Journal of Cell Science 111, 2809-2818 (1998) 2809 Printed in Great Britain © The Company of Biologists Limited 1998 JCS3813 SPC72: a spindle pole component required for spindle orientation in the yeast Saccharomyces cerevisiae Sylvie Souès* and Ian R. Adams Laboratory of Molecular Biology, Medical Research Council Centre, Hills Road, Cambridge CB2 2QH, UK *Author for correspondence at present address: Institut de Génétique et de Microbiologie, Bât. 400, Université de Paris-Sud XI, 91 405 Orsay Cédex, France (e-mail: [email protected]) Accepted 7 July; published on WWW 27 August 1998 SUMMARY The monoclonal antibody 78H6 recognises an 85 kDa mating capability. Precisely, deletion of SPC72 resulted in component of the yeast spindle pole body. Here we identify a decreased number of astral microtubules: early in the cell and characterise this component as Spc72p, the product of cycle only few were detectable, and these were unattached YAL047C. The sequence of SPC72 contains potential coiled- to the spindle pole body in small-budded cells. Later in the coil domains; its overexpression induced formation of large cell cycle few, if any, remained, and they were unable to polymers that were strictly localised at the outer plaque align the spindle properly. We conclude that Spc72p is not and at the bridge of the spindle pole body. Immunoelectron absolutely required for nucleation per se, but is needed for microscopy confirmed that Spc72p was a component of normal abundance and stability of astral microtubules. these polymers. SPC72 was found to be non-essential for cell growth, but its deletion resulted in abnormal spindle Key words: Yeast, Spindle Pole Body, Astral microtubule, positioning, aberrant nuclear migration and defective Microtubule dynamic, Nuclear migration, Mating INTRODUCTION fails to orient the spindle towards the bud neck, with the consequence that nuclei fail to segregate appropriately (Palmer Microtubules play a key role in mitosis and mating of yeast. et al., 1992; Sullivan and Huffaker, 1992). Along with astral Based on morphological considerations, three classes have microtubules, several cytoplasmic motor proteins are been characterised: astral, kinetochore and non-kinetochore implicated in nuclear migration. For instance, dynein heavy (spindle) microtubules. In Saccharomyces cerevisiae, all three chain (encoded by DYN1) and its putative light chain (JNM1) classes originate from a microtubule organising centre known participate in the alignment of the spindle with the mother-bud as the spindle pole body (SPB). The SPB is a multi-layered axis (Li et al., 1993; Eshel et al., 1993; McMillan and Tatchell, disk-like structure which remains embedded in the nuclear 1994; Yeh et al., 1995). Given that dyneins (minus-end directed envelope throughout the cell cycle. The function of the three motors) appear to localise both at the nuclear envelope and at main layers is partially understood: a central plaque, which the cell cortex, it has been suggested that dyneins must dock constitutes the SPB core, spans the nuclear envelope, whereas astral microtubules to the bud neck in order to pull the spindle an outer plaque anchors astral microtubules in the cytoplasm; towards the mother-bud axis. Several of the proteins associated the inner plaque nucleates spindle microtubules in the nucleus with the cell cortex, such as actin, Num1p and the intermediate (Byers and Goetsch, 1975). This capability to nucleate filament-like protein, Mdm1p, have been shown to sustain the microtubules both at the outer and inner plaques requires the spindle orientation (Palmer et al., 1992; Farkasovsky and association of at least three components: Spc97p and Spc98p Küntzel, 1995; Fisk and Yaffe, 1997). Observation in live cells in the SPB, and Tub4p, the yeast homologue of γ-tubulin of DYN1 tagged with green fluorescence protein (GFP) allowed (Sobel and Snyder, 1995; Geissler et al., 1996; Marschall et al., Shaw et al. (1997) to detect highly dynamic astral microtubules 1996; Spang et al., 1996; Knop et al., 1997). Whether or not that were sensing the cell cortex in search of a bud. Thus rather these three proteins are sufficient to achieve nucleation and than on stable attachment, nuclear migration may depend on anchorage of microtubules at the SPB remains to be explored. multiple transient interactions between microtubules and the The role of spindle and astral microtubules has been cell cortex. investigated by genetic studies on TUB2, the unique gene The half-bridge appears as a horseshoe-like structure encoding β-tubulin in yeast (Huffaker et al., 1988; Sullivan and adjacent to the SPB, and is implicated in SPB duplication Huffaker, 1992; Reijo et al., 1994). Spindle microtubules are during mitosis as well as SPB fusion during mating (Byers involved in chromosome segregation (Hoyt and Geiser, 1996). and Goetsch, 1975). Astral microtubules generally nucleate Astral microtubules are essential for proper nuclear migration: at the SPB, but nucleation at the bridge also occurs early in a conditional mutant lacking astral microtubules (tub2-401) the cell cycle. During S phase, following SPB