Bacillus ACT 2021

9th International Conference on Bacillus anthracis, cereus and thuringiensis

April 26-28, 2021

Online

Table of contents

CONTACTS 3

GUIDELINES FOR ATTENDING THE MEETING 4

SPONSORS 5

PROGRAM 7

EPIDEMIOLOGY, ECOLOGY AND ADAPTATION 7 PHYSIOLOGY AND DEVELOPMENT (1) 8 PHYSIOLOGY AND DEVELOPMENT (2) 8 HOST-PATHOGEN INTERACTIONS 9 SPORE PROPERTIES 10 GENOMIC, PHYLOGENY AND MOBILE ELEMENTS 10 TOXINS AND THERAPIES 11

NEXT BACILLUS ACT CONFERENCE 13

ABSTRACTS 15

SPEAKERS 52

2

Contacts

Steering committee

Tjakko Abee (Wageningen University, the Netherlands) Rakesh Bhatnagar (Jawaharlal Nehru University, India) Steven Blanke (Illinois University at Urbana-Champaign, USA) Monika Ehling-Schulz (University of Veterinary Medicine Vienna, Austria) Arthur M. Friedlander (USAMRIID, USA) Michel Gohar (INRAE Jouy-en-Josas, France) Jean-Nicolas Tournier (IRBA, France)

Organizing committee

Véronique Broussolle (INRAE Avignon, France) Michel Gohar (INRAE Jouy-en-Josas, France) Leyla Slamti (INRAE, Jouy-en-Josas, France) Jean-Nicolas Tournier (IRBA, France)

Session chairs

Steve Blanke (University of Illinois at Urbana-Champaign, USA) Frédéric Carlin (INRAE Avignon, France) Theodor Chitlaru (Israel Institute for Biological Research, Israel) Monika Ehling-Schulz (University of Veterinary Medicine Vienna, Austria) Arthur M. Friedlander (USAMRIID, USA) Annika Gillis (UCLouvain, Belgium) Theresa Koehler (UTHealth, USA) Didier Lereclus (INRAE Jouy-en-Josas, France) Jacques Mahillon (UCLouvain, Belgium) Anne Moir (University of Sheffield, UK) Ole Andreas Økstad (University of Oslo, Norway) Ben Raymond (University of Exeter, UK)

3

Guidelines for attending the meeting

The BACT 2021 conference will be held on the Zoom webinar platform. There is no need to create a Zoom account or download any software. You can access the webinar by clicking on the link that was sent to you a few days prior to the meeting. Please do not share this link and do not post it online. You can check if the link is operational a few days in advance. Please let us know if you have any issue with it at [email protected].

For optimal experience, it is best to use a landline connection rather than Wi-Fi.

We have allocated 20 min per presentation: 15 min maximum for data sharing and the remainder for discussion. For a smooth running of the conference, and out of respect for all the participants, it is essential that the speakers respect this rule.

Questions should be written down in the chat panel during and after the presentation and will be directed to the speaker by the session chairs at the end of the presentation.

We ask the participants not to record any presentation, as some data might be unpublished.

There will be 3 types of participants during the meeting: - Hosts (organizing committee) - Panelists (speakers and session chairs) - Attendees (all other participants)

All participants will be Attendees by default when entering the webinar. At the beginning of each session, the Hosts will change the status of the moderators and the speakers of the session to Panelists. During the switch, the connection will be interrupted but will resume within a few seconds. Microphones and cameras are operational for both Hosts and Panelists. To preserve bandwidth, only the hosts, speakers and chairs of each session will turn their cameras on.

Using a videoconference platform such as Zoom webinar should hopefully not pose too many difficulties and many of us have been using these means of communication for a while now. However, if you feel that you need more information, please visit the Zoom website (https://zoom.us/).

We thank you for your support and for joining us for the BACT 2021 online conference. We wish you a pleasant and scientifically rich meeting.

4

Sponsors

We thank our sponsors for their generous support

5

We also thank the following people for their precious assistance

Ludovic Bridoux (INRAE, Jouy-en-Josas, France) for the website maintenance Céline Gautier and the Micalis administrative staff (INRAE, Jouy-en-Josas, France) for the registration and finance management

6

Program

The schedule corresponds to the time in Paris, France.

Monday, April 26

14h00 – 14h10 Welcome address

14h10 – 14h30 Introduction Arthur M. Friedlander, Senior scientist | United States Army Medical Research Institute of Infectious Diseases, Frederick, MD and Department of Medicine, Uniformed Services University of Health Sciences, Bethesda, MD, USA.

Epidemiology, ecology and adaptation Ben Raymond (University of Exeter, UK) and Jacques Mahillon (UCLouvain, Belgium)

14h30 – 14h50 Adaptation of Bacillus thuringiensis to plant colonisation affects differentiation and toxicity #1 Yicen Lin, PhD student | Bacterial Interactions and Evolution Group, DTU Bioengineering, Technical University of Denmark, Denmark

14h50 – 15h10 The fate of bacteria of the Bacillus cereus group in the amoeba environment #2 Haibo Chen, PhD student | Micalis Institute, INRAE, AgroParisTech, Université Paris-Saclay, Jouy-en-Josas, France

15h10 – 15h30 Immunological evidence of host variation in exposure and resistance to anthrax in Kruger and Etosha National Parks #3 Sunday Ochai, PhD student | Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Onderstepoort, South Africa

15h30 – 15h50 Anthrax: A comprehensive review describing the clinical features of reported hospitalized cases for all routes of infection published in the english literature, 1880-2018 #4 Katherine Hendricks, Senior scientist | Division of High Consequence Pathogens and Pathology, Centers for Disease Control and Prevention, Atlanta GA, USA

15h50 – 16h10 Environmental and genetic factors affecting Bacillus anthracis spore concentrations at anthrax carcass sites #5 Zoë R. Barandongo, PhD student | Department of Forest and Wildlife Ecology, University of Wisconsin-Madison, Madison WI, USA

Break

7

Physiology and development (1) Monika Ehling-Schulz (University of Veterinary Medicine Vienna, Austria) and Theresa Koehler (UTHealth, USA)

16h30 – 16h50 Bacillus anthracis’ S-layer is a cell envelope load-bearing component #6 Antonella Fioravanti, Post-doctoral fellow | Structural and Molecular Microbiology, Structural Biology Research Center, VIB and Structural Biology Brussels, Vrije Universiteit Brussel, Brussels, Belgium

16h50 – 17h10 A model for the early steps of SCWP assembly in the Bacillus cereus sensu lato group #7 Anastasia Tomatsidou, Post-doctoral fellow | Howard Taylor Ricketts Laboratory, Argonne National Laboratory, Lemont IL, USA

17h10 – 17h30 The putative different roles of tasA and calY in the biofilm formation of B. cereus #8 Ana Álvarez-Mena, PhD student | Institute for Mediterranean and Subtropical Horticulture "La Mayora", Spanish National Research Council–University of Malaga, Spain

17h30 – 17h50 Motility and biofilm regulation in the B. cereus group – identification of the conserved motility genes cdgL and mogR #9 Ole Andreas Økstad, Senior scientist | Section for Pharmacology and Pharmaceutical Biosciences, Department of Pharmacy, University of Oslo, Oslo, Norway

17h50 – 18h10 Role of materials types and positions on the Bacillus cereus [Bc-98/4] fouling and its resistance to cleaning #10 Piyush Kumar Jha, Post-doctoral fellow | UMET, Univ. Lille, CNRS, INRAE, ENSCL, Villeneuve d’Ascq, France

18h10 – 18h30 Towards the characterization of an alternative survival mode during infection in Bacillus thuringiensis #11 Hasna Toukabri, PhD student | Micalis Institute, INRAE, AgroParisTech, Université Paris-Saclay, Jouy-en-Josas, France

Tuesday, April 27

Physiology and development (2) Monika Ehling-Schulz (University of Veterinary Medicine Vienna, Austria) and Theresa Koehler (UTHealth, USA)

14h00 – 14h20 The activation of σP, an ECF σ factor that controls β-lactam resistance in Bacillus thuringiensis, cereus, and anthracis #12 Kelsie Nauta, PhD student | Department of Microbiology and Immunology, University of Iowa, Iowa City IA, USA

8

14h20 – 14h40 Identification of the extracytoplasmic function σ factor σP regulon in Bacillus thuringiensis #13 Theresa D. Ho, Post-doctoral fellow | Department of Microbiology and Immunology, Carver College of Medicine, University of Iowa, Iowa City IA, USA

14h40 – 15h00 Transcriptomic response to oxidative stress of Bacillus anthracis htrA-disrupted and parental wild type strains #14 Galia Zaide, Senior scientist | Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, Ness-Ziona, Israel

Host-pathogen interactions Didier Lereclus (INRAE Jouy-en-Josas, France) and Steve Blanke (University of Illinois at Urbana-Champaign, USA)

15h00 – 15h20 Branched-chain amino acid metabolism and virulence in Bacillus anthracis #15 Soumita Dutta, Post-doctoral fellow | Department of Microbiology and Molecular Genetics, McGovern Medical School, The University of Texas Health Science Center at Houston, Houston TX, USA

15h20 – 15h40 Distinct contribution of the HtrA protease and PDZ domains to its function in stress resilience and virulence of Bacillus anthracis #16 Ofer Cohen, Senior scientist | Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, Ness-Ziona, Israel

15h40 – 16h00 The sequence of the universal bacterial DNA repair protein Mfd dictates the pathogenicity of Bacillus cereus strains #17 Delphine Cormontagne, PhD student | Micalis Institute, INRAE, AgroParisTech, Université Paris-Saclay, Jouy-en-Josas, France

Break

16h20 – 16h40 AtxA-controlled small RNAs of Bacillus anthracis virulence plasmid pXO1 regulate gene expression in trans #18 Ileana D. Corsi, PhD student | Department of Microbiology and Molecular Genetics, McGovern Medical School, The University of Texas Health Science Center at Houston and MD Anderson Cancer Center and UTHealth Graduate School of Biomedical Sciences, The University of Texas, Houston TX, USA

16h40 – 17h00 Encapsulation with D isomer poly -g-glutamic acid, an especially poor TLR ligand, inhibits human dendritic cell responses to Bacillus anthracis #19 Tanya M. Jelacic, Investigator | United States Army Medical Research Institute of Infectious Diseases, Frederick MD, USA

9

Spore properties Anne Moir (University of Sheffield, UK) and Frédéric Carlin (INRAE Avignon, France)

17h00 – 17h20 Enhanced germination of heat activated Bacillus anthracis spores persists over a five-week period #20 Andrew Roser, PhD student | Louisiana Tech University, USA

17h20 – 17h40 Characterization of Bacillus anthracis spores lacking dipicolinate synthase #21 Chandler Hassan, PhD student | University of Nevada, Department of Chemistry and Biochemistry, Las Vegas NV, USA

17h40 – 18h00 A novel pilus superfamily from the endospores of pathogenic Bacilli #22 Pradhan Brajabandhu, PhD student | Structural and Molecular Microbiology, VIB- VUB Center for Structural Biology, VIB and Department of Bioengineering Sciences, Structural Biology Brussels, Vrije Universiteit Brussel, Brussels, Belgium

18h00 – 18h20 Measurement of interaction force between material and Bacillus spores #23 Anna Ipatova, PhD student | Univ. Lille, CNRS, UMR 8520, Lille, France

18h20 – 18h40 Foam Flow: An eco-efficient strategy for cleaning of contaminated industrial equipment #24 Heni Dallagi, PhD student | UMET, Univ. Lille, CNRS, INRAE, ENSCL, Villeneuve d’Ascq, France

Wednesday, April 28

Genomic, phylogeny and mobile elements Annika Gillis (UCLouvain, Belgium) and Ole Andreas Økstad (University of Oslo, Norway)

14h00 – 14h20 Dating points along the phylogeny of Bacillus anthracis #25 Gilles Vergnaud, Senior scientist | Université Paris-Saclay, France

14h20 – 14h40 Signatures of selection in core and accessory genomes suggest ecological diversification between clades of Bacillus cereus sensu lato #26 Hugh White, PhD student | Department of Biosciences, University of Exeter, Exeter, UK

14h40 – 15h00 A novel Bacillus thuringiensis strain: A highly dynamic plasmid environment #27 Nancy Fayad, Post-doctoral fellow | Laboratory of Biodiversity and Functional Genomics, UR-EGP, Faculty of Science, Université Saint-Joseph de Beyrouth, Beirut, Lebanon and Laboratory of Food and Environmental Microbiology, Earth and Life Institute, UCLouvain, Louvain-la-Neuve, Belgium

