DOCSLIB.ORG

SPC72: a Spindle Pole Component Required for Spindle Orientation in the Yeast Saccharomyces Cerevisiae

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SPC72: a Spindle Pole Component Required for Spindle Orientation in the Yeast Saccharomyces Cerevisiae Journal of Cell Science 111, 2809-2818 (1998) 2809 Printed in Great Britain © The Company of Biologists Limited 1998 JCS3813 SPC72: a spindle pole component required for spindle orientation in the yeast Saccharomyces cerevisiae Sylvie Souès* and Ian R. Adams Laboratory of Molecular Biology, Medical Research Council Centre, Hills Road, Cambridge CB2 2QH, UK *Author for correspondence at present address: Institut de Génétique et de Microbiologie, Bât. 400, Université de Paris-Sud XI, 91 405 Orsay Cédex, France (e-mail: [email protected]) Accepted 7 July; published on WWW 27 August 1998 SUMMARY The monoclonal antibody 78H6 recognises an 85 kDa mating capability. Precisely, deletion of SPC72 resulted in component of the yeast spindle pole body. Here we identify a decreased number of astral microtubules: early in the cell and characterise this component as Spc72p, the product of cycle only few were detectable, and these were unattached YAL047C. The sequence of SPC72 contains potential coiled- to the spindle pole body in small-budded cells. Later in the coil domains; its overexpression induced formation of large cell cycle few, if any, remained, and they were unable to polymers that were strictly localised at the outer plaque align the spindle properly. We conclude that Spc72p is not and at the bridge of the spindle pole body. Immunoelectron absolutely required for nucleation per se, but is needed for microscopy confirmed that Spc72p was a component of normal abundance and stability of astral microtubules. these polymers. SPC72 was found to be non-essential for cell growth, but its deletion resulted in abnormal spindle Key words: Yeast, Spindle Pole Body, Astral microtubule, positioning, aberrant nuclear migration and defective Microtubule dynamic, Nuclear migration, Mating INTRODUCTION fails to orient the spindle towards the bud neck, with the consequence that nuclei fail to segregate appropriately (Palmer Microtubules play a key role in mitosis and mating of yeast. et al., 1992; Sullivan and Huffaker, 1992). Along with astral Based on morphological considerations, three classes have microtubules, several cytoplasmic motor proteins are been characterised: astral, kinetochore and non-kinetochore implicated in nuclear migration. For instance, dynein heavy (spindle) microtubules. In Saccharomyces cerevisiae, all three chain (encoded by DYN1) and its putative light chain (JNM1) classes originate from a microtubule organising centre known participate in the alignment of the spindle with the mother-bud as the spindle pole body (SPB). The SPB is a multi-layered axis (Li et al., 1993; Eshel et al., 1993; McMillan and Tatchell, disk-like structure which remains embedded in the nuclear 1994; Yeh et al., 1995). Given that dyneins (minus-end directed envelope throughout the cell cycle. The function of the three motors) appear to localise both at the nuclear envelope and at main layers is partially understood: a central plaque, which the cell cortex, it has been suggested that dyneins must dock constitutes the SPB core, spans the nuclear envelope, whereas astral microtubules to the bud neck in order to pull the spindle an outer plaque anchors astral microtubules in the cytoplasm; towards the mother-bud axis. Several of the proteins associated the inner plaque nucleates spindle microtubules in the nucleus with the cell cortex, such as actin, Num1p and the intermediate (Byers and Goetsch, 1975). This capability to nucleate filament-like protein, Mdm1p, have been shown to sustain the microtubules both at the outer and inner plaques requires the spindle orientation (Palmer et al., 1992; Farkasovsky and association of at least three components: Spc97p and Spc98p Küntzel, 1995; Fisk and Yaffe, 1997). Observation in live cells in the SPB, and Tub4p, the yeast homologue of γ-tubulin of DYN1 tagged with green fluorescence protein (GFP) allowed (Sobel and Snyder, 1995; Geissler et al., 1996; Marschall et al., Shaw et al. (1997) to detect highly dynamic astral microtubules 1996; Spang et al., 1996; Knop et al., 1997). Whether or not that were sensing the cell cortex in search of a bud. Thus rather these three proteins are sufficient to achieve nucleation and than on stable attachment, nuclear