. similar affinities (Ki) for A2AAR, A2AAR D52N T4L, and A2AAR S91A T4L: 17.3 ± 5.9, 25.2 ± 3.5, and 20.0 ± 3.7 nM, RESULTS respectively (Table 1).
Crystallization of A2AAR D52N T4L and A2AAR S91A T4L Functional Characterization of A2AAR Sodium-Site bound to the agonist UK432097 was carried out in lipid cubic Variants phase (LCP) (Caffrey and Cherezov, 2009)(Figure S1), and the In the high-resolution crystal structure of antagonist-bound structures were refined to a final resolution of 2.6 and 2.9 A˚ , 2.50 3.39 A2AAR, D52 and S91 were the only two residues observed respectively (Figures 2C–2H). Direct structural comparisons
2 Structure 26, 1–11, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
G protein Signaling Figure 2. Functional and Structural Compar- ABUK432097 Binding 125 (Agonist) 150 isons of A2AAR with the Variants A2AAR– D52N and A2AAR–S91A 100 100 Control (A and B) UK432097 competition binding with [3H] 75 50 A2AAR wild-type CGS21680 (A) and cAMP accumulation upon A AR D52N 50 2A 0 stimulation with UK432097 (B). Data in (A) and (B) A AR S91A 2A are shown as means ± SD. Experiments were 25 -50 Agonist efficacy %
H]CGS21680 binding % conducted three times, each in triplicate. A2AAR is 3 [ 0 -100 -10 -8 -6 -4 -14 -12 -10 -8 -6 shown in gray, A2AAR D52N is shown in green, log [UK432097], M log [UK432097], M and A2AAR S91A is shown in blue. (C–E) Superposition of side views of the overall CDD52N–UK432097 (agonist) D52N–UK432097 (agonist) E D52N–UK432097 (agonist) structure of D52N UK432097 (green) with A AR–ZM241385 (antagonist) 2A A2AAR–UK432097 (agonist) S91A–UK432097 (agonist) (C) A2AAR ZM241385 (yellow; PDB: 3EML),
(D) A2AAR UK432097 (gray; PDB: 3QAK), and (E) S91A UK432097 (blue). The dashed line be- tween helices V and VI indicates the position of the T4L fusion protein. Ligands are colored as fol- lows: ZM241385 in orange, UK432097 bound to D52N UK432097 in purple, UK432097 bound to
A2AAR in cyan, and UK432097 bound to S91A UK432097 in yellow. (F–H) Intracellular views of D52N UK432097
superimposed on (F) A2AAR ZM241385, (G) FGH A2AAR UK432097, and (H) S91A UK432097; with the same coloring scheme used in (C)–(E). VI VII VI VI VII VII Helices are numbered with Roman numerals. In (F), VIII VIII V VIII V V arrows indicate rearrangements in the positions of helices at the intracellular surface between III III III A2AAR ZM241385 and D52N UK432097. I I I See also Figures S1 and S2 and Table 2. II II II IV IV IV
were made only for constructs that have this identical T4L fusion (A2AAR UK432097; PDB: 3QAK) (Xu et al., 2011) showed that partner for consistency and to remove the possibility of the overall structure of the variant protein presented hallmarks of introducing bias by using different fusion partners. Throughout an active-like state (Figures 2C and 2D). Specifically, the the article, we refer to the co-crystal structures of UK432097 positions of helices at the intracellular surface of the bound to A2AAR D52N T4L and A2AAR S91A T4L as D52N UK432097 complex were displaced from the antago- D52N UK432097 and S91A UK432097, respectively. nist-bound structure in the same directions expected for an Comparing the structure of the agonist-bound D52N active-like conformation. The alignment of D52N UK432097
UK432097 complex with the previously published structures and A2AAR ZM241385 was performed after removal of fusion of A2AAR T4L in complex with the antagonist ZM241385 partner atoms and the root-mean-square deviation (RMSD) ˚ (A2AAR ZM241385; PDB: 3EML) (Jaakola et al., 2008) was 1.33 A (264 aligned Ca atoms). Furthermore, the super- and A22AAR T4L in complex with the agonist UK432097 position of D52N UK432097 and A2AAR UK432097 revealed
Table 1. Radioligand Binding and G Protein Signaling Effects of A2AAR Variants 3 3 3 3 KD [ H]ZM241385 KD [ H]NECA, 0 mM KD [ H]NECA, 150 mM KD [ H]CGS21680 Ki UK432097 EC50 UK432097
Receptor (nM)/logKD NaCl (nM)/logKD NaCl (nM)/logKD (nM) (nM) (nM)
A2AAR 7.69 nM 23.4 nM 290 nM 13.6 ± 3.1 17.3 ± 5.9 0.45 ± 0.08 (WT) 8.11 ± 0.06 7.63 ± 0.11 6.5 ± 0.14
A2AAR D52N 9.63 nM 9.16 nM 10.4 nM 7.35 ± 0.30 22.4 ± 2.5 no signaling 8.02 ± 0.05 8.03 ± 0.10 7.98 ± 0.11 a A2AAR S91A 7.0 ± 0.2 nM 132 nM 138 nM 17.3 ± 6.12 14.7 ± 0.7 0.75 ± 0.09 6.88 ± 0.08 6.86 ± 0.07
A2AAR D52N T4L ND ND ND 12.0 ± 3.6 25.2 ± 3.5 ND
A2AAR S91A T4L ND ND ND 10.0 ± 4.9 20.0 ± 3.7 ND
Radioligand binding and G-protein signaling effects of A2AAR variants. ZM241385 and NECA KD measurements were done via homologous competition, and CGS21680 KD measurement was done using saturation binding. Binding assays were carried out in the absence of sodium unless otherwise indi- cated. KD,Ki, and EC50 values were calculated in Prism 7.0 software (GraphPad, San Diego, CA) and data are displayed as means ± SD; three experiments were conducted in triplicate. Error is shown for either nM or logKD depending on assay method as detailed in the STAR Methods. ND, not determined. aDenotes data previously published (Massink et al., 2015).
Structure 26, 1–11, February 6, 2018 3 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
˚ Table 2. Data Collection and Refinement Statistics were very similar to both D52N UK432097 (RMSD 0.44 A, 263 aligned Ca atoms) (Figure 2E and Table 2) and D52N-UK432097 S91A-UK432097 ˚ a PDB: 5WF5 PDB: 5WF6 A2AAR UK432097 (RMSD 0.46 A, 261 aligned C atoms). The density maps of D52N UK432097 and S91A UK432097 are Data Collection shown in Figures S2C and S2D. Number of crystals 24 25
Space group P21 P21 Residues in the NPxxY Motif of D52N–UK432097 Are Cell dimensions Neither in an Entirely Inactive Nor an Active-like a, b, c (A˚ ) 47.69, 77.77, 47.78, 78.22, Conformation 86.49 86.48 The relative side-chain orientations in GPCR microswitches are b ( ) 100.05 101.20 sensitive to differences of the pharmacological efficacies of No. of total reflections 78,572 42,494 bound ligands (Katritch et al., 2013). Rearrangements in side No. of unique 17,786 13,000 chains of the microswitches are thought to precede larger struc- reflections tural rearrangements of helical backbones required for the re- Resolution (A˚ ) 46.80–2.60 44.88–2.90 ceptor to recognize intracellular partner proteins. We compared a a (2.69–2.60) (3.00–2.90) the structures of antagonist-bound A2AAR ZM241385 (PDB: 3EML), agonist-bound A2AAR UK432097 (PDB: 3QAK), and Rsym or Rmerge 0.180 (0.880) 0.218 (0.710) agonist-bound D52N-UK432097 in four conserved structural I/sI 8.1 (1.1) 4.6 (1.3) motifs: the PIF motif formed between helices III, V, and VI; the Completeness (%) 92.3 (69.4) 91.9 (74.5) CWxP motif in helix VI; the DRY motif in helix III; and the NPxxY Redundancy 4.4 (3.0) 3.3 (2.3) motif in helix VII (Figure 3). Strong electron densities in the micro- Highest shell CC1/2 0.50 0.52 switch regions of D52N UK432097 (Figure S2C) allowed us to Refinement confidently compare backbone and side-chain orientations for Resolution (A˚ ) 29.9–2.60 29.49–2.90 residues in these regions. We observed strong overlap between No. of reflections/ 17,709/907 12,850/660 A2AAR UK432097 and D52N UK432097 for three microswitch test set regions: PIF, CWxP, and DRY. Because there was strong agreement in these regions between A2AAR UK432097 and Rwork/Rfree 0.214/0.251 0.254/0.289 D52N-UK432097 (Figures 3A–3C), we concluded that side- No. of atoms chain orientations for D52N UK432097 were in an active-like Protein 3,479 3,405 conformation. UK432097 57 57 Comparing the RMSD in the positions of Ca atoms between Lipids and others 29 11 the structures of A2AAR UK432097 and D52N UK432097 Wilson B factors (A˚ 2) 75.6 92.2 revealed that the largest differences occurred for residues in Average B factors (A˚ 2) the NPxxY motif in helix VII and for residues immediately preced- A2a 82.9 98.7 ing this motif (Figure 4A). The