10

15h00 – 15h20 tip, the intriguing transfer locus of pXO16, a conjugative plasmid from Bacillus thuringiensis serovar israelensis #28 Pauline Hinnekens, PhD student | Laboratory of Food and Environmental Microbiology, Earth and Life Institute, UCLouvain, Louvain-la-Neuve, Belgium

15h20 – 15h40 Viral proteins involved in the adsorption process of phage Deep-Purple infecting members of the Bacillus cereus group #29 Audrey Leprince, PhD student | Laboratory of Food and Environmental Microbiology, Earth and Life Institute, UCLouvain, Louvain-la-Neuve, Belgium

Toxins and therapies Arthur M. Friedlander (USAMRIID, USA) and Theodor Chitlaru (Israel Institute for Biological Research, Israel)

15h40 – 16h00 New insights into the emetic toxin cereulide: Means of distribution, synergistic actions and prevention strategies #30 Markus Kranzler, Post-doctoral fellow | Institute of Microbiology, Department of Pathobiology, University of Veterinary Medicine Vienna, Vienna, Austria

16h00 – 16h20 Bacillus cereus growth and cereulide formation in different food matrices #31 Katia Rouzeau-Szynalski, Senior scientist | Food Safety Microbiology, Institute of Food Safety and Analytical Sciences, Food Safety Research Department, Nestlé Research, Lausanne, Switzerland

Break

16h40 – 17h00 Crystal structure and molecular docking studies of Bacillus cereus Haemolysin BL lytic component, HblL1 #32 Lainey Williamson, PhD student | School of Biosciences, Cardiff University, Park Place, Cardiff, UK

17h00 – 17h20 Entry and trafficking of Bacillus anthracis edema factor #33 Emilie Tessier, PhD student | Institut de Recherche Biomédicale des Armées, Bretigny-sur-Orge, France

17h20 – 17h40 Clindamycin protects nonhuman primates against inhalational anthrax but does not enhance reduction of circulating toxin levels when combined with ciprofloxacin #34 Mary E. Wright, Senior scientist | Division of Clinical Research, National Institute of Allergy and Infectious Diseases, Bethesda MD, USA

17h40 – 18h00 Treatment of experimental anthrax with pegylated circularly permuted capsule depolymerase #35 Arthur M. Friedlander, Senior scientist | United States Army Medical Research Institute of Infectious Diseases, Frederick MD and Department of Medicine, Uniformed Services University of Health Sciences, Bethesda MD, USA

11

18h00 – 18h20 The novel diagnostic approaches for B. anthracis in Georgia #36 Nino G. Vepkhvadze, Senior scientist | State Laboratory of Agriculture, Tbilisi, Georgia

Closing remarks

12

Next Bacillus ACT conference

The next Bacillus ACT conference is scheduled to take place in Paris April 24-28, 2022, if the sanitary conditions allow it.

The sessions are planned to be held at the Espace Saint Martin and the gala dinner will be hosted at the Musée des Arts Forains.

We look forward to seeing you there!

Espace Saint Martin, Paris

13

Musée des Arts Forains, Paris

14

Abstracts

15

#1

Adaptation of Bacillus thuringiensis to plant colonisation affects differentiation and toxicity

Yicen Lin1, Monica Alstrup1, Janet Ka Yan Pang1, Gergely Maróti2, Mériem Er-Rafik3, Nicolas Tourasse4, Ole Andreas Økstad5, Ákos T. Kovács1

1Bacterial Interactions and Evolution Group, DTU Bioengineering, Technical University of Denmark, Denmark 2 Institute of Plant Biology, Biological Research Centre of the Hungarian Academy of Sciences, Hungary 3 National Centre for Nano Fabrication and Characterization, Technical University of Denmark, Denmark 4 Univ. Bordeaux, CNRS, INSERM, ARNA, France 5 Centre for Integrative Microbial Evolution and Section for Pharmacology and Pharmaceutical Biosciences, Department of Pharmacy, University of Oslo, Norway

Although certain isolates from the Bacillus cereus group (Bacillus cereus sensu lato) are used as plant biologicals, safety concerns remain due to pathogenic traits. For example, toxin production might shift as an adaptive survival strategy in natural niches (the soil and plant rhizosphere). Therefore, it is crucial to explore bacterial evolutionary adaptation to the environment. Herein, we investigated Bacillus thuringiensis (Cry-) adaptation to the colonisation of Arabidopsis thaliana roots, and monitored changes in cellular differentiation in experimentally evolved isolates. Isolates from two populations displayed improved iterative ecesis on roots, reduced biofilm formation on abiotic surfaces, diminished swimming, but increased swarming, in addition to enhanced haemolysis and toxicity against insect larvae. Molecular dissection and recreation of a causative mutation revealed the importance of a non- sense mutation in the rho transcription terminator gene. Finally, transcriptome analysis revealed how Rho impacts various B. thuringiensis genes involved in carbohydrate metabolism and virulence. Our work suggests that evolved multicellular aggregates have a fitness advantage over single cells when colonising plants, creating a trade-off between swimming and multicellularity in evolved lineages, in addition to unrelated alterations in pathogenicity.

16

#2

The fate of bacteria of the Bacillus cereus group in the amoeba environment

Haibo Chen, Emilie Verplaetse, Leyla Slamti, and Didier Lereclus

Université Paris-Saclay, INRAE, AgroParisTech, Micalis Institute, 78350, Jouy-en-Josas, France.

Spores of the Bacillus cereus group bacteria are commonly found in the soil but evidence suggests that they are unable to grow in such a natural environment in the absence of nutrient input. Amoebas have been reported to be an amplifier for several species of pathogenic bacteria and their potential involvement to explain the large amount of B. thuringiensis and B. cereus spores in soil has been frequently proposed. Here, we studied the fate of Bacillus and amoebas when cultured together. We show that the virulence factors produced by B. thuringiensis and B. cereus do not affect the amoeba Acanthamoeba castellanii, which, on the contrary, can phagocytose and effectively digest vegetative Bacillus cells to grow and prevent the formation of cysts. Bacterial spores can germinate in the amoeba environment and the vegetative cells can then form chains or aggregates that appear to be less efficiently phagocyted by the amoeba. The use of transcriptional fusions between fluorescent reporter genes and stationary phase- and sporulation-specific promoters showed that the sporulation process occurs more efficiently in the presence of amoebas than in their absence. Moreover, our results showed the amoeba environment to promote spore germination and allow the bacteria to complete their developmental cycle. Overall, this study reports that the amoeba-Bacillus interaction creates a virtuous circle in which each protagonist helps the other to develop.

17

#3

Immunological evidence of host variation in exposure and resistance to anthrax in Kruger and Etosha National Parks

SO Ochai 1, WC Turner 2, H van Heerden 1

1 Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Onderstepoort, South Africa. 2 U.S. Geological Survey, Wisconsin Cooperative Wildlife Research Unit, Department of Forest and Wildlife Ecology, University of Wisconsin-Madison, Madison, Wisconsin, U.S.A.

Anthrax has a global distribution and is enzootic in Kruger National Park (KNP) in South Africa and Etosha National Park (ENP) in Namibia. These parks have similar savanna ecosystems and many of the same potential host species, yet the main anthrax host in each park is only a minor host species in the other. In KNP the main host species is greater kudu (Tragelaphus strepsiceros) and in ENP the main host species is plains zebra (Equus quagga). We measured the presence of anti-PA antibodies in zebra and kudu sampled from endemic and non-endemic areas in each park using Anti-PA ELISA and their ability to neutralise anthrax lethal toxin using the toxin neutralisation assay (TNA). It was found that kudus in KNP had higher anti-PA antibody titres than kudus in ENP and a higher proportion of animals that were positive than ENP (95% versus 40%, respectively). ENP zebras had higher titres and higher proportions of positive animals than those of KNP (83% versus 63%, respectively). Animals in anthrax endemic areas in KNP had higher titres than those in non-endemic areas, but this was not so in ENP. It was seen that ENP kudus and KNP zebras showed better toxin neutralization than their respective counterparts in each park. In summary, these results indicate that these species differ in their exposure to and resistance toward B. anthracis between the two parks. These patterns may be due to environmental differences between these systems and their interplay with host behavior, leading to differences in exposure frequency and dose, which in turn lead to immunological trade-offs between resistance versus tolerance to the anthrax lethal toxin.

18

#4

Anthrax: A Comprehensive Review Describing the Clinical Features of Reported Hospitalized Cases for All Routes of Infection Published in the English Literature, 1880- 2018

Katherine Hendricks, MD, MPH&TM1; Marissa K. Person, MSPH1; John S. Bradley, MD2; Thitipong Mongkolrattanothai, MPH1; Nathaniel Hupert, MD, MPH3; Peter Eichacker, MD4; Arthur M. Friedlander, MD5; William A. Bower, MD1

1. Division of High Consequence Pathogens and Pathology, Centers for Disease Control and Prevention; Atlanta, United States of America 2. Division of Infectious Diseases, Rady Children’s Hospital San Diego and the University of California San Diego School of Medicine; San Diego, United States of America 3. Departments of Population Health Sciences and of Medicine, Weill Cornell Medicine, Cornell University and New York-Presbyterian Hospital; New York, United States 4. Department of Critical Care Medicine, Clinical Center, National Institutes of Health; Bethesda, MD, United States of America 5. US Army Medical Research Institute of Infectious Diseases; Frederick, United States of America

Background: Anthrax, a toxin-mediated zoonotic disease caused by Bacillus anthracis with a worldwide distribution, has long been considered a potential biowarfare agent. Existing adult antimicrobial postexposure prophylaxis and treatment recommendations are consensus based. Methods: To inform an update of clinical guidelines, we completed a systematic review of the English literature for clinical and demographic characteristics of adults and children hospitalized with anthrax infection (cutaneous, inhalation, ingestion, injection, primary meningitis) abstracted from published case reports, case series, and line lists in English during 1880-2018, assessing geographic distribution, exposure source, signs, symptoms, and complications over the course of hospitalization and outcome by treatment. Results: Data on 764 adults and 167 children hospitalized with anthrax met completeness criteria for review; cutaneous anthrax was the most common form for both adults and children. From 1880 through 1915, reported cases were mostly from Europe; from 1916-1950, most were from North America; since then, most have come from Western and Central Asia. Since 1960, adult mortality has ranged from 31% for cutaneous to 90% for primary meningitis. Overall pediatric mortality was lower – at 22% for the entire time period. For adults, indirect – mostly occupational – animal contact (e.g., woolmaking, brushmaking, tanning) accounted for half or more of exposures until the most recent time period, and finished consumer goods accounted for one quarter to one third of cases through 1950. Almost two-thirds (59%) of pediatric exposures were direct exposures to ill animals. Most patients with inhalation anthrax developed pleural effusions, over half with ingestion anthrax developed ascites, and a third with ingestion anthrax had coagulopathies. Treatment improved survival for those with systemic symptoms, from ~30% in those untreated to ~70% in those receiving antimicrobials with/without antiserum/antitoxin. Conclusions: This review provides an improved evidence base for both clinical care of individual anthrax cases and public health planning for large-scale anthrax attacks.

19

#5

Environmental and genetic factors affecting Bacillus anthracis spore concentrations at anthrax carcass sites

Zoë R. Barandongo1*, Yen-Hua Huang1, Amelie C. Dolfi1, Spencer A. Bruce2, and Wendy C. Turner3

1Department of Forest and Wildlife Ecology, University of Wisconsin-Madison, Madison, WI 53706, USA 2Department of biological Sciences, State University of New York, Albany, NY 12222, USA 3U.S. Geological Survey, Wisconsin Cooperative Wildlife Research Unit, Department of Forest and Wildlife Ecology, University of Wisconsin-Madison, Madison, WI 53706, USA

Anthrax is a lethal zoonotic disease posing significantly risk to herbivorous wildlife and livestock. Upon host death, vegetative cells of Bacillus anthracis are released into the environment and undergo sporulation. Spores of B. anthracis are highly resistance to adverse temperatures, drought and ultra-violet radiation enabling them to persist in the soil reservoir for years. Anthrax transmission requires host exposure to high dose of spores. Therefore, environmental conditions or infection traits that facilitate higher initial spore concentrations and higher rates of spore survival will increase the chances that strains present at a particular carcass site are able to infect future host. This study builds off a long-term study of B. anthracis spore concentrations in soils at natural plains zebra (Equus quagga) anthrax carcass sites in Etosha National Park, Namibia. Here we investigate environmental and pathogen genetic factors affecting initial spore concentrations and spore survival rates over a decade at 40 zebra anthrax carcass sites. Specifically, we examine how spore concentrations are affected by i) soil characteristics at carcass sites (e.g., pH, calcium content, percent organic matter or soil composition); ii) seasonality and weather conditions at the time of host death; and iii) pathogen genomic diversity. The biggest predictor of variation in spore concentrations was the season in which the animal died. Zebras dying of anthrax in wet seasons—the peak season for anthrax in this system—had several orders of magnitude higher spore concentrations in carcass site soils than did zebras that died of anthrax in dry seasons. Soil characteristics and pathogen genetic diversity had no significant effects on spore concentrations or survival rates. Future research is needed to determine if the seasonal patterns in spore concentrations are driven by seasonal variation in sporulation success or seasonal differences in host health and susceptibility, affecting terminal cell concentrations.