migration may depend on anchorage of microtubules at the SPB remains to be explored. multiple transient interactions between microtubules and the The role of spindle and astral microtubules has been cell cortex. investigated by genetic studies on TUB2, the unique gene The half-bridge appears as a horseshoe-like structure encoding β-tubulin in yeast (Huffaker et al., 1988; Sullivan and adjacent to the SPB, and is implicated in SPB duplication Huffaker, 1992; Reijo et al., 1994). Spindle microtubules are during mitosis as well as SPB fusion during mating (Byers involved in chromosome segregation (Hoyt and Geiser, 1996). and Goetsch, 1975). Astral microtubules generally nucleate Astral microtubules are essential for proper nuclear migration: at the SPB, but nucleation at the bridge also occurs early in a conditional mutant lacking astral microtubules (tub2-401) the cell cycle. During S phase, following SPB duplication, 2810 S. Souès and I. R. Adams microtubules arising from the bridge are directed towards the with the gene locus in diploid K842, proper His+ recombinants were bud; they frequently even penetrate into the bud. The function identified by PCR amplification of both ends of the expected insert, of these microtubules is not well established. During mating, using a combination of primers of about 20 bp. after fusion of G1 cells, microtubules originating from the A strain overexpressing Spc72p was prepared by introducing the S. pombe HIS5 selector gene followed by the GAL1-10 promoter bridge connect the SPB of the two partners, and apparently ′ pull the nuclei together before fusion. Several alleles of TUB2 immediately 5 to the SPC72 initiation codon. The strategy used was similar to that described for epitope tagging: the GAL1-10 promoter result in defective astral microtubules, causing improper was amplified from vector pJK404 (Donaldson and Kilmartin, 1996) nuclear positioning and fusion (Huffaker et al., 1988). Loss using primers containing KpnI and XhoI sequences, and inserted into of Kar3p (a minus-end directed motor) results in remarkably the pBS-3xHA-His5 vector at the remaining KpnI and XhoI sites of elongated microtubule bundles, which seem to prevent the polylinker. This Bluescript derivative (pBS-3xHA-His5-Gal1-10) congression of the nuclei (Rose, 1996). In mating cells, was used as template for an amplification reaction. As above, each Kar3p has been localised at both ends of astral microtubules; primer was designed with 18 bp of the template and 45 bp of the it could mediate sliding of astral microtubules as well as their targeted gene (either flanking or including the SPC72 initiation depolymerisation at the SPB (Meluh and Rose, 1990; Endow codon), and proper His+ recombinants were identified by PCR et al., 1994). amplification. The heterozygous strain was cultured at 30°C in YEP Rout and Kilmartin (1990) prepared a series of monoclonal medium containing 2% raffinose, and Spc72p overexpression was induced by addition of 2% galactose. antibodies directed against an extract enriched in SPB from Deletion of SPC72 open reading frame (ORF) was achieved by a Saccharomyces uvarum. Antibody 78H6 reacted weakly with one-step gene replacement method (Baudin et al., 1993). The an entity of apparent molecular mass 85 kDa, localised at the His3MX6 module was amplified by PCR; again, the forward cytoplasmic side of the SPB (Rout and Kilmartin, 1991). primer (AACACTAATATCAAAAAACTAAGCAAACAACATAA- More recently, we confirmed by matrix-assisted laser GAAAGTTATAGCCTCGACGGATCCCCGGGTTAATTA) and desorption/ionisation (MALDI) mass spectrometry that backward primer (AGAGTGACTGAGTGTTACATTAAATATATTT- extracts enriched in SPB contain a protein of apparent ATATATAAACGTATGATATATCATCGATGAATTCGAGCTCGTT) molecular mass 85 kDa, encoded by YAL047C (Wigge et al., were designed with at least 18 bp of the template and 45 bp flanking + 1998). Here we show that YAL047C encodes the antigen the SPC72 ORF (underlined), and proper His recombinants recognised by 78H6, and we provide evidence about the identified by PCR amplification. After sporulation of the heterozygous strain, tetrads were dissected, and two haploid strains function of this new SPB component. Our results confirm the of opposite mating type (both lacking SPC72) were selected. To localisation of Spc72p at the outer plaque of the SPB and express a Tub1p-GFP fusion protein in the heterozygous strain suggest that it also localises at the half-bridge structure. deleted for SPC72, the TUB1-GFP fusion