Osu1343763753.Pdf (14.8

Targeting of Peripherally Associated Proteins to the Inner Nuclear Membrane in

Saccharomyces cerevisiae: The Role of Essential Proteins

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Greetchen M. Díaz

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2012

Dissertation Committee:

Anita K. Hopper, Advisor

Stephen Osmani

Mark Parthun

Jian-Qiu Wu

Greetchen M. Díaz

2012

Abstract

The nuclear envelope (NE) is composed of the inner nuclear membrane (INM)

and the outer nuclear membrane (ONM) which is contiguous with the endoplasmic

reticulum (ER). The appropriate location of NE proteins is important in cells. Integral

INM proteins are proposed to be synthesized at the ER and then translocated through the

nuclear pore complex (NPC). In contrast, peripherally associated INM proteins are

proposed to follow a targeting mechanism to the nucleus that is similar to nucleoplasmic

proteins. Our research aims to understand the mechanism of targeting of peripherally

associated proteins to the INM. We employed yeast as a genetic model and the tRNA modification enzyme, Trm1-II, as a reporter. We screened a collection of temperature sensitive (ts) mutants for defects in galactose-inducible Trm1-II-GFP (Gal-Trm1-II-GFP)

INM localization. We found that the majority (46%) of the ts mutations affecting Gal-

Trm1-II-GFP localization were in genes that encode proteins involved in ER-Golgi

homeostasis. Interestingly, about 35% of the mutated essential genes encode components

of the Spindle Pole Body (SPB). In the SPB ts mutants, at the non-permissive

temperature, Gal-Trm1-II-GFP accumulates as a spot that localizes to the ER, rather than

being evenly distributed around the entire INM as in wild-type cells. Following the

dynamics of Gal-Trm1-II-GFP we learned that its inappropriate distribution results from

a failure to move from the initial contact with the NE (ONM) throughout the INM. Gal- ii

Trm1-GFP accumulates to the ER with time, suggesting that this might be the initial

Trm1-II tethering site. Surprisingly, SPB defects also affect targeting of an integral INM protein, but not a soluble nucleoplasmic protein which indicates that there is no defect in import and that appropriate SPBs are required for INM targeting of both integral and peripheral INM proteins, but not nucleoplasmic proteins. Our evidence suggests Gal-

Trm1-II-GFP is alternatively transported via soluble mechanism when unable to tether to the ER. We propose a novel mechanism for peripherally associated INM proteins that combines targeting mechanisms for both integral and soluble proteins. We also learned that INM maintenance of Gal-Trm1-II-GFP was altered in SPB defective cells, which suggests that a general defect at the membrane that forms the ER and the NE occurs in

SPB defective cells. The possible role of the SPB based in INM targeting and maintenance is discussed.

iii

This document is dedicated to the memory of my beloved grandmother “Doña” Julia.

Acknowledgments

I would like to thank Dr. Anita K. Hopper for give me the opportunity of being part of a privileged group of people who received her support and guidance. I wish to thank all the members of A.K.H. lab from 2006-12. In particular, my friends in this journey, Rebecca, Hui-Yi, Nripesh, Tsung-Po, Ivy, JingYan and Emily who were always very helpful and supportive of me. I also want to express my appreciation to a former lab member, Athula who not only helped me in my project, but also for being a great friend no matter the distance. My gratitude to the members of my thesis committee: Stephen Osmani, Jian-Qiu Wu and Mark Parthun for their advice, ideas and support. It was an honor for me to have these great people guiding me in this process. In special, I thank Mark for my first rotation opportunity at OSU. Thanks to the MCDB program for the opportunity and the people of the Molecular Genetics Department, particularly to the neighbors at the 8th floor (Riffe) for their friendship and nice environment. Also my thanks to Jim Hopper and his lab members in particular Onur, for all the interesting conversations and exchange of ideas (and reagents!). Thanks to I-Ju Lee for all her help an friendship. I want to thank all the new friends I met here, for everything I shared with them, the smiles, the jokes and happiness, but also thanks to the old friends who gave me their best wishes when I left Puerto Rico and are still there for me. They are so many that I can’t list them here, but they know who they are! In special I would like to thank my great friend Hector for being like a brother, be always there for me and for introduce to my life a special person, Henry. Thanks Henry for his love and support, especially to help me with my crazy ideas. My special thanks to the incredible team “CienciaPR” for their passion to serve and because they motivate me every day to believe that everything is possible.

I give all my unconditional love and gratitude to my very big family in Mississippi, Orlando, Massachusetts and Puerto Rico, because they always wish me the best and they always believe in me.

Vita

June, 2003………………… B.S. Biology, University of Puerto Rico, Mayagüez Campus

June, 2006………………….M.S. Biology, University of Puerto Rico, Mayagüez Campus

2006 to present………..Graduate Research Assistant, MCDB, The Ohio State University

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

vii

Table of Contents

Abstract ...... ii

Acknowledgments...... v

Vita ...... vii

Table of Contents ...... viii

List of Tables ...... xv

List of Figures ...... xvi

Chapter 1: General Introduction ...... 1

The Nucleus: Outer Nuclear Membrane ...... 1

The Nucleus: Inner Nuclear Membrane and the Nucleoplasm ...... 2

The Nucleus: Spindle Pole Body ...... 6

The Nucleus: Nuclear Pore Complex ...... 10

Nucleocytoplasmic Transport and the Ran Cycle ...... 11

Protein Targeting to the Nucleus ...... 16

Trm1 as a Reporter for INM Peripheral Targeting ...... 22

Inner Nuclear Membrane Proteins and Disease ...... 26

Yeast as a Genetic Model ...... 27

viii

Aims of this Study ...... 27

Chapter 2: General Materials and Methods ...... 29

Yeast strains and media ...... 29

Yeast plasmids...... 29

Chemically competent E. coli cells ...... 31

Plasmid DNA isolation and E. coli transformation ...... 31

Bacterial colony PCR ...... 32

Sequencing ...... 32

Yeast plasmid transformations ...... 32

Yeast transformation for genomic tagging ...... 33

Isolation of DNA from yeast ...... 33

PCR ...... 34

DNA manipulation ...... 34

Indirect immunofluorescence ...... 35

Microscopy and Imaging ...... 36

Western Blot ...... 37

Oligonucleotides...... 38

Chapter 3: Genomic Screen of Essential Genes for INM Protein Targeting in

Saccharomyces cerevisiae ...... 40

Abstract ...... 40

Introduction ...... 40

Temperature Sensitive Collection ...... 41

Specific Aim ...... 42

Methods ...... 42

96-well Plate Yeast Transformation and Galactose Induction of TRM1-II-GFP ..... 42

Microscopy (screen) ...... 43

Low copy Trm1-II-GFP in SPB ts mutants ...... 43

Treatment with alpha factor, Brefeldin A and DTT in WT cells ...... 43

Results ...... 45

Gal-Trm1-II-GFP is mislocalized in Temperature Sensitive Mutations of Genes that

Encode Spindle Pole Body ...... 45

Gal-Trm1-II-GFP is Mislocalized in Temperature Sensitive Mutations of Genes that

Encode for Proteins Involved in ER-Golgi Processes ...... 55

Temperature Sensitive Mutations Affecting Gal-Trm1-II-GFP INM Location that are

Involved in Proteolysis ...... 65

Other Temperature Sensitive Mutants Affecting Gal-Trm1-II-GFP INM Location . 68

Gal-Trm1-II-GFP is Mislocalized in Cells Treated with α-factor, DTT and Brefeldin

A ...... 71

Discussion ...... 74 x

A Genomic Screen of Essential Genes Affecting Gal-Trm1-II-GFP INM

Localization ...... 74

Trm1-II INM Localization in Temperature Sensitive Mutants for Essential Genes . 75

Chapter 4: Co-localization experiments for Gal-Trm1-II-GFP ...... 80

Abstract ...... 80

Introduction ...... 80

Specific Aim ...... 81

Materials and Methods ...... 81

Co-localization Studies for mislocalized Gal-Trm1-II-GFP ...... 81

Co-localization Studies for Trm1-II INM Binding Motif in WT Cells ...... 84

Results ...... 84

Gal-Trm1-II-GFP does not Localizes to the SPB, the Nucleolus, the Chromatin and

the Nucleus-Vacuole Junctions ...... 84

Gal-Trm1-II-GFP Localizes to a Pore-less Region of the Nucleus, Close to ER-

Nucleus Junctions ...... 91

Trm1-II may Initiates “Spreading” in a Region Close to the ER-Nucleus Junctions 96

Discussion ...... 98

Chapter 5: Nuclear Targeting Dynamics of Galactose Inducible Proteins ...... 101

Abstract ...... 101

Introduction ...... 101

The Microfluidics System ...... 102

Specific Aim ...... 103

Methods ...... 103

Dynamics of galactose inducible Trm1-GFP, Heh2-GFP and Pus1-GFP ...... 103

Imaging and counting ...... 104

Dynamics of Gal-Trm1-II-(A147D)-GFP ...... 104

Dynamics of galactose inducible Trm1-GFP in WT cells arrested with α-factor ... 104

Imaging and counting for arrested cells ...... 105

Results ...... 105

Gal-Trm1-II-GFP is mislocalized to the ER or a region of NE in the SPB ts mutant

spc110-220...... 105

Transport to the nucleus of the soluble protein Gal-Pus1-GFP is not altered in the

SPB ts mutant spc110-220 ...... 111

The INM localization of the integral protein Gal-Heh2-GFP is affected in the SPB ts

mutant spc110-220 ...... 115

Gal-Trm1-II-GFP is at the ER before its translocation to the INM ...... 120

Gal-Trm1-GFP Maintenance at the INM is affected during Cell Arrest by α-factor in

WT cells ...... 125

xii

Gal-Trm1-II-GFP utilizes the soluble import pathway to ensure its location to the

nucleus, when it does not bind to the initial tethering site ...... 132

Discussion ...... 137

Chapter 6: A Possible Connection between the Spindle Pole Body and the Endoplasmic

Reticulum ...... 141

Abstract ...... 141

Introduction ...... 141

Specific Aim ...... 143

Methods ...... 144

Kar2 IF ...... 144

Invertase Assay ...... 144

β-galactosidase Assay (UPR) ...... 145

Growth in Inositol Media ...... 146

Results ...... 146

ER protein kar2 is Mislocalized when the SPB Structure/Function is Altered ...... 146

Secretion is not altered in all SPB ts mutants ...... 149

UPR response is not affected in SPB ts mutants ...... 149

Growth in Inositol restores growth of some SPB ts mutants at semi-permissive

temperature and non-permissive temperature ...... 150

xiii

Discussion ...... 156

Chapter 7: General Discussion...... 159

INM Targeting...... 160

The Possible Role of the SPB in INM Targeting ...... 167

Final Remarks ...... 168

References ...... 171

Apendix A: Gal-Trm1-II-GFP in ice2∆ cells...... 193

Apendix B: Trm1-II-GFP localizes to the INM, in ice2∆ if lipid are overproduced ...... 194

xiv

List of Tables

Table 1. Oligonucleotides used in this study ...... 39

Table 2. SPB temperature sensitive mutants affecting Gal-Trm1-II-GFP INM localization

...... 53

Table 3. Temperature sensitive mutants of genes affecting Gal-Trm1-II-GFP location, that encode proteins of the ER-Golgi Processes ...... 62

Table 4. Temperature sensitive mutants that encode proteins involved in proteolysis and

affect Gal-Trm1-II-GFP localization ...... 67

Table 5. Other temperature sensitive mutants with defects in Gal-Trm1-GFP INM

location ...... 70

List of Figures

Figure 1.A simplified view of the eukaryotic cell ...... 4

Figure 2. Organization of the membrane system that forms the ER and the NE ...... 5

Figure 3. The Core SPB ...... 8

Figure 4. The yeast cell cycle and the SPB cycle ...... 9

Figure 5. A simplified view of the Nuclear Pore Complex...... 12

Figure 6. A simplified view of import ...... 14

Figure 7. A simplified view of export...... 15

Figure 8. Models for active transport nuclear targeting...... 21

Figure 9. Current model for Trm1-II INM targeting...... 25

Figure 10. Screen strategy and galactose induction of Gal-Trm1-II-GFP ...... 44

Figure 11. Phenotypes found in the screen for essential genes affecting localization of

Gal-Trm1-II-GFP...... 46

Figure 12. Distribution of temperature sensitive mutants affecting Gal-Trm1-II-GFP localization...... 47

Figure 13. Gene products of the SPB ts mutants that affect localization of Gal-Trm1-II-

GFP...... 50

Figure 14. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes

encoding SPB components ...... 51

xvi

Figure 15. The spot phenotype occurs in SPB ts mutant expressing Trm1-II-GFP

controlled by its own promoter...... 52

Figure 16. Distribution of ts mutants for ER-related proteins affecting Gal-Trm1-II-GFP localization ...... 57

Figure 17. Specific Function of ER-related proteins affecting Gal-Trm1-II-GFP

localization...... 58

Figure 18. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes

encoding proteins of ER-related processes such as ER quality control and lipid

biosynthesis ...... 59

Figure 19. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes

encoding proteins of ER-Golgi processes such as GPI anchor synthesis and regulation. 60

Figure 20. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes

encoding proteins of ER-Golgi processes such as secretion ...... 61

Figure 21. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes

encoding proteins for proteolysis...... 66

Figure 22. Other Temperature Sensitive Mutants that Mislocalize Gal-Trm1-GFP ...... 69

Figure 23. Gal-Trm1-II-GFP is mislocalized in cell treated with factor, DTT and BFA . 73

Figure 24. Gal-Trm-II-GFP spots does not co-localize with the SPB...... 87

Figure 25. Gal-Trm1-II-GFP does not co-localize with the chromatin...... 88

Figure 26. Gal-Trm-II-GFP spots do not localize with the nucleolus ...... 89

Figure 27. Gal-Trm1-GFP spots does not co-localize with the NVJ...... 90

Figure 28. Gal-Trm1-II-GFP localizes to a pore-less region at the NE...... 93

xvii

Figure 29. Gal-Trm1-II-GFP spots co-localize with a region close to the ER-nucleus junctions in cells with altered SPB structure...... 94