20

#6

Bacillus anthracis’ S-layer is a cell envelope load-bearing component

Antonella Fioravanti1,2, Marion Mathelie-Guinlet3, Yves Dufrêne3, Han Remaut1,2

1) Structural and Molecular Microbiology, Structural Biology Research Center, VIB, Brussels, Belgium. 2) Structural Biology Brussels, Vrije Universiteit Brussel, Brussels, Belgium. 3) Louvain Institute of Biomolecular Science and Technology, UCLouvain, Croix du Sud, 4- 5, bte L7.07.07, B-1348 Louvain-la-Neuve, Belgium.

As part of its immune evasion strategy Bacillus anthracis presents a dynamic and complex composition of its cell envelope. In the vegetative bacteria the cell surface is covered by one of two 2D-protein arrays known as the Sap or EA1 S-layer (surface layer), present during exponential and stationary growth phase, respectively [1].

S-layers are commonly found as the outermost cell surface components of procaryotic cells [2, 3]. Recently we succeeded in exposing the disruption of S-layer integrity as a mechanism with therapeutic potential in S-layer carrying pathogens [4]. Using anti-Sap Nanobodies (Nbs [5]) able to destroy Sap S-layer integrity, we could show that acute disruption of B. anthracis S- layer integrity results in severe morphological cell surface defects and in attenuated growth. Unlike the genetic knockout of sap, cells with acutely compromised Sap S-layer would wrinkle and collapse.

In Gram-positive bacteria, the peptidoglycan sacculus is thought to form the major cell envelope supporting structure, ensuring cell shape and withstanding turgor pressure. To investigate the unexpected observations that the loss of Sap results in cell collapse, we used a combination of Atomic Force Microscopy and light microscopy observation to probe the contribution of B. anthracis S-layer to cell integrity. Our new experiments show that cells presenting a compromised S-layer by means of Nbs insult or genetic knockout lose their elasticity and stiffness. Furthermore, our experiments show that S-layer integrity is required to maintain cell shape in presence of osmotic stresses. These results present compelling experimental evidence to the hypothesis that the S-layer can serve as prokaryotic exoskeletons and a major load-bearing component of bacterial cells.

1. Mignot, T., et al., Developmental switch of S-layer protein synthesis in Bacillus anthracis. Mol Microbiol, 2002. 43(6): p. 1615-27. 2. Sara, M. and U.B. Sleytr, S-Layer proteins. J Bacteriol, 2000. 182(4): p. 859-68. 3. Albers, S.V. and B.H. Meyer, The archaeal cell envelope. Nat Rev Microbiol, 2011. 9(6): p. 414-26. 4. Fioravanti, A., et al., Structure of S-layer protein Sap reveals a mechanism for therapeutic intervention in anthrax. Nat Microbiol, 2019. 4(11): p. 1805-1814. 5. Muyldermans, S., Nanobodies: Natural Single-Domain Antibodies. Annual Review of Biochemistry, 2013. 82(1): p. 775-797.

21

#7

A model for the early steps of SCWP assembly in the Bacillus cereus sensu lato group Anastasia Tomatsidou1,2, Olaf Schneewind(†), Dominique Missiakas1,2

1Howard Taylor Ricketts Laboratory, Argonne National Laboratory, Lemont, IL 60439; 2Department of Microbiology, University of Chicago, Chicago, IL 60637 † Deceased 26 May 2019

Bacillus anthracis, the causative agent of anthrax disease, elaborates a secondary cell wall polysaccharide (SCWP) that is essential for the retention of Surface (S)-layer and S-layer homology (SLH) domain proteins. The SCWP is a conserved feature of the Bacillus cereus sensu lato group of bacteria. In B. anthracis, genetic disruptions of the SCWP biosynthetic pathway impair growth, cell division and virulence. Growth impairment can be explained by the irreversible accumulation of biosynthetic intermediates of SCWP assembly. Cell division and virulence defects result from the loss of S-layer associated proteins including murein hydrolases that control the separation of daughter cells, and adhesins that promote B. anthracis invasion of host cells. The SCWP of B. anthracis is comprised of trisaccharide repeat units composed of one ManNAc and two GlcNAc residues with O3-α-Gal and O4-β-Gal substitutions. Pyruvylation at O4, O6 of the distal ManNAc and acetylation at O3 of the penultimate GlcNAc residue account for the retention of S-layer and SLH proteins in the envelope. Our current model for SCWP assembly purports that trisaccharide repeat units are assembled onto undecaprenol on the cis side of the plasma membrane, translocated, and subsequently polymerized by WpaA and WpaB. Ultimately, polymerized units are transferred onto peptidoglycan by LCP enzymes. Here, we describe the three enzymes that synthesize repeat units and examine candidate genes for the cis to trans flipping of repeat units across the plasma membrane.

22

#8

The putative different roles of TasA and CalY in the biofilm formation of B. cereus

A. Álvarez-Mena1, M. L. Antequera-Gómez1, L. Díaz-Martínez1, J. Caro-Astorga1, O. P. Kuipers2, A. de Vicente1, D. Romero1 1Institute for Mediterranean and Subtropical Horticulture "La Mayora", Spanish National Research Council–University of Malaga, Bulevar Louis Pasteur 31 (Campus Universitario de Teatinos), 29071, Málaga, Spain; 2 Department of Molecular Genetics, Groningen Biomolecular Sciences and Biotechnology Institute, Centre for Synthetic Biology, University of Groningen, Nijenborgh 7, 9747 AG Groningen, The Netherlands [email protected]

Bacillus cereus is a human pathogen responsible of many food poisoning due to the ingestion of contaminated vegetables or processed foods. The biofilm development and spore formation, are essential stages in the survival and transmission of the bacteria and hence the production of harmful toxins for the consumer. During the biofilm formation, a subpopulation is differentiated to extracellular matrix producers, mainly composed by exopolysaccharides, proteins and extracellular DNA. One of the most fascinating compounds of this matrix are the amyloid proteins, that shows a high tendency to fibrillate and have a multifunctional role in the bacterial physiology.

In earlier studies it was identified that B. cereus possess two orthologues genes to the tasA gene in B. subtilis, initially described as essential in the assembly of amyloid fibers, and they were named as tasA and calY respectively. Both genes are located in the same genomic region and the deletion of each one leads to a different phenotype related with a deficient biofilm. In the case of the tasA mutant the biofilm finally detaches from the well at 72 hours, and the calY mutant shows a thinner ring phenotype in comparison with the wild type strain. Those preliminary results could indicate that TasA and CalY have different roles in the biofilm formation. The level of tasA and calY expression in the biofilm was higher than in planktonic cells, and it could be differentiated three different subpopulations: both genes are expressed, only calY or none of them. Amyloid proteins have been described as being involved in adhesion and host-colonization. A study of the dynamic of tasA gene expression show that is influenced by the type of vegetable surface.

The results mentioned above indicate that TasA and CalY might complementarily contribute to biofilm formation.

This work was supported by grants from the National Plan I+D+I of the Ministerio de Ciencia e Innovación (AGL2016-78662-R and PID2019-107724GB-I00) and by the European Research Council Starting Grant (BacBio 637971). Ana Álvarez is supported by a PhD fellowship (BES-2017-081275) from the FPI program of the same Ministry.

23

#9

Motility and biofilm regulation in the B. cereus group – identification of the conserved motility genes cdgL and mogR

Veronika Smith1, Toril Lindbäck2, Ida K. Hegna1, Sarah Finke1, Nicolas J. Tourasse1, 1 1 Christina Nielsen-LeRoux3, Malin Josefsen , Ida Kristine Bu Nilssen , Bjørn Dalhus4,5, Annette Fagerlund1,6, Ole Andreas Økstad1

1Section for Pharmacology and Pharmaceutical Biosciences, Department of Pharmacy, University of Oslo, Oslo, Norway. 2Department of Paraclinical Sciences, Faculty of Veterinary Medicine, Norwegian University of Life Sciences, Oslo, Norway. 3INRAE, AgroParisTech, Micalis, Jouy-en-Josas, Paris-Saclay University, France. 4Department of Medical Biochemistry, Institute of Clinical Medicine, University of Oslo, Postboks 4950 Nydalen, 0424 Oslo, Norway. 5Department of Microbiology, Division of Laboratory Medicine, Oslo University Hospital, Postboks 4950 Nydalen, 0424 Oslo, Norway. 6Nofima, Norwegian Institute of Food, Fisheries and Aquaculture Research, Ås, Norway.

The second messenger c-di-GMP was previously identified in Gram-negatives as a key regulator of the switch from planktonic growth to biofilm formation. By searching B. cereus group genomes, we previously identified ten conserved proteins (CdgA-J), putatively related to c-di-GMP synthesis (DGCs) or breakdown (PDEs). Furthermore, motility, biofilm formation, and/or virulence was affected by deletion and/or overexpression of cdg genes. Among the putative DGCs and PDEs, only two were conserved in Bacillus subtilis, indicating that c-di- GMP signaling is different in the two groups of bacteria. A novel B. thuringiensis 407 protein, CdgL, carries a degenerate nucleotide cyclase domain, and cdgL deletion rendered the bacterium severely reduced in flagellar gene expression, resulting in non-flagellated, non- motile cells. cdgL deletion also caused a delay in biofilm pellicle formation, which was also observed by flagellin gene deletion. cdgL was found to reside in a three-gene operon, also encoding a putative glycosyl transferase and a NupC family transporter, and which is conserved throughout the B. cereus group with the exception of non-motile B. pseudomycoides. Also, a newly identified putative transcriptional regulator MogR, is present only in Listeria spp and B. cereus group bacteria, and was found to affect flagellar gene expression in B. thuringiensis 407. By global transcriptional profiling B. thuringiensis MogR was also found to affect the expression of genes related to virulence and biofilm formation, and EMSA analyses suggested direct repression of flagellar genes. Increased biofilm formation and attenuation of virulence upon MogR overexpression was confirmed by phenotypic assays including toxicity to Galleria mellonella larvae, and influence of MogR on biofilm formation and cytotoxicity was found to be independent of the loss of flagella. LC-MS/MS analyses and microarray experiments suggested increased total cellular levels of c-di-GMP and higher sinI transcriptional levels, respectively. Interestingly, mogR was found to be conserved also in non-motile B. cereus group species such as B. mycoides and B. pseudomycoides, and is expressed in non-motile B. anthracis. Altogether this provides indications of an expanded set of functions for MogR in B. cereus group species, beyond motility regulation. Altogether this work further develops the knowledge of the coordinated regulation between motility, virulence and biofilm formation in B. cereus group bacteria.

24

#10

Role of materials types and positions on the Bacillus cereus [Bc-98/4] fouling and its resistance to cleaning

Piyush Kumar JHA*, Heni DALLAGI*, Elodie Richard**, Thierry BENEZECH*, Christine FAILLE*

*UMET, Univ. Lille, CNRS, INRAE, ENSCL, 369, Rue Jules Guesde, F-59650 Villeneuve d’Ascq CEDEX, France ** Univ. Lille, CNRS, INSERM, CHU Lille, Institut Pasteur de Lille, US 41, UMS 2014, PLBS, F-59000, Lille, France

Bacteria can adhere and proliferate on any surface especially in agri-food environments, producing biofilms that are sometimes very difficult to control. Along with bacterial properties, environmental factors including material type and surface properties, as well as location within processing lines, determine the fouling capability of bacteria. However, the role of the vertical vs horizontal position on fouling and further resistance to cleaning has been the subject of little research. In this study, we investigated the role of materials on biofilm properties of Bacillus cereus 98/4, in vertical and horizontal positions. Four materials with very different topographic and hydrophilic/hydrophobic properties were tested: stainless steels with 2R (smooth) and 2B (rough) finishes, glass (hydrophilic) and PP (hydrophobic). We first analyzed the amount and structure of the 24-h biofilms. For this purpose, biofilms were produced on coupons vertically or horizontally immersed in a suspension of 107 cells/ml in 1/10 TSB (tryptone soy broth). The amount of cultivable cells within biofilms was evaluated by the plate count method. The covered surface and the organization of the biofilms were analyzed through microscopic observations (epifluorescence and confocal laser scanning microscopes) after staining biofilms with orange acridine. The material type only played a minor role in biofilm formation, while some role of positions was seen on the contamination level. Actually, vertically immersed PP coupons were contaminated by 1 log more than horizontally immersed PP coupons, while only a few differences were seen for the other materials. Whatever the materials and the vertical/horizontal position, biofilms were formed of cell clusters separated with poorly contaminated areas. We then investigated the ease of detachment of the different biofilms, using a pilot-scale cleaning test rig, and a standard rinsing method (5 Pa for 20 min at 30±2 °C). Contrary to what was observed for biofilm formation, the resistance of biofilms to detachment is clearly affected by the material, the lowest log reduction being seen for PP surfaces (log reduction for PP surfaces were under 1 log, while for other materials it was more than 1.5 log). Conversely, no effect of the vertical/horizontal position could be evidenced in this study. In conclusion, positions to some extent determined the contamination level, meanwhile, material type impacted the detachment level.