structural rearrangement begins at 7.46 a T4L 80.0 92.5 S281 , which has an altered C position in D52N UK432097 relative to A AR UK432097 of 2.4 A˚ . Furthermore, the Ca po- UK432097 77.3 89.2 2A sitions for several subsequent residues are also altered: Lipids and others 124.8 111.3 V2827.47 by 2.9 A˚ , V2837.48 by 2.2 A˚ , N2847.49 by 1.5 A˚ , and RMSDs P2857.50 by 1.1 A˚ . D52N UK432097 residues S2817.46, Bond lengths (A˚ ) 0.003 0.003 V2827.47, and V2837.48 have side-chain conformations Bond angles ( ) 0.46 0.48 that resemble those for the antagonist-bound receptor 7.49 There were no Ramachandran outliers for any structures. A2AAR ZM241385 (Figures 4B and 4C), and residues N284 aValues in parentheses are for the highest-resolution shell. and P2857.50 are neither in inactive nor in active-like confor- mations. At the end of the NPxxY motif, F2867.51 through Y2887.53, we again observe a strong agreement between an overall strong agreement between the two structures with the agonist-bound structures, A2AAR UK432097 and D52N an RMSD of 0.32 A˚ (263 aligned Ca atoms). Residues in the UK432097, that extends through the conformations of the re- ligand binding pocket and the binding pose of UK432097 ap- maining residues from the intracellular surface to the C terminus peared to be nearly identical between A2AAR UK432097 and (Figure 4A). D52N UK432097 agonist complexes (Figures 2D, S2A, and The structural rearrangement near the NPxxY motif of S2B), indicating the D52N replacement did not interfere with D52N UK432097 was observed in the difference electron- the conformation of the agonist in the binding pocket. density maps (jFoj jFcj) between D52N UK432097 and We also solved a crystal structure of the variant A2AAR S91A A2AAR UK432097 (Figure S2E). The difference electron-density in complex with the agonist UK432097 using the same T4L maps show clear rearrangements near S2817.46, P2857.50, and fusion construct design, referred to as S91A UK432097. Crys- the site of mutation N522.50 (Figure S2E). Similar differences tallization of S91A UK432097 was also performed in LCP (Caf- were observed in the jFoj jFcj maps using the molecular ˚ frey and Cherezov, 2009) and the structure was refined to 2.9 A. replacement solution with A2AAR UK432097 as a search model. The S91A UK432097 also showed active-like features that We observed negative electron densities at S2817.46 and positive
4 Structure 26, 1–11, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
Figure 3. Residues in the NPxxY Motif of D52N–UK432097 Are in Neither an Entirely Inactive Nor an Active-like Conformation Four conserved structural motifs (i.e., microswitches) labeled according to the amino acid types found in each motif: (A) PIF, (B) CWxP, (C) D(E)RY, (D) NPxxY.
Within each panel, a superposition of A2AAR ZM241385 (yellow; PDB: 3EML) with D52N UK432097 (green) is on the left, and a superposition of
A2AAR UK432097 (gray; PDB: 3QAK) with D52N UK432097 (green) is on the right. Amino acids comprising each structural motif are shown in stick representation and labeled by the Ballesteros-Weinstein nomenclature. Positions of the microswitches in the global structures are indicated by boxes in the middle superposition of all three structures. The location of residue D52N is indicated in the global view of the structure and labeled. In addition, the binding sites of the orthosteric ligand (UK432097, cyan sticks), sodium (blue sphere), and G protein are shown in the center composite, where a surface representation of the mini Gas and its contacts with A2AAR from the previously published A2AAR NECA mini Gas complex structure (PDB: 5G35) (Carpenter et al., 2016) are shown. See also Figure S2. electron densities near V2827.47,V2837.48, N2847.49, and P2857.50, hydrogen bonds, while additional hydrogen bonds are formed consistent with our final D52N UK432097 structure (Figure S2F). between N2807.45 and W2466.48 and between D522.50 and In addition, we solved the structure of D52N UK432097 using S913.39 (Figures 5 and S3). By comparison, the overall hydrogen
A2AAR UK432097 or A2AAR ZM241385 as search models and bond network in this region of the agonist-bound variant obtained the same results, confirming that the structural rear- D52N UK432097 is more similar to the antagonist-bound rangements near the NPxxY motif are not due to phase bias. A2AAR ZM241385 inactive state structure than the agonist- 7.46 The two most significant differences between the D52N bound A2AAR UK432097. In D52N UK432097, S281 UK432097 and the S91A UK432097 structures is the rotamer formed a hydrogen bond with N241.50 and formed two hydrogen position of S2817.46 as well as differences in Ca position of res- bonds between N522.50. N522.50 formed a hydrogen bond with idues in the NPxxY motif (Figures S2A–S2D). Because the elec- S913.39; however, the hydrogen bond between N2807.45 and 6.48 tron-density maps were more ambiguous in the NPxxY motif W246 observed in the agonist-bound A2AAR-UK432097 is for the S91A UK432097 structure (Figures S2C and S2D), we absent in the agonist-bound variant D52N UK432097. These limited detailed comparisons of side-chain conformations and results detail consequences of the N522.50 replacement on struc- rotameric states to the A2AAR–ZM241385, A2AAR UK432097, tural rearrangement in helix VII. and D52N UK432097 complexes.
Analysis of A2AAR Thermal Denaturation Temperatures Changes in the Hydrogen Bonding Network Observed Corroborates Prominent Effects of D52 and Influence of among Antagonist-Bound A2AAR–ZM241385, Agonist- Sodium on Agonist Complexes Bound A2AAR–UK432097, and Agonist-Bound D52N– We measured thermal denaturation temperatures (Tm) for A2AAR UK432097 Structures and A2AAR variants in complex with various ligands using a To gain insight into the effects of the D52N amino acid replace- thiol-specific fluorochrome (CPM). This dye produces a signal ment on helix-helix interactions, we investigated the hydrogen when it conjugates to cysteine residues buried in the receptor bond network between helix VII and neighboring helices I, II, III, transmembrane helices that become exposed to an aqueous and VI (Figures 5 and S3), near the site of structural rearrange- environment upon heating the protein (Alexandrov et al., 2008). ment in the D52N UK432097 structure discussed in the above To investigate the effect of the sodium allosteric site on receptor text. In the antagonist-bound structure of A2AAR ZM241385 melting temperatures, we included five A2AAR variants in the 7.46 (PDB: 3EML) (Jaakola et al., 2008), S281 formed hydrogen thermal denaturation experiments. Purified A2AAR BRIL recon- bonds between N241.50 and D522.50. In the agonist-bound stituted into n-dodecyl b-D-maltoside (DDM)/cholesteryl hemi- conformation, A2AAR UK432097 (PDB: 3QAK), a change in succinate (CHS) mixed micelles was added to a panel of ligands the side-chain rotamer of S2817.46 caused a loss of these at saturating concentrations (25 mM for UK432097 and 100 mM
Structure 26, 1–11, February 6, 2018 5 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
Figure 4. Comparison of the Positions of Ca
Atoms between A2AAR–UK432097, D52N– UK432097, and A2AAR–ZM241385 All three structures were aligned globally and the root-mean-square deviation (RMSD) was calcu- lated between Ca atoms of the same residue
number between (A) A2AAR UK432097 and
D52N UK432097 and (B) A2AAR UK432097 and
A2AAR ZM241385 and (C) D52N UK432097
and A2AAR ZM241385. Residue number is plotted on the horizontal axis and RMSD is plotted on the vertical axis. The observed RMSDs are colored according to the legends in the figures. Roman numerals indicate helix numbers, blue shading indicates positions of intracellular loops, and red shading indicates positions of extracel- lular loops.