Figure 30. Gal-Trm1-II-GFP at the ER-nucleus junctions...... 95

Figure 31. NLS-130-151-Trm7-GFP localizes close to the ER-nucleus junction and to the

ER...... 97

Figure 32. Gal-Trm1-II-GFP is mislocalized in the SPB ts mutant, spc110-220...... 108

Figure 33. SPB ts mutant spc110-220 shows a higher percentage of cells without Gal-

Trm1-II-GFP rings at the NE, compared to WT...... 110

Figure 34. Gal-Pus1-GFP is not mislocalized in the SPB ts mutant, spc110-220...... 112

Figure 35. Gal-Pus1 localization was identical in WT cells and the SPB ts mutant spc110-

220...... 114

Figure 36. Gal-Heh2-GFP is mislocalized in the SPB ts mutant, spc110-220...... 117

Figure 37. SPB ts mutant spc110-220 shows a higher percentage of cells with Gal-Heh2-

GFP at the ER, compared to WT ...... 119

Figure 38. Gal-Trm1-II-GFP distribution at the INM is recovered during release from cell

cycle arrest with α-factor...... 122

Figure 39. Gal-Trm1-II-GFP is located at the ER before its translocation to the INM.. 124

Figure 40. Gal-Trm1-II-GFP maintenance is affected during cell cycle arrest...... 127

Figure 41. The majority of the spots after Gal-Trm1-II-GFP “collapse” are located to the

NE, mainly, the INM...... 129

Figure 42.. Maintenance at the INM is also affected in the SPB ts mutant...... 130

xviii

Figure 43.Gal-Trm1-II(A147D)-GFP nucleoplasmic location is not affected by alterations of the SPB...... 134

Figure 44. Gal-Trm1-II(A147D)-GFP localizes to the nucleoplasm in both, WT and spc110-220 ...... 136

Figure 45. Kar2 distribution changes when the SPB structure/function is altered...... 148

Figure 46. SPB ts mutants have no detectable defect in secretion of invertase...... 152

Figure 47. SPB ts mutants have no detectable defect in secretion of invertase...... 153

Figure 48. Basal levels of UPR response are affected in the SPB ts mutants when

compared to WT...... 154

Figure 49. Growth of some SPB ts mutants is improved when inositol is present, at semi- permissive and/or non-permissive temperature...... 155

Figure 50. New model for INM targeting of peripherally associated protein Trm1-II.. . 165

Figure 51. Alternative import mechanism for Trm1-II...... 166

Figure 52. Model for the indirect role of the SPB in INM targeting...... 169

Figure 54. Gal-Trm1-II-GFP localizes to the NE before it accumulates at the nucleoplasm

in ice2∆ cells...... 193

Figure 53. Trm1-II-GFP localizes to the INM, in ice2∆ when lipids are overproduced. 194

xix

Chapter 1: General Introduction

Eukaryotic cells contain membrane bound organelles in their cytoplasm that include mitochondria, Golgi apparatus, vesicles, vacuoles, the nucleus, and others (Figure 1). The most important membrane bound organelle is the nucleus which is surrounded by the nuclear envelope (NE). Compartmentalization in eukaryotic cells by the evolution of the nuclear envelope allows the segregation of gene expression and protein synthesis which is important to coordinate a diversity of biological processes. The NE is formed by two lipid bilayers which are mainly composed of phospholipids (Figure 2). The bilayer at the cytoplasmic face, the outer nuclear membrane (ONM), is contiguous with the endoplasmic reticulum (English et al., 2009). The bilayer facing the nucleoplasm is the inner nuclear membrane (INM). Both the ONM and the INM contain proteins with different roles to ensure proper function and architecture of the nucleus and they are connected by the nuclear pore complex (NPC) to control nucleocytoplasmic exchange.

The Nucleus: Outer Nuclear Membrane

In organisms like yeast, the ONM connects to other organelles such as the vacuole, by physical interactions between ONM proteins and vacuole membrane proteins. This region is called the nucleus-vacuole junction (NVJ) (Pan et al., 2000; Kvam and Goldfarb, 2004). Also, proteins at the ONM have different functions. For example, in higher eukaryotes, the ONM protein Nesprin 3, is involved in nuclear positioning by association with the cytoskeleton (Wilhelmsen et al., 2005) while defects in Nesprin 4 causes relocation of the centrosome and Golgi with respect to the nucleus (Roux et al., 2009). Another ONM protein, UNC-83, functions in nuclear migration (McGee et al., 2006). The location of Nesprin and UNC proteins is dependent on their KASH (Klarsicht, ANC-1, Syne Homology) binding domain to interact with SUN (Sad1p, UNC-84) 1 proteins (also present in yeast) which reside mainly at the inner nuclear membrane (INM).

The Nucleus: Inner Nuclear Membrane and the Nucleoplasm

Although there are proteins that are proposed to reside in both the ONM and the INM (Siniossoglou et al., 1998; Deng and Hochstrasser, 2006), the general protein composition in both membranes is distinct and serves different functions. The INM is an essential bilayer facing the nuclear interior, or nucleoplasm. Many important processes occur at the nucleoplasm. In recent years, new developed technology, especially in microscopy, allowed the discovery of additional subcompartments in the nucleoplasm (Cardoso et al., 2012). The most prominent compartment in the nucleoplasm is the nucleolus, where ribosomal RNAs (rRNA) are synthesized and pre-ribosomes are assembled (Sirri et al., 2008). The nucleolus is also involved in the cell cycle regulation and stress response. Hundreds of proteins reside in the nucleolus (Andersen et al., 2005) and many of them are in continuous exchange with the nucleoplasm (Phair and Misteli, 2000). The most important component of the nucleoplasm is the chromatin. The DNA is assembled with proteins and packaged to provide the cell multiple mechanisms to regulate DNA replication and gene expression. To help in DNA replication, gene expression and other processes, the INM contains a number of proteins that assist these functions. For example, the integral INM protein Asi1 regulates the ability of certain transcription factors to access the DNA and prohibits transcription (Boban et al., 2006). The localization of the DNA within the nucleus has an enormous impact upon its transcriptional regulation. As reviewed in Ahmed and Brickner (2007), INM peripheral proteins involved in messenger RNA (mRNA) export can facilitate the coupling between transcription and mRNA transport to the cytoplasm (Strambio-de-Castillia et al., 1999). Also, in metazoan and vertebrate cells, the organization of chromatin is influenced in part by lamin proteins which are peripherally associated with the INM. The nuclear lamina is a protein meshwork

2 composed of lamin proteins (A, B and C) which are filaments containing a C-terminal CααX motif for association to INM membrane proteins such as lamin associated polypeptide (LAP), emerin and MAN (the three forms the LEM sub-family) and lamin B receptor (LRB). Due to its association with chromatin, the lamina has a role in DNA replication and gene regulation. In addition, the lamina has a prominent role in nuclear architecture, as cells with defects on lamina proteins shows NE shape abnormalities (Coffinier et al., 2011). There are no lamins known homologues in plants and yeast. However, it has been show recently, that in fission yeast cells, the proteins Lem2 and Man1 perform essential functions analogous to the animal cell lamina (Gonzalez et al., 2012). In budding yeast, the protein Esc1 has been proposed to function similarly lamins (Andrulis et al., 2002; Taddei et al., 2004; Hattier et al., 2007). As mentioned above, SUN proteins are located at the INM where they interact with ONM proteins to connect both membranes, providing another architectural function of INM proteins. The space between the ONM and the INM is called the periplasmic space which is contiguous with the ER lumen. The INM and the ONM are connected at the nuclear pore complex (NPC) which allows passage of molecules and proteins into and out of the nucleus. Also in organisms like the yeast S. cerevisiae, the membranes are also connected at the insertion site for the Spindle Pole Body (SPB).

Centrosome

Nucleolus Vesicles NPC Mitochondria

ER Golgi

Lysosomes Nucleus and Nucleoplasm Vacuole

Cytoplasm

Plasma membrane

Figure 1.A simplified view of the eukaryotic cell. Diagram by Greetchen Díaz.

Cytoplasm

ER and ER proteins

ER lumen

NPC ONM proteins ONM Nuclear envelope

Periplasmic space

INM Lamina

INM peripheral proteins Nucleoplasm INM integral proteins

Figure 2. Organization of the membrane system that forms the ER and the NE. Diagram by Greetchen Díaz.

The Nucleus: Spindle Pole Body

The SPB is the microtubule organizing center (MTOC) in yeast (Jaspersen and Winey, 2004) and it is the functional equivalent to the centrosome of higher eukaryotic cells. The SPB is embedded in the nuclear membrane during the entire yeast cell cycle. The cylindrically shapped SPB contains three main plaques (inner, central and outer) composed of multiple proteins (Figure 3). The outer plaque faces the cytoplasm while the inner plaque faces the nucleoplasm. The ϒ-tubulin complex (Spc97, Spc98, and Tub4) is located in both the outer plaque and the inner plaque and it associates with cytoplasmic and nucleoplasmic microtubules respectively. Components that localize exclusively to the outer plaque are Cnm67, Nud1 and Spc72. In addition to the ϒ-tubulin complex, the inner plaque contains a component that is also shared with the central plaque, Spc110 (Muller et al., 2005). The central plaque, composed of proteins Spc42, Spc29, Spc110 and Cmd1, is anchored to the nuclear membrane by association of the SPB periphery protein Bbp1 and Nbp1, with integral membrane proteins Ndc1 and Mps2 (Schramm et al., 2000; Araki et al., 2006). More detailed studies showed the existence of interconnected layers between the inner and central plaque, called the first and second intermediate layers (IL1 and IL2). They share with central plaque, components Spc42 and Cnm67 (Bullitt et al., 1997). The SPB is duplicated during the cell cycle (Figure 4). The site for the new SPB assembly is called the half bridge (Adams and Kilmartin, 1999). Proteins of the SPB half-bridge are Kar1, Cdc31, Sfi1 and Mps3 and it was proposed that their association to the membrane occurs by interactions within Bbp1and Kar1 (Schramm et al., 2000). The SPB is a dynamic organelle. During the cell cycle, the diameter of the SPB in haploid cells changes while its height remains constant (Byers and Goetsch, 1975). In addition, the SPB structure changes in preparation for its duplication and the mating process (Byers and Goetsch, 1975). The duplication process seems to be complex and was proposed to be semi-conservative, so that both, the old and the new SPB incorporate new components to their structures (Pereira et al., 2001; Yoder et al., 2003).

The majority of the SPB proteins are essential. Cells with mutations in genes encoding components of the SPB exhibit defects in spindle formation, karyogamy, and nuclear positioning. The SPB duplication has to be coordinated to ensure that all chromosomes will segregate correctly and only one SPB is present in each mother and daughter cell. During SPB duplication process, the half bridge is elongated and a satellite material is accumulated. This satellite expands into a duplication plaque (at cytoplasmic face) where underneath, the half-bridge continues to elongate and retract. Finally, the SPB duplication plaque is inserted into the nuclear envelope and inner plaque components are assembled to it (Byers and Goetsch, 1975; Vallen et al., 1994; Kilmartin, 2003). How the SPB inserts to the NE is still unclear, but it was suggested that nuclear pores are involved as they locate close to the duplicating SPBs (Adams and Kilmartin, 1999).

The Spindle Pole Body

Cytoplasmic microtubules

Outer Plaque Satellite Nuclear envelope Central Plaque

Inner Plaque Half bridge

Nucleoplasmic microtubules

Outer plaque: ϒ-tubulin complex (Spc97, Spc98, Tub4), Cnm67, Nud1, Spc72, Stu2

Central plaque: Spc42, Spc29, Spc110, Cmd1

Inner plaque: Spc110, ϒ-tubulin complex (Spc97, Spc98, Tub4)

Membrane associated or at SPB periphery: Bpp1, Mps2, Nbp1, Ndc1

Half Bridge: Cdc31, Kar1, Mps3, Sfi1

Other: Mps1, Cdc28

Figure 3. The Core SPB. Diagram by Greetchen Díaz. 8

Figure 4. The yeast cell cycle and the SPB cycle. Diagram by Greetchen Díaz.