25

#11

Towards the characterization of an alternative survival mode during infection in Bacillus thuringiensis

Hasna Toukabri, Didier Lereclus and Leyla Slamti

Micalis Institute, INRAE, AgroParisTech, Université Paris-Saclay, 78350, Jouy-en-Josas, France

Bacteria of the Bacillus cereus group are able to complete a full developmental cycle in their host. Using the honeycomb moth, Galleria mellonella (Gm), as an infection model, it was shown that these bacteria were able to kill their host, to survive in its cadaver via necrotrophism and to form spores by sequentially activating virulence, necrotrophism (Nec) and sporulation (Spo) genes. The differentiation course of a Bacillus thuringiensis (Bt) population was determined by monitoring necrotrophism and sporulation gene expression at the single-cell level with transcriptional fluorescent reporters. These studies showed that only a part of the population became Nec+ and among this subpopulation some bacteria differentiated into spores. A subpopulation composed of cells that did not express any of the fluorescent reporters remained uncharacterized and did not appear to be in exponential or stationary phase, but the majority was identified as viable using a cell death marker. All these results suggest that a subpopulation of cells in an unknown physiological state is able to survive in the host cadaver without resorting to sporulation which is a costly, complex and irreversible process. To precisely identify the bacterial cells of interest during infection for subsequent analysis, a reporter strain harboring optimized and unstable fluorescent reporters was constructed. We show that the Nec-/Spo- cells accounts for at least 50% of the population in the insect cadaver. We then examined the metabolic activity of the Nec- cells during infection by assaying their ability to synthesize proteins using genetic tools. Our data indicate that there is a metabolic change leading to a potential quiescence in this subpopulation over time. Furthermore, microscopic observations highlight a strong modification of the bacterial shape from rods towards coccoid forms. More metabolic activity assays are being performed on this subpopulation. In order to characterize the factors involved in this physiological state which has never been described in sporulating Firmicutes during host infection, we started a global RNA-Seq approach on the subpopulation of cells of interest. This study will help understand the adaptation, survival and persistence of bacteria in their environment and especially for B. cereus, that appears today as an important emerging pathogen.

26

#12

The activation of σP, an ECF σ factor that controls β-lactam resistance in Bacillus thuringiensis, cereus, and anthracis

Kelsie Nauta*, Theresa Ho, and Craig Ellermeier

Department of Microbiology and Immunology, University of Iowa, Iowa City, IA; *kelsie- [email protected]

Antibiotic resistance has reduced the efficacy of antibiotics, resulting in untreatable infections. Expression of resistance genes can be controlled by extracytoplasmic function (ECF) σ factors; which are alternative transcription factors found exclusively in bacteria that activate transcription in response to extracellular stresses. Although ECF σ factors are a diverse and important group of transcription factors, they remain poorly understood. σP is an ECF σ factor that controls β-lactamase expression in Bacillus cereus, B. thuringiensis, and some strains of B. anthracis, resulting in resistance to certain β- lactams. In the absence of these β-lactams, σP is sequestered by RsiP, the membrane- spanning anti-σ factor that inhibits σP activity. In the presence of σP-inducing β-lactams, RsiP is proteolytically degraded. This process is generally accomplished by sequential site-1 and site-2 proteases. We have identified signal peptidase as the site-1 protease that cleaves RsiP in the extracellular domain. We also showed the conserved site-2 protease, RasP, is required for cleavage of RsiP at site-2. We identified a penicillin binding protein (PBP) that is required for site-1 cleavage of RsiP. We find it binds both β- lactams that activate and β-lactams that don’t activate σP. We hypothesize the PBP binds β- lactams and this PBP-β-lactam complex is required for a protein-protein interaction that results in σP activation. The goal of this work is to define a novel mechanism for the control of β- lactam resistance.

27

#13

Identification of the Extracytoplasmic Function σ factor σP regulon in Bacillus thuringiensis

Theresa D. Ho1, Kelsie Nauta1 & Craig D. Ellermeier 1,2

1 Department of Microbiology and Immunology Carver College of Medicine University of Iowa 431 Newton Rd Iowa City, IA 52242

2 Graduate Program in Genetics, University of Iowa, Iowa City, IA 52242, USA

Bacillus thuringiensis and other members of the B. cereus family are resistant to many beta- lactams. Resistance is dependent upon the Extra Cytoplasmic Function sigma factor SigP. We used shotgun proteomics to identify proteins whose expression was induced by SigP. We compared the protein profiles of strains which either lacked SigP or over-expressed SigP and we identified 8 members of the SigP regulon which included four beta-lactamases as well as three Penicillin Binding Proteins (PBPs). Using transcriptional reporters, we confirmed that these genes are induced by beta-lactams in a SigP-dependent manner. Each of these genes were deleted individually or in various combinations to determine their role in resistance to a subset of beta-lactams, ampicillin, methicillin, cephalexin and cephalothin. We find that different beta- lactamases and PBPs are differentially involved in resistance to different beta-lactams. Our data show that B. thuringiensis utilizes a suite of enzymes to protect itself from beta-lactam antibiotics.

28

#14

Transcriptomic response to oxidative stress of Bacillus anthracis htrA-disrupted and parental wild type strains

Galia Zaide, Uri Elia, Inbar Cohen-Gihon, Ma'ayan Israeli, Shahar Rotem, Ofir Israeli, Sharon Ehrlich, Hila Cohen, Shirley Lazar, Adi Beth-Din, Anat Zvi, Ofer Cohen and Theodor Chitlaru

Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, Ness-Ziona 74100, Israel

HtrA (High Temperature Requirement A) protease/chaperone is active in the quality control of protein-synthesis. High throughput genomic/proteomic/serologic surveys of B. anthracis showed that HtrA is an exposed immunogenic putative-vaccine candidate. B. anthracis HtrA disruption resulted in a dramatic attenuation in the guinea pig, murine and rabbit models of anthrax, and therefore an htrA-deleted Sterne-strain served for the development of an efficacious and safe next-generation live attenuated anthrax spore-vaccine. The phenotype associated with disruption of the htrA gene established that HtrA is necessary for tolerance to various stress stimuli and for modulation of several bacterial proteins potentially involved in the stress response. The htrA-disrupted bacteria exhibited sensitivity to oxidative stress correlating with a delayed multiplication in macrophages. Here we report a comparative RNA- seq transcriptomic study generating a database of differentially expressed genes in the B. anthracis htrA-disrupted and wild-type parental strains under oxidative stress. The study demonstrates that, apart from protease and chaperone activities, HtrA exerts a regulatory role influencing expression of more than 1000 genes under stress. Functional analysis of groups or individual genes exhibiting strain-specific modulation, evidenced (i) massive downregulation in the DhtrA and upregulation in the WT strains of various transcriptional regulators, (ii) downregulation of translation processes in the WT strain, (iii) downregulation of metal ion binding functions and upregulation of sporulation-associated functions in the DhtrA strain. Fifteen genes uniquely upregulated in the wild-type strain were further interrogated for their modulation in response to other stress regimens. Reference: Zaide, Elia, Cohen-Gihon, Israeli, Rotem, Israeli, Ehrlich, Cohen, Lazar, Beth-Din, Shafferman, Zvi, Cohen, Chitlaru. Comparative Analysis of the Global Transcriptomic Response to Oxidative Stress of Bacillus anthracis htrA-Disrupted and Parental Wild Type Strains. Microorganisms. 2020, E1896.

29

#15

Branched-Chain Amino Acid Metabolism and Virulence in Bacillus anthracis

Soumita Dutta1, Ileana D. Corsi1, 2 and Theresa M. Koehler1, 2 1Department of Microbiology and Molecular Genetics, McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX, United States 2MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences, The University of Texas, Houston, TX, United States

Bacillus anthracis exhibits robust proliferation in diverse niches of mammalian hosts. Infection can result in up to 108 CFU/g of tissue at time of death of the animal. The metabolic attributes of B. anthracis that permit rapid proliferation to high numbers in multiple mammalian tissues have not been established. We posit that branched-chain amino acid (BCAA: I, L, and V) metabolism is key to B. anthracis pathogenesis. B. anthracis carries an unusually large number of genes predicted to be involved in BCAA biosynthesis and import. Two partially paralogous operons are associated with BCAA biosynthesis. Six genes are predicted to encode BCAA transporters (permeases) of the cation symporter family and additional genes are predicted to encode at least two BCAA-associated ABC transporters. Previous studies have demonstrated that expression of BCAA-related genes is altered during growth of B. anthracis in bovine blood in vitro, and the bacterium exhibits valine-auxotrophy during growth in a medium that mimics blood serum. In addition, our recent RNA-seq data show that transcript levels of many BCAA- related genes are controlled by AtxA, the transcription regulator that positively affects expression of the anthrax toxin and capsule genes. We found that B. anthracis growth in defined media was severely restricted in the absence of exogenously added BCAAs, suggesting even when BCAA biosynthesis genes are expressed, BCAA transport is required for optimal growth in vitro. We created mutants deleted for one or multiple BCAA metabolism genes and examined the null-mutants for (1) growth in defined media, (2) the ability to import BCAAs, and (3) virulence in a murine model for anthrax. Here we report data indicating that the predicted BCAA transporter gene brnQ3 is required for optimal isoleucine and valine transport. A brnQ3- null mutant showed a growth defect in media containing limited concentrations of BCAAs. Moreover, the mutant was highly attenuated in a murine model for anthrax and tissues of surviving animals showed no B. anthracis CFU. Interestingly, full B. anthracis virulence also requires BCAA biosynthesis. An ilvD-null mutant lacking dihydroxy-acid dehydratase, an enzyme essential for BCAAs synthesis, exhibited unperturbed growth when cultured in media containing BCAAs, but was highly attenuated for virulence in the murine model. Our findings suggest that BCAA availability is a critical factor for B. anthracis dissemination and proliferation in host tissues.

30

#16

Distinct Contribution of the HtrA Protease and PDZ Domains to its Function in Stress Resilience and Virulence of Bacillus anthracis

Ofer Cohen, Ma'ayan Israeli, Uri Elia, Shahar Rotem, Hila Cohen, Avital Tidhar, Adi Bercovich-Kinori, Theodor Chitlaru

Department of Biochemistry and Molecular Genetics, Israel Institute for Biological Research, Ness-Ziona, Israel

The chaperone/protease HtrA (High Temperature Requirement A of B. anthracis) is an important pathogenicity determinant of B. anthracis. Consequently, disruption of the htrA gene, results in significant virulence attenuation, despite unaffected ability of DhtrA strains to synthesize the exotoxins. B. anthracis DhtrA strains exhibited increased sensitivity to stress regimens as well as silencing of the secreted starvation-associated Neutral Protease A (NprA) and down-modulation of the bacterial S-layer. The virulence attenuation associated with disruption of the htrA gene was suggested to reflect the susceptibility of DhtrA mutated strains to stress insults encountered in the host. As all HtrA serine proteases, HtrA exhibits a protease catalytic domain and a PDZ domain. We interrogated the relative impact of the proteolytic activity (mediated by the protease domain) and the PDZ domain (presumably necessary for the chaperone activity and/or interaction with substrates) on manifestation of phenotypic characteristics mediated by HtrA. By inspecting the phenotype exhibited by DhtrA strains trans-complemented with either a wild-type, truncated (DPDZ), or non-proteolytic form (mutated in the catalytic serine residue) of HtrA, as well as strains exhibiting modified chromosomal alleles, it is shown that: (i) the proteolytic activity of HtrA is essential for its N- terminal autolysis and subsequent release into the extracellular milieu, while the PDZ domain was dispensable for this process, (ii) the PDZ domain appeared to be dispensable for most of the functions related to stress resilience as well as involvement of HtrA in assembly of the bacterial S-layer, (iii) conversely, the proteolytic activity but not the PDZ domain, appeared to be dispensable for the role of HtrA in mediating up-regulation of the extracellular protease NprA under starvation stress, and (iv) in a murine model of anthrax, the HtrA PDZ domain, was dispensable for manifestation of B. anthracis virulence. The unexpected dispensability of the PDZ domain may represent a unique characteristic of B. anthracis HtrA amongst bacterial serine proteases of the HtrA family.