sequence was recovered Functional characterisation implies that Spc72p either by gap-repair from strain ASF475 (Straight et al., 1997). stabilises or anchors astral microtubules and thus plays a key Centromere-based plasmid pRS314 (TRP/CEN) was digested with role in the complex processes of nuclear migration and KpnI and SacI of the polylinker and used to transform ASF475. Gap- mating. repaired plasmid was recovered from Trp+ yeast and used to transform E. coli TG2 cells by electroporation. One out of 24 E. coli transformants contained a recombinant plasmid with the TUB1-GFP sequence, which was transferred to the polylinker of integrative MATERIALS AND METHODS vector pRS304. Recombinant pRS304 was linearised with Bsu36I in TRP1 and used to transform the heterozygous strain deleted for General methods SPC72. Proper Trp+ recombinants were identified by PCR, and Yeast strains used in this study were all derived from K842 (MATa/α sporulated. Tetrads were dissected and the haploid strain (MATa ade2-1 trp1-1 can1-100 leu2-3,112 his3-11,15 ura3 GAL psi+ ssd1- Spc72∆::HIS5 TRP1::TUB1-GFP) isolated. d2) described in Nasmyth et al. (1990); yeast growth media and yeast techniques used are described in Guthrie and Fink (1991), and pRS Cloning of SPC72 vectors used for DNA manipulation in yeast are described in Sikorski SPC72 was isolated by the method of gap-repair (Orr-Weaver et al., and Hieter (1989). Recombinant DNA methodology in E. coli was 1983). Sequences flanking the SPC72 ORF were amplified to performed as suggested in Sambrook et al.
Load more

Recommended publications
  • Chloroplast Transit Peptides: Structure, Function and Evolution
    reviews Chloroplast transit Although the first demonstration of precursor trans- port into chloroplasts was shown over two decades peptides: structure, ago3,4, only now is this area of cell biology becom- ing well understood. Many excellent reviews have been published recently on the evolution of plas- function and tids5, the evolution of organelle genomes6, the mechanism of gene transfer from organelles to the nucleus7 and the mechanism of protein import into evolution chloroplasts8,9. Proteins destined to plastids and other organ- elles share in common the requirement for ‘new’ Barry D. Bruce sequence information to facilitate their correct trafficking within the cell. Although in most cases this information resides in a cleavable, N-terminal sequence often collectively referred to as signal It is thought that two to three thousand different proteins are sequence, the different organelle-targeting se- targeted to the chloroplast, and the ‘transit peptides’ that act as quences have distinct properties and names: ‘signal peptides’ for the endoplasmic reticulum, chloroplast targeting sequences are probably the largest class of ‘presequences’ for the mitochondria and ‘transit peptides’ for chloroplasts and other plastids. This targeting sequences in plants. At a primary structural level, transit review focuses on recent progress in dissecting peptide sequences are highly divergent in length, composition and the role of the stromal-targeting domain of chloro- plast transit peptides. I will consider briefly the organization. An emerging concept suggests that transit peptides multitude of distinct functions that transit peptides contain multiple domains that provide either distinct or overlapping perform, provide an update on the limited struc- tural information of a number of transit peptides functions.
    [Show full text]
  • Physical and Functional Interaction Between SET1/COMPASS Complex Component CFP-1 and a Sin3s HDAC Complex in C. Elegans
    Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans Flore Beurton, Przemyslaw Stempor, Matthieu Caron, Alex Appert, Yan Dong, Ron A-J Chen, David Cluet, Yohann Couté, Marion Herbette, Ni Huang, et al. To cite this version: Flore Beurton, Przemyslaw Stempor, Matthieu Caron, Alex Appert, Yan Dong, et al.. Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans. Nucleic Acids Research, Oxford University Press, 2019, 47 (21), pp.11164- 11180. 10.1093/nar/gkz880. hal-02375443 HAL Id: hal-02375443 https://hal.archives-ouvertes.fr/hal-02375443 Submitted on 25 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. bioRxiv preprint doi: https://doi.org/10.1101/436147; this version posted October 5, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Physical and functional interaction between SET1/COMPASS complex component CFP- 1 and a Sin3 HDAC complex Beurton F.