The Nucleus: Nuclear Pore Complex

The NPC (Wente and Rout, 2010) is the structure that allows the exchange of molecules between the nucleoplasm and the cytoplasm. The nucleopore is a cylindrical aqueous channel crossing the NE and it is composed of different protein complexes (Figure 5). Different techniques including fluorescence microscopy, atomic force microscopy, electron microscopy, and crystallography, permitted an understanding on the NPC composition (Fernandez-Martinez and Rout, 2012). The yeast NPC is the best studied among the eukaryotic structures (Aitchison and Rout, 2012) and has been shown to include the main characteristics of the NPCs of other organisms (DeGrasse et al., 2009). The yeast NPC is smaller (diameter of ~100nm and a height of ~40nm), compared to NPCs in higher eukaryotes (~130nm and ~80nm respectively) (Yang et al., 1998). The NPC components are called nucleoporins or nups. There are nups that have other roles beyond transport and/or NPC architecture and also non- nucleoporin proteins that interact transiently with the NPC (Chial et al., 1998; Strambio-de-Castillia et al., 1999). Nups are structural components of the NPC filaments projected from the core to the cytoplasm (gate) and from the core to the nuclear interior (basket). They also form the NPC center (~40nm of diameter) and the three rings (membrane, inner and outer) around this center. The proteins of the cytoplasmic and nucleoplasmic filaments are Nup42, Nup159, Nup1, Nup60, Mlp1 and Mlp2 (Wente and Rout, 2010). These proteins contain phenyl-alanine-glycine (FG) repeats and polar amino acids that take on natively unfolded structure (Denning et al., 2003). The center of the NPC is composed of FG proteins Nsp1, Nup49, Nup57, Nup100, Nup116 and Nup145N. The NPC is anchored to the NE by transmembrane proteins that form the membrane ring (Chial et al., 1998; Madrid et al., 2006; Miao et al., 2006). These proteins are the pore membranes, Pom152, Pom33, and Pom34 (only in fungi) and the nuclear division cycle protein, Ndc1. The proteins of the inner and outer rings give shape and strength to the NPC by their structures mainly composed of combinations of β-propeller fold domains and α-solenoid-like/helix-turn- helix repeats. Yeast proteins at the inner ring of the NPC are Nup53, Nup59, Nup 157,

Nup 170, Nup188 and Nup192. The protein Nic96 (linker nup) is anchored through Nup188 and Nup192 to connect the inner ring to other NPC structures. The yeast outer ring is composed by proteins Nup84, Nup85, Nup120, Nup133, Nup145C, Sec13 and Seh1. The structure of proteins at the inner and outer rings of the NPC is similar to those proteins found in the vesicle coating complexes (Field and Dacks, 2009). The protocoatomer hypothesis postulates that scaffolds nups and the coated vesicle proteins have a common origin (ancestor complex) called a protocoatomer (Devos et al., 2004; 2006; DeGrasse et al., 2009). Because of the NPC architecture and the repeats of major types of domains presents in nups, it was suggested that NPC evolution was caused by extensive intragenic duplication (Devos et al., 2006). As mentioned above, the yeast nups contain structural homology to nups in other organisms. Moreover, the role of the NPC in biogenesis, the composition of the core structure and their transport dynamics are very similar (Doucet and Hetzer, 2010; Wente and Rout, 2010). In particular, the principles governing nucleocytoplasmic transport via the Ran pathway and the role of karyopherin proteins are well conserved.

Nucleocytoplasmic Transport and the Ran Cycle

Nucleocytoplasmic transport is an essential cellular process. As in eukaryotic cells, gene regulation and the production of ribosomes are physically segregated from protein synthesis, it is crucial to control the exchange of molecules into and out of the nucleus. In order to control nucleocytoplasmic exchange, molecules have to pass through the NPC. There are two main different mechanisms of exchange between the nucleus and the cytoplasm: passive diffusion and active transport. Molecules such as water, ions, and others smaller than ~5 nm, can passively diffuse into and out of the nucleus and interact with the aqueous NPC channel (Kapon et al., 2010). There are numerous studies regarding passive diffusion (Liashkovich et al.; Patel et al., 2007), but the exact mechanism is still under debate (Peters, 2005). Macromolecules such as tRNAs, mRNAs

11 and proteins larger than 5nm are trafficked by a highly selective process of active transport.

The Nuclear Pore Complex

Figure 5. A simplified view of the Nuclear Pore Complex. Components of the cytoplasmic filaments and cytoplasmic FG nups (green), outer ring (purple), inner ring (red), central tube (gray), linker (yellow), luminal ring (cyan) and nuclear basket and nucleoplasmic FG nups (orange). Diagram by Greetchen Díaz, adapted from (Wente and Rout, 2010)

The small Ran (Ras-related nuclear protein), a GTP binding protein, is essential for active transport (Moore and Blobel, 1993) and it imparts directionality to the process (Izaurralde et al., 1997). Directionality of the active transport process is possible due to the location of the Ran regulators, the cytoplasmic GTPase activating protein (RanGAP) and the nuclear located guanine nucleotide exchange factor (RanGEF). Ran regulation results in a gradient where Ran-GTP is more concentrated in the nucleus than in the cytoplasm. For import (Figure 6), the low concentration of Ran-GTP in the cytoplasm allows for the interaction of transport factors with their cargo that contain a nuclear localization signals (NLS) (Stewart, 2007). Classical NLSs (cNLS) resemble the NLS for the SV40 T antigen and it is composed of a short stretch rich in basic residues. Classical NLSs can be classified as monopartite if they contain one stretch of basic amino acids, or bipartite if they contain two stretches of basic amino acids separated by a short sequence of 8-10 non-basic amino acids (Lange et al., 2007; 2010). The cNLSs interact with the transport factor importin beta, by an adaptor, importin alpha. Importin alpha recognizes the NLS of the cargo by its NLS-binding groove (Conti et al., 1998), while its N-terminus binds to importin beta (Cingolani et al., 1999). The entire complex is directed to the NPC where it is translocated to the nucleoplasm and then disassembled by association of Ran- GTP, to the importin complex, which allows the recycle of the importin proteins to maintain the Ran GTPase cycle (Stewart, 2007). Other types of NLSs have been described which add more complexity to the transport process (Xu et al., 2010). Conversely, the gradient allows other transport factors, exportins, to transport a cargo containing a nuclear export signal (NES) from the nucleoplasm to the cytoplasm (Cook and Conti, 2010). The exportin recognizes the cargo and forms a complex containing Ran-GTP, which is translocated out of the nucleus through the NPC. Regulation of Ran is also important for export and ensures the continuity of the cycle (Figure 7). Many proteins trafficked by the Ran cycle are shuttling in and/or out of the nucleus to perform their role in the cell. On the other hand, there are proteins that reside in the nucleoplasm and are targeted to different sub-nuclear compartments. Subnuclear targeting of these proteins requires information, in addition to the NLSs.

Cytoplasm

Nucleoplasm

Figure 6. A simplified view of import from the cytoplasm to the nucleoplasm. The karyopherin importin complex is show in yellow. Diagram by Greetchen Díaz.

Cytoplasm

Nucleoplasm

Figure 7. A simplified view of export from the nucleoplasm to the cytoplasm. The karyopherin exporting complex is show in purple. Diagram by Greetchen Díaz.

Protein Targeting to the Nucleus

There are different types of proteins in the nucleus. Nuclear soluble proteins are targeted to the nucleoplasm via the classical Ran cycle by their NLS association to importins. Nucleoplasmic proteins reside freely inside the nucleus or associate with other proteins to form nucleoplasmic subcompartments. Examples of proteins targeted to a nucleoplasmic subcompartment are nucleolar proteins. Nucleolar targeting is not well understood, but some advances occurred during the last years (Emmott and Hiscox, 2009). Some nucleolar proteins seem to use a NLS to enter the nucleus and then accumulate at the nucleolus by association with other nucleolar components or by assistance of nucleolar proteins containing a NoLS (nucleolar localization signal) (Créancier et al., 1993; Schmidt-Zachmann and Nigg, 1993; Li et al., 1996). Other nuclear proteins are nuclear membrane residents. The endoplasmic reticulum (ER) plays an important role in targeting of ONM and INM proteins. The main membrane system in eukaryotic cells is the ER. The ER is classified as smooth ER (lacking ribosomes) or rough ER (covered by millions of ribosomes) (Shibata et al., 2006). In addition, the ER can be divided into two domains according to its location in the cell: the cortical ER (cER) that extends a network of tubules and cisternae throughout the cytoplasm and the perinuclear ER (pER) which is contiguous with the ONM part of the NE. The general ER structure and function is conserved among all eukaryotic organisms. The smooth ER is dedicated to the transport of proteins already made at the rough ER to other parts of the cell, for example the Golgi apparatus. The Golgi is not directly connected to the ER, but proteins are transported from and to the ER by vesicle budding by coat protein (COPI)-coated vesicles (Popoff et al., 2011). Another important feature is that the smooth ER contains many enzymes that are involved in the regulation of calcium (Stutzmann and Mattson, 2011), drug detoxification (Cribb et al., 2005), carbohydrate metabolism (Roth et al., 2010) and lipid biosynthesis (Ye and DeBose-Boyd, 2011). Lipids that are components of other membranes complexes are synthesized at the smooth ER and transported to different organelles by direct physical connections formed with the 16

ER. The ER connects to sites of the plasma membrane, mitochondria, peroxisomes, lysosomes, vacuole, and the nucleus (Voeltz, 2002). The rough ER is a site for protein biosynthesis. Proteins are translocated to the ER by cotranslational translocation (translocated during translation), a process that is conserved among all domains of life (Schwartz, 2007). A protein that is synthesized at the ribosome is recognized by a signal recognition particle (SRP) (Egea et al., 2005) which causes a pause in its synthesis. Once the protein is recognized by the SRP, the entire translational complex is directed to the ER where it is recognized by a SRP receptor (Luirink and Sinning, 2004; Halic and Beckmann, 2005). At the ER, the nascent protein is inserted into a translocon (Sec complex) that spans the ER membrane (Beckmann et al., 1997; Becker et al., 2009) and interacts with the ribosome by its cytosolic loops (Cheng et al., 2005) . Once at the ER, the new proteins can access the ER lumen where they interact with ER chaperones that assist in their folding. Proteins made at the rough ER are subject of quality control processes such as the ER-associated degradation (ERAD) and the unfolded protein response (UPR). Unfolded proteins that cannot be fixed are retrotranslocated to the cytoplasm (Nakatsukasa and Brodsky, 2008; Roth et al., 2010). Properly folded proteins are modified and are retained at the ER (ER/ONM membrane or lumen resident proteins) by ER retention signals, or are directed to other organelles like the Golgi apparatus (secretory proteins) and the nucleus (integral nuclear membrane proteins). INM integral proteins need to be translocated from the ONM to the INM. It seems that there are different mechanisms for INM targeting (Burns and Wente, 2012). A class of transmembrane proteins of the INM is proposed to access the interior by a diffusion-retention model (Smith and Blobel, 1993). This model predicts that transmembrane proteins attached at the ONM, are passively translocated (without a signal) through the NPC and then, they are retained at the INM by other proteins or protein complexes such as lamina (Soullam and Worman, 1995). Evidence for this kind of passive mechanism was found in a diversity of organisms (Smith and Blobel, 1993; Wu et al., 2002). Other proteins without classical targeting signals can take advantage of

the active transport of their binding partners. For example, yeast SUN protein Mps3 is targeted to the INM by binding to the N-terminus of the histone variant H2A.Z (Htz1). The variant, which is a NLS containing protein, is required for Mps3 translocation through the NPC, but not for INM targeting and maintenance (Gardner et al., 2011).The tethering mechanism for Mps3 is still unclear. Recent studies challenge the diffusion-retention mechanism for integral INM protein targeting (Ohba et al., 2004; King et al., 2006). Many of the described INM transmembrane proteins contain putative cNLSs (Lusk et al., 2007). In fact, a NLS facilitates the translocation to the INM of the transmembrane proteins Heh1 and Heh2 in yeast (King et al., 2006). King et al. (2006), showed that Heh2 is translocated through NPC via recognition of its cNLS by the import complex, Kap-60-Kap95 (Figure 8). They suggested that translocation occurs via the lateral channels of the NPC. However, size predictions of the import complex with the Heh2, compared to the size of the NPC lateral channel, suggest that this part of the mechanism is unlikely. A more recent study suggests that long unfolded linkers facilitates translocation of Heh2 through the NPC (Meinema et al., 2011) (Figure 8-translocation). On the other hand, another study suggests that Heh2 uses an INM sorting motif (INM-SM) that directs its trafficking towards the NE (Liu et al., 2010). The INM-SM which contains at least two positively charged amino acids within five to eight amino acids of the nucleoplasmic face of the transmembrane domain, was found initially in a viral protein that is targeted to the INM by the host import machinery (Braunagel et al., 2004). Another integral protein containing an INM-SM is the C. elegans, SUN protein, UNC-84. Interestingly, this protein contains three additional targeting sequences (two cNLSs and a SUN NE localization signal or SUN-NELS). An investigation of its INM targeting mechanism revealed that those sequences have some degree of redundancy as only disruption of all four regions prevents INM location (Tapley et al., 2011). The general mechanism for INM targeting of UNC-84 is that the protein is actively transported from the ONM to the NPC for translocation to the INM. Once at the INM, it binds to nuclear lamina.

A different and probably more complicated active transport mechanism was described for human Sun2 (Turgay et al., 2010). Sun2 INM location is dependent on a cNLS, a Golgi retrieval signal, and a perinuclear domain. This is the first description of a mammalian INM protein that uses multiple domains for its appropriate location. As more studies on INM protein targeting emerge, the mechanisms seem to be more diverse (Zuleger et al., 2011). There are some reports that suggest a possible NPC-independent pathway of INM targeting that may involve vesicular fusion and trafficking (Burns and Wente, 2012). Similarly, vesicle trafficking was showed to be implicated in assembly of peripheral proteins to the NPC (Ryan et al., 2003). The study suggested that during NPC biogenesis a subset of nups (peripheral) are transported to the NE by cytoplasmic vesicles. There are no reports on additional endogenous NE proteins using this mechanism. Another group of INM proteins are peripherally associated to the INM. Compared to integral INM proteins, information of how peripheral proteins are targeted to the INM is very limited. Most of the information relates to lamin proteins. Lamin protein association to the INM is mediated by specific modifications in the CaaX motif at their C-terminus which is isoprenylated posttranslationally (Nigg, 1992). This lipid modification confers the ability to bind endomembranes and is also present in other proteins such as Ras proteins of the plasma membrane (Hofemeister et al., 2000). The specific targeting to the NE and not to other membranes is possible due to the presence of a NLS (Holtz et al., 1989). The combination of a peptide motif and a NLS for INM targeting seems to be conserved among organisms. One study in yeast showed the role of a membrane amphipatic α-helix (HA) for INM targeting of the SPB protein Nbp1 (Kupke et al., 2011). Nbp1 is a monotropic membrane protein that does not contains a transmembrane domain. The HA region was first described in some scaffold nucleoporins and it is proposed to sense membrane curvatures (Drin et al., 2007). The HA domain, was responsible for INM targeting of Nbp1, as Nbp1 variants with mutations of the HA region localized to the nucleoplasm, rather than the INM. Furthermore, the HA region was sufficient to target

GFP to the NE (Kupke et al., 2011). The HA domain is located at the N-terminus of Nbp1 and adjacent to one of the two NLSs present, NLS1. Binding of karyopherin 123 to NLS1, prevent non specific binding to other membranes. In kap123∆ cells, Nbp1 locates to cell periphery and the protein was able to bind liposomes. This study concluded that appropriate Nbp1 location is essential, as mutations on the HA domain and the bipartite NLS1 affects cell growth and SPB duplication. They used a prediction program to scan other peripheral proteins for the presence of the HA domain and found that proteins Nup53 and Pct1 contained this region. However they did not find such domain in the peripheral INM protein, Trm1.