31

#17

The sequence of the universal bacterial DNA repair protein Mfd dictates the pathogenicity of Bacillus cereus strains

Delphine Cormontagne1, Seav-Ly Tran1, Samantha Samson2, Solène Albert1,2, Gwenaëlle André-Leroux2 and Nalini Ramarao1

1Micalis Institute, INRAE, AgroParisTech, Université Paris-Saclay, 78350 Jouy-en- Josas, France. 2Maiage, INRAE, AgroParisTech, Université Paris-Saclay, 78350 Jouy-en-Josas, France.

The bacterial protein Mfd (mutation frequency decline) is highly conserved among bacteria and has been shown to be involved in bacterial DNA repair. We have recently shown that this protein confers bacterial resistance to the host nitrogen response produced during an infection by the immune system. Indeed, Mfd helps preserving DNA integrity and is involved in the repair following NO-induced DNA damage. Using a large collection of Bacillus cereus strains with various pathogenicity, we could further establish a link between Mfd sequences, protein 3D structures and virulence. Protein sequence comparison and 3D modelling were used to determine specific domains involved in the virulence of B. cereus. Using an in vivo insect model of infection, we show that the mfd gene of a pathogenic strain could complement the avirulent phenotype of a non-pathogenic strain. These data strongly suggest that the 3D structure of Mfd plays an essential role in its function and might be a new and interesting way to discriminate pathogenic from harmless B. cereus strains. As Mfd is widely conserved within bacteria, those findings could improve our understanding on the pathogenicity of potentially a large spectrum of bacteria.

32

#18

AtxA-controlled Small RNAs of Bacillus anthracis Virulence Plasmid pXO1 Regulate Gene Expression in trans

Ileana D. Corsi1,2, Soumita Dutta1, Ambro van Hoof1,2, Theresa M. Koehler1,2

1Department of Microbiology and Molecular Genetics, McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX, United States 2MD Anderson Cancer Center and UTHealth Graduate School of Biomedical Sciences, The University of Texas, Houston, TX, United States

Small regulatory RNAs (sRNAs) are short transcripts that base-pair to mRNA targets or interact with regulatory proteins. sRNA function has been studied extensively in Gram-negative bacteria; comparatively less is known about sRNAs in Firmicutes. Here we investigate two sRNAs encoded by virulence plasmid pXO1 of Bacillus anthracis, the causative agent of anthrax. The sRNAs, named “XrrA and XrrB” (for pXO1-encoded regulatory RNA) are abundant and highly stable primary transcripts, whose expression is dependent upon AtxA, the master virulence regulator of B. anthracis. sRNA levels are highest during culture conditions that promote AtxA expression and activity, and sRNA levels are unaltered in Hfq RNA chaperone null-mutants. Comparison of the transcriptome of a virulent Ames-derived strain to the transcriptome of isogenic sRNA-null mutants revealed multiple 4.0- to >100-fold differences in gene expression. Most regulatory effects were associated with XrrA, although regulation of some transcripts suggests functional overlap between the XrrA and XrrB. Many sRNA-regulated targets were chromosome genes associated with branched-chain amino acid metabolism, proteolysis, and transmembrane transport. In silico analysis revealed complementarity between XrrA and the 5’ UTR of seven mRNA transcripts whose expression is affected by the sRNA, suggesting base-pairing interactions. A translational fusion of one of these targets, the secreted metalloprotease inhA1, to GFP suggests XrrA-mediated regulation of protease translation. Finally, in a mouse model for systemic anthrax, the lungs and livers of animals infected with xrrA-null mutants had a small reduction in bacterial burden, suggesting a role for XrrA in B. anthracis pathogenesis. XrrA and XrrB are the first reported sRNAs of B. anthracis. Future work will focus on the molecular basis for sRNA function, including investigations of potential RNA and/or protein interacting partners of XrrA and XrrB.

33

#19

Encapsulation with D isomer poly-g-glutamic acid, an especially poor TLR ligand, inhibits human dendritic cell responses to Bacillus anthracis

Tanya M. Jelacic*, Wilson J. Ribot*, Donald J. Chabot*, Jennifer Chua*, Steven A. Tobery*, Anne E. Boyer†, Adrian R. Woolfitt†, John R. Barr†, and Arthur M. Friedlander*,‡

*United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland 21702; †Centers for Disease Control and Prevention, National Center for Environmental Health, Atlanta, Georgia 30341; ‡Department of Medicine, Uniformed Services University of Health Sciences, Bethesda, MD 20814

The poly-g-glutamic acid (PGA) capsule produced by Bacillus anthracis (Ba) is composed entirely of D isomer glutamic acid while non-pathogenic Bacillus species produce mixed D, L isomer PGAs. To determine if Ba PGA confers a pathogenic advantage over other PGAs, we compared the responses of human innate immune cells to Ba PGA and PGAs from non- pathogenic B. subtilis subsp. chungkookjang (Bs) and B. licheniformis (Bl). Monocytes and immature dendritic cells (iDCs) responded differentially to the PGAs with Ba PGA being least stimulatory and Bl PGA most stimulatory. All three elicited IL-8 and IL-6 from monocytes, but Bs PGA also elicited IL-10 and TNFa while Bl PGA elicited all those plus IL-1b. Similarly, all three PGAs elicited IL-8 from iDCs, but Bs PGA also elicited IL-6, and Bl PGA elicited those plus IL-12p70, IL-10, IL-1b, and TNFa. Only Bl PGA induced DC maturation. TLR assays also yielded differential results. Bs PGA and Bl PGA both elicited more TLR2 signal than Ba PGA, but only responses to Bs PGA were affected by a TLR6 neutralizing antibody. Bl PGA elicited more TLR4 signal than Ba PGA while Bs PGA elicited none. Thus, Ba PGA is recognized less effectively than PGAs from non-pathogenic Bacillus species. During infection, encapsulation protects Ba from phagocytosis. We hypothesized that encapsulation provides a further pathogenic advantage by shielding more inflammatory antigens on the bacillus surface. To test this, we exposed human iDCs to increasing multiplicities of infection (MOIs) of killed Ba bacilli from the fully encapsulated wild type Ames strain (WT) and an isogenic capsule deficient strain (capA mutant). Both strains elicited robust cytokine responses, but IL-23, TNFa, and IL-10 were significantly reduced in response to the encapsulated WT strain compared to capA mutant up to a MOI of 15. CapA mutant bacilli could induce phenotypic maturation of iDCs with upregulation of MHCs I and II, CD83, and CCR7 at a MOI of 3.75 while encapsulated WT bacilli didn’t induce significant upregulation of MHCs I and II at a MOI of 15. DCs exposed to capA mutant bacilli (MOI 3.75) exhibited CCR7 dependent chemotaxis comparable to LPS stimulated controls while DCs exposed to encapsulated WT bacilli exhibited significantly less chemotaxis. We conclude that capsule fails to induce a robust host response and shields more inflammatory surface antigens, delaying an adaptive immune response by reducing TNFa and thereby inhibiting DC maturation.

34

#20

Enhanced Germination of Heat Activated Bacillus anthracis Spores Persists Over a Five-week Period

Andrew Roser1, Blake Roberson1, Rebecca Giorno1

1Louisiana Tech University, USA

Bacteria of the Bacillus genera can form dormant and resilient cells called spores in response to starvation. These dormant spores can be reactivated in the presence of nutrients by a process called germination. Historically, spores are exposed to sublethal heat treatments to increase the extent and rate of germination. This process is known as heat activation. Previous studies on Bacillus cereus T indicate that effects of heat activation are reversible within 72 hours. After this time, the spores must be reactivated. However, recent experiments by our lab suggest that this might not be the case for Bacillus anthracis spores. B. anthracis Sterne spores were prepared by exhaustion in DSM and extensively water washed. Each sporulation was split into three samples: no heat treatment (UH), heat activated on day zero of the experiment (HA), and heat activated on the same day of measurement relative to day 0 (Hn). Spores were heated at 65oC for 30 minutes, cooled on ice for 15 minutes, and warmed to room temperature. Germination was initiated with 1mM inosine paired with either 1mM L-alanine or 1mM L- serine in 20 mM Tris pH 7.5 and was measured by the loss of OD at 580nm. Assays were performed on various days up to five weeks. As expected, heat activation had a positive impact on spore germination with either germinant pair. On day zero using L-alanine and inosine, UH spores had an OD loss of 33% while HA and H0 spores had an OD loss of 58% and 59%, respectively, after 60 minutes. On day 35, UH spores had only 38% OD loss compared to HA and H35 with 62% and 65%, respectively. A similar trend was observed with L-serine and inosine, with the exception of day 35 where HA spores germinate to a lesser extent than H35, 50% and 58% OD loss, respectively. Our data suggest that B. anthracis spores remain activated for at least 35 days after heating. This may have broader impacts on our understanding of heat activation among Bacillus species.

35

#21

Characterization of Bacillus anthracis spores lacking dipicolinate synthase

Chandler Hassan, Tiffany Mata, and Ernesto Abel-Santos

University of Nevada, Las Vegas Department of Chemistry and Biochemistry Las Vegas, NV 89154

Anthrax is a disease that occurs in individuals following exposure to Bacillus anthracis spores. Inhalation of spores leads to the most severe form of the disease. Following phagocytosis by alveolar macrophages, spores are transported to the lymph nodes during which they germinate inside the phagosome. The outgrowing bacteria begin toxin production one to three hours post-infection; eventually killing the macrophage before escaping to the bloodstream where extracellular multiplication occurs. Newly germinated B. anthracis cells are devoid of protective structures afforded by the spore composition. Hence, this nascent form of B. anthracis should be the most vulnerable to macrophage attack. The mechanism used by the newly germinated B. anthracis cells to survive within the macrophage is not completely understood. Upon germination, the cell excretes a large depot of calcium complexed with dipicolinic acid (Ca-DPA). Intracellular calcium overload can disrupt signaling pathways required for normal macrophage function and trigger cell death. In this study, the spores of B. anthracis mutants lacking dipicolinate synthase, the enzyme responsible for synthesizing DPA, have been characterized. The mutants sporulated normally but did not germinate via optical density assay. However, the mutants were able to form colonies, albeit at a lower frequency than wild type. Phase-contrast microscopy reveals a mixed population of phase-bright, phase-gray, and phase-dark spores among the mutants. Additionally, the mutant spores display an altered mineral content, including higher concentrations of calcium, and an increased sensitivity to heat.

36

#22

A novel pilus superfamily from the endospores of pathogenic Bacilli.

Brajabandhu Pradhan1,2,§, Janine Liedtke3,§ , Mike Sleutel1,2,§ , Toril Lindbäck3 , Ephrem Debebe Zegeye3, Kristin O´Sullivan3, Ann-Katrin Llarena3, Ola Brynildsrud3,4, Marina Aspholm3* , Han Remaut1,2*

1. Structural and Molecular Microbiology, VIB-VUB Center for Structural Biology, VIB, 1050 Brussels, Belgium. 2. Department of Bioengineering Sciences, Structural Biology Brussels, Vrije Universiteit Brussel, 1050 Brussels, Belgium. 3. Department of Paraclinical Sciences, Faculty of Veterinary Medicine, the Norwegian University of Life Sciences, PO Box 369 Sentrum, N-0102, Oslo, Norway 4. Division of Infection Control and Environmental Health, Norwegian Institute of Public Health, P.O. Box 222 Skøyen, 0213 Oslo, Norway § These authors contributed equally

Bacillus cereus sensu lato is a group of Gram-positive endospore-forming bacteria with high ecological diversity. Their endospores are decorated with micrometer-long appendages of unknown identity and function. Here we isolate endospore appendages (Enas) from the food poisoning outbreak strain B. cereus NVH 0075-95 and find proteinaceous fibers of two main morphologies: S- and L-Ena. By using cryo-EM and 3D helical reconstruction of S-Enas, we show these to represent a novel class of Gram-positive pili. S-Enas consist of single domain subunits with jellyroll topology that are laterally stacked by β-sheet augmentation. S-Enas are longitudinally stabilized by disulfide bonding through N-terminal connector peptides that bridge the helical turns. Together, this results in flexible pili that are highly resistant to heat, drought and chemical damage. Phylogenomic analysis reveals a ubiquitous presence of the ena gene cluster in the B. cereus group, which include species of clinical, environmental, and food importance. We propose 31 Enas to represent a new class of pili specifically adapted to the harsh conditions encountered by bacterial spores.