In addition, we recorded thermal
denaturation experiments for A2AAR in complex with a larger selection of li- gands at a lower sodium concentration of 75 mM (Figure 6B) and in the absence and presence of sodium at variable con- centrations (Figure 6C) to investigate the effect of different sodium concentrations on receptor stability. At 75 mM NaCl, the highest melting temperatures were observed for complexes with either full or partial agonists, which were 6 Cto 10 C higher than melting temperatures
reported for A2AAR in complex with the same or similar agonists and partial ago- nists in the presence of 800 mM NaCl (Xu et al., 2011). Melting temperatures
for A2AAR in complex with antagonists were similar to previously reported for all other ligands) or no ligand added (apo) all in the presence melting temperatures for A2AAR antagonist complexes in the of 150 mM NaCl. In these conditions, A2AAR D52N showed the presence of 800 mM NaCl (Jaakola et al., 2008; Xu et al., highest denaturation temperature for all but one ligand complex 2011). Experiments using variable sodium concentrations
(A2AAR N284A in complex with UK432097 showed the overall confirmed the sensitivity of agonist complexes to sodium and highest Tm of nearly 75 C) (Table S1). The most striking effect indicated a greater effect of sodium on agonist complexes was for apo A2AAR D52N, which showed a nearly 8 C increase than on antagonist complexes. The melting temperatures of in the Tm compared with apo A2AAR (Figure 6A). Notably, for the A2AAR in complex with the full agonist UK432097 were variant A2AAR D52A, we observed a melting temperature that 77.7 C, 73.2 C, and 69.7 C at 0, 150, and 500 mM NaCl, was slightly lower than for A2AAR and markedly lower than for respectively (Figure 6C). This effect was not observed when us- A2AAR D52N for all ligands studied. This striking difference ing 150 or 500 mM choline chloride (Figure S6). This trend of can be rationalized by the loss of hydrogen bonds in sodium on A2AAR melting temperatures may reflect changes A2AAR D52A, which are observed in A2AAR D52N between in rates of ligand association or dissociation specific to agonist N522.50 and residues in helices II, III, and VII (Figures 5 and S3). complexes (see Discussion).
The measured Tm values for Figure 6A are given in Table S1. There was a statistically significant difference in Tm between DISCUSSION receptor variants for each ligand condition tested as determined by one-way ANOVA: apo (F(5,17) = 14.18, p < 0.0001), The combination of structural, biophysical, and pharmacological ZM241385 (F(5,16) = 5.724, p = 0.0033), UK432097 (F(5,13) = data presented here provides a basis to delineate the role of the 2.50 139.4, p < 0.0001), NECA (F(5,14) = 26.12, p < 0.0001), and D N mutation on A2AAR thermal stability, the structure of the theophylline (F(5,14) = 4.485, p = 0.0119). Dunnett’s multiple com- NPxxY activation motif, and inhibition of G-protein signaling. In parison tests revealed that the D522.50N variant is significantly addition, the D2.50N mutation desensitizes the response of different from A2AAR for apo (p < 0.001), ZM241385 (p < 0.05), A2AAR agonist binding to increasing sodium concentration, UK432097 (p < 0.01), and NECA (p < 0.05) (Figure S5). which has been documented in other receptors including DOR
6 Structure 26, 1–11, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
A AR–UK432097 D52N–UK432097 Figure 5. Comparison of Hydrogen Bonding A2AAR–ZM241385 2A (Antagonist) (Agonist) (Agonist) Networks in A2AAR–ZM241385, A2AAR– VII VII VII UK432097, and D52N–UK432097 I I I VI VI VI A schematic ispresented of cross-sectional views of N280 N280 N280 S281 S281 S281 helices I–III, VI, and VII, indicated by circles with N24 W246 N24 W246 N24 W246 Roman numerals. Amino acids involved in hydrogen II II II III III III bonding between helices are indicated by colored D52 S91 D52 S91 N52 S91 dots on each circle and labeled. Dashed lines be- tween helices indicate the presence of a hydrogen bond, and the thickness of the dashed line indicates the number of hydrogen bonds (i.e., two hydrogen bonds between N52 and S281 are observed in D52–
UK432097 and only one is observed in A2AAR– ZM241385). See also Figures S3 and S4.
(Fenalti et al., 2014). We propose that this sodium desensitization but caused a striking loss of G-protein signaling for a number of and loss of G-protein signaling are manifested by D2.50N, and receptors. In the CB2 cannabinoid receptor, replacement of that loss of G-protein signaling is due to subtle changes in inter- S7.46 with alanine causes of loss of agonist-induced signaling helical packing facilitated by specific interactions with N2.50. for some ligands (Raitio et al., 2005). Thus, differences in Local conformational changes observed in the NPxxY motif for signaling for the D52N UK432097 complex and local structural D52N UK432097 suggest coupling between the NPxxY motif rearrangements in the NPxxY motif and residues immediately and position D2.50 that may contribute to changes in signaling preceding appear consistent with mutational studies that disrup- for the variant protein. It has been proposed that maintaining ted the same region. It has been proposed that the NPxxY region the structural integrity of the NPxxY motif in native class A recep- facilitates signaling through changes in the network of hydrogen- tors is critical for signal propagation from the orthosteric ligand bonded water molecules (Pardo et al., 2007), which may ratio- binding site to the intracellular surface (Fritze et al., 2003; Hulme, nalize the required structural integrity of this region. 2013; Trzaskowski et al., 2012). In earlier studies, replacement of Comparison of the agonist-bound variant D52N UK432097 residues in the NPxxY motif resulted in apparent attenuation or crystal structure with the crystal structures of A2AAR UK432097 complete loss of G-protein signaling (Borroto-Escuela et al., (PDB: 3QAK) and A2AAR ZM241385 (PDB: 3EML) provides 2011; Bouley et al., 2003; Gale´ s et al., 2000; Govaerts et al., fresh insight into the mechanism of how agonist binding at the or- 2001; Lu et al., 2001; Raitio et al., 2005). Replacement of N7.49 thosteric ligand cavity leads to conformational changes and in- with alanine did not significantly perturb ligand binding affinities teractions of helices that lead to receptor activation. Starting at
Figure 6. Thermal Stability and Function of A Apo ZM241385 UK432097
) A2AAR and Allosteric Site Variants C
˚ (Antagonist) (Agonist)
(
R (A) Fluorescence thermal shift assays for A2AAR-
A 2A
A BRIL and variants in complex with five different
to ligands and for no ligand added (apo). The mean
changes in melting temperature (DTm) relative to A AR are displayed with error bars representing
Relative 2A m
T SEM (n = 3) and were performed at 150 mM NaCl. ∆ Tm values are listed in Table S1, and statistical
) 2.50 C D52 N analysis is shown in Figure S5.
˚ NECA Theophylline
( R (Agonist) (Antagonist) 2.50
A D52 A (B) Tm values calculated from fluorescence ther- 2A
A 3.39 mal shift assays for A2AAR (without a fusion part-
S91 A to ner protein) for complexes with ten ligands and N2847.49A apo. Ligands are identified below each column
W2466.48A Relative
and the assay was performed at 75 mM NaCl.
m T
∆ (C) Tm values for A2AAR-BRIL complexes with B C ligands in the absence (solid bars) and presence 75 Apo 80 (checkered bars) of sodium (150 or 500 mM), as Antagonist indicated. Partial Agonist Agonist See also Figure S6. 70 65
60 emperature (ºC) T Temperature (ºC) 55
50
Apo XAC Apo Apo NECA Caffeine LUF5834 ZM241385 CGS21680UK432097 ZM241385ZM241385UK432097UK432097UK432097 Preladenant Theophylline Regadenoson + 150 mM NaCl + 150 mM NaCl + 150 mM+ NaCl 500 mM NaCl
Structure 26, 1–11, February 6, 2018 7 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
A AR A AR A AR A AR-D52N Figure 7. Schematic of Effects of a Range of ACD2A B 2A 2A 2A Agonist Agonist Agonist Agonist Sodium Concentrations on A2AAR Agonist “Low” [Sodium] 150 mM NaCl “High” [Sodium] All Sodium Recognition and Binding and Proposed (< 150 mM NaCl) (> 150 mM NaCl) Concentrations Mechanism of D52N Mutation on G-Protein Signaling (A–C) A AR is shown in gray in complex with an Na+ Na+ Na+ 2A Na+ Na+ Na+ agonist (orange) in the presence of (A) low so- Na+ Na+ Na+ Na+ Na+ Na+ Na+ Na+ dium concentration (<150 mM), (B) physiologi- II II II II cally relevant sodium concentration (150 mM), and (C) high sodium concentration (>150 mM). VI The allosteric sodium pocket is shown as a red V I V Na+ I V Na+ I V I oval in the center of the protein. Sodium ions are shown as blue circles. (A) Highlights a hypo- VII VI VII VII VI VI VII thetical pathway of signal transduction from the III III III III orthosteric ligand binding pocket through the VIII VIII NPxxY motif in helix VII, shaded in red, to VIII Na+ VIII Na+ Na+ Na+ Na+ the intracellular surface of helix VI. (A–C) high- G-protein G-protein Na+ Na+ Na+ Na+ Na+ Na+ Na+ light the allosteric effect of sodium on agonist binding.