    [Show full text]
  • Asymmetric Distribution of Glucose Transporter Mrna Provides Growth Advantage
    bioRxiv preprint doi: https://doi.org/10.1101/380279; this version posted July 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Asymmetric Distribution of Glucose Transporter mRNA Provides Growth Advantage Timo Stahl1, Stefan Hümmer1,2, Nikolaus Ehrenfeuchter1, Geoffrey Fucile3, and Anne Spang1 1Biozentrum, University of Basel, 4056 Basel, Switzerland 2current affiliation: Translational Molecular Pathology, Vall d'Hebron Research Institute, Universitat Autònoma de Barcelona, Barcelona and Spanish Biomedical Research Network Centre in Oncology (CIBERONC), Spain 3SIB Swiss Institute of Bioinformatics, sciCORE Computing Center, University of Basel, 4056 Basel, Switzerland Address of Correspondence: Anne Spang Biozentrum University of Basel Klingelbergstrasse 70 CH-4056 Basel Switzerland Email: [email protected] Phone: +41 61 207 2380 Running title: PKA asymmetrically localizes HXT2 mRNA 1 bioRxiv preprint doi: https://doi.org/10.1101/380279; this version posted July 30, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract (175 words) Asymmetric localization of mRNA is important for cell fate decisions in eukaryotes and provides the means for localized protein synthesis in a variety of cell types. Here we show that hexose transporter mRNAs are retained in the mother cell of S. cerevisiae until metaphase-anaphase transition (MAT) and then are released into the bud.
    [Show full text]
  • 2019 Abstracts
    We are delighted EDITORIAL to welcome the worldwide yeast community in Gothenburg for ICYGMB2019! The “International Yeast Conferences” started in the 1960s with a handful of delegates and since then have become THE most important event in yeast research. Now the yeast meeting to returns to Gothenburg. Many yeast researchers still remember the meeting in 2003 with over 1,100 delegates, a truly memorable event. The Life Sciences are changing, and yeast research remains at their forefront. Advancements in genome sequencing and genome editing just make yeast more exciting as model organism in basic cell biological research, genome evolution and as a tool for synthetic biology and biotechnology. One of the most important reasons for the enormous success of yeast research lies in the unique character of the international yeast research community. No other community employs such a free exchange and access to information and research tools. Nor has any other community had the ability to build – even intercontinental – consortia of critical mass to tackle large‐scale projects, such as in sequencing the first eukaryotic genome or the first comprehensive yeast knockout library. Yeast2019 is the meeting of the international yeast research community where the latest, and even unpublished results are exchanged, and new projects, alliances, and collaborations are founded. A do‐not‐miss‐event. We attempt to incorporate the present excitement in yeast research in the programme of yeast2019. We are confident that this conference will contain important news and information for all yeast researchers. Taken together, yeast2019 will provide an up‐ to‐date overview in yeast research and it will set the scene for years to come.
    [Show full text]
  • Many Routes Lead to the Pole Nidulans and the Fission Yeast Schizo.Mc­ Charomyces Pombe, Genes Required for the Caroline E
    NEWS AND VIEWS remaining material. One intriguing pro­ planets and under the sea, and especially One of the most surprising has emerged posal (R. F. Scott, California Institute of of the artificially triggered Soviet geo­ from the study of genes concerned with Technology) was that a 10-m diameter, technical landslides, will shed new light another process associated with the pole 1,000 g geotechnical centrifuge would on this vexing question. It is clear that body, namely, the movement of nuclei permit model experiments on dynam­ Western geoscientists have much to gain towards one another during karyogamy. ically scaled analogues of natural large from cooperation with our Soviet counter­ One of these, KARI, encodes a pole-body landslides. parts in the new spirit of glasnost. D component of unknown function 111 but In spite of the flood of new data on giant another, KAR3, has been shown to landslides, the fundamental cause of their H. J. Me/ash is in the Lunar and Planetary encode a homologue of the microtubule 11 mobility is still far from understood. It is Laboratory and Department of Geosciences, motor protein kinesin • This colocalizes hoped that the new opportunities for the University of Arizona, Tucson, Arizona 85721, with the KARI product at the outer sur­ study of their deposits both on other USA. face of the pole body during conjugation CELL BIOLOGY-------------------- but resides at the inner face during mitosis (M. Rose, personal communication). In the filamentous fungus Aspergillus Many routes lead to the pole nidulans and the fission yeast Schizo.mc­ charomyces pombe, genes required for the Caroline E.