37

#23

Measurement of interaction force between material and Bacillus spores

Anna IPATOVA1, Farzam ZOUESHTIAGH1, Alexis DUCHESNE1, Maureen DELEPLACE2, Christine FAILLE2, Pascal MARIOT3

1Univ. Lille, CNRS, UMR 8520 - IEMN, F-59000 Lille, France 2UMET, Univ. Lille, CNRS, INRAE, ENSCL, 369, Rue Jules Guesde, F-59650 Villeneuve d’Ascq CEDEX, France 3Univ. Lille, INSERM U1003, Bâtiment SN3, F-59655 Villeneuve d'Ascq, France

The force of interaction between bacteria and materials is an essential factor in the understanding of phenomena at interfaces and has been studied experimentally for years. Thus, many force-based techniques have been developed to evaluate the force of interaction between a particle and a surface. The method presented here is part of the single-cell micromanipulation to analyse the behaviour of individual cells, deriving from the patch-clamp technique. It consists of the aspiration of adherent particles with a micropipette, as described previously on mammalian cells (Salanki et al., 2014). In this technique, the micropipette is brought into contact with an adherent particle under the optical microscope, a given aspiration pressure is then applied and the pipette is pulled away from the particle at a given rate. If the particle does not detach, a higher aspiration pressure is applied and the experiment is repeated until the particle detach. The minimum pressure, allowing the detachment is used to calculate the adhesion force between the cell and the substrate. This method was adapted to quantify the interaction force between Bacillus spores and materials, with aspiration pressures ranging from -5 to -800 mbar. The development of the technique was first carried out using latex microspheres with a diameter of 1 µm and 3 µm. A droplet containing the microspheres was deposited on a glass slide previously cleaned with ethanol (final water contact angle of 50°) and left to dry (1 h or 24 h). Around 30 particles were analysed and curves giving the percentage of detached spores as a function of detachment force were drawn. Even under defined conditions, a huge variability was observed on the force required to detach the microspheres, which is in line with the results of the literature. The detachment curves were sigmoids, and the curve shape was clearly affected by the size of the microsphere and the time of drying with average values of 12.1 nN and 22.6 nN for 1 µm and 3 µm after 1 h of drying and 18 nN and 36.5 nN after 24 h of drying. Similar curves were obtained for the hydrophilic B. subtilis PY79 spores with average interaction forces of 1.7 nN and 5.1 nN after 1 h and 24 h of drying. Furthermore, with the highly hydrophobic B. cereus 98/4 spores, known to be very adherent to various surface, most spores remained attached even at the higher aspiration pressures and the average values of the detached spores were 102.4 nN after 1 h of drying.

38

#24

Foam Flow: An Eco-Efficient Strategy for Cleaning of Contaminated Industrial Equipment

H. DALLAGI1, M. ARTHUR1, A. AL-SAABI1, P. K. JHA1, M. DELAPLACE1, L. BOUVIER1, L. WAUQUIER1, F. ALOUI2, C. FAILLE1*, T. BÉNÉZECH1*

¹ UMET, Univ. Lille, CNRS, INRAE, ENSCL, 369, Rue Jules Guesde, F-59650 Villeneuve d’Ascq CEDEX, France. ² LAMIH UMR CNRS 8201, Polytechnic University of Hauts-de-France (UPHF) Department of Mechanics, Campus Le Mont Houy 59313 Valenciennes Cedex 9 – France

In the food industry, cleaning of contaminated surfaces requires adoption of new strategies that can provide higher cleaning efficiency with a minimal energy and water consumption for environmental concerns. Cleaning using wet foam flow can represent an innovative method due to the interesting foam mechanical properties e.g., generation of significant drag forces generated by the bubbles’ passage and the chemical properties of the surfactant as a cleaning agent. In this study, foam flow cleaning (50% air/water and Sodium Dodecyl Sulfate (SDS, 0.15 w/w)) was compared to cleaning-in-place (CIP) conditions (same surfactant). The consequences in terms of cleaning of the use of foam was investigated on a B. cereus biofilm, produced on 2B stainless steel coupons as follows: coupons were immersed horizontally in a soiling suspension containing 107 CFU/ml of a 24 h culture of B. cereus 98/4. Coupons were kept at 30°C for 24 h. Half of the coupons were directly analyzed after rinsing (enumeration of the cultivable cells, observation under microscope). The other coupons were subjected to different times of cleaning procedures (CIP at a mean wall shear stress of 10 Pa; foam cleaning at 2, 6, and 10 Pa) and analyzed as above. The 24 h-biofilms (stained with orange acridine) were composed of medium-sized clusters (a few dozens to a few hundred bacteria) separated with less contaminated areas with many single cells or very small clusters. After cleaning for 20 min with foam, the number of small clusters and isolated cells had greatly diminished while the larger clusters seemed to have resisted better to detachment. The observation of the detachment curves with foam showed close detachment kinetics whatever the shear stress. Two phases were clearly observed, the first being characterized by a very fast detachment (around 1.5 log in <1 min), the second by a much slower detachment and the percentage of residual adherent bacteria after 20 min was around 1.5. When a CIP procedure was applied, the first phase, corresponding to a rapid detachment, was shorter, resulting in a greater number of residual adherent bacteria. Furthermore, almost no detachment was observed in the second phase of the detachment kinetics. In conclusion, foam cleaning seems to be at least as effective as conventional cleaning, despite a drastic reduction in water (13 times less) and energy (33 times less) consumption.

39

#25

Dating points along the phylogeny of Bacillus anthracis

Gilles VERGNAUD

University Paris-Saclay, France; [email protected]

Within the Bacillus cereus group, Bacillus anthracis shows a strictly clonal evolution due to its ecology. B. anthracis is an obligate pathogen with no evidence for significant replication outside of its mammalian hosts and no opportunities for recombination. This behavior allowed deducing topologically unambiguous phylogenetic trees from whole genome sequence data. However, no temporal signal could be detected in the genetic data presumably because the sporulated form can stay viable for decades in the environment [1]. Branch length expansion rate may vary greatly according to infection cycles opportunities in different ecosystems. Consequently, it has not been possible to infer dating points along the phylogenetic tree of B. anthracis with the methods applied to other pathogens such as Mycobacterium tuberculosis, which display a much more stable evolution pattern over time. The first robust dating point was proposed in 2016 based on the combined analysis of the topology of B. anthracis phylogeny and of historical time periods. We could show that the dominant lineage in North America, called WNA, was derived from a lineage found exclusively in Western Europe (France, Spain, Italy), indicative of a post-Columbian introduction [2]. We proposed that the remarkably faster branch length expansion achieved by B. anthracis after reaching North America reflects the recent arrival in a naïve ecosystem, and suggested that the arrival of B. anthracis in Eastern Canada in the seventeenth century was the first step towards the almost extinction of American Bison [3]. The finding of such a modern emergence for one major lineage prompted us to reexamine the origins of B. anthracis. The presence in Central Africa of B. cereus strains carrying both B. anthracis virulence plasmids [4] suggests that B. anthracis emerged from Central Africa with the advent of pastoralism approximately 5000 years ago. This hypothesis allows organizing the phylogenetic tree of extant B. anthracis lineages and uncovering evidence of four major historical Out-of-Africa departures. In this presentation, I will further explore public sequence data to test some of the proposed hypotheses and investigate in more details correlations between the phylogeography of B. anthracis and recent human history.

[1] Sahl et al. (2016). MBio 7. [2] Vergnaud et al. (2016). PLoS One 11, e0146216. [3] Vergnaud. (2020). Erciyes Med J 42, 362-369. [4] Antonation et al. (2016). PLoS Negl Trop Dis 10, e0004923.

40

#26

Signatures of selection in core and accessory genomes suggest ecological diversification between clades of Bacillus cereus sensu lato

White, H.1, Bayliss, S. C.2, Sharma, M.1, Pascoe, B.2, Vos, M.1, Sheppard, S. K.2, and Raymond, B.1

1 Department of Biosciences, University of Exeter, Exeter, UK 2 The Milner Centre for Evolution, Department of Biology and Biochemistry, University of Bath, Bath, UK

The Bacillus cerus sensu lato (Bc sl) group consists of a diverse collection of strains, which cluster together into cohesive genetic clades. Despite high levels of genetic similarity between clades, there is growing evidence that each clade is ecologically distinct. This raises two important questions; firstly, whether niche-based selection is driving divergence between clades, and secondly, which parts of the genome are under selection in each clade. Understanding how clade and ecology relate to one another will help predict pathogenicity and inform production of Bacillus-derived bio-pesticides. We used allelic diversity amongst core genes from 352 genomes in three clades to identify signatures of recent selection, inferring that genes under diversifying and purifying selection would have extremely high or low diversity respectively. Meanwhile, accessory genes of interest were identified by clade-specific distribution ; in other words, their presence in one clade and absence from the others. Gene ontology analysis was then used to determine which functional categories were over- or under- represented amongst genes under putative strong selection. We found that functional enrichment was strongly shaped by clade amongst both core genes and accessory genes, supporting the hypothesis that niche-based selection was occurring and differed between clades. Additionally, many of these enriched functions can be linked to ecological roles previously associated to each clade, such as insect pathogenicity for the clade containing the majority of Bacillus thuringiensis strains and psychrotolerance for the clade containing mycoides strains. Some of these functions were only enriched amongst the core genes or accessory genes respectively. These results suggest that both core and accessory genes play a key role in determining strain ecology, and that signatures of selection may provide a means to identify Bc sl clades.

41

#27

A novel Bacillus thuringiensis strain: A highly dynamic plasmid environment

Nancy Fayad1,2, Jacques Mahillon2, Mireille Kallassy Awad1

1 Laboratory of Biodiversity and Functional Genomics, UR-EGP, Faculty of Science, Université Saint-Joseph de Beyrouth, Beirut, Lebanon; 2 Laboratory of Food and Environmental Microbiology, Earth and Life Institute, UCLouvain, Louvain-la-Neuve, Belgium

Bacillus cereus sensu lato is a group of nine phylogenetically close but ecologically very diverse species. One of the most studied members of this group is Bacillus thuringiensis, used worldwide as a biopesticide thanks to its entomopathogenic capacities. Remarkably, this species differs from the rest of the group by the high plasmidial variety it harbours, notably the toxin-carrying plasmids. They form up to 30.6% of its plasmid pool and are important for, not only the insecticidal activity, but also for other cellular functions such as sporulation, germination, or horizontal gene transfer. Other plasmid types are also found in B. thuringiensis strains, such as conjugative plasmids, responsible in intra-cellular movement, or those carrying clusters for the production of bioactive molecules or genes implicated in biofilm formation.

In this study, a novel B. thuringiensis strain, H3, was isolated from Lebanese soil, and characterized at an in vivo, genomic and proteomic levels. Following whole genome sequencing of H3, three megaplasmids were found in this strain: pH3-552, pH3-101 and pH3-180. The latter carries 11 novel cry genes, 8 of which are assembled in genes with an orf1-gap-orf2 organization, where orf2 is a potential Cry4-type crystallization domain. Toxins encoded by these 11 cry genes are found within H3 parasporal crystal that displays an unusual killing profile with a higher LC50 than the reference B. thuringiensis serovar israelensis crystal proteins. In addition, H3 has a different toxicity order: it is more toxic to Aedes albopictus and Anopheles gambiae than to Culex pipiens. On another plasmidial aspect, pH3-180 holds a wide repertoire of mobile genetic elements that amount to ca. 22% of its size, including novel insertion sequences and class II transposable elements. The two other large plasmids present in H3 carry genetic determinants for the production of many interesting molecules - such as chitinase, cellulase and bacitracin - that may add up to H3 bioactive properties. This study therefore reports a novel mosquitocidal Bacillus thuringiensis strain with unusual Cry toxin genes in a rich mobile DNA environment.