(D) A2AAR D52N in complex with an agonist is not affected by sodium concentration. The NPxxY motif is shaded in yellow, reflecting the structural changes observed in the crystal structure of D52N UK432097, and arrows indicate incomplete transfer of signal from the orthosteric ligand binding pocket. the orthosteric binding pocket, the ribose moiety of agonist for the antagonist ZM241385 that has been co-crystallized 7.42 7.43 UK432097 makes unique contacts with S277 and H278 with A2AAR (Figure 6B). Furthermore, A2AAR in complex with in helix VII. As this ribose moiety is characteristic of all A2AAR UK432097 showed a trend of decreasing melting temperatures full agonists, structures of A2AAR in complex with other agonists with increasing concentration of sodium (150 mM and higher) also revealed the same critical contacts between the agonists (Figure 6C). Typically, antagonists are thought to have a more and helix VII (Lebon et al., 2011b). While important agonist-re- stabilizing effect on receptors than agonists (Chun et al., 2012; ceptor interactions occur at helix VII, a recent structure of an Zhang et al., 2015b), but our data suggest that may be the
A2AAR ternary complex with an agonist, NECA, and engineered case only at sodium concentrations higher than physiologically G protein revealed a larger outward rearrangement of helix VI relevant levels (R150 mM NaCl). at the intracellular surface (Carpenter et al., 2016). From these From these collective observations, we propose that the observations, we propose that a key step in signal propagation collapsed sodium pocket observed in A2AAR agonist-bound from the orthosteric site involves interactions between helices states facilitates stronger helix-helix interactions at the intersec- VI and VII near the orthosteric pocket and the NPxxY activation tion between helices II, III, VI, and VII. Coordination of sodium at motif (Figures 7A and 7B). Although additional interactions are this intersection maintains these interactions but decreases their likely also involved in activation, these observations are strength. In addition, the coordination of sodium at this site intriguing in the context of analyzing patterns of interaction net- possibly modulates the conformation of the orthosteric pocket works among class A GPCRs (Venkatakrishnan et al., 2013, in subtle ways that could result in suboptimal interactions 2016). For the D52N UK432097 agonist complex, loss of inter- between agonists and receptor (Figure 7C). The notion of subop- actions between helices VI and VII and concurrent gain of inter- timal agonist-receptor interactions is supported by the observa- actions between helices VII and II are correlated with a loss of tion of decreased ligand binding affinities for agonists, but not G-protein signaling and increased thermal stability (Figures 5 antagonists, in the presence of physiological concentrations of and 7D). In addition, the protonation state of D2.50 may be sodium (150 mM) (Katritch et al., 2014; Pert et al., 1973). This involved in A2AAR signaling, as was suggested by recent analysis was also observed for the agonist NECA binding to A2AAR, but of crystal structures of class A GPCR-ligand complexes and not for variants A2AAR D52N and A2AAR S91A (Table 1). computational modeling (Vickery et al., 2018). This study sug- The data reported here suggest an important utility of the D2.50N gests that for inactive conformations, D2.50 is negatively charged mutation in GPCR construct design for drug discovery and bio- and forms coordinative bonds with sodium, while agonist bind- physical assays that has not yet been explored fully. The D2.50N 2.50 ing facilitates D protonation and intracellular transfer of single-point mutation increases the Tm of all A2AAR ligand com- sodium. plexes, and there is an especially large increase in the Tm for the The schematic in Figure 7 summarizes experimental condi- apo receptor (Figure 6A). While A2AAR D52N exhibits no G-pro- tions from the literature (Xu et al., 2011) and current study and tein signaling (Figure 2B), the conformations of residues in the highlights the effects of a spectrum of sodium concentrations ligand binding pocket and binding pose of the bound agonist on A2AAR agonist binding. The extreme boundaries of sodium are identical to A2AAR UK432097. Also, ligand binding affinities concentrations provide a mechanistic understanding of A2AAR of antagonist ZM241385 and agonist UK432097 were nearly iden- 2.50 function that will inform future experimental design (Figures tical between A2AAR and A2AAR D52N (Table 1). Because D is 7A–7C). At a lower sodium concentration of 75 mM NaCl, all one of the most highly conserved amino acids among all class A
A2AAR complexes with either partial or full agonists had a higher GPCRs (Katritch et al., 2014), introducing a single-point mutation melting temperature than almost all antagonist complexes, even at this location may provide a rapid and straightforward means for
8 Structure 26, 1–11, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
improving the overall stability and expression of many GPCRs and ACKNOWLEDGMENTS may accelerate the design of GPCR constructs for crystallization trials. Further, this method may also improve efforts for frag- K.L.W. was funded by the Weike Zhang Postdoctoral Fellowship at USC. M.T.E. acknowledges funding from an American Cancer Society postdoctoral ment-based screening of small molecules that target GPCRs, fellowship. The authors also acknowledge additional support from the USC for example, by NMR (Chen et al., 2012) or surface plasmon Bridge Undergraduate Science (BUGS) research program (to A.D. and T.L.). resonance (Shepherd et al., 2014), because these methods rely Z.G.G. and K.A.J. thank NIDDK Intramural Res. (ZIADK031117) for support. on immobilized GPCRs that have relatively higher denaturation V.K. acknowledges funding from the NIH (DA038858 and DA035764). The au- temperatures. thors would like to thank Vadim Cherezov for feedback on the manuscript; Jef- Replacement of D2.50 has been shown to be beneficial to the frey Velasquez for assistance with construct cloning; Meihua Chu, Kelly Villers, and Chris Hanson for baculovirus expression; and Angela Walker for assis- stabilization of both the KOR and NTSR1 in a recent study utiliz- tance with manuscript preparation. ing the directed evolution approach of GPCR stabilization (Schutz et al., 2016). It is notable that the directed evolution AUTHOR CONTRIBUTIONS approach utilized no prior knowledge about which mutations could potentially be beneficial; however, evolved constructs for K.L.W., M.T.E., and R.C.S. designed the project. K.L.W. and M.T.E. optimized, purified, and crystallized the receptors in LCP. K.L.W. collected and pro- both KOR and NTSR1 included substitutions at D2.50. Other cessed synchrotron data for D52N UK43209 and S91A UK43209. K.L.W. methods of stabilizing GPCRs, including systematic alanine and G.W.H. solved and refined structures. Z.G.G. conducted radioligand bind- scanning (Lebon et al., 2011a) or the directed evolution approach ing and G-protein-signaling assays. K.L.W. performed homologous radioli- (Schutz et al., 2016), have been essential for structure determi- gand binding assays with ZM241385 and NECA. K.L.W., M.T.E., T.L., and nation of unique GPCRs. However, such methods can be time A.D. generated and purified A2AAR and A2AAR variant constructs. K.L.W., and resource consuming and may stabilize receptor interactions M.T.E., T.L., and A.D. performed thermal denaturation assays. K.L.W., M.T.E., and N.P. analyzed the structures. K.L.W. and M.T.E. wrote the manu- with ligands of specific chemical or pharmacological properties, script with contributions from R.C.S., K.A.J., V.K., and all other co-authors. which can limit experimental probing with multiple ligands. Here 2.50 we propose an alternative approach of a single mutant, D N, DECLARATION OF INTERESTS which significantly boosts receptor stability, increases the melting temperature of apo GPCRs and GPCR-ligand com- The authors declare no competing interests. plexes, and maintains ligand binding affinities similar to the 2.50 Received: September 22, 2017 native receptor. Thus, utilization of the D N mutation across Revised: November 21, 2017 the spectrum of class A GPCRs may improve the robustness Accepted: December 27, 2017 of screening platforms and accelerate drug discovery. Published: January 25, 2018