2 1

Figure 8. Models for active transport nuclear targeting. Integral INM proteins located at the ONM are recognized by the karyopherin import complex which drives them to the NPC vicinity (docking). Then, the proteins are translocated by either interactions of the karyopherin complex with the central channel of the NPC (facilitated by unfolded linkers present in the integral protein) or by using the lateral channels of the NPC. Once at the INM, the integral proteins are released from the karyopherin complex and remain attached to the INM. The proposed mechanism for targeting peripheral INM proteins is similar to the mechanism used by soluble nuclear21 proteins, with the exception that the peripheral INM proteins are re-distributed from the nucleoplasm to the INM. Diagram by Greetchen Díaz, adapted from (Burns and Wente, 2012) Trm1 as a Reporter for INM Peripheral Targeting

Trm1 (transfer RNA methyltransferase 1), catalyzes the modified base N2,N2- dimethylguanosine to position G26 of tRNAs. A single gene encodes proteins that locate in the mitochondria by a mitochondrial targeting signal (MTS) and the nucleus by its NLS (Ellis et al., 1986; Rose et al., 1992). TRM1 is a non essential gene as cells lacking this gene are viable. There are two isoforms of the protein that are made by alternative translation starts, Trm1-I and Trm1-II. Trm1-I, which localizes to the mitochondria, is the long form that begins translation at the first AUG producing a protein of 570 amino acids. Trm1-II which localizes to the mitochondria and to the INM (predominant) begins translation in the second AUG forming a protein of 554 amino acids. Trm1-II is located evenly at the INM in live and fixed cells and it locates to the same location when tagged with GFP (Li et al., 1989; Rose et al., 1992; Murthi and Hopper, 2005; Lai et al., 2009). There is evidence that indicates Trm1-II is a peripheral protein at the INM. First, the protein does not contain a predicted transmembrane domain. Second, Trm1-II mutants that are unable to tether to the INM, accumulates in the nucleoplasm (Murthi and Hopper, 2005; Lai et al., 2009). Third, the protein is released by using reagents that releases other peripheral proteins (Rose et al., 1995). In addition, the modification catalyzed by this enzyme occurs on pre-tRNAs before they are exported out of the nucleus (Etcheverry et al., 1979). These characteristics make the Saccharomyces cerevisiae Trm1-II, an ideal reporter to study peripheral targeting to the INM. It was hypothesized that in the absence of gene products involved in Trm1-II INM targeting/tethering, the protein will be mislocated to the nucleoplasm. To test this hypothesis, our group performed for the first time, a genome-wide screen approach to identify yeast genes involved in INM targeting (Murthi and Hopper, 2005). From this study, it was revealed that deletion of the gene that encodes the protein Ice2 (Inheritance of Cortical ER), mislocalizes Trm1-II-GFP to the nucleoplasm with a residual pool at the nuclear membrane. Ice2 is an ER type-III transmembrane protein involved in formation and maintenance of the cortical ER network in budding yeast (de Martin et al., 2005;

Loewen et al., 2007). Because of its ER location, it is unlikely that Ice2 is the INM tether for Trm1-II. Also, no evidence of a direct interaction between Ice2 and Trm1-II was found employing different approaches (Murthi, unpublished). Nevertheless, as suggested, Ice2 may play an indirect role in Trm1-II INM targeting by directing the authentic tether or regulating the levels of it (Murthi and Hopper, 2005). The genome-wide screen for INM targeting also revealed that deletion of genes that encode the subunits of the N-terminal acetyltransferase, NatC, causes Trm1-II-GFP to be nucleoplasmic. This heterotrimeric complex is composed of subunits of Mak (MAintenance of Killer) proteins, Mak3, Mak10 and Mak 31, where Mak3 is the catalytic subunit (Polevoda and Sherman, 2001). Previous studies proposed that the NatC complex is required for replication of dsRNA virus (Wickner and Leibowitz, 1976; Polevoda and Sherman, 2001), for targeting/association of the proteins Arl3 and Grh1 to the Golgi complex in yeast (Behnia et al., 2004; Setty et al., 2004; Behnia et al., 2007) and in targeting proteins to the chloroplast in plants (Pesaresi et al., 2003) . Yeast and higher eukaryotes may have the same systems for N-terminal acetylation as suggested by an analysis of sequences that are required for N-acetylation (Polevoda and Sherman, 2003). The signature sequence of NatC substrates, MLKA, is present at the N-terminal sequence of Trm1 (Murthi and Hopper, 2005). Indeed, Trm1 is acetylated and acetylation is necessary, but not sufficient for INM targeting. Murthi and Hopper suggested that N- acetylation may be involved in protein folding and or exposure of a cis-acting INM targeting motif. A mutational analysis (internal deletions and in vitro mutagenesis) of cis-acting elements for TRM1, revealed that the specific region composed of amino acids 133 to 151 was sufficient for NE targeting (Lai et al., 2009). The binding motif was capable to target tested reporter proteins to the NE. The binding motif was very close to the Trm1 active site as shown by the predicted structure. In fact, the mutants that were mislocalized from the INM had little or no enzyme activity. However, there was no correlation between Trm1-II activity and localization, as protein activity was reduced in other mutant of amino acids 133-155 that was appropriate located to the INM (Lai et al., 2009). Trm1-II

23 showed a nucleoplasmic localization when mutated at this binding motif. Also from this study we learned that the protein accumulates in the cytoplasm in the rna1-1 temperature sensitive mutant at non-permissive temperature. The Ran pathway was required for Trm1-II import, but not for its INM maintenance, as disruption of the pathway after the protein was located at the INM, did not alter its INM location (Lai et al., 2009). The evidence obtained from previous work, suggested that Trm1-II follows the classical import pathway similar to soluble nuclear proteins. The proposed model for Trm1-II INM targeting (Figure 9) suggests that the protein is translated on free polysomes in the cytoplasm and imported into the nucleus in a Ran-dependent manner through the NPC via the cNLS. Once at the nucleoplasm, Trm1-II is redistributed to the INM via the INM targeting/tethering motif (Lai et al., 2009). Trm1-II INM targeting is one of the best characterized peripherally associated proteins of the INM (that is not part of the NPC or the SPB). However, the exact mechanism for INM targeting/tethering is not completely solved. There are still important questions that remain. For example, why does Trm1-II need N-acetylation for INM targeting? What is the exact role of the ER protein Ice2? Are essential proteins involved in Trm1-II INM targeting? Are other peripheral INM proteins targeted in a similar way to Trm1-II? These are very important aspects that need to be understood as proteins at the INM plays crucial roles in the cell and nuclear architecture.

Cytoplasm

Nucleoplasm

Figure 9. Current model for Trm1-II INM targeting. The proposed model for Trm1-II INM targeting suggests that the protein is translated on free polysomes in the cytoplasm. After recognition via its cNLS by an importin complex (yellow), Trm1-II is imported into the nucleus in a Ran-dependent manner through the NPC. Once at the nucleoplasm, Trm1-II is redistributed to the INM via the INM targeting/tethering motif (Lai et al., 2009). Diagram by Greetchen Díaz.

Inner Nuclear Membrane Proteins and Disease

How proteins are targeted to the nucleus has special relevance to health. Alterations in nucleocytoplasmic transport are believed to play an important role in pathological cell conditions that result from different sources: changes in the cargo protein, changes in the transport receptor (karyopherins) and changes at the NPC (Chahine and Pierce, 2009; McLane and Corbett, 2009). Alterations in one or more of these factors for nucleocytoplasmic trafficking was found in different types of cell pathological conditions such as diabetes, cancer, hypertension, atherosclerosis, heart disease, cirrhosis, and viral infections. INM protein targeting is of special interest because inappropriate location of INM proteins causes laminophaties or envelophaties. Nuclear envelopathies are diseases caused by mutations in genes encoding proteins of the nuclear lamina (Nagano, 2000). A number of diseases are cause by envelophaties such as, muscular dystrophy, cardiovascular disease, lipodystrophy (degenerative conditions of adipose tissue), progeria (premature aging) and dysplasia (developmental abnormalities) (Worman, 2012). The best known and studied envelophaty is the Emery-Dreifuss muscular dystrophy (EDMD) which is caused by mutations in the gene that encodes the INM protein, Emerin (Bione et al., 1994; Lammerding et al., 2005). Localization of Emerin to the INM is dependent on lamins (Clements et al., 2000). One class of EDMD is due to mislocalization of Emerin from the INM to the ER as a result of the loss of incorporation of lamin proteins to the lamina (Sullivan et al., 1999). In addition, overexpression of lamin proteins can alter nuclear membrane (Prüfert et al., 2004; Ralle et al., 2004). Yeast undergoes closed mitosis and does not contain known lamin protein homologues. However, yeast has been used extensively to study NE abnormalities like those occurring in laminopathies (Hattier et al., 2007; Webster et al., 2009). It was shown, that human lamin B and chicken lamin B receptor (LBR) localizes to the INM when expressed in yeast cells (Smith and Blobel, 1994). Also, fungi (including yeast) contain a sterol C-14 reductase enzyme which is the activity carried out by LBR (Silve et al., 1998). 26

Yeast as a Genetic Model

A model organism is a non-human species that is studied to understand particular biological processes, which could provide insights into how they work in other organisms. The budding yeast, Saccharomyces cerevisiae, is an ideal experimental organism for genetic studies. S. cerevisiae shares the cellular architecture and a common life cycle with higher eukaryotes. Additionally, the tools available for yeast genetics and yeast biochemistry are invaluable and very powerful. Yeast has been used to understand biological phenomena involved in many human diseases (Smith and Snyder, 2001; Petranovic and Nielsen, 2008) such as cancer (Pereira et al., 2012), congenital disorders (Aebi and Hennet, 2001), neurorologic diseases (Walberg, 2000), and viral infections (Alves-Rodrigues et al., 2006). As mentioned above, yeast also has been used to study NE defects similar to those present in envelopathies. Many factors involved in nucleo-cytoplasmic transport (Ran), secretion and nuclear architecture (including NPC structure) are conserved from yeast to humans, and were first characterized using yeast. Specifically for INM targeting, previous investigations suggest that targeting mechanisms that occur in yeast, could take place in a variety of organisms (King et al., 2006; Straube et al., 2010; Gardner et al., 2011; Meinema et al., 2011). Moreover, S. cerevisiae was utilized as a model to study the delivery of virulence factors to the human cell nucleus (Skrzypek et al., 2003). In our study, we utilized budding yeast as a model organism and Trm1-II, a peripheral protein of the INM as a reporter, to elucidate the targeting mechanism of peripherally associated INM proteins.

Aims of this Study

There are previous studies for nuclear soluble proteins and INM integral membrane proteins that shed some light in understanding their targeting mechanism. However, the studies on how peripherally associated INM proteins are targeted and

tethered to the membrane are limited. In order to elucidate the players in INM targeting/tethering, our study aims: (1) To investigate essential proteins in S. cerevisiae that when mutated, cause a change in Trm1-II INM distribution and to identify the subcellular location of the mislocalized protein. We performed a screen for location of galactose-inducible Trm1-II-GFP (Gal-Trm1-II-GFP) using an ordered collection of temperature sensitive (ts) mutants (Li et al., 2011). We also used different cellular markers to identify the location of Gal-Trm1-II-GFP in those mutants. This genome-wide approach showed that the yeast SPB is important for Trm1-II’s appropriate distribution to the INM. (2) To describe the targeting mechanism of Trm1-II and compare it to other nuclear proteins. We followed the dynamics of the galactose-inducible proteins Trm1-II- GFP, Heh2-GFP and Pus1-GFP in a SPB ts mutant and analyzed the differences and similarities between them. (3) To investigate the effect of the SPB in Trm1-II targeting/tethering throughout the INM. We analyzed in more detail the dynamics of Gal- Trm1-II-GFP in SPB defective cells to determine whether the SPB was involved exclusively in INM targeting or was also affecting INM maintenance. In addition, we also studied if the SPB defect affected other cellular processes unrelated to its role as a MTOC.

Chapter 2: General Materials and Methods

Yeast strains and media

All the experiments were performed using the yeast strain BY4741 (MATa his3∆ leu2∆ met15∆ ura3∆). B4741 is the parent strain for the temperature sensitive (ts) colletion and the strains used from the deletion collection. Yeast strains were maintained in YEPD media with or without G418 (0.2 mg/ml) or in synthetic defined media (SC) lacking the appropriate nutritional ingredients for selection.