42

#28

tip, the intriguing transfer locus of pXO16, a conjugative plasmid from Bacillus thuringiensis serovar israelensis

Pauline Hinnekens, Audrey Leprince, Jacques Mahillon

Laboratory of Food and Environmental Microbiology, Earth and Life Institute, Université catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium pXO16, the 350 kb conjugative plasmid from Bacillus thuringiensis serovar israelensis, was first described for inducing the formation of macroscopic aggregates during conjugation under liquid conditions1. Even though it enhances pXO16 transfer efficiency, the aggregation mechanism is not mandatory for the plasmid transfer and pXO16 can potentially “circulate” among all members of the Bacillus cereus group2. Yet, this is contrasting with pXO16's known natural distribution, which is apparently limited to the israelensis serovar of B. thuringiensis. pXO16’s unique abilities for self-transfer and mobilization have also been highly investigated. pXO16 is indeed able to transfer itself at high frequencies, to mobilize and retro-mobilize non- conjugative plasmids, including “non-mobilizable” plasmids, and to transfer chromosomal loci3. Even though pXO16 kinetics and frequencies of transfer have been studied in great details, limited information has been gathered so far on its conjugative apparatus, mainly due to poor homology with known conjugative mechanisms. This reinforces the unique character of pXO16 transfer system and the need to understand the underlying mechanism. Recent work delimitated a 25 kb region, the tip (transfer of israelensis plasmid) locus, encoding 16 proteins, TipA to TipP, putatively involved in pXO16 conjugation3. Within this region, the FtsK/SpoIIIE ATPase TipL was identified and characterized as essential for pXO16 transfer. TipL was proposed as the coupling protein of pXO16 T4SS, while the ATPase TipH was presented as a VirB4-like protein, a signature-protein of T4SS3. Bioinformatics analyses suggested TipB as the cell-wall hydrolase and recent work successfully demonstrated the protein cell-wall activity4. Bioinformatics and experimental data also suggest an essential role of the membrane protein TipA and TipE, presented as channel components of pX16 T4SS5. Information is still missing concerning pXO16 relaxosome as no relaxase could be detected through homology searches. Work is focusing on tipO, coding for a putative helicase, and tipP as preliminary data indicate a potential role in pXO16 maintenance for both genes and a possible DNA binding and nicking activity for TipO5. Since gene proximity from the putative relaxosome is expected, studies are focusing on this region for oriT search.

References 1. Andrup, L., Damgaard, J. & Wassermann, K. Mobilization of small plasmids in Bacillus thuringiensis subsp. israelensis is accompanied by specific aggregation. J. Bacteriol. 175, 6530-6536 (1993). 2. Hinnekens, P., Koné, K. M., Fayad, N., Leprince, A. & Mahillon, J. pXO16, the large conjugative plasmid from Bacillus thuringiensis serovar israelensis displays an extended host spectrum. Plasmid 102, 46-50 (2019). 3. Makart, L., Gillis, A., Hinnekens, P. & Mahillon, J. A novel T4SS-mediated DNA transfer used by pXO16, a conjugative plasmid from Bacillus thuringiensis serovar israelensis. Environ. Microbiol. 20, 1550-1561 (2018). 4. Hinnekens, P., Leprince, A. & Mahillon, J. In preparation. 5. Hinnekens, P. & Mahillon, J. Unpublished data.

43

#29

Viral proteins involved in the adsorption process of phage Deep-Purple infecting members of the Bacillus cereus group

Audrey Leprince, Manon Nuytten, Jacques Mahillon

Laboratory of Food and Environmental Microbiology, Earth and Life Institute, Université catholique de Louvain, B-1348 Louvain-la-Neuve, Belgium

The phage life cycle is initiated by the interaction between viral proteins and specific receptor at the bacterial surface. This adsorption step is a key determinant of the phage host spectrum and also the main target of resistance mechanisms developed by bacteria to overcome phage infection. Thus, in the light of the increase interest for phage in medical and industrial applications, it is paramount to characterize the molecular mechanisms underlying phage-host primary interactions. In this work, we were interested in identifying and characterizing the phage structural proteins involved in the adsorption of Deep-Purple, a Siphoviridae (i.e. phage possessing a long non contractile tail) infecting members of the B. cereus group [1]. Commonly, the central actors in the adsorption step are structures called Receptor Binding Proteins (RBP) which are responsible for the specific recognition of the bacterial host and subsequent triggering of genome delivery. However, recently, another type of adsorption associated protein, called evolved Distal tail (evoDit) proteins, were identified in Siphoviridae infecting Lactic Acid Bacteria (LAB). These proteins were previously thought to have only a structural role, but it appears that the presence of a carbohydrate-binding module (CBM) allows them to interact with the host surface and thus assist the RBP. Bioinformatic analysis of Deep-Purple tail protein- encoding region allowed to identify gp28 and gp29 as the putative evoDit protein and RBP, respectively. Both proteins contain a CBM, suggesting that these proteins can interact with host associated polysaccharides. When fused to a fluorescent tag, both proteins were able to decorate the bacterial surface but differences in binding spectra were observed. The RBP-gp29 only recognized strains that are sensitive to the phage whereas evoDit-gp28 bound to many strains including some that are insensitive to Deep-Purple, highlighting the fact that the evoDit is not the sole determinant of subsequent phage replication. A detailed the characterization of both RBP-gp29 and evoDit-gp28 will be presented, together with their respective involvement in Deep-Purple adsorption.

References 1. Hock, L., Gillis, A., & Mahillon, J. Complete genome sequence of bacteriophage Deep- Purple, a novel member of the family Siphoviridae infecting Bacillus cereus. Arch. Virol. 163, 2555-2559 (2018).

44

#30

New insights into the emetic toxin cereulide: Means of distribution, synergistic actions and prevention strategies

Markus Kranzler1; Timo D. Stark2; Veronika Walser2; Thomas Hofmann2; Monika Ehling- Schulz1

1Institute of Microbiology, Department of Pathobiology, University of Veterinary Medicine Vienna, Veterinärplatz 1, A-1210 Vienna, Austria (E-Mail: [email protected]) 2Chair of Food Chemistry and Molecular Sensory Science, Technical University of Munich, Lise-Meitner-Straße 34, D-85354 Freising, Germany

The emetic toxin cereulide, a 1.2 kDa small dodecadepsipeptide produced by Bacillus cereus, is responsible for food intoxications leading to illness, vomiting, and, in some cases, also to severe organ failures. Generally, the toxin is pre-formed in contaminated foods. Its chemical structure makes it resistant against heat-treatment, proteolysis, hydrolysis, and due to its size, it is not filterable. Thus, prevention strategies of cereulide are of utmost importance, as recall actions and outbreaks constitute economic and medical challenges. As the incidence of B. cereus is ubiquitous, prevention strategies against contaminations with cereulide are needed. Furthermore, to this date, at least 18 isovariants of cereulide are known, which differ from the conventional toxin in the exchange of single amino acids but also in their toxic potential. For instance, isocereulide A showed an 8- to 10-fold increased cytotoxicity compared to cereulide. In this current work, we focused on investigating the influence of parameters, such as carbon source, amino acid availability, pH value and temperature, on the formation of cereulide and its isoforms. Mechanisms of toxin spreading were elucidated by spiking of cereulide to spores of B. cereus and other, partly apathogenic spore formers, which previously showed high resistance against thermal inactivation, making them relevant in food processing. Inhibition of cereulide formation and isoforms was tested by a screening of natural substances, which are in use in the food industry or are compounds of food ingredients. We could identify molecules that inhibit bacterial growth and also abolish specifically the transcriptional rate of the ces gene, encoding for the cereulide assembling non-ribosomal peptide synthetase. The most efficient substances were assayed in model foods that were previously shown to support the formation of cereulide, by using bioluminescent reporter strain. By this study, we provide knowledge on environmental parameters influencing cereulide production and its dissemination, and present approaches in order to reduce food intoxications linked to this emetic toxin.

45

#31

Bacillus cereus growth and cereulide formation in different food matrices

Katia Rouzeau-Szynalski1, Mariem Ellouze1, Nathália Buss Da Silva2, Laura Coisne1, Frédérique Cantergiani1 and József Baranyi3 1 Food Safety Microbiology, Institute of Food Safety and Analytical Sciences, Food Safety Research Department, Nestlé Research, Lausanne, Switzerland.2 Laboratory of Food Microbiology, Wageningen University & Research, Wageningen, The Netherlands.3 Institute of Nutrition, University of Debrecen, Hungary.

Introduction: Bacillus cereus can cause food poisoning through the emetic toxin known as cereulide. It can be pre-formed in food, is extremely thermostable and therefore ends up in the finished product after the production line. The growth of B. cereus and cereulide production can occur during inappropriate time/temperature storage conditions throughout processing steps in the production chain. Limited knowledge is currently available on both B. cereus growth and the potential to produce cereulide in food matrices under different environmental conditions (e.g. temperature, matrices). In this study, experiments were carried out in five different matrices (brain heart infusion synthetic medium (BHI), cereal-based, dairy-based, meat-based and vegetable-based products) to study and compare the ability of the different matrices to support both B. cereus growth and cereulide formation. Methodology: 10 g individual portions (solid matrices) or 100 ml (liquid matrices) of each matrix were inoculated to reach 102 CFU/ml or g with the emetic B. cereus reference strain F4810/72. The samples were incubated at temperatures ranging from 9 °C to 45 °C. At defined times, adequate dilutions were plated on Bacara (bioMérieux) agar plate for the B. cereus counts and incubated for 24 hours at 30°C. Simultaneously, samples were taken for the quantification of cereulide using an adapted LC-MS/MS method based on ISO method 18465:2017. At least three replicates were performed in each matrix and each temperature. Growth rates were then calculated by fitting the growth kinetic for each matrix and temperature by using DMFit. Time to reach 0.2 ng cereulide/g (corresponding to the limit of quantification) was computed by a linear interpolation between the last point below this value and the first one above 0.2 ng/g. Results: Growth rates showed that the studied strain had higher growth rates in BHI over the tested temperature range, followed by vegetable-based product, dairy-based product, meat- based product, and finally cereal-based product. For example, the growth rates (h-1) at 30°C are in average 2.547 for BHI, 1.869 for vegetable-based product, 1.530 for dairy-based product, 1.493 for meat-based product and finally 0.870 for cereal-based product. Concerning the time to reach 0.2 ng cereulide/g, a different trend was observed. Indeed, the time to reach this target was generally faster in cereal products and slowest in meat-based product within the temperature range tested. For example, at 30°C, the time to reach 0.2 ng/g was in average 8 hours for cereal-based product, 12 hours for BHI, dairy-based products, and 14 hours for meat- based products. For vegetable-based product, this time is 12 hours at 31°C. Conclusion: These results clearly demonstrated that a matrix showing faster growth will not always start to form cereulide earlier in time. The production of cereulide depends on the matrix and on environmental factors like the temperature. As growth data are not enough to extrapolate trends, cereulide data must be acquired to know whether a specific matrix will enhance or inhibit the formation of the toxin. Finally, this set of data can be used to model the growth and cereulide formation for each matrix and tested temperature range.

46

#32

Crystal structure and molecular docking studies of Bacillus cereus Haemolysin BL lytic component, HblL1

Lainey Williamson1, Harley Worthy1,2, Husam Sabah Auhim1,3, Stephen H. Leppla4, Inka Sastalla4,5, D. Dafydd Jones1, Pierre J. Rizkallah6, Colin Berry1

1 School of Biosciences, Cardiff University, Park Place, Cardiff CF10 3AX, UK 2 Current address, The Henry Wellcome Building for Biocatalysis, Exeter University, Stocker Road, Exeter EX4 4QD, UK 3 Current address, Department of Biology, College of Science, University of Baghdad, Baghdad, Iraq 4 Laboratory of Parasitic Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland, USA 5 Current address, Scientific Review Program, Division of Extramural Activities, NIAID, NIH, USA 6 School of Medicine, Cardiff University, Heath Campus, Cardiff CF14 4XN, UK

Haemolysin BL (Hbl) is a tripartite toxin implicated in the diarrhoeal syndrome of Bacillus cereus food poisoning. Plasma membrane insertion results in lytic pore formation and inflammasome-mediated mortality. All three Hbl components are required for activity, with recent work suggesting that a rate-limiting priming step involving HblB binding to target host receptors precedes lysis by HblL1 and HblL2. Whilst the structure of HblB is known, structures of HblL1 and HblL2 remain to be elucidated.