REFERENCES STAR+METHODS Adams, P.D., Afonine, P.V., Bunko´ czi, G., Chen, V.B., Davis, I.W., Echols, N., Detailed methods are provided in the online version of this paper Headd, J.J., Hung, L.W., Kapral, G.J., Grosse-Kunstleve, R.W., et al. (2010). and include the following: PHENIX: a comprehensive Python-based system for macromolecular struc- ture solution. Acta Crystallogr. D Biol. Crystallogr. 66, 213–221. d KEY RESOURCES TABLE Alexandrov, A.I., Mileni, M., Chien, E.Y., Hanson, M.A., and Stevens, R.C. d CONTACT FOR REAGENTS AND RESOURCE SHARING (2008). Microscale fluorescent thermal stability assay for membrane proteins. d EXPERIMENTAL MODEL AND SUBJECT DETAILS Structure 16, 351–359. B Microbes Ballesteros, J.A., and Weinstein, H. (1995). Integrated methods for the con- B Cell Lines struction of three-dimensional models and computational probing of struc- ture-function relations in G protein-coupled receptors. Methods Neurosci. d METHODS DETAILS 25, 366–428. B Construct Design and Cloning Bonneau, O., Wyss, D., Ferretti, S., Blaydon, C., Stevenson, C.S., and Trifilieff, B Protein Production and Purification A. (2006). Effect of adenosine A2A receptor activation in murine models of res- B Fluorescent Thermal Shift Assays - CPM Assays piratory disorders. Am. J. Physiol. Lung Cell. Mol. Physiol. 290, L1036–L1043. B Signaling Assay - cAMP Assay Borroto-Escuela, D.O., Romero-Fernandez, W., Garcı´a-Negredo, G., Correia, B Radioligand Binding Assay P.A., Garriga, P., Fuxe, K., and Ciruela, F. (2011). Dissecting the conserved B Homologous Radioligand Binding Assays NPxxY motif of the M3 muscarinic acetylcholine receptor: critical role of Asp-7.49 for receptor signaling and multiprotein complex formation. Cell. B Crystallization of A2AAR Variants B Data Collection and Structure Determination Physiol. Biochem. 28, 1009–1022. d QUANTIFICATION AND ANALYSIS Bouley, R., Sun, T.X., Chenard, M., McLaughlin, M., McKee, M., Lin, H.Y., Brown, D., and Ausiello, D.A. (2003). Functional role of the NPxxY motif in inter- B Fluorescent Thermal Shift Assays - CPM Assays nalization of the type 2 vasopressin receptor in LLC-PK1 cells. Am. J. Physiol. B Radioligand Binding and Functional Assays Cell Physiol. 285, C750–C762. B Homologous Radioligand Binding Assays Caffrey, M., and Cherezov, V. (2009). Crystallizing membrane proteins using d DATA AVAILABILITY lipidic mesophases. Nat. Protoc. 4, 706–731. Carpenter, B., Nehme´ , R., Warne, T., Leslie, A.G., and Tate, C.G. (2016). SUPPLEMENTAL INFORMATION Structure of the adenosine A2A receptor bound to an engineered G protein. Nature 536, 104–107. Supplemental Information includes six figures and one table and can be found Ceresa, B.P., and Limbird, L.E. (1994). Mutation of an aspartate residue highly with this article online at https://doi.org/10.1016/j.str.2017.12.013. conserved among G-protein-coupled receptors results in nonreciprocal
Structure 26, 1–11, February 6, 2018 9 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
disruption of a2-adrenergic receptor-G-protein interactions. A negative charge Lebon, G., Bennett, K., Jazayeri, A., and Tate, C.G. (2011a). at amino acid residue 79 forecasts a2A-adrenergic receptor sensitivity to allo- Thermostabilisation of an agonist-bound conformation of the human adeno- steric modulation by monovalent cations and fully effective receptor/G-protein sine A2A receptor. J. Mol. Biol. 409, 298–310. coupling. J. Biol. Chem. 269, 29557–29564. Lebon,G.,Warne,T.,Edwards,P.C.,Bennett,K.,Langmead,C.J.,Leslie, Changeux, J.P., and Christopoulos, A. (2016). Allosteric modulation as a unify- A.G., and Tate, C.G. (2011b). Agonist-bound adenosine A2A receptor ing mechanism for receptor function and regulation. Cell 166, 1084–1102. structures reveal common features of GPCR activation. Nature 474, Chen, D., Errey, J.C., Heitman, L.H., Marshall, F.H., IJzerman, A.P., and Siegal, 521–525. G. (2012). Fragment screening of GPCRs using biophysical methods: identifi- Leone, R.D., Lo, Y.C., and Powell, J.D. (2015). A2aR antagonists: next gener- cation of ligands of the adenosine A2A receptor with novel biological activity. ation checkpoint blockade for cancer immunotherapy. Comput. Struct. ACS Chem. Biol. 7, 2064–2073. Biotechnol. J. 13, 265–272. Cherezov, V., Hanson, M.A., Griffith, M.T., Hilgart, M.C., Sanishvili, R., Liu, W., Chun, E., Thompson, A.A., Chubukov, P., Xu, F., Katritch, V., Han, Nagarajan, V., Stepanov, S., Fischetti, R.F., Kuhn, P., and Stevens, R.C. G.W., Roth, C.B., Heitman, L.H., IJzerman, A.P., et al. (2012). Structural basis (2009). Rastering strategy for screening and centring of microcrystal samples for allosteric regulation of GPCRs by sodium ions. Science 337, 232–236. of human membrane proteins with a sub-10 microm size X-ray synchrotron Lu, Z.L., Saldanha, J.W., and Hulme, E.C. (2001). Transmembrane domains beam. J. R. Soc. Interface 6 (Suppl 5 ), S587–S597. 4 and 7 of the M(1) muscarinic acetylcholine receptor are critical for ligand Chun, E., Thompson, A.A., Liu, W., Roth, C.B., Griffith, M.T., Katritch, V., binding and the receptor activation switch. J. Biol. Chem. 276, Kunken, J., Xu, F., Cherezov, V., Hanson, M.A., et al. (2012). Fusion partner 34098–34104. toolchest for the stabilization and crystallization of G protein-coupled recep- Massink, A., Gutie´ rrez-de-Tera´ n, H., Lenselink, E.B., Ortiz Zacarı´as, N.V., Xia, tors. Structure 20, 967–976. L., Heitman, L.H., Katritch, V., Stevens, R.C., and IJzerman, A.P. (2015). Cieslak, M., Komoszynski, M., and Wojtczak, A. (2008). Adenosine A2A recep- Sodium ion binding pocket mutations and adenosine A2A receptor function. tors in Parkinson’s disease treatment. Purinergic Signal. 4, 305–312. Mol. Pharmacol. 87, 305–313. Dodevski, I., and Pluckthun, A. (2011). Evolution of three human GPCRs for McCoy, A.J., Grosse-Kunstleve, R.W., Adams, P.D., Winn, M.D., Storoni, L.C., higher expression and stability. J. Mol. Biol. 408, 599–615. and Read, R.J. (2007). Phaser crystallographic software. J. Appl. Crystallogr. Eddy, M.T., Lee, M.Y., Gao, Z.G., White, K.L., Didenko, T., Horst, R., Audet, M., 40, 658–674. Stanczak, P., McClary, K.M., Han, G.W., et al. (2017). Allosteric coupling of Neve, K.A. (1991). Regulation of dopamine D2 receptors by sodium and pH. drug binding and intracellular signaling in the A2A adenosine receptor. Cell. Mol. Pharmacol. 39, 570–578. https://doi.org/10.1016/j.cell.2017.12.004. Otwinowski, Z., and Minor, W. (1997). Processing of X-ray diffraction data Emsley, P., Lohkamp, B., Scott, W.G., and Cowtan, K. (2010). Features and collected in oscillation mode. Methods Enzymol. 276, 307–326. development of Coot. Acta Crystallogr. D Biol. Crystallogr. 66, 486–501. Pardo, L., Deupi, X., Do¨ lker, N., Lo´ pez-Rodrı´guez, M.L., and Campillo, M. Fenalti, G., Giguere, P.M., Katritch, V., Huang, X.P., Thompson, A.A., (2007). The role of internal water molecules in the structure and function of Cherezov, V., Roth, B.L., and Stevens, R.C. (2014). Molecular control of the rhodopsin family of G Protein-coupled receptors. ChemBioChem d -opioid receptor signalling. Nature 506, 191–196. 8, 19–24. Fritze, O., Filipek, S., Kuksa, V., Palczewski, K., Hofmann, K.P., and Ernst, Pert, C.B., Pasternak, G., and Snyder, S.H. (1973). Opiate agonists and antag- O.P. (2003). Role of the conserved NPxxY(x) F motif in the rhodopsin 5,6 onists discriminated by receptor binding in brain. Science 182, 1359–1361. ground state and during activation. Proc. Natl. Acad. Sci. USA 100, € 2290–2295. Raitio, K.H., Salo, O.M., Nevalainen, T., Poso, A., and Jarvinen, T. (2005). Targeting the cannabinoid CB2 receptor: mutations, modeling and develop- Gale´ s, C., Kowalski-Chauvel, A., Dufour, M.N., Seva, C., Moroder, L., ment of CB2 selective ligands. Curr. Med. Chem. 12, 1217–1237. Pradayrol, L., Vaysse, N., Fourmy, D., and Silvente-Poirot, S. (2000). Mutation of Asn-391 within the conserved NPxxY motif of the cholecystokinin Schutz, M., Schoppe, J., Sedlak, E., Hillenbrand, M., Nagy-Davidescu, G., B receptor abolishes G qProtein activation without affecting its association Ehrenmann, J., Klenk, C., Egloff, P., Kummer, L., and Pluckthun, A. (2016). with the receptor. J. Biol. Chem. 275, 17321–17327. Directed evolution of G protein-coupled receptors in yeast for higher functional production in eukaryotic expression hosts. Sci. Rep. 6, 21508. Govaerts, C., Lefort, A., Costagliola, S., Wodak, S.J., Ballesteros, J.A., Van Sande, J., Pardo, L., and Vassart, G. (2001). A conserved asn in transmem- Shepherd, C.A., Hopkins, A.L., and Navratilova, I. (2014). Fragment screening brane helix 7 is an on/off switch in the activation of the thyrotropin receptor. by SPR and advanced application to GPCRs. Prog. Biophys. Mol. Biol. 116, J. Biol. Chem. 276, 22991–22999. 