Yeast plasmids

The following plasmids were derived from a series of centromere (CEN) containing plasmids, pRS4XX (New England Biolabs) that also contains an autonomously replicating sequence (ARS). The plasmid employed for the screen of the temperature sensitive collection was pGP54a-Trm1-GFP, generated by A. Murthi and G. Peng and it contains a galactose-inducible Trm1-GFP in the centromeric-containing pRS416 plasmid background (yeast auxotrophic marker URA3). In addition, a plasmid containing galactose-inducible Trm1-II-GFP in a pRS415 background (yeast auxotrophic marker LEU2) was generated by T. Harchar and used in co-localization experiments. Both galactose-inducible promoters were derived from the GAL1-GAL10 regulatory region. Similar plasmids were generated to monitor targeting of galactose-inducible Pus1 and Heh2. Plasmid pGP54a-Pus1-GFP was generated by inserting the PUS1 open reading frame (ORF) into the polylinker region of plasmid pGP54a. Oligonucleotides used to amplify the ORF were GDM031-032 (Table 1). Plasmid pGP54a-Heh2-GFP was generated by T.P. Lai using the same strategy as for the Pus1 plasmid. Oligonucleotides

used to amplify the ORF were GDM027-028. Plasmid pRS415-Trm1-II-GFP (Murthi and Hopper, 2005) was used in experiments to analyze Trm1 regulated by its own promoter. To visualize the nuclear pore protein Nup49, a plasmid (TPL3) containing Nup49- mCherry regulated by the ADH2 promoter in the pRS415 backbone (Lai et al., 2009) was used. To visualize the chromatin, the histone protein, H2B was tagged with mCherry in a pRS415 plasmid under the control of the ADH2 promoter (provided by O. Egriboz, J. Hopper lab) Vector pag25mCherry, generated by W. Chang, contains mCherry along with clonNAT drug marker and was used as template for PCR (oligonucleotides GDM013- 014) and subsequent genomic tagging of spindle pole body protein, Spc97. Vector pRS415mCherry, contains mCherry along with the LEU2 marker and was generated in this study as template for PCR amplification (oligonucleotides GDM083-084) to subsequent genomic tagging of the ER protein Sec63. Plasmid NLS-(73-151)-Trm7-GFP encodes a cytoplasmic protein, Trm7, which is targeted to the nuclear envelope by the Trm1 region 73-151. This vector was used in co- localization experiments and was generated from vector pIGoutA (Butterfield-Gerson et al., 2006) by T.P. Lai (Lai et al., 2009) . Plasmid construction was conducted by restriction digestion of DNA fragments in buffers suggested by the manufacturers, usually for 1 hour at 37⁰C. Dephosphorylation of DNA fragments was performed by adding 1 l CIP phosphatase (New England) to the

digestion reaction after 1 hour and adding µan extra hour of incubation at the same temperature. DNA fragments were amplified by cloning into pGEM vector (Stratagene). Then, DNA fragments of restriction products were ligated using T4 DNA ligase (New England Biolabs). E. coli DH5α was utilized for recombinant DNA plasmid propagation and was maintained in Luria-Bertani (LB) media with antibiotics for selection.

Chemically competent E. coli cells

E. coli DH5α was grown overnight on LB plate at 37⁰C. Colonies were transferred to 250 ml of Super Optimal Broth (SOB) media (250 ml= 5g Tryptone, 1.25g

Yeast Extract, 0.125g NaCl, 0.625ml 1M KCl, 1.25ml 2M MgCl2). Cells were grown by

incubation at 18⁰C with vigorous shaking until A600= 0.55-0.75. The culture was incubated on ice for 10 minutes before centrifugation (Beckman Coulter Avanti J-26 XP) at 5,000 rpm for 10 minutes at 4⁰C. The pellet was respuspended in 80 ml of ice-cold TB solution (1L= 2.383g 10 mM HEPES, 2.205g 15mM CaCl2, 18.64g 250mM KCl, pH

adjusted to 6.7 by adding KOH, then 10.88g MnCl2.4H2O and completed with water). Cells were incubated 10 minutes on ice bath and centrifuged. The pellet was respuspended in 20 ml of ice-cold TB. Then, 1.5 ml of dimethyl sulfoxide (DMSO) was added slowly, followed by incubation on ice for 10 minutes. Cells were aliquoted in microtubes and frozen using liquid nitrogen.

Plasmid DNA isolation and E. coli transformation

Plasmid DNA was isolated using the Qiagen® mini-prep kit following manufacturer’s instructions. For bacterial transformation, 100µl of competent DH5α E. coli cells in a microtube was thawed on ice. 1 µl of plasmid DNA was added and cells were incubated on ice for 20 minutes. Heat shock was performed at 42⁰C for 45 seconds followed by one minute incubation on ice. Then, 800 µl of Luria-Bertani (LB) media was added to the cells. Cells were incubated in an air shaker at 37⁰C for 15 minutes. For transformation of ligation products, cells were incubated for 1 hour. After recovery, cells were plated in LB media containing 50µg/ml of ampicillin or kanamycin for selection.

Bacterial colony PCR

Bacterial cells growing on selection media were selected by a tip on a micropipette and resuspended into the PCR mix. PCR reactions of 25µl each were performed by setting up a master mix reaction containing PCR Buffer (5x GoTaq), 10mM dNTPs mixture (dATP, dCTP, dGTP and dTTP), 10 µM of each oligonucleotide, and water to complete final volume. Bacterial colonies were picked by using a micropipette tip and resuspended into the PCR tube containing 25µl of the master mix reaction. In addition, cells from the same tip were inoculated into LB liquid media containing antibiotic and incubated overnight at 37⁰C for plasmid isolation if the candidate was verified by PCR.

Sequencing

DNA sequencing was carried out by the Plant-Microbe Genomics Facility at The Ohio State University.

Yeast plasmid transformations

In a microtube, 500 µl of overnight grown yeast culture were pelleted and resuspended in 100 µl of transformation mix containing 40% of PEG, 0.1M DDT, 0.5 µg of boiled sheared salmon sperm DNA (sssDNA) and 0.2M LiAc. 3 µl of mini-prep isolated plasmid DNA was added to individual transformants. Heat shock of cells was performed at 42⁰C for 30 minutes for wild type and single deletion strains and for 15 minutes for temperature sensitive strains. After heat shock cells were plated in selective media plates and incubated at the appropriate temperature (30⁰C or 37⁰C) for 2-3 days.

Yeast transformation for genomic tagging

To obtain competent cells, 50 ml of yeast culture grown overnight to an OD of 1 to 3 at 600 nm, was pelleted in a 50 ml Falcon tube at 4,000 rpm using a Jouan tabletop centrifuge for 5 minutes. The pellet was resuspended into 2 ml of freshly prepared 1XTE- 1XLiAc solution (10X TE= 100mM Tris-HCl + 10mM EDTA, pH 7.5 and 10X LiAc = 1M LiAc, pH 7.5 by using acetic acid). Cells were pelleted again and resuspended into 1 ml of 1XTE-1XLiAc solution to use for immediate transformation or was storaged at 4⁰C for a week. Integration of DNA fragments into the yeast genome by homologous recombination was carried out by adding 10µl of PCR product and 5 µl of sssDNA into a 2 ml microtube containing 100 µl of competent cells. Microtubes were placed in a rolling platform and incubated at 30⁰C for 30 minutes. 650 µl of TE/Lithium Acetate/PEG mix (6.66 ml 60% PEG, 1 ml 1M LiAc, 1ml 10X TE and 1.33 ml water) was added to the microtubes and content was mixed slowly. Microtubes were placed in a rolling platform at 30⁰C for 1 hour. Then, microtubes were placed in a water bath at 42⁰C for 15 minutes. Cells were pelleted at 4,000 rpm using a 5426 Eppendorf microcentrifuge for 5 minutes and were resuspended in water. Cells were plated in selective media and incubated at 23⁰C or 30⁰C. For drug selection markers, cells were resuspended in YEPD media, grown for 6 hours aand then plated into selective drug media.

Isolation of DNA from yeast

In a microtube, 200-500 µl of yeast culture was pelleted and resuspended into 200 µl of zymolyase solution (pinch of powder diluted in water). Cells were incubated at 37⁰C for 30 minutes. After incubation 200 µl of 1:1 phenol:chloroform and 20 µl of sodium dodecyl sulfate (SDS) were added and the resulted mixture was vortexed briefly. Samples were pelleted for 2 minutes at maximum speed to remove supernatant and were transferred into a new microtube. NaOAc was added to a final concentration of 0.1M, and then 2 volumes of 100% ethanol were added and mixed by inversion. Microtubes were

placed at -80⁰C for 20 minutes. After incubation, samples were pelleted for 10 minutes and supernatant was decanted. The pellet was washed twice with 700 µl of iced-cold ethanol and then pelleted for 1 minute. The pellet was air dried and resuspended in 50- 100 µl of water.

PCR

25, 50 or 100 µl reactions were performed by setting up a master mix reaction containing PCR Buffer (5x for GoTaq versus 10X for Pfu or Invitrogen Platinum Taq), 10 mM dNTPs mixture (dATP, dCTP, dGTP and dTTP), 10 µM of each oligonucleotide, ~100 ng/µl of plasmid or genomic DNA and water to complete final volume. Standard PCR conditions during thermocycling were 94⁰C for 3 minutes, followed by 25-30 cycles of 94⁰C for 30 seconds (denaturation), 55⁰C for 30 seconds (annealing) and 68-72⁰C (GoTaq or Platinum Taq versus Pfu, respectively) for 2-5 minutes (extension, depending on the size product). Then, a final extension of 68-72⁰C for 5 minutes completed the reaction. Annealing temperatures for gradient PCR ranged from 50-61⁰C or 55-66⁰C.

DNA manipulation

PCR reactions, genomic preps, and digestion products were resolved on ethidium bromide containing agarose gels (0.8-1%) in 1X TBE (10X: 108 g Tris base, 55g boric acid, 7.44 g EDTA in 500 ml of water). 6X loading dye (Fermentas) was added to DNA samples before electrophoresis. In some cases, DNA was purified from gel slices using the Qiagen® gel purification kit following the manufacturer’s instructions. In other cases, DNA was purified directly from the PCR reaction using the Qiagen® PCR purification kit or by DNA precipitation. DNA precipitation was carried out by adding 0.1 volumes of 5M NaOAc, 2.5 volume of 100% ethanol followed by incubation for 1 hour at -80⁰C. DNA was pelleted at 14,000 rpm using a 5426 Eppendorf microcentrifuge for 20

minutes, then washed twice with 70% ethanol, dried and resuspended in 10-30 µl of water.

Indirect immunofluorescence

Indirect immunofluorescence (IF) was performed as described by Li et al., (1989) and Pringle, et al (1991). 10 ml of yeast culture were grown overnight to log phase in an air shaker at 23⁰C. In experiments to localize galactose inducible Trm1-GFP, cells were induced as described above and maintained at 23⁰C or shifted to 37⁰C for 1.5 to 2 hours before processing. Then, 1.2 ml of 37% formaldehyde was added to a 15 ml Falcon tube where cultures were transferred. Cultures were centrifuged at 4,000 rpm for 5 minutes using a Jouan tabletop centrifuge. Pellets were resuspended in 5 ml of solution A containing 40mM K2HPO4-KH2PO4 and 500 µm MgCl2. The solution was supplemented with 0.6 ml of 37% formaldehyde and cells were incubated at room temperature for 25 to 30 minutes depending on the primary antibody used. For use of primary monoclonal rabbit Kar2 antibody, 1:50,000 dilution (Rose et al., 1989) and also polyclonal rabbit Kar2 (y-115) antibody (Santa Cruz Biotechnology, 1:5,000 dilution) cells were incubated for 25 min. For use of primary mouse monoclonal Nsp1 antibody (1:10,000 dilution) (Tolerico et al., 1999), mouse monoclonal anti-Nop1 (Aris and Blobel, 1988) and mouse monoclonal anti-HA (Babco) antibodies incubation was 30 min. After incubation, cells were washed twice with solution A and resuspended in solution B containing 40mM

K2HPO4-KH2PO4, 500 µM MgCl2 and 1.2 M sorbitol. Cells were pelleted and resuspended in 500 µl of digestion solution (1 ml solution B, 55µl glusulase, 10µl mercaptoethanol and a toothpick tip of zymolyase 20T powder, MPbio) for cell wall removal (digestion) by using a sterile wooden stick and were incubated at 37⁰C for 20-40 minutes. Digestion was monitored by light microscopy at different time points until about 60-70% of the cells had their wall removed. Digested cells were pelleted at 3,000 rpm for 3 minutes using a Jouan tabletop centrifuge. Cells were resuspended in solution B for

washing (twice). After washing, cells were resuspended again in 200-500 µl of solution B, depending on cell density. Cells were adhered to glass 8-well slides (placed in a big Petri dish) by using poly-lysine (1:10 dilution from 0.1% stock, Sigma) for 10 seconds. 10 µl of sample was added to each well and aspirated after 1 minute. To inhibit non-specific binding of antibodies, 10 µl of solution F was added to each well for blocking. Solution F contained

0.73mM KH2PO4 pH 7.4, 0.15 M NaCl, 0.015 NaN3 and 0.1% BSA. After 1 hour, solution F was aspirated and primary antibody diluted (as mentioned above) in solution F, was added and incubated for 1 hour. After incubation, primary antibody was aspirated from the wells and washed seven times with solution F. Secondary antibody (CY3 goat anti rabbit IgG or CY3 goat anti-mouse IgG, Jackson laboratories) diluted 1:400 in solution F was added to each well and incubated for 1 hour covered by aluminum foil. Secondary antibodies used were Cy3-conjugated goat anti-rabbit IgG and Cy3- conjugated goat anti-mouse IgG. After incubation, wells were washed five times with solution F. To visualize DNA in the cells, 4’,6-diamidino-2phenyllindole dihydrochloride (DAPI, 1:100,000 dilution in water from a 10mg/ml stock) was added to the wells and incubated for 1 minute, then washed twice with water. Mounting media (50 mg of phenylenediamine in 5 ml PBS, pH 9 added to 25 ml glycerol) was added to the slide and then covered with a cover slip that was sealed by using nail polish and storage at -20⁰C before microscopy.

Microscopy and Imaging

For live imaging (short time experiments) and for GFP and/or mCherry fixed cells, agarose slants (1.2%) were prepared on microscope slides to avoid cell movement caused by liquid media. Cells were visualized using Differential Interference Contrast (DIC), fluorescein isothiocyanate (FITC), DAPI and/or Texas red filters in a Nikon 90i microscope and a 60x objective. Imaging was performed using a CoolSNAP HQ2 (Photometrics) camera along with METAMORPH or Nis-Elements software.