duplication, 2810 S. Souès and I. R. Adams microtubules arising from the bridge are directed towards the with the gene locus in diploid K842, proper His+ recombinants were bud; they frequently even penetrate into the bud. The function identified by PCR amplification of both ends of the expected insert, of these microtubules is not well established. During mating, using a combination of primers of about 20 bp. after fusion of G1 cells, microtubules originating from the A strain overexpressing Spc72p was prepared by introducing the S. pombe HIS5 selector gene followed by the GAL1-10 promoter bridge connect the SPB of the two partners, and apparently ′ pull the nuclei together before fusion. Several alleles of TUB2 immediately 5 to the SPC72 initiation codon. The strategy used was similar to that described for epitope tagging: the GAL1-10 promoter result in defective astral microtubules, causing improper was amplified from vector pJK404 (Donaldson and Kilmartin, 1996) nuclear positioning and fusion (Huffaker et al., 1988). Loss using primers containing KpnI and XhoI sequences, and inserted into of Kar3p (a minus-end directed motor) results in remarkably the pBS-3xHA-His5 vector at the remaining KpnI and XhoI sites of elongated microtubule bundles, which seem to prevent the polylinker. This Bluescript derivative (pBS-3xHA-His5-Gal1-10) congression of the nuclei (Rose, 1996). In mating cells, was used as template for an amplification reaction. As above, each Kar3p has been localised at both ends of astral microtubules; primer was designed with 18 bp of the template and 45 bp of the it could mediate sliding of astral microtubules as well as their targeted gene (either flanking or including the SPC72 initiation depolymerisation at the SPB (Meluh and Rose, 1990; Endow codon), and proper His+ recombinants were identified by PCR et al., 1994). amplification. The heterozygous strain was cultured at 30°C in YEP Rout and Kilmartin (1990) prepared a series of monoclonal medium containing 2% raffinose, and Spc72p overexpression was induced by addition of 2% galactose. antibodies directed against an extract enriched in SPB from Deletion of SPC72 open reading frame (ORF) was achieved by a Saccharomyces uvarum. Antibody 78H6 reacted weakly with one-step gene replacement method (Baudin et al., 1993). The an entity of apparent molecular mass 85 kDa, localised at the His3MX6 module was amplified by PCR; again, the forward cytoplasmic side of the SPB (Rout and Kilmartin, 1991). primer (AACACTAATATCAAAAAACTAAGCAAACAACATAA- More recently, we confirmed by matrix-assisted laser GAAAGTTATAGCCTCGACGGATCCCCGGGTTAATTA) and desorption/ionisation (MALDI) mass spectrometry that backward primer (AGAGTGACTGAGTGTTACATTAAATATATTT- extracts enriched in SPB contain a protein of apparent ATATATAAACGTATGATATATCATCGATGAATTCGAGCTCGTT) molecular mass 85 kDa, encoded by YAL047C (Wigge et al., were designed with at least 18 bp of the template and 45 bp flanking + 1998). Here we show that YAL047C encodes the antigen the SPC72 ORF (underlined), and proper His recombinants recognised by 78H6, and we provide evidence about the identified by PCR amplification. After sporulation of the heterozygous strain, tetrads were dissected, and two haploid strains function of this new SPB component. Our results confirm the of opposite mating type (both lacking SPC72) were selected. To localisation of Spc72p at the outer plaque of the SPB and express a Tub1p-GFP fusion protein in the heterozygous strain suggest that it also localises at the half-bridge structure. deleted for SPC72, the TUB1-GFP fusion sequence was recovered Functional characterisation implies that Spc72p either by gap-repair from strain ASF475 (Straight et al., 1997). stabilises or anchors astral microtubules and thus plays a key Centromere-based plasmid pRS314 (TRP/CEN) was digested with role in the complex processes of nuclear migration and KpnI and SacI of the polylinker and used to transform ASF475. Gap- mating. repaired plasmid was recovered from Trp+ yeast and used to transform E. coli TG2 cells by electroporation. One out of 24 E. coli transformants contained a recombinant plasmid with the TUB1-GFP sequence, which was transferred to the polylinker of integrative MATERIALS AND METHODS vector pRS304. Recombinant pRS304 was linearised with Bsu36I in TRP1 and used to transform the heterozygous strain deleted for General methods SPC72. Proper Trp+ recombinants were identified by PCR, and Yeast strains used in this study were all derived from K842 (MATa/α sporulated. Tetrads were dissected and the haploid strain (MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3 GAL psi+ ssd1- Spc72∆::HIS5 TRP1::TUB1-GFP) isolated. d2) described in Nasmyth et al. (1990); yeast growth media and yeast techniques used are described in Guthrie and Fink (1991), and pRS Cloning of SPC72 vectors used for DNA manipulation in yeast are described in Sikorski SPC72 was isolated by the method of gap-repair (Orr-Weaver et al., and Hieter (1989). Recombinant DNA methodology in E. coli was 1983). Sequences flanking the SPC72 ORF were amplified to performed as suggested in Sambrook et al.