113–123. Gutie´ rrez-de-Tera´ n, H., Massink, A., Rodrı´guez, D., Liu, W., Han, G.W., Shibata, Y., White, J.F., Serrano-Vega, M.J., Magnani, F., Aloia, A.L., Joseph, J.S., Katritch, I., Heitman, L.H., Xia, L., Ijzerman, A.P., et al. (2013). Grisshammer, R., and Tate, C.G. (2009). Thermostabilization of the neuroten- sin receptor NTS1. J. Mol. Biol. 390, 262–277. The role of a sodium ion binding site in the allosteric modulation of the A2A adenosine G protein-coupled receptor. Structure 21, 2175–2185. Trzaskowski, B., Latek, D., Yuan, S., Ghoshdastider, U., Debinski, A., and Hishinuma, S., Kosaka, K., Akatsu, C., Uesawa, Y., Fukui, H., and Shoji, M. Filipek, S. (2012). Action of molecular switches in GPCRs–theoretical and (2017). Asp73-dependent and -independent regulation of the affinity of ligands experimental studies. Curr. Med. Chem. 19, 1090–1109. for human histamine H1 receptors by Na. Biochem. Pharmacol. 128, 46–54. van der Westhuizen, E.T., Valant, C., Sexton, P.M., and Christopoulos, A. Hulme, E.C. (2013). GPCR activation: a mutagenic spotlight on crystal struc- (2015). Endogenous allosteric modulators of G protein-coupled receptors. tures. Trends Pharmacol. Sci. 34, 67–84. J. Pharmacol. Exp. Ther. 353, 246–260. Jaakola, V.P., Griffith, M.T., Hanson, M.A., Cherezov, V., Chien, E.Y., Lane, Venkatakrishnan, A.J., Deupi, X., Lebon, G., Heydenreich, F.M., Flock, T., J.R., IJzerman, A.P., and Stevens, R.C. (2008). The 2.6 angstrom crystal struc- Miljus, T., Balaji, S., Bouvier, M., Veprintsev, D.B., Tate, C.G., et al. (2016). ture of a human A2A adenosine receptor bound to an antagonist. Science 322, Diverse activation pathways in class A GPCRs converge near the G-protein- 1211–1217. coupling region. Nature 536, 484–487. Katritch, V., Cherezov, V., and Stevens, R.C. (2013). Structure-function of the Venkatakrishnan, A.J., Deupi, X., Lebon, G., Tate, C.G., Schertler, G.F., and G protein-coupled receptor superfamily. Annu. Rev. Pharmacol. Toxicol. 53, Babu, M.M. (2013). Molecular signatures of G-protein-coupled receptors. 531–556. Nature 494, 185–194. Katritch, V., Fenalti, G., Abola, E.E., Roth, B.L., Cherezov, V., and Stevens, Vickery, O., Carvalheda, C., Zaidi, S.A., Pisliakov, A., Katritch, V., and R.C. (2014). Allosteric sodium in class A GPCR signaling. Trends Biochem. Zachariae, U. (2018). Intracellular passage of Na+ in an active state G protein Sci. 39, 233–244. coupled receptor. Structure 26, 171–180.e2.
10 Structure 26, 1–11, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
Werling, L.L., Brown, S.R., Puttfarcken, P., and Cox, B.M. (1986). Sodium Xu, F., Wu, H., Katritch, V., Han, G.W., Jacobson, K.A., Gao, Z.G., Cherezov, regulation of agonist binding at opioid receptors. II. Effects of sodium replace- V., and Stevens, R.C. (2011). Structure of an agonist-bound human A2A aden- ment on opioid binding in Guinea pig cortical membranes. Mol. Pharmacol. osine receptor. Science 332, 322–327. 30, 90–95. Zhang, D., Gao, Z.G., Zhang, K., Kiselev, E., Crane, S., Wang, J., Paoletta, S., Winn, M.D., Ballard, C.C., Cowtan, K.D., Dodson, E.J., Emsley, P., Evans, Yi, C., Ma, L., Zhang, W., et al. (2015a). Two disparate ligand-binding sites in P.R., Keegan, R.M., Krissinel, E.B., Leslie, A.G., McCoy, A., et al. (2011). the human P2Y1 receptor. Nature 520, 317–321. Overview of the CCP4 suite and current developments. Acta Crystallogr. D Zhang, X., Stevens, R.C., and Xu, F. (2015b). The importance of ligands for Biol. Crystallogr. 67, 235–242. G protein-coupled receptor stability. Trends Biochem. Sci. 40, 79–87.
Structure 26, 1–11, February 6, 2018 11 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One shot Top10 chemically competent E. coli ThermoFisher Cat#C404003 Chemicals, Peptides, and Recombinant Proteins n-Dodecyl-b-D-Maltopyranoside Anatrace Cat#D310 Cholesteryl hemisuccinate (CHS) Anatrace Cat#CH210 ATP Sigma-Aldrich Cat#A2383 DPN I NEB Cat#R0176S YNB (without amino acids and ammonium sulfate) Sigma-Aldrich Cat#Y1251 Biotin Sigma-Aldrich Cat#B4639 1-Oleoyl-rac-glycerol Sigma-Aldrich Cat#M7765-1G Cholesterol Sigma-Aldrich Cat#C8667-100G 4-(2-[7-Amino-2-(2-furyl)[1,2,4]triazolo[2,3-a][1,3,5]triazin- Tocris Cat#1036 5-ylamino]ethyl)phenol (ZM241385) 5’-N-Ethylcarboxamidoadenosine (NECA) Tocris Cat#1691 Xanthine amine congener (XAC) Tocris Cat#3200 4-[2-[[6-Amino-9-(N-ethyl-b-D-ribofuranuronamidosyl)-9H- Tocris Cat#1063 purin-2-yl]amino]ethyl]benzenepropanoic acid hydrochloride (CGS21680) 2-Amino-4-(4-hydroxyphenyl)-6-[(1H-imidazol-2-ylmethyl)thio]- Tocris Cat#4603 3,5-pyridinecarbonitrile (LUF 5834) Preladenant MedChem Express Cat#HY-10889 Regadenoson Apex Bio Cat#B5904 Caffeine Sigma-Aldrich Cat#C8960 Theophylline Sigma-Aldrich Cat#T1633 UK432097 Axon Medchem Cat#1193 Iodoacetamide Sigma-Aldrich Cat#I1149 [3H]2-[p-(2-carboxyethyl)phenyl-ethylamino]-50-N- Perkin-Elmer Cat#NET1021001MC ethylcarboxamidoadenosine ([3H]CGS21680) [3H]4-[2-[7-amino-2-(2-furyl)-1,2,4-triazolo[1,5-a][1,3,5]triazin- American Radiolabeled Chemicals Cat#ART 0884-50 5-yl-amino]ethylphenol ([3H]ZM241385) 5’-N-[Adenine-2,8-3H], Ethylcarboxamidoadenosine Perkin-Elmer Cat#NET811250UC Polyethylene glycol 400 Hampton Research Cat#HR2-603 Sodium citrate, pH 5 Hampton Research Cat#HR2-235 50% v/v Jeffamine M-600, pH 7.0 Hampton Research Cat#HR2-428-77 Magnesium Chloride hexahydrate (2.0 M) Hampton Research Cat#HR2-245 TALON Metal Affinity Resin Clontech Cat#635504 Critical Commercial Assay MycoAlertTM Mycoplasma Detection Lonza Cat#LT07-318 Deposited Data
A2AAR-D52N-UK432097 This study PDB: 5WF5
A2AAR-S91A-UK432097 This study PDB: 5WF6 Experimental Models: Cell Lines Insect: Sf9 ATCC Cat#CRL-1711 HEK293 cells ATCC Cat#CRL-1573 FreeStyle 293-F ThermoFisher Cat#R79007 (Continued on next page)
e1 Structure 26, 1–11.e1–e5, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
Continued REAGENT or RESOURCE SOURCE IDENTIFIER Experimental Models: Organisms/Strains P. pastoris: Bg12 BioGrammatics Cat#PS004-01 Oligonucleotides
Primer: A2AAR_D52N_F: IDT n/a TTTGTGGTGTCACTGGCGGCGGCCAACATCGCAGT GGGTGTGCTCGCCATCC
Primer: A2AAR_D52N_R: IDT n/a GGATGGCGAGCACACCCACTGCGATGTTGGCCGC CGCCAGTGACACCACAAA
Primer: A2AAR_D52A_F: IDT n/a TTTGTGGTGTCACTGGCGGCGGCCGCCATCGCAGT GGGTGTGCTCGCCATCC
Primer: A2AAR_D52A_R: IDT n/a GGATGGCGAGCACACCCACTGCGATGGCGGCCGC CGCCAGTGACACCACAAA
Primer: A2AAR_S91A_F: IDT n/a GCTTCGTCCTGGTCCTCACGCAGAGCGCCATCTTC AGTCTCCTGGCCATCGCCA
Primer: A2AAR_S91A _R: IDT n/a TGGCGATGGCCAGGAGACTGAAGATGGCGCTCTG CGTGAGGACCAGGACGAAGC
Primer: A2AAR_W246A_F: IDT n/a CATTGTGGGGCTCTTTGCCCTCTGCGCCCTGCCCC TACACATCATCAACTGCT
Primer: A2AAR_W246A_R: IDT n/a AGCAGTTGATGATGTGTAGGGGCAGGGCGCAGAG GGCAAAGAGCCCCACAATG
Primer: A2AAR_N284A_F: IDT n/a TCTCCCACACCAATTCGGTTGTGGCCCCCTTCATCTA CGCCTACCGTATC
Primer: A2AAR_N284A_R: IDT n/a GATACGGTAGGCGTAGATGAAGGGGGCCACAACC GAATTGGTGTGGGAGA Recombinant DNA
Plasmid: human A2AAR in pcDNA3.1 This study N/A
Plasmid: human A2AAR in pPIC9k vector This study n/a
Plasmid: human A2AAR-[D52N, T4L ICL3] This study n/a
Plasmid: human A2AAR-[S91A, T4L ICL3] This study n/a
Plasmid: human A2AAR-[D52N, BRIL ICL3] This study n/a
Plasmid: human A2AAR-[D52A, BRIL ICL3] This study n/a
Plasmid: human A2AAR-[S91A, BRIL ICL3] This study n/a
Plasmid: human A2AAR-[W246A, BRIL ICL3] This study n/a
Plasmid: human A2AAR-[N284, BRIL ICL3] This study n/a
Plasmid: human A2AAR-[D52N] This study n/a
Plasmid: human A2AAR-[D52A] This study n/a
Plasmid: human A2AAR-[S91A] This study n/a
Plasmid: human A2AAR-[W246A] This study n/a
Plasmid: human A2AAR-[N284A] This study n/a Software and Algorithms Coot Emsley et al., 2010 https://www2.mrc.lmb.com.ac.uk/ personal/pemsley/coot/ Phenix Suite Adams et al., 2010 https://www.phenix-online.org (Continued on next page)
Structure 26, 1–11.e1–e5, February 6, 2018 e2 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
Continued REAGENT or RESOURCE SOURCE IDENTIFIER CCP4 software suite Winn et al., 2011 http://www.ccp4.ac.uk HKL2000 Otwinowski and http://www.hkl-xray.com Minor, 1997 Prism 6.05 GraphPad https://www.graphpad.com/ scientific-software/prism/
CONTACT FOR REAGENTS AND RESOURCE SHARING
Further information and requests for reagents may be directed to, and will be fulfilled by the Lead Author, Dr. Raymond C. Stevens ([email protected]).