For live imaging of long term experiments, the Cell Asic ONIXTM microfluidics system was used (See chapter 5 for detailed information). Microscopy was performed in a Nikon spinning disk confocal microscope apparatus (UltraView, PerkinElmer Life and Analytical Science, Waltham, MA). Cells were visualized using 488nm (green) and 568nm (red) argon ion lasers and a 100x/1.4 NA objective lens. Imaging was performed using a cooled charged coupled device camera (ORCA-AG, Hamamatsu, Bridgewater, NJ) along with UltraView ERS software (3.1). Image analyses of single optical 0.4-μm optical sections were performed using Image J (http://rsb.info.nih.gov/ij/). Adobe Photoshop was used for image assembly (San Jose, CA).

Western Blot

Western Blot analysis was used to determine levels of galactose inducible Trm1- II-GFP in WT and SPB ts strains (spc110-220, spc42-10, mps3-1, mps1-1, mps2-2). 5 ml of yeast cells were grown to OD600 = 0.45. Cells were induced using 2 % galactose and incubated at 23⁰C or 37⁰C for 2 hours. Cells were collected, pelleted and washed with water. Cells were resuspended in 100 µl of lysis buffer (50mM Tris-HCl, pH 7.4, 150 mM NaCl, 25mM EDTA, 1% Triton X-100, 0.5% SDS and 10mM PMSF in 1M methanol) and soda lime glass beads (Thomas Scientific) were added (1:1 volume). To break cells, samples were vortexed for 30 seconds followed by 1 minute on ice (10 times). Then, cells were centrifuged for 10 minutes at maximum speed at 4⁰C. Lysate was transferred to a new tube. Protein concentration was measured using the Bradford Assay (Pierce). Protein sample was boiled with 4X protein dye (0.2M Tris-Hcl pH 6.8, 8% SDS, 0.4% BPB, 40% glycerol and 57.2 mM 2-mercaptoethanol) for 5 minutes, and then placed on ice for 3 minutes before loading into 10% polyacrylamide gel. SDS-PAGE was run at 100V, using running buffer (0.025M Tris-Hcl pH 8.3, 0.192 M glycine and 0.1% SDS). The protein was transferred to a nitrocellulose membrane (Amersham Hybond) at 0.3A for 1 hour and using transfer buffer (30mM glycine, 0.037% SDS, 20%

methanol and 48mM Tris-HCl, pH 8.3). The membrane was blocked using blocking buffer (5% non-fat milk and 1% BSA/TBST) at 4⁰C and washed with TBST buffer (20mM Tris-Hcl, pH 7.4 and 0.1% Tween 20). Protein detection was carried out using primary antibody mouse anti-GFP (1:1,000, Roche), then secondary antibody, anti-mouse horseradish peroxidase conjugated antibody (1:7,500, Amersham) for 1 hour each. Blots were developed using the Super Signal® West Femto Maximum Sensitivity Substrate (Pierce).

Oligonucleotides Oligonucleotides were synthesized by Sigma-Aldrich® and are listed in table 1.

Table 1. Oligonucleotides used in this study

Primers Oligonucleotide sequence

GDM013 5'TTCTTTACTCTATAGTACCTCCTCGCTCAGCATCTGCTTCTTCCCAAAGAGGAGCTGGTGCAGGCGCTGG3’ GDM014 5'ACAACCAAAGAAACTACCCTAGTGAGGTGTATGCTGACTTGGTATCACACCCAGGTCGACGGATCCCCGG3’ GDM015 5'ATGTCAACTGGACCCCGTAC3’ GDM016 5'CATCTACACACCGCACGCC3’ GDM017 5'GTAAGATCAAAGCCAGAAAGCAATG3’ GDM027 5’CCCGGGATGGATCACAGAAACCTT3’ GDM028 5’CCCGGGTTCTTTCCATTCCCAACA3’ GDM031 5’CCCGGGATGTCTGAAGAGAATTG3’ GDM032 5’AAGCTTATTAGCTGCCGCTTCCGG3’ 39

GDM083 5’GGTGTAAATGGCGACGAACAAGATGCTATCTTATTGAAAAAACACATTTCTTAACAGATGGCTGGAGAGTGCACCATATCGACTAC GTCGTAAGGCCG3’ GDM084 5’GAAAGTGATGCTAGCGATTATACTGATATCGATACGGATACAGAAGCTGAAGATGATGAATCACCAGAAGGAGCTGGTGCAGGCG CTGG3’ GDM085 5'GAATATGAAAGTTCGTGATTCTCCTGCAGTGG3’ GDM086 5'CCAGCAGTGGATGATCTTACAAAGCAATGG3’

Chapter 3: Genomic Screen of Essential Genes for INM Protein Targeting in

Saccharomyces cerevisiae

Abstract

Here we report the results of screening an ordered collection of yeast strains with of temperature sensitive (ts) mutations of essential genes employing a version of a galactose-inducible Trm1-II-GFP (Gal-Trm1-II-GFP). We uncovered numerous mutants that caused Gal-Trm1-II-GFP mislocalization. At non-permissive temperature, Trm1- GFP accumulates as one or multiple spots rather than being evenly distributed around the entire INM. Surprisingly, about 35% of the mutated genes affecting Gal-Trm1-GFP location encode for components of the Spindle Pole Body (SPB) or related proteins. Also a large number (46%) of the ts mutants affecting Gal-Trm1-II-GFP, have mutations in genes that encode proteins involved in endoplasmic reticulum (ER) and Golgi homeostasis. Finally, WT cells treated with chemical compounds that alter the same cellular processes and structures as the ts mutants, showed mislocalization of Gal-Trm1- II-GFP. Thus, essential processes in yeast that occur at the ER and the nucleus are important for appropriate INM localization of Gal-Trm1-II-GFP.

Introduction

Our research group employs budding yeast, Saccharomyces cerevisiae as a model system to study tRNA biogenesis. tRNAs molecules are highly modified. These modifications are added to tRNAs in various subcellular compartments (Phizicky and Hopper, 2010). The work reported here was originally motivated to learn why and how the tRNA modifications enzymes are distributed to different subcellular compartments.

How Trm1, a tRNA methyltransferase, is targeted to different compartments (the mitochondria and the INM) has been subject of study in our group for years. As discussed in Chapter 1, Trm1-II is peripherally associated to the INM. Thus, Trm1-II is an ideal reporter protein to study targeting of peripherally associate proteins to the INM. In 2005, our group identified mutations of unessential genes that affect Trm1-II INM location by performing a genome-wide approach (Murthi and Hopper, 2005). More recently, our group characterized a cis-acting region of Trm1-II that is necessary and sufficient for its INM location (Lai et al., 2009). However, the Trm1-II tether remains unknown and the mechanism by which Trm1-II associates with the INM remains unexplored. In order to study which essential proteins are involved in Trm1-II INM tethering/targeting, we performed a genetic screen employing an ordered collection of temperature sensitive mutants developed by Dr. C. Boone’s laboratory in Toronto, Canada (Li et al., 2011).

Temperature Sensitive Collection

The yeast genome is predicted to contain about 6,200 protein-encoding genes. Of these, about 5,000 deletion mutants are viable, while ~1,200 are not (Giaever et al., 2002). To study the loss of function of the essential genes it is necessary to employ mutant strains with conditional mutations for function or conditional regulation. An ordered collection of temperature sensitive (ts) mutants for essential genes was created by Dr. Charles Boone’s laboratory (Li et al., 2011). They collected 1,300 ts alleles from more than 280 laboratories. They utilized a PCR-based homologous recombination strategy to amplify each ts allele and integrated the mutant alleles into the genome of the yeast strain BY4741. Each allele was marked with a kanamycin resistance gene (kanR). To date, the collection contains ~787 ts allele strains representing 497 essential genes (~45% of all essential genes in yeast). Approximately 30% of the genes are represented by multiple alleles. After shift to non-permissive temperature, the gene product is inactivated rapidly. The ts strain collection was further validated by plasmid

complementation (Li et al., 2011). By collaboration with Dr. Boone we accessed the collection which at the time contained 757 alleles. In order to study INM targeting using this collection we transformed each of the strains with a plasmid containing a galactose- inducible Trm1-II-GFP. By using this inducible system we were able to visualize the phenotype of only newly synthesized protein after the shift to non-permissive temperature.

Specific Aim

We aim to identify essential gene products that when mutated, disrupt Gal-Trm1- II-GFP INM distribution.

Methods

96-well Plate Yeast Transformation and Galactose Induction of TRM1-II-GFP

Transformation of the plasmid pGP54aTRM1-GFP into the entire temperature sensitive collection was performed using a method based in the LiAc transformation protocol (Ito et al., 1983) and adapted for the 96-well plate format (Murthi and Hopper, 2005). Cells were grown in YEPD + G418 in 96-well plates for two days (Figure 10). The cells were collected by using a Jouan CR412 centrifuge containing an adapter for 96- well plates. The media was aspirated and cells were resuspended in 100 µl of transformation mix composed of 40% of PEG, 0.1M DTT, 0.5 µg of boiled single stranded sheared salmon sperm DNA (sssDNA), 0.2M LiAc and approximately 1 µg of plasmid DNA. Heat shock was performed using an Inca personal plate incubator (Mikura) at 45⁰C for 15 minutes. Then, 10µl of cells were transferred (in duplicate) to solid selection media, SC –ura, and incubated at 23⁰C for approximately one week. The remaining cells in the transformation plates were pelleted and resuspended in liquid selection media for incubation at 23⁰C. After visible grow, cells were pelleted and resuspended in 60% glycerol for long-term storage at -80⁰C. A total of 740 yeast strains,

representing about 99% of the temperature sensitive collection (750 strains total) were examined for the location of Gal-Trm1-II-GFP after shift to non-permissive temperature. The original collection contained a total of 757 strains, but 7 strains were unable to grow when transferred from the original plate and the other 10 strains were unable to grown after transformation.

Microscopy (screen)

Cells were observed using DIC microscopy and epifluorescence using the FITC channel for GFP fluorescence. During microscopy, slides were maintained at 37-38⁰C by the use of the microscope stage warmer (Nikon). After all rounds of preliminary observations, the temperature sensitive mutants that showed mislocalization of Gal- Trm1-II-GFP were verified by repeating the galactose induction in a second and third round. This allowed eliminating false positive candidates identified on the initial screen. Cells on slides containing agarose slants were observed using the fluorescence microscope.

Low copy Trm1-II-GFP in SPB ts mutants

To study the phenotype of Trm1-II-GFP at endogenous levels, WT and the SPB ts mutant spc110-220 expressing a CEN plasmid, pRS415-Trm1-II-GFP (from T.P Lai) was utilized. Cells were grown overnight to log phase in selective media (SC –ura) and shifted to non-permissive temperature for 2 hours before they were observed.

Treatment with alpha factor, Brefeldin A and DTT in WT cells

All the treatments were performed with WT cells at log phase of growth to test whether Gal-Trm1-GFP was mislocalized. First, for cells treated with yeast pheromone, 2µg/ml of α-factor (dissolved in water, Sigma) was added to the media and the culture 43

was incubated at 23⁰ C in an air shaker until the typical shmoo phenotypes were detected by microscopy (1-2 hours). For treatment with Brefeldin A (Sigma), a final concentration of 75µg/ml (dissolved in methanol) was added to the media and culture was incubated for 1, 2, or 3 hour in an air shaker at 23⁰ C. Then, Gal-Trm1-GFP was induced using 2% galactose for 1.5 hours, as described above. For DTT treatment, a total of 8mM DTT (Sigma) was added to the media simultaneously or one hour before galactose induction. Cells were observed using fluorescence microscopy on slides containing agarose slants as described in Chapter 2.

C D E

Figure 10. Screen strategy and galactose induction of Gal-Trm1-II-GFP. A. Cells were grown in 96-well plates containing YEPD + G418 for 2 days at 23⁰C. B. Yeast cells were transformed with plasmid pGP54a-TRM1-GFP using 96-well plate LiAc transformation procedure. C. Cells were plated onto selective media (SC –ura). D. After grown in plates, (~1 week), cells were grown individually in liquid selective media overnight. Cells were induced using 2% galactose for 30 minutes at 23⁰C, then shifted to 37⁰C for 1.5 hr. E. Cells were observed using fluorescence microscopy. Diagram by Greetchen Díaz.

Results

By screening a collection of temperature sensitive (ts) mutantions of essential genes, we uncovered 63 mutants (representing 53 genes) for which galactose-inducible Trm1-II-GFP was mislocalized. This number represents 8.5% of the total of strains examined (740). The majority of the mutations affecting Gal-Trm1-II-GFP location occurred in genes that encode for proteins of the SPB, ER homeostasis, and secretion. Upon galactose induction at the non-permissive temperature, the ts mutants showed a predominant spot phenotype for Gal-Trm1-II-GFP, rather than being evenly distributed around the entire INM as in WT cells (Figure 11). The spot phenotype appears as single spot close to the NE (SS), double or multiple spots close to the NE (DS) or cytoplasmic spots (CS). Some cells also showed a half-moon phenotype (HM), which looks like an incomplete ring close to the nuclear envelope. Many of the mutants in this group were represented by more than one allele. However, not all the mutated alleles present in the collection for a particular gene affected Gal-Trm1-II-GFP localization to the INM. A caveat of the galactose-inducible system is that the protein is expressed in large quantities. To address this caveat, we tested if endogenous expression of Trm1-II-GFP also mislocalizes as a spot in the ts mutants (Figure 15) and found that it does and the phenotype we detected in our screen is not caused just by over expression upon galactose induction.

Gal-Trm1-II-GFP is mislocalized in Temperature Sensitive Mutations of Genes that Encode Spindle Pole Body

About 35% (19) of the mutated genes affecting Gal-Trm1-II-GFP location encode components of the Spindle Pole Body (SPB) and kinetochore proteins (Figure 12 and Table 2). These mutants displayed a spot phenotype for Gal-Trm1-II-GFP in contrast to WT in which Gal-Trm1-II-GFP is evenly distributed around the INM (Figure 14). As mentioned in Chapter 1, the SPB is the microtubule organizing center (MTOC) in yeast. In S. cerevisiae, the SPB is attached to the nuclear membrane during its entire life cycle 45 and it contains a complex structure composed of three plaques, the outer, the central and the inner. These plaques are connected to the nuclear membrane by other SPB components that are membrane proteins. During cell division, the SPB is duplicated. During that process, the SPB forms a half bridge and a satellite where the new SPB is assembled.