Here, we present the crystal structure of the HblL1 component at 1.36 Å resolution. Two almost parallel helical domains were identified in the overall fold which, similarly to the structurally related Haemolysin E (HlyE), appear to be able to hinge apart, potentially playing a role in pore formation. Two transmembrane (TM) regions were predicted in the hydrophobic beta tongue of domain two, in contrast to only one for HblB and none for HblL2. This distribution mimics that of the putative TM regions identified in the three components (NheA, NheB and NheC) of a further B. cereus tripartite non-haemolytic toxin, Nhe. This result, alongside studies showing sequential binding of HblB/NheC (one TM region) followed by HblL1/NheB (two TM regions) and finally HblL2/NheA (no TM regions), may indicate functionally equivalent pairs between the toxins. Since NheB and NheC, the proposed functional equivalents of HblL1 and HblB, have been shown to associate in solution, we used molecular docking and molecular dynamics studies to model the interaction of HblL1-HblB. Results suggest a head to tail dimer might form which enables the hydrophobic HblL1 beta tongue region to be buried. This conformation may play a role in assisting HblL1 solubility and priming of pore formation.

47

#33

Entry and trafficking of Bacillus anthracis edema factor.

Emilie TESSIER1, Annabelle GARNIER1, Clarisse VIGNE1, Laurence CHEUTIN1, Pierre GOOSSENS1,2, Jean-Nicolas TOURNIER1,2, Clémence ROUGEAUX1.

1Institut de Recherche Biomédicale de Armées, Bretigny-sur-Orge, France. 2Institut Pasteur, Paris, France.

Bacillus anthracis is the well known bacterial agent responsible of the anthrax disease. The virulence is notably associated with secreted toxins, formed of three components : the protective antigen (PA), the edema factor (EF) and the lethal factor (LF). So far, studies demontrated that PA was an essential prerequisite for natural endocytosis of EF and LF. After PA clivage by furin-like proteases, PA fixes two main cell-surface receptors, ANTXR1/TEM-8 (Tumor Endothelial Marker-8) and CMG2 ANTXR2/CMG-2 (Capillary Morphogenesis Protein-2), triggering pre-pore formation and the fixation of EF and/or LF. The toxin-receptor complex is then endocytosed. In our study, using fluorescent recombinant EF and commercial EF, we showed that EF alone was able to enter different cell lines, independantly of PA. Surprinsigly, when epithelial cells were intoxicated with EF or ET, only one pole allowed their entry, either the apical or the basolateral side, according to cell line, probably involving an active process. Pathways of endocytosis were explored in Raw264.7 and A549 cell lines searching for specificities in endocytosis process, different or not between EF and ET. Undoubtedly, this entry of EF alone is of interest to the bacteria. If PA is secreted later, it could constitute a stock, ready to be used when all the conditions are met.

48

#34

Clindamycin Protects Nonhuman Primates Against Inhalational Anthrax But Does Not Enhance Reduction of Circulating Toxin Levels When Combined With Ciprofloxacin

Nicholas J Vietri1, Steven A Tobery1, Donald J Chabot1, Susham Ingavale1, Brandon C Somerville1, Jeremy A Miller1, Chris W Schellhase2, Nancy A Twenhafel2, David P Fetterer3, Christopher K Cote1, Christopher P Klimko1, Anne E Boyer4, Adrian R Woolfitt4, John R Barr4, Mary E Wright5, Arthur M Friedlander6,7

1Division of Bacteriology, United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland, USA. 2Division of Pathology, United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland, USA. 3Division of Biostatistics, United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland, USA. 4National Center for Environmental Health, Centers for Disease Control and Prevention, Atlanta, Georgia, USA. 5Division of Clinical Research, National Institute of Allergy and Infectious Diseases, Bethesda, Maryland, USA. 6Headquarters, United States Army Medical Research Institute of Infectious Diseases, Frederick, Maryland, USA. 7Department of Medicine, Uniformed Services University of the Health Sciences, Bethesda, Maryland, USA

Background: Clindamycin is a protein-synthesis inhibitor and has anti-toxin activity in Gram positive bacteria. Despite the absence of animal data in anthrax, clindamycin was empirically and urgently given in combination antimicrobial therapy during the 2001 anthrax letter attacks to increase survival and has since been added to the Centers for Disease Control and Prevention’s guidelines. We evaluated the effect of clindamycin on circulating toxin levels and survival in nonhuman primates receiving clindamycin alone or in combination with ciprofloxacin. Methods: Rhesus macaques were divided into three groups receiving ciprofloxacin, clindamycin, or ciprofloxacin plus clindamycin. 172 LD50 of Bacillus anthracis spores were delivered via aerosol to each nonhuman primate. Antimicrobial treatment was begun after two consecutive positive blood cultures. Circulating lethal factor and protective antigen levels were measured prior to treatment and 1.5 and 12 hours after therapy was initiated. Results: For the first time in a nonhuman primate model, clindamycin was studied in inhalational anthrax and shown to improve survival. However, in this small experiment, survival was not statistically different between the groups. In the ciprofloxacin-only group, 9 of 9 (100%) macaques survived, compared with 8 of 11 in the clindamycin-only group and 8 of 11 macaques in the ciprofloxacin plus clindamycin group. Similarly, there were no significant differences between the groups comparing pre-treatment and 12-hour post-treatment lethal factor and protective antigen levels. Animals that died in the clindamycin-only arm had a greater incidence of meningitis due to anthrax compared to those in the ciprofloxacin or ciprofloxacin plus clindamycin groups, but the numbers were too small to draw a firm conclusion. Conclusion: This is the first study performed in nonhuman primates demonstrating that clindamycin improves survival in the setting of bacteremia caused by B. anthracis in an inhalational model. The ability to determine the effect of adding clindamycin to ciprofloxacin on overall survival could not be measured in this small experiment because 100% of the ciprofloxacin-only macaques survived. However, there were no differences in the decline of circulating lethal factor or protective antigen levels between the groups from pre-treatment to 12 hours after starting antibiotics.

49

#35

Treatment of Experimental Anthrax with Pegylated Circularly Permuted Capsule Depolymerase

Patricia M. Legler1*#, Stephen F. Little2*#, Jeffrey Senft2, Rowena Schokman2, John H. Carra2, Jaimee R. Compton1, Donald Chabot2, Steven Tobery2, David P. Fetterer2, Justin B. Siegel3, David Baker4, Arthur M. Friedlander2,5#

1Center for Bio/molecular Science and Engineering, U.S. Naval Research Laboratories, Washington, DC 20375. 2United States Army Medical Research Institute of Infectious Diseases, Frederick, MD 21702. 3Department of Chemistry, Biochemistry & Molecular Medicine, University of California, Davis, CA 95616, 4Department of Biochemistry, University of Washington, Seattle, WA 98195. 5Department of Medicine, Uniformed Services University of Health Sciences, Bethesda, MD 20814.

Capsule depolymerase is a γ-glutamyltransferase that anchors the capsule to the cell wall of Bacillus anthracis. The capsule is anti-phagocytic and essential for virulence. Encapsulated strains of B. anthracis can be treated with recombinant capsule depolymerase to enzymatically remove the capsule and promote phagocytosis and killing by human neutrophils. Here we show that mice infected with B. anthracis and treated by intraperitoneal injection of 40 mg/kg of a pegylated protein designed variant of capsule depolymerase, PEG-CapD-CPS334C, delivered 24 h post-exposure every 8 h for 2 days (6 injections) are protected. Mice infected with 382 LD50 of B. anthracis spores from a nontoxigenic encapsulated strain, were completely protected (10/10) after treatment with PEG-CapD-CPS334C while only 10% of control mice (1/10) survived with bovine serum albumin (P < 0.0001, log-rank analysis). Treatment of mice infected with 5 LD50 of a fully virulent toxinogenic, encapsulated B. anthracis strain with PEG- CapD-CPS334C protected 80% (8/10) of the animals while only 20% of controls (2/10) survived (P = 0.0125, log-rank analysis). This strategy effectively renders B. anthracis susceptible to the innate immune responses and does not rely on antibiotics. These findings suggest that enzyme-catalyzed removal of the capsule may be a potential therapeutic strategy for the treatment of multidrug- or vaccine-resistant anthrax and other bacterial infections.

50

#36

The novel diagnostic approaches for B. anthracis in Georgia

N. G Vepkhvadze, M. Kokhreidze, M. Donduashvili, M. Nikolaishvili, I. Beradze, M. Zakareishvili, A. Gulbani

State Laboratory of Agriculture (SLA), Tbilisi, Georgia

Anthrax is a zoonotic, infectious disease caused by the bacterium Bacillus anthracis. Infection most often involves the skin, gastrointestinal tract, or lungs in both humans and animals. Classified as especially dangerous pathogen and represents the threat for Bioterrorism. Virulent strains corresponding with two plasmids pXO1 and pXO2 unique genes that conform toxin production and capsule synthesis. B. anthracis is a member of the Bacillus cereus group of bacteria. There are six (6) genetically related species: B. cereus, B. anthracis, B. thuringiensis, B. mycoides, B. weibanstephanensis and B. pseudomycoides. The genomic homology exists between B. cereus, B. anthracis and B. thuringiensis. B. cereus contains anthrax-specific pXO plasmids. The purpose of the studies is to provide laboratories novel diagnostic approaches using RT-PCR assays for detection of B. anthracis that rely on plasmid encoded targets with a chromosomal marker to correctly differentiate pathogenic strain from non-anthracis Bacillus species. This study is being accomplished under the Biological Threat Reduction Program project with the support of the Defense Threat Reduction Agency (DTRA). For diagnostic purpose, used Real-Time PCR targeting chromosomal marker. Detection of the saspB gene (chromosomal marker) utilized a TaqMan Universal PCR Master mix, primers ANT-L: cagtaaaacaagcaaacgc, ANT-R:ctgatttgaactagaagattgtga and Probe 6FAM- tttgaatgctagcaccagaagctt-BBQ. Amplification was performed on Fast 7500 instrument under the following conditions: selected ROX as the passive reference dye, UNG activation (if UNG used) 50oC 2 min, Taq heat activation 95oC 10 min, Amplification 40 cycler, 95oC 15 sec, 60oC 60 sec. For this study we used n=20 POS culture samples conformed by bacteriology and received expected results. The novel diagnostic approaches give opportunity to distinguish B. anthracis from its near neighbor’s species and verify the presence of B. anthracis gene homologs in animals and environmental bacillus isolates.

51

Speakers

Last name First name Institute Country E-mail Alvarez-Mena Ana University of Malaga Spain [email protected] Barandongo Zoe University of Wisconsin-Madison United States [email protected] Chen Haibo Micalis, INRAE France [email protected] Chitlaru Theodor Israel Institute for Biological Research Israel [email protected] Cormontagne Delphine INRAE France [email protected] Corsi Ileana MD Anderson Cancer Center and UTHealth Graduate School of Biomedical Sciences United States [email protected] Dallagi Heni INRAE France [email protected] Dutta Soumita University of Texas Health Science Center United States [email protected] Fayad Nancy Université Saint-Joseph de Beyrouth Lebanon [email protected] Fioravanti Antonella VUB-VIB Belgium [email protected] Friedlander Arthur USAMRIID United States [email protected] Hassan Chandler University of Nevada Las Vegas United States [email protected] Hendricks Katherine Centers for Disease Control and Prevention United States [email protected] Hinnekens Pauline Earth and Life Institute, UCLouvain Belgium [email protected] Ho Theresa University of Iowa United States [email protected] Ipatova Anna Université de Lille France [email protected] Jha Piyush Kumar INRAE France [email protected] Kranzler Markus Institute of Microbiology, University of Veterinary Medicine Vienna Austria [email protected] Leprince Audrey Earth and Life Institute, UCLouvain Belgium [email protected] Lin Yicen Technical University of Denmark Denmark [email protected] Nauta Kelsie University of Iowa United States [email protected] Obreiter Tanya USAMRIID United States [email protected] Ochai Sunday University of Pretoria South Africa [email protected] Pradhan Brajabandhu VIB-VUB Center for Structural Biology Belgium [email protected] Roser Andrew Louisiana Tech University United States [email protected] Rouzeau-Szynalski Katia Nestlé Research-Institute of Food Safety and Analytical Sciences Switzerland [email protected] Smith Veronika University of Oslo Norway [email protected] Tessier Emilie IRBA France [email protected] Tomatsidou Anastasia University of Chicago United States [email protected] Toukabri Hasna Micalis, INRAE France [email protected] Vepkhvadze Nino State Laboratory of Agriculture Georgia [email protected] Vergnaud Gilles Institute for Integrative Biology of the Cell (I2BC) France [email protected] White Hugh University of Exeter United Kingdom [email protected] Williamson Lainey Cardiff University United Kingdom [email protected] Wright Mary National Institute of Allergy & Infectious Diseases United States [email protected] Zaide Galia Israel Institute for Biological Research Israel [email protected]

52