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Microbes E. coli cells were cultured in LB medium, and P. pastoris cells were cultured in BMGY and BMMY media.
Cell Lines Sf9 cells were cultured in ESF 921 media. HEK cells were cultured in DMEM media. Insect and mammalian cells are periodically tested for mycoplasma using MycoAlertTM Mycoplasma Detection kit (Lonza). The cell lines used were authenticated by suppliers and were chosen to remain consistent with previous studies and they are well validated for these assays.
METHODS DETAILS
Construct Design and Cloning All constructs produced in both Sf9 and Pichia pastoris used in this study were truncated after residue 316 and contained an N-ter- minal FLAG tag and C-terminal 10 X His tag. For A2AAR produced in Pichia pastoris, the glycosylation site N154 was replaced with Q. A2AAR-BRIL was identical to a previously published construct (Chun et al., 2012; Liu et al., 2012) where residues 1-106 of the thermo- stabilized apocytochrome b562 from E. coli (M7W, H102I, K106L) were inserted between K209 to G218 in the third intracellular loop of A2AAR, and variants of this construct were generated by single amino acid replacement. A2AAR-T4L was identical to a previously published construct used to determine the crystal structure of A2AAR in complex with UK432097 (Xu et al., 2011), where A2AAR res- idues K209-A221 were replaced by a cysteine-free variant of bacteriophage T4 lysozyme (C54T, C97A). PCR-based site-directed mutagenesis (QuickChange II, Stratagene, CA) was used to generate all variants, and primers used for site-directed mutagenesis were obtained from Integrated DNA Technology (San Diego, CA).
Protein Production and Purification High-titer recombinant baculovirus were generated with the Bac-to-Bac system (Invitrogen) and used to infect Sf9 cells (ATCC).
Insect cell membranes were disrupted in hypotonic buffer (10 mM HEPES pH 7.0, 10 mM MgCl2, 20 mM KCl, and protease inhibitors) and then washed in high osmotic buffer (10 mM HEPES pH 7.0, 10 mM MgCl2, 20 mM KCl, 1 M NaCl, protease inhibitors). Isolated Sf9 membranes were resuspended in buffer with 2.0 mg/ml iodoacetamide (Sigma), 4 mM theophylline (Sigma), and a 1:1000 v/v protease inhibitor solution (500 mM 4-benzenesulfonyl fluoride hydrochloride AEBSF, 1 mM E-64, 1 mM Leupeptin, 150 nM Aprotinin). Protein was extracted from membranes in buffer containing 0.5% w/v n-Dodecyl b-D-maltoside (DDM) (Anatrace) and 0.1% cholesteryl hemisuccinate (CHS) (Sigma) for 3 hours at 4 C, and unsolubilized material was separated by centrifugation at 150,000 x g for 30 minutes. The supernatant was incubated overnight at 4 C with Co2+-charged immobilized metal resin (TALON;
Clontech). After washing with 20 column volumes of buffer 1 (50 mM HEPES at pH 7.0, 500 mM NaCl, 10 mM MgCl2,1mM DDM, 0.2 mM CHS, 30 mM imidazole, 8 mM ATP), the protein-bound IMAC resin was washed with buffer 2 (50 mM HEPES at pH 7.0, 250 mM NaCl, 0.5 mM DDM, 0.1 mM CHS, 30 mM imidazole, 27 mM glycerol) and protein was eluted with buffer 2 containing 250 mM imidazole. For crystallization, the agonist UK432097 was added to buffers 1, 2 and elution buffer at a final concentration of 25 mM. Protein purity and approximate protein concentration were determined by analytical size-exclusion chromatography.
For Pichia pastoris-produced A2AAR (1-316), the gene was cloned into a pPIC9K vector (Invitrogen) at BamHI and NotI restriction sites. The construct was transformed via electroporation into the Bg12 strain (BioGrammatics, Carlsbad, CA). Protein purification of
A2AAR produced from Pichia pastoris was performed identically to Sf9-produced protein with the exception of a slightly longer sol- ubilization period of approximately 4 hours. Protein purified from Pichia pastoris was used for the thermal stability assays (Figure 6B). For probing the effect of monovalent cations on receptor thermal stability, sodium chloride was replaced in all buffers with the same concentration of choline chloride or potassium chloride, as indicated in the text.
e3 Structure 26, 1–11.e1–e5, February 6, 2018 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
Theophylline (Sigma) was dissolved in deionized water at a final concentration of 100 mM. Stock solutions of other ligands were prepared for UK432097 (25 mM; Axon Medchem, VA), ZM241385 (100 mM; Tocris), and NECA (50 mM; Tocris).
Fluorescent Thermal Shift Assays - CPM Assays Thermal shift assays were carried out as described previously (Alexandrov et al., 2008). N-[4-(7-diethylamino-4-methyl-3-coumarinyl) phenyl]maleimide (CPM; Invitrogen) was dissolved at 4 mg/ml in dimethylformamide (Sigma) and further diluted at a ratio of 1:1000 v/v in sample buffer that consisted of 50 mM HEPES pH 7.0, 150 mM NaCl, 0.05% DDM, and 0.01% CHS (Figure 6A), or in the presence of 75 mM NaCl (Figure 6B). For studying the effects of sodium on receptor melting temperatures (Figures 6C and S6), the receptor was purified with KCl instead of NaCl followed by a desalting step to replace KCl with 75 mM choline chloride. These samples were then diluted in assay buffer containing salt conditions specified in the figures (Figures 6C and S6). Approximately 5 mg of protein with no ligand added (apo) was incubated on ice with CPM buffer containing ligand in a total volume of 200 mL. Assays were performed with a Cary Eclipse spectrofluorometer using quartz cuvettes (Starna Cells, Inc., Atascadero, CA) over a linear tem- perature range from 20 Cto90 C heated at a constant rate of 2 C/min. The excitation wavelength was 384 nm, and the emission wavelength was 470 nm.
Signaling Assay - cAMP Assay CHO cells (ATCC) were grown in DMEM and F12 (1:1) supplemented with 10% fetal bovine serum, 100 Units/ml penicillin, 100 mg/ml streptomycin, and 2 mmol/ml glutamine. Transfection of the wild-type or mutant A2AAR was performed in 6-well plate (0.5 mg plas- mids/well) using Lipofectamine 2000. After 48 hours, cells were treated with assay buffer containing rolipram (10 mM) and adenosine deaminase (3 units/ml) for 30 min followed by the addition of agonists and incubated for 20 min. The reaction was terminated upon removal of the supernatant, and addition of 100 ml Tween-20 (0.3%). Intracellular cAMP levels were measured with an ALPHAScreen cAMP assay kit as instructed by the manufacturer (PerkinElmer).