Ring at NE

Spot

Single close to NE Double or Multiple cytoplasmic close to NE

Half-moon

Figure 11. Phenotypes found in the screen for essential genes affecting localization of Gal-Trm1-II-GFP. Green represents the location of Gal-Trm1-II- GFP. WT and ts mutants that do not affect Gal-TRm1-II-GFP location showed a ring at the NE. The spot phenotype appears as single spot close to the NE (SS), double or multiple spots close to the NE (DS) or cytoplasmic spots (CS). Some cells also showed a half-moon phenotype (HM), which looks like an incomplete ring close to the nuclear envelope. Diagram by Greetchen Díaz.

8% 11% 35% SPB ER-Golgi 46% Proteolysis Others

Figure 12. Distribution of temperature sensitive mutants affecting Gal-Trm1-II- GFP localization. In blue, the SPB ts mutants. In orange the ts mutants for genes that encode proteins of the ER, the early secretion pathway and lipid biosynthesis. In green, ts mutants for proteins involved in proteolysis. In purple, other ts mutants. A total of 740 yeast strains, representing about 99% of the temperature sensitive collection, were examined for the location of Gal-Trm1-II- GFP. Only 8.5% of the strains affected Gal-Trm1-II-GFP location.

A total of thirteen out of the eighteen known SPB core components, are represented in the ts collection: Tub4, Stu2, Spc29, Spc42, Spc110, Cmd1, Bbp1, Mps2, Mps3, Nbp1, Ndc1, Cdc31 and Sfi1. Among the other five core components that are not present, only two are essential (Spc97 and Spc98), while proteins Cnm67, Nud1 and Spc72 are not. From those thirteen SPB proteins represented in the collection with ts mutations of their genes, a total of nine, were found to affect Gal-Trm1-II-GFP localization (Tub4, Spc29, Spc42, Spc110, Cmd1, Bbp1, Mps2, Mps3 and Ndc1). Their localization at the SPB is described in Figure 13 and they correspond to all parts of the structure (the three plaques as well the half bridge and membrane proteins). In addition, the group of ts mutant genes affecting Gal-Trm1-II-GFP localization is represented by more than one ts allele, with the exception of ndc1, which is present only in the allele ndc1-4. All the ts alleles corresponding to the gene products Tub4, Spc42, Cmd1, Bbp1 and Mps2, affected Gal-Trm1-II-GFP localization (Table 2). However, for genes that encode Spc29, Spc110 and Mps3, one of the two ts alelles included in the collection were found to have a WT phenotype (spc29-3, spc110-221 and mps3-7 respectively). The majority and the most severe phenotypes occur when cells are defective in SPB components of the central plaque (Spc42 and Spc110) or components that are attached to the nuclear membrane (Mps2, Bbp1). Spc110 is also part of the outer plaque. Interestingly, the mutation in spc110-220 is at the C-terminus of the protein which is essential for correct SPB assembly, while the mutation in spc110-221 is at the amino- terminus and affects binding to ϒ-tubulin complex and no cytological defect is present at non-permissive temperature (Sundberg and Davis, 1997) Two essential kinases that regulate core proteins of the SPB and have a critical role on its function, Mps1 and Cdc28, are represented in the ts collection. Mps1, phosphorylates Spc42, Spc98 and Spc110 (Pereira et al., 1998; Friedman et al., 2001; Castillo et al., 2002) and it is involved in many step of SPB duplication (Schutz and Winey, 1998). The gene that encodes Mps1 is present in the collection as the ts alleles mps1-1, mps1-6, mps1-417 and mps1-3796. Only the ts alleles mps1-1 and mps1-6 were found among the ts mutants affecting Gal-Trm1-II-GFP localization. Cdc28 has a role in

SPB duplication by phosphorylation of Spc42, Spc110 and Mps1 when in complex with other proteins (Jaspersen et al., 2004; Huisman et al., 2007). Four different ts alleles are present in the collection for Cdc28 (cdc28-1, cdc28-4, cdc28-13 and cdc28-td). Only the first two showed mislocalization of Gal-Trm1-II-GFP. In summary, a total of eleven SPB proteins were found in our screen (21% of total). The screen also revealed that Gal-Trm1-II-GFP INM distribution is altered in mutants for kinetochore proteins (8 genes). We group the kinetocore ts mutants with the SPB ts mutants as their functions are strictly related. According to the Saccharomyces Genome Database (SGD), there are about 45 kinetochore-related proteins described in yeast and 26 are essential. The ts colletion includes ts genes of twenty of them and seven (Cbf2, Dad2, Nnf1, Nls1, Spc25, Spc34 and Sgt1) were found in our screen affecting Gal-Trm1-II-GFP localization. Ts alleles, cbf-1, cbf-2, nnf1-48, nnf1-77, nsl1-6, spc34-ts and sgt1-5 were present in the collection, but showed WT phenotype for Gal-Trm1-II- GFP localization. The function of the proteins encoded by the mutants affecting INM location is variable as some are involved in kinetochore assembly, but other in its regulation.

The Spindle Pole Body Cycle

Figure 13. Gene products of the SPB ts mutants that affect localization of Gal-Trm1-II- GFP. The SPB cycle is represented according to the stages of the yeast cell cycle. The proteins are color coded to their corresponding region of the SPB. Spc110 localizes to both, the central and inner plaque. Tub4 localizes to both, the outer and the inner plaques. In black and underlined, proteins that are not core components of the SPB, but instead, are regulators of the SPB components. Their organization represents the suggested step in the SPB cycle where they participate. Diagram by Greetchen Díaz.

Figure 14. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes encoding SPB components. DIC and fluorescence images of representative SPB ts mutants. Bar= 5µm.

Figure 15. The spot phenotype occurs in SPB ts mutant expressing Trm1-II-GFP controlled by its own promoter. WT (A) and SPB ts mutant spc110-220 (B) Expression of Trm1- II-GFP (CEN plasmid pRS415-Trm1-II-GFP) in ts spc110- 220 after 2 hours at 37⁰C. At non-permissive temperature, the ts mutant shows accumulation of Trm-II-GFP (white arrows). Bar = 5µm.

Table 2. SPB temperature sensitive mutants affecting Gal-Trm1-II-GFP INM localization

Gene Alelle (s) in ts collection Gal-Trm1-II-GFP Gene product description from SGD phenotype *

BBP1 (YKR037C) bbp1-1, bbp1-2 SS + + + Required for SPB duplication Bfr1 Binding Protein

CBF2 (YGR140W) cbf2-42 SS + Kinetochore protein, component of a complex that binds to a region of the Centromere-Binding centromere Factor

CDC28 (YBR160W) cdc28-1 , cdc28-4 SS, HM + + Cyclin-dependent kinase (CDK). Phosphorylates Spc42, Spc110 and Mps1 Cell Division Cycle

CMD1 (YBR109C) cmd1-1, cmd1-3, cmd1-8 SS + + + Ca2+ binding protein that regulates mitosis, bud growth, actin organization, CalMoDulin endocytosis, etc., as well stress-activated pathways

53 DAD2 (YKR083C) dad2-9 SS + + + Subunit of the Dam1 complex that couples kinetochores to the force Duo1 And Dam1 produced by MT depolymerization interacting

MPS1 (YDL028C) mps1-1, mps1-6 SS, HM + + + Kinase required for SPB duplication and spindle checkpoint function MonoPolar spindle

MPS2 (YGL075C) mps2-1, mps2-2 SS, HM + + + Membrane protein localized at the NE and SPB, required for insertion of the MonoPolar spindle newly duplicated SPB into the nuclear envelope

MPS3 (YJL019W ) mps3-1 SS, HM + + NE protein required for SPB duplication and nuclear fusion MonoPolar Spindle

NDC1 (YML031W) ndc1-4 SS + NE protein with multiple putative transmembrane domains, required for NPC Nuclear Division Cycle assembly and SPB duplication

Table 2: continued NNF1 (YJR112W) nnf1-17 SS + + Component of the MIND kinetochore complex which joins kinetochore Necessary for Nuclear subunits contacting DNA to those contacting microtubules Function

NSL1 (YPL233W) nsl1-5 SS, HM + + + Component of the MIND kinetochore complex joins kinetochore subunits Nnf1 Synthetic Lethal contacting DNA to those contacting microtubules

SGT1 (YOR057W) sgt1-3 SS + Co-chaperone protein; Involved in kinetochore complex assembly Suppressor of G2 (Two) allele of skp1

SPC25 (YER018C) spc25-1 SS + + + Component of the kinetochore-associated Ndc80 complex. Involved in Spindle Pole Component spindle checkpoint activity, chromosome segregation and kinetochore clustering

SPC29 (YBR160W) spc29-20 SS, HM + + Links the central plaque component Spc42p to the inner plaque component Spindle Pole Component Spc110p and is required for SPB duplication 54 SPC34 (YKR037C) spc34-41-1 SS, HM + + + Subunit of the Dam1 complex. Couples kinetochores to the force produced Spindle Pole Component by MT depolymerization

SPC42 (YKL042W) spc42-10, spc42-11 SS, HM + + + Involved in SPB duplication, may facilitate attachment of the SPB to the Spindle Pole Component nuclear membrane

SPC110 (YDR356W) spc110-220 SS, HM, + + + Involved in connecting nuclear microtubules to SPB Spindle Pole Component TUB4 (YLR212C) tub4-Y455D , tub4-∆DSY SS, HM + + Involved in nucleating microtubules from both the cytoplasmic and nuclear TUBulin faces of the SPB

*severity of the phenotype (proportion of cells with Gal-Trm1-II-GFP mislocalization phenotype compared to WT. + + + = strongest) SS= single spot, DS= double or multiple spots, CS= cytoplasmic spots, HM= half-moons, SGD= Saccharomyces Genome Database

Gal-Trm1-II-GFP is Mislocalized in Temperature Sensitive Mutations of Genes that Encode for Proteins Involved in ER-Golgi Processes

About 46% (25) of the mutants in our screen affecting Gal-Trm1-II-GFP localization encode for proteins involved in ER-Golgi processes (Figure 16 and Table 3). The ER is the main site for lipid synthesis and is responsible for folding and maturation of secretory and membrane proteins. The ER communicates with the Golgi apparatus by vesicle trafficking in a process called the secretion pathway (Figure 17). There are different ER-related processes in which we can classify the ts mutants in this group. First, we found two (8%) ts mutants that encode proteins involved in ER quality control: Cdc48 and Kar2. Only the ts allele cdc48-3 showed mislocalization (Figure 18), but not the other ts alleles present in the collection (cdc48-1, cdc48-2, cdc48- 9 and cdc48-4601). On the other hand, only one ts allele for Kar2 (kar2-159) is included in the collection. Cdc48 is an ATPase protein involved in different quality control processes that utilize the protesome, such as ER-associated degradation (ERAD) (Rabinovich et al., 2002; Raasi and Wolf, 2007). Kar2 is another ATPase and a chaperone protein that functions in ERAD, the unfolded protein response (UPR), transport to the ER and also has a role in mating (Brizzio et al., 1999). Defects in this protein results in ER stress, as many unfolded proteins accumulate at the ER (Kimata et al., 2003). In addition, we found ts mutants that encode for proteins involved in lipid biosynthesis (five genes, 20% in the ER-Golgi group). They also showed a spot phenotype in most cases (Figure 18). Among them, two proteins, Lcb1 and Lcb2, are involved in the biosynthesis of sphingolipids (Gable et al., 2002). Another protein Mvd1 (alias Erg19), has a role in the synthesis of isoprenoids and sterols (Bergès et al., 1997). We also found that Gal-Trm1-II-GFP is mislocalized in a ts strain with a mutation in a gene that encodes the protein Nmt1. This protein has a role in the attachment of the lipid anchor of membranes, myristic acid, to the N-terminus of several proteins (Duronio et al., 1991). We did not found any predicted site for miristoylation by NMT for Trm1 by using the MYR-Predictor program (http://mendel.imp.univie.ac.at/) (Eisenhaber et al., 2003). 55

Finally, we found the ts strain with a mutation in a gene that encodes Cdc1, which is a Lipid phosphatase of the ER. All the ts alleles present in the collection for Cdc1, Mvd1 and Nmt1 were found to affect Gal-Trm1-II-GFP localization at non-permissive temperature. However, the alleles lcb1-2, lcb1-4, lcb1-10, lcb2-1 and lcb2-2 showed a WT location phenotype for Gal-Trm1-II-GFP. Interestingly, we found other ts mutants (Figure 19) that encode proteins involved in synthesis or regulation of Glycosylphosphatidylinositol (GPI anchor) which is a glycolipid that is posttranslationally attached to the C-terminus of a protein. In our screen, six ts strains (24% of the ER-Golgi group) containing mutations of this kind of GPI-related proteins showed mislocalization of Gal-Trm1-II-GFP: Dpm1, Gpi2, Gpi13, Mcd4, Spt14 and Uap1 (alias Qri1). The majority of the ts alleles of these genes in the collection had similar mislocalization phenotypes, with the exception of gpi13-4 and qri- ts6. Trm1-II lacks potential GPI sites within its sequence, as assessed by the prediction program big-PI Fungal predictor (http://mendel.imp.univie.ac.at/) (Eisenhaber et al., 2003; Eisenhaber et al., 2004). The major sub-group (twelve genes, 48% of the ER-Golgi group) among the ts mutants for ER-Golgi processes found in our screen corresponds to ts mutants that encode secretion proteins. These mutants also displayed a spot phenotype (Figure 20). Two particular proteins encoded by these genes are Sec11 and Sec61. Both proteins, along with Kar2, are involved in targeting and subsequent translocation of proteins to the ER (Böhni et al., 1988; Wilkinson et al., 2000), but Sec61 is also involved in retrograde transport of misfolded proteins (Sommer and Wolf, 1997). Curiously, seven ts gene products (Sec7, Sec16, Sec17, Sec23, Sec26, Sec31 and Uso1) function in the early secretory pathway (ESP) as they are part of the ER to Golgi trafficking. More specifically, they have a role in vesicle budding from the ER and subsequent transport to Golgi (Figure 17). Other ts strains with lessons in genes that encode proteins involved in later steps of secretion and exocytosis such as Sec3, Sec10 and Sec7 also mislocalized Gal-Trm1-II-GFP. Sec7 was proposed originally to function in late steps of secretion, but was found that it also have a role in ER to Golgi trafficking

(Wolf et al., 1998). The ts collection includes a total of thirty one ts genes that encode Sec proteins (some with multiple ts alleles) and ten (mostly of the ESP) were found to affect Gal-Trm1-II-GFP localization at non-permissive temperature. The only ts mutant related to retrograde trafficking that displayed a spot phenotype was dsl1-DC30 which encodes Dsl1.