    [Show full text]
  • Mutant Membrane Protein of the Budding Yeast Spindle Pole Body Is Targeted to the Endoplasmic Reticulum Degradation Pathway
    Copyright 2002 by the Genetics Society of America Mutant Membrane Protein of the Budding Yeast Spindle Pole Body Is Targeted to the Endoplasmic Reticulum Degradation Pathway Susan McBratney and Mark Winey1 Department of Molecular, Cellular and Developmental Biology, University of Colorado, Boulder, Colorado 80309-0347 Manuscript received June 5, 2001 Accepted for publication June 3, 2002 ABSTRACT Mutation of either the yeast MPS2 or the NDC1 gene leads to identical spindle pole body (SPB) duplication defects: The newly formed SPB is improperly inserted into the nuclear envelope (NE), preventing the cell from forming a bipolar mitotic spindle. We have previously shown that both MPS2 and NDC1 encode integral membrane proteins localized at the SPB. Here we show that CUE1, previously known to have a role in coupling ubiquitin conjugation to ER degradation, is an unusual dosage suppressor of mutations in MPS2 and NDC1. Cue1p has been shown to recruit the soluble ubiquitin-conjugating enzyme, Ubc7p, to the cytoplasmic face of the ER membrane where it can ubiquitinate its substrates and target them for degradation by the proteasome. Both mps2-1 and ndc1-1 are also suppressed by disruption of UBC7 or its partner, UBC6. The Mps2-1p mutant protein level is markedly reduced compared to wild-type Mps2p, and deletion of CUE1 restores the level of Mps2-1p to nearly wild-type levels. Our data indicate that Mps2p may be targeted for degradation by the ER quality control pathway. N the budding yeast Saccharomyces cerevisiae, the spin- martin 1999; O’Toole et al. 1999). It was originally I dle pole body (SPB) functions as the sole microtu- proposed that Mps2p and Ndc1p function to insert the bule-organizing center (Byers et al.
    [Show full text]
  • Osu1343763753.Pdf (14.8
    Targeting of Peripherally Associated Proteins to the Inner Nuclear Membrane in Saccharomyces cerevisiae: The Role of Essential Proteins DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Greetchen M. Díaz Graduate Program in Molecular, Cellular and Developmental Biology The Ohio State University 2012 Dissertation Committee: Anita K. Hopper, Advisor Stephen Osmani Mark Parthun Jian-Qiu Wu Copyright by Greetchen M. Díaz 2012 Abstract The nuclear envelope (NE) is composed of the inner nuclear membrane (INM) and the outer nuclear membrane (ONM) which is contiguous with the endoplasmic reticulum (ER). The appropriate location of NE proteins is important in cells. Integral INM proteins are proposed to be synthesized at the ER and then translocated through the nuclear pore complex (NPC). In contrast, peripherally associated INM proteins are proposed to follow a targeting mechanism to the nucleus that is similar to nucleoplasmic proteins. Our research aims to understand the mechanism of targeting of peripherally associated proteins to the INM. We employed yeast as a genetic model and the tRNA modification enzyme, Trm1-II, as a reporter. We screened a collection of temperature sensitive (ts) mutants for defects in galactose-inducible Trm1-II-GFP (Gal-Trm1-II-GFP) INM localization. We found that the majority (46%) of the ts mutations affecting Gal- Trm1-II-GFP localization were in genes that encode proteins involved in ER-Golgi homeostasis. Interestingly, about 35% of the mutated essential genes encode components of the Spindle Pole Body (SPB). In the SPB ts mutants, at the non-permissive temperature, Gal-Trm1-II-GFP accumulates as a spot that localizes to the ER, rather than being evenly distributed around the entire INM as in wild-type cells.