Radioligand Binding Assay HEK293 cells (ATCC) were cultured in DMEM supplemented with 10% fetal bovine serum, 100 Units/ml penicillin, 100 mg/ml strep- tomycin, and 2 mmol/ml glutamine. Lipofectamine 2000 was used for the transfection of the wild-type or mutant A2AAR. Transfected cells were detached from plates by scraping into cold PBS and centrifuged at 250 g for 5 min. The pellets were resuspended in ice- cold Tris HCl buffer (50 mM, pH 7.4) and then homogenized. After homogenization and suspension, cells were centrifuged at 1000 g for 10 min, and the pellet was discarded. The suspension was then re-centrifuged at 20,000 g for 60 min at 4 C. The pellets were resuspended in buffer containing 3 Units/ml adenosine deaminase and incubated at 37 C for 30 min. The aliquots of membrane prep- arations were stored at -80 C until the binding experiments. The protein concentration was measured using the Bradford assay. For saturation binding, [3H] CGS21680 (ranging from 2 to 100 nM) was incubated with membrane preparations (5-10 mg proteins/tube) for 60 min at 25 C in a total assay volume of 200 mL of 50 mM Tris HCl (pH 7.4) containing 10 mM MgCl2. Nonspecific binding was deter- mined using 10 mM NECA. For displacement binding assays, membrane preparations (10-20 mg proteins/tube) were incubated at 25 C for 60 min with a final concentration of 5 nM [3H] CGS21680 in a mixture containing 50 mL of increasing concentrations of a test ligand in a total assay volume of 200 mL of 50 mM Tris HCl, pH 7.4, containing 10 mM MgCl2. Nonspecific binding was determined using 10 mM of NECA. The reaction was terminated by filtration with GF/B filters. Filters were placed in scintillation vials containing 5 ml of Hydrofluor scintillation buffer and counted using a PerkinElmer Tricarb 2810TR Liquid Scintillation Analyzer.
Homologous Radioligand Binding Assays Radioligand binding assays were performed as previously described (Massink et al., 2015). Briefly, ligand binding was measured us- ing washed membranes from HEK 293 cells (FreeStyle 293-F, ThermoFisher, R79007) transiently expressing wild-type A2AAR or point-mutant A2AAR constructs. Cells were dounce homogenized (50 mM Tris HCl, pH 7.4) and centrifuged for 15 min at 30,000 g. The pellet was resuspended in assay buffer in the presence of adenosine deaminase (0.8 IU/ml, Roche) to break down endogenous adenosine. Membranes were stored in 250 ml aliquots at -80 C. Binding assays were carried out in a total volume of 0.125 ml in 96-well plates with a binding buffer with or without 150 mM NaCl as indicated (50 mM Tris HCl, 1 U/ml adenosine deam- inase, pH 7.4) containing 0.5 nM [3H] ZM241385 (American Radiolabelled Chemicals, Inc., St. Louis, MO) or 1.0 nM [3H] NECA (Perkin Elmer) for 60 min at room temperature. Membranes were harvested over 0.3% polyethyleneimine-treated, 96-well filter mats using a 96-well Filtermate harvester (Perkin Elmer) and washed three times with cold buffer (50 mM Tris HCl, pH 7.4). Filter mats were dried, wax scintillant was melted onto each filter, and radioactivity was counted in a MicroBeta2 TriLux plate scintillation counter (Perkin 2.50 Elmer). ZM241385 and NECA binding affinities (KD) for wild-type and D52 N were determined using homologous competition bind- ing. All cell lines used arrived with a certificate of authenticity from the supplier and morphology and growth rates are constantly moni- tored. After thirty passages the cells are discarded. Insect and mammalian cells are periodically tested for mycoplasma using MycoAlertTM Mycoplasma Detection kit (Lonza). The cell lines used here were chosen to remain consistent with previous studies and they are well validated for these assays.
Crystallization of A2AAR Variants Solutions containing purified A2AAR variants in complex with UK432097 were concentrated and reconstituted into lipidic cubic phase (LCP) by mixing in a Hamilton gas tight syringe as described previously (Caffrey and Cherezov, 2009). The protein-LCP mixture
Structure 26, 1–11.e1–e5, February 6, 2018 e4 Please cite this article in press as: White et al., Structural Connection between Activation Microswitch and Allosteric Sodium Site in GPCR Signaling, Structure (2018), https://doi.org/10.1016/j.str.2017.12.013
contained 40% (w/w) protein solution, 54% (w/w) monoolein (Sigma) and 6% (w/w) cholesterol (Avanti Polar Lipids). All crystallization trials were performed in 96-well glass sandwich plates by an NT8-LCP in meso crystallization robot (Formulatrix) using 40 nl protein/LCP drops each overlaid with 0.8 ml precipitant solution. Crystallization trials were conducted at room temperature ( 23 C), and plates stored and imaged at 20 C in an incubator imager (RockImager 1000, Formulatrix). Diffraction quality crystals were obtained in precipitant conditions containing 100 mM sodium citrate pH 5, 24-27% (v/v) polyethylene glycol (PEG) 400,
30-80 mM MgCl2, 5% (v/v) Jeffamine M-600 pH 7 (Hampton). Crystals appeared about 1 hour after crystallization setup and continued to grow to full size ( 200 mm in length) within one week. Crystals were harvested directly from LCP using MicroMounts (MiTeGen) and flash frozen in liquid nitrogen.
Data Collection and Structure Determination X-ray diffraction data were collected on the 23ID-D and 23ID-B beamlines (GM/CA-CAT) at the Advanced Photon Source (Argonne, IL) using a 20 mm minibeam with a Pilatus3-6M and Eiger-16m, respectively. Crystals embedded in LCP were not visible in the mesophase after flash-freezing in liquid nitrogen, so a previously reported common rastering and data-collection strategy was used as described (Cherezov et al., 2009). We collected 30-50 frames with 0.2-0.5 oscillation per crystal to minimize radiation dam- age with a 1s exposure using an unattenuated beam. Data were integrated, scaled, and merged using HKL2000 (Otwinowski and Minor, 1997). Data from 24 crystals and 25 crystals were merged for D52N-UK432097 and S91A-UK432097, respectively. Diffraction of D52N UK432097 yielded a 92.3% complete dataset at 2.6 A˚ and S91A UK432097 crystals yielded a 91.9 % complete dataset at 2.9 A˚ . In order to minimize phase bias from the model, the initial structures were obtained by molecular replacement (MR) using
PHASER (McCoy et al., 2007) in the CPP4 suite using A2AAR and T4L as separate search models from either A2AAR ZM241385 or A2AAR UK432097 structures (3EML (Jaakola et al., 2008) or 3QAK (Xu et al., 2011)). The results between the two search models were very similar, and our final structures were obtained using A2AAR-ZM241385 (3EML) as the search model. The resulting models of A2AAR T4L variants were refined with phenix.refine (PHENIX) followed by manual examination and rebuilding of the refined co- ordinates in COOT (Emsley et al., 2010) using both sigma-A weighted 2jFoj-jFcj and jFoj-jFcj maps. The data collection and refinement statistics are shown in Table 2.
QUANTIFICATION AND ANALYSIS
Fluorescent Thermal Shift Assays - CPM Assays All thermal shift data were analyzed with the program Prism (version 7.0 for Windows, GraphPad Software, La Jolla, CA). To deter- mine melting temperatures (Tm), the data were normalized and then fit to a Boltzmann sigmoidal function and the means ± S.D. are shown in Table S1. All CPM experiments were carried out in triplicate or more for statistical analysis. The data were presented in a bar graph as means ± S.E.M. and assessed using one-way analysis of variance (ANOVA) to determine the effect of receptor variants on melting temperature for a range of drug treatments (Figure S5). For each drug treatment a Dunnett’s multiple comparison test was performed to determine if variant receptors had a significant effect on melting temperatures relative to A2AAR.
Radioligand Binding and Functional Assays
Binding and functional parameters were calculated using Prism 7.0 software (GraphPAD, San Diego, CA). IC50 values obtained from competition curves were converted to Ki values using the Cheng-Prusoff equation. Data were expressed as mean ± S.D. and done three times in triplicate.
Homologous Radioligand Binding Assays
The data were analysed by Prism 7.0 (GraphPad Software) to give KD values and reported as the mean ± S.D. and done three times or more in triplicate.
DATA AVAILABILITY
Coordinates and structure factors have been deposited in the Protein Data Bank for the A2AAR variant structures D52N UK432097 (PDB ID 5WF5) and S91A UK432097 (PDB ID 5WF6). The PDB accession codes 4EIY, 3QAK, 3EML, and 5G35 were referenced in this study. The UniProt accession codes P29274 for human A2AAR was used in this study. All other data are available from the corresponding authors on reasonable request.
e5 Structure 26, 1–11.e1–e5, February 6, 2018