ER Quality Control 20% 48 % Lipid Biosynthesis 24% GPI anchor Synthesis/Regulation ER-Golgi Trafficking (Secretion)

Figure 16. Distribution of ts mutants for ER-related proteins affecting Gal-Trm1-II-GFP localization

Figure 17. Specific Function of ER-related proteins affecting Gal-Trm1-II-GFP localization. (A) Lipid Biosynthesis and GPI anchor synthesis/regulation: Cdc1, Dpm1, Gpi2, Gpi13, Lcb1, Lcb2, Mcd4, Mvd1, Nmt1, Spt14 and Uap1. Secretion: (B) Early: Sec7, Sec16, Sec17, Sec23, Sec26, Sec31 and Uso1. (C) Late/exocytosis: Sec3, Sec7 and Sec10. (D) Retrograde transport to ER: Dsl1. (E) ER protein translocation: Sec11, Sec61 and Kar2. (F) ER quality control: Cdc48 and Kar2. Some proteins have multiple roles in the pathway. sER= smooth ER, rER= rough ER, COPI-II= coat protein complexes I and II. Diagram by Greetchen Díaz.

Figure 18. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes encoding proteins of ER-related processes such as ER quality control and lipid biosynthesis. DIC and fluorescence images of representative SPB ts mutants. Bar= 5µm.

Figure 19. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes encoding proteins of ER-Golgi processes such as GPI anchor synthesis and regulation. DIC and fluorescence images of representative SPB ts mutants. Bar= 5µm.

Figure 20. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes encoding proteins of ER-Golgi processes such as secretion. DIC and fluorescence images of representative SPB ts mutants. Bar= 5µm.

Table 3. Temperature sensitive mutants of genes affecting Gal-Trm1-II-GFP location, that encode proteins of the ER-Golgi Processes

Gene Alelle (s) in ts Gal-Trm1-II-GFP Gene product description from SGD collection phenotype *

CDC1 (YDR182W) cdc1-2 SS + + Lipid phosphatase of the ER, may affect Ca2+ signaling Cell Division Cycle

CDC48 (YDL126C) cdc48-3 SS, HM + + + Involved in ubiquitin-mediated protein degradation, ER-associated Cell Division Cycle degradation (ERAD); controls the proteasome-mediated degradation of Sec23

DPM1 (YPR183W) dpm1-6 SS + + Dolichol phosphate mannose synthase of the ER membrane, required for Dolichol Phosphate Mannose GPI membrane anchoring, O mannosylation, and protein glycosylation synthase

62 DSL1 (YNL258C) dsl1-DC30 SS + Peripheral membrane protein needed for Golgi-to-ER retrograde traffic Dependence on SLy1-20

GPI2 (YPL076W) gpi2-1-7B, SS + + Involved in the synthesis of N-acetylglucosaminyl phosphatidylinositol GlycosylPhosphatidylInositol anchor gpi2-774 (GlcNAc-PI), the first intermediate in the synthesis of GPI anchors biosynthesis

GPI13 (YLL031C) gpi13-4 SS + ER membrane phosphoryltransferase that adds phosphoethanolamine GlycosylPhosphatidylInositol anchor onto the third mannose residue of the GPI anchor precursor biosynthesis

Kar2 (YJL034W) Kar2-159 SS + Chaperone to mediate protein folding in the ER. Involved in protein KARyogamy import into the ER and may play a role in ER export of soluble proteins

LCB1 (YMR296C) lcb1-5 SS, DS, HM + + Component of serine palmitoyltransferase, responsible along with Lcb2p Long-Chain Base for the first committed step in sphingolipid synthesis

Table 3: continued LCB2 (YDR062W) lcb2-16, lcb2-19 SS, DS, HM Component of serine palmitoyltransferase, responsible along with Lcb1p Long-Chain Base + + + for the first committed step in sphingolipid synthesis

MCD4 (YKL165C) mcd4-174 SS, DS, CS Involved in GPI anchor synthesis; multimembrane-spanning protein that Morphogenesis Checkpoint + + + localizes to the ER Dependent

MVD1 (YNR043W) mvd1-1296 SS, DS, HM Mevalonate pyrophosphate decarboxylase, involved in the biosynthesis of MeValonate pyrophosphate + + + isoprenoids and sterols, including ergosterol Decarboxylase

NMT1 (YLR195C) nmt-181 SS, DS, HM N-myristoyl transferase, catalyzes the cotranslational, covalent N-Myristoyl Transferase + + + attachment of myristic acid to the N-terminal glycine residue of several proteins

SEC3 (YER008C) sec3-2 SS + + Subunit of the exocyst complex which mediates targeting of post-Golgi 63 SECretory vesicles to sites of active exocytosis

SEC7 (YDR170C) sec7-1 SS + + Involved in proliferation of the Golgi, intra-Golgi transport and ER-to- SECretory Golgi transport

SEC10 (YLR166C) sec10-2 SS, HM + + Subunit of the exocyst complex which has the essential function of SECretory mediating polarized targeting of secretory vesicles to active sites of exocytosis

SEC11 (YIR022W) sec11-2 SS, DS + + + Subunit of the Signal Peptidase Complex (SPC) which cleaves the signal SECretory sequence of proteins targeted to the endoplasmic reticulum

SEC16 (YPL085W) sec16-2 SS, CS + + COPII vesicle coat protein required for ER transport vesicle budding; SECretory bound to the periphery of ER membranes and may act to stabilize initial COPII complexes

SEC17 (YBL050W) sec17-1 SS, CS + + Peripheral membrane protein required for vesicular transport between ER SECretory and Golgi 63

Table 3: continued

SEC23 (YPR181C) sec23-1 SS + Component of the Sec23p-Sec24p heterodimer of the COPII vesicle coat, SECretory involved in ER to Golgi transport

SEC26 (YDR238C) sec26-11D2 SS, DS, CS + + Beta-coat protein of the COPI coatomer, involved in ER-to-Golgi protein SECretory trafficking and maintenance of normal ER morphology

SEC31 (YDL195W) sec31-1 SS + Component of the Sec13p-Sec31p complex of the COPII vesicle coat, SECretory required for vesicle formation in ER to Golgi transport

SEC61 (YLR378C) sec61-2 SS, DS + + Subunit of Sec61 complex; forms a channel for SRP-dependent protein SECretory import and retrograde transport of misfolded proteins out of the ER; with Sec63 complex allows SRP-independent protein import into ER

SPT14 (YPL175W) spt14-1-10C SS, DS + + UDP-GlcNAc-binding and catalytic subunit of the enzyme that mediates SuPpressor of Ty the first step in GPI biosynthesis

64 UAP1 or QRI1 (YDL103C) qri1-ts1 SS, DS + UDP-N-acetylglucosamine pyrophosphorylase, catalyzes the formation of UDP-N-Acetylglucosamine UDP-GlcNAc, which is important in cell wall biosynthesis, protein N- Pyrophosphorylase glycosylation, and GPI anchor biosynthesis

USO1 (YDL058W) uso1-1 SS, DS + + + Involved in the vesicle-mediated ER to Golgi transport step of secretion; yUSOu - transport in Japanese binds membranes and functions during vesicle docking to the Golgi; required for assembly of the ER-to-Golgi SNARE complex

Temperature Sensitive Mutations Affecting Gal-Trm1-II-GFP INM Location that are Involved in Proteolysis

About 11% (six) of the total ts mutants from our screen for INM location, encode proteins with a role in proteolysis: Pre1, Pre2, Rpn6, Rpn11, Rpt6 and Uba1. Mutants in this group have the phenotype previously described (Figure 21 and Table 4). All the mentioned proteins are subunits of the 26S proteosome, except for Uba1, which is an ubiquitin activating enzyme, involved in degradation. About twenty proteins are known to be structural components of the proteosome and thirteen are present in the ts collection. Six were found as ts gene products affecting Gal-Trm1-II-GFP localization. Pre2 was represented by five different ts alleles, pre2-1, pre2-2, pre2-75, pre2-127 and pre2-V214A, but only pre2-V214A was found in our screen. For protein Rpn11, the ts allele rpn11-8, but not rpn11-14 was found in our screen as affecting INM location. Temperature sensitive alleles rpt6-1, rpt6-20 and rpt6- 25 were present in the collection, but only rpt6-20 affected Gal-Trm1-II-GFP INM localization. It is important to mention that the previously mentioned protein, Cdc48 is also involved in proteolysis, where its role is important for ER quality control performed by ERAD (Wolf and Stolz, 2012). Indeed, the proteosome plays an essential role in ER quality control processes (Thoz et al., 2006).

Figure 21. Gal-Trm1-II-GFP is mislocalized in strains that possess ts mutations of genes encoding proteins for proteolysis. DIC and fluorescence images of representative SPB ts mutants. Bar= 5µm.

Table 4. Temperature sensitive mutants that encode proteins involved in proteolysis and affect Gal-Trm1-II-GFP localization

Gene Alelle (s) in ts Gal-Trm1-II-GFP Gene product description from SGD collection phenotype *

PRE1 (YER012W) pre1-1 SS + + + Beta 4 subunit of the 20S proteasome; localizes to the nucleus throughout the cell PRoteinase yscE cycle

PRE2 (YPR103W) pre2-V214A SS + + Beta 5 subunit of the 20S proteasome, responsible for the chymotryptic activity of PRoteinase yscE the proteasome

RPN6 (YDL097C) rpn6-1 SS + + Non-ATPase regulatory subunit of the 26S proteasome lid required for the Regulatory Particle Non- assembly and activity of the 26S proteasome ATPase

RPN11 (YFR004W) rpn11-8 SS + Metalloprotease subunit of the 19S regulatory particle of the 26S proteasome lid; Regulatory Particle Non- couples the deubiquitination and degradation of proteasome substrates

67 ATPase

RPT6 (YGL048C) rpt6-20 SS + + + ATPase of the 19S regulatory particle of the 26S proteasome involved in the Regulatory Particle degradation of ubiquitinated substrates; localized mainly to the nucleus throughout Triphosphatase the cell cycle

UBA1 (YKL210W) uba1-1 SP, HM + Ubiquitin activating enzyme (E1), involved in ubiquitin-mediated protein UBiquitin Activating degradation

*severity of the phenotype (proportion of cells with Gal-Trm1-II-GFP mislocalization phenotype compared to WT. + + + = strongest). SS= single spot, DS= double or multiple spots, CS= cytoplasmic spots, HM= half-moons, SGD= Saccharomyces Genome Database

Other Temperature Sensitive Mutants Affecting Gal-Trm1-II-GFP INM Location

There are four additional mutants that were found in our screen as affecting Gal- Trm1-II-GFP localization (8%) (Figure 22 and Table 5). They do not belong to any of the previously described categories and do not share obvious similarities between each other. These mutants encode proteins Kap121, Nse4, Tcp1 and Zpr1. Kap121 (alias Pse1) is a karyopherin importin protein responsible of transport of a subset of proteins (Leslie et al., 2002). This is the only essential karyopherin protein present in the ts collection and is represented by two ts alleles, pse1-34 and pse1-41. Only pse1-34 was identified in our screen affecting INM location of Gal-Trm1-II-GFP. Nse4 (formerly known as Qri2) is a nuclear protein with a suggested role in maintenance of higher order chromosome structure (Hu et al., 2005). Four different ts alleles are present in the ts collection, nse4- ts1, nse4-ts2, nse4-ts3 and nse4-ts4, but only nse4-ts2 was identified among our candidates. Protein Tcp1 was also found in our screen affecting Gal-Trm1-II-GFP localization. Tcp1 was represented by two ts alleles (tcp1-1 and tcp1-2), but only one, tcp1-2 was in our list of candidates. The last protein represented in our screen was Zpr1. Only one ts allele was included in the ts collection. The information about this protein is very limited, but it was suggested to be required for normal nucleolar function (Galcheva- Gargova et al., 1998).

Figure 22. Other Temperature Sensitive Mutants that Mislocalize Gal- Trm1-GFP. DIC and fluorescence images of representative SPB ts mutants. Bar= 5µm.

Table 5. Other temperature sensitive mutants with defects in Gal-Trm1-GFP INM location

Gene Alelle (s) in Gal-Trm1-II-GFP Gene product description from SGD ts collection phenotype *

KAP121 or PSE1(YMR308C) pse1-34 SS, HM + + Karyopherin/importin that interacts with the nuclear pore complex; acts as the KAryoPherin/Protein Secretion nuclear import receptor for specific proteins Enhancer

NSE4 (YDL105W) nse4-ts2 SS + + + Component of the SMC5-SMC6 complex which plays role during DNA Non-SMC Element replication and repair

TCP1 (YDR212W) tcp1-2 SP, HM + Alpha subunit of chaperonin-containing T-complex, which mediates protein Tailless Complex Polypeptide folding in the cytosol; involved in actin cytoskeleton maintenance

ZPR1 (YGR211W) zpr1-1 SS + Zinc fingers protein present in the nucleus of growing cells but relocates to the Zinc finger PRotein cytoplasm in starved cells 70 *severity of the phenotype (proportion of