    [Show full text]
  • DISCOVERY and CHARACTERIZATION of PATHWAYS INVOLVED in FUS and TDP43-INDUCED TOXICITY in YEAST a Thesis Submitted in Partial
    DISCOVERY AND CHARACTERIZATION OF PATHWAYS INVOLVED IN FUS AND TDP43-INDUCED TOXICITY IN YEAST A thesis submitted in partial fulfillment of the requirement for the degree of Master of Science By WESTON JOSEPH SHAW B.S., Wright State University, 2017 2020 Wright State University WRIGHT STATE UNIVERSITY GRADUATE SCHOOL DATE OF DEFENSE 04 / 30 /2020 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY WESTON JOSEPH SHAW ENTITLED DISCOVERY AND CHARACTERIZATION OF FUS AND TDP43-INDUCED TOXICITY IN YEAST BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF MASTER OF SCIENCE. Shulin Ju, Ph.D. Thesis Director Eric Bennett, Ph.D. Chair, Department of Neuroscience, Cell Biology and Physiology Committee on Final Examination Chris Wyatt, Ph.D. Thomas Brown, Ph.D. Barry Milligan, Ph.D. Interim Dean of the Graduate School ABSTRACT ShaW, Weston Joseph. M.S., Department of Neuroscience, Cell Biology, and Physiology, Wright State University, 2020. Discovery and characterization of pathways involved in FUS and TDP43-induced toxicity in yeast. High-throughput genome-scale studies are becoming increasingly common as a means to discover genetic interactions. This methodology is particularly efficient When performed in the budding yeast Saccharomyces cerevisiae. Here, We (1) overexpress a large human gene library in yeast to assess how many of them are toxic, and (2) use the list of genes generated above to refine and analyze human genes previously identified to enhance toxicity of tWo ALS-associated proteins, FUS and TDP-43. By introducing each of 13,500 human genes into yeast, we demonstrated that the majority of these genes (about 97%) are not toxic to yeast When overexpressed.
    [Show full text]
  • Cytoskeleton: Anatomy of an Organizing Center Laura G
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE R754 Dispatch provided by Elsevier - Publisher Connector Cytoskeleton: Anatomy of an organizing center Laura G. Marschall and Tim Stearns One component of the yeast spindle pole body, Spc42p, SPB are duplicated each cell cycle, such that a new has been found to form a crystalline array within one of organelle is created next to the existing one. Unlike DNA the central layers of the structure; the Spc42p crystal replication, where the structure of the molecule immedi- might provide a scaffold around which the spindle pole ately suggests a templated mechanism of replication, body is assembled, and could be involved in regulating there is no obvious template in either the centrosome or the size of the spindle pole body. SPB. Two recent papers suggest that the SPB might be assembled from the inside out, starting with a central Address: Department of Biological Sciences, Stanford University, Stanford, California 94305, USA. crystalline array of a single protein [1], to which other components are added [2]. Current Biology 1997, 7:R754–R756 http://biomednet.com/elecref/09609822007R0754 Early studies showed that, when viewed by thin-section © Current Biology Ltd ISSN 0960-9822 electron microscopy, the SBP appears to consist of three layers (reviewed in [3]). The central plaque is embedded Most cells in your body have an extensive microtubule in the nuclear envelope, the inner plaque is on the nuclear network that is busily transporting organelles and vesicles side of the central plaque, and the outer plaque is on the from one place to another, and separating chromosomes in cytoplasmic side of the central plaque.
    [Show full text]
  • Telomere Length Homeostasis Is Achieved Via a Switch Between Telomerase- Extendible and -Nonextendible States
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Cell, Vol. 117, 323–335, April 30, 2004, Copyright 2004 by Cell Press Telomere Length Homeostasis Is Achieved via a Switch between Telomerase- Extendible and -Nonextendible States M. Teresa Teixeira,1,3 Milica Arneric,1 acts telomere shortening (reviewed in Kelleher et al. Peter Sperisen,2 and Joachim Lingner1,* [2002]). It extends the 3Ј end of chromosomes by reverse 1Swiss Institute for Experimental Cancer Research transcribing in an iterative fashion the template region and National Center of Competence in Research of its tightly associated telomerase RNA moiety. The “Frontiers in Genetics” complementary DNA strand is presumably synthesized 2 Swiss Institute for Bioinformatics by the conventional DNA polymerases ␣ and ␦ (Diede CH-1066 Epalinges/s Lausanne and Gottschling, 1999; Ray et al., 2002). Telomerase Switzerland expression is required for unlimited proliferation of uni- cellular organisms such as yeast or protozoa as well as for immortal cells in multicellular organisms such as Summary germ cells, some stem cells, and many cancer cells. In humans, a decline in telomere length correlates with the Telomerase counteracts telomere erosion that stems onset of age-dependent mortality (Cawthon et al., 2003). from incomplete chromosome end replication and Short telomeres and reduced levels of telomerase have nucleolytic processing. A precise understanding of been observed in individuals that carry a defective tel- telomere length homeostasis has been hampered by omerase RNA gene or a defective allele of the tel- the lack of assays that delineate the nonuniform telo- omerase-associated dyskerin protein (Mitchell et al., mere extension events of single chromosome mole- 1999; Vulliamy et al., 2001).
    [Show full text]
  • Atspc98p and Plant Microtubule Nucleation 2425
    Research Article 2423 The plant Spc98p homologue colocalizes with γ-tubulin at microtubule nucleation sites and is required for microtubule nucleation Mathieu Erhardt1, Virginie Stoppin-Mellet1,*, Sarah Campagne1, Jean Canaday1, Jérôme Mutterer1, Tanja Fabian2, Margret Sauter1,2, Thierry Muller1, Christine Peter1, Anne-Marie Lambert1 and Anne-Catherine Schmit1,‡ 1Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique UPR 2357, Université Louis Pasteur, 12 rue du Général Zimmer F-67084, Strasbourg Cedex, France 2Institut für Allgemeine Botanik, Hamburg, Ohnhorststr. 18, D-22609 Hamburg, Germany *Present address: Laboratoire de Physiologie Cellulaire Végétale, UMR 5019 CEA/CNRS/UJF, CEA Grenoble, 17 Avenue des Martyrs 38054 Grenoble cedex 9, France ‡Author for correspondence (e-mail: [email protected]) Accepted 13 March 2002 Journal of Cell Science 115, 2423-2431 (2002) © The Company of Biologists Ltd Summary The molecular basis of microtubule nucleation is still not tobacco nuclei and in living cells. AtSpc98p-GFP also known in higher plant cells. This process is better localizes at the cell cortex. Spc98p is not associated with γ- understood in yeast and animals cells. In the yeast spindle tubulin along microtubules. These data suggest that pole body and the centrosome in animal cells, γ-tubulin multiple microtubule-nucleating sites are active in plant small complexes and γ-tubulin ring complexes, respectively, cells. Microtubule nucleation involving Spc98p-containing nucleate all microtubules. In addition to γ-tubulin, Spc98p γ-tubulin complexes could then be conserved among all or its homologues plays an essential role. We report here eukaryotes, despite differences in structure and spatial the characterization of rice and Arabidopsis homologues of distribution of microtubule organizing centers.
    [Show full text]
  • The JNM1 Gene in the Yeast Saccharomyces Cerevisiae Is Required for Nuclear Migration and Spindle Orientation During the Mitotic Cell Cycle John N
    The JNM1 Gene in the Yeast Saccharomyces cerevisiae Is Required for Nuclear Migration and Spindle Orientation During the Mitotic Cell Cycle John N. McMillan and Kelly Tatchell Department of Microbiology, North Carolina State University, Raleigh, North Carolina 27695 Abstract. JNM1, a novel gene on chromosome XIII in during mitosis, as assayed by the rate of chromosome the yeast Saccharomyces cerevisiae, is required for loss, or nuclear migration during conjugation, as as- proper nuclear migration, jnml null mutants have a sayed by the rate of mating and cytoduction. The temperature-dependent defect in nuclear migration and phenotype of a jnml mutant is strikingly similar to an accompanying alteration in astral microtubules. At that for mutants in the dynein heavy chain gene 30°C, a significant proportion of the mitotic spindles (Eshel, D., L. A. Urrestarazu, S. Vissers, J.-C. is not properly located at the neck between the mother Jauniaux, J. C. van Vliet-Reedijk, R. J. Plants, and cell and the bud. This defect is more severe at low I. R. Gibbons. 1993. Proc. Natl. Acad. Sci. USA. temperature. At ll°C, 60% of the cells accumulate 90:11172-11176; Li, Y. Yo, E. Yeh, T. Hays, and K. with large buds, most of which have two DAPI stain- Bloom. 1993. Proc. Natl. Acad. Sci. USA. 90:10096- ing regions in the mother cell. Although mitosis is 10100). The JNM1 gene product is predicted to en- delayed and nuclear migration is defective in jnml mu- code a 44-kD protein containing three coiled coil do- tants, we rarely observe more than two nuclei in a mains.
    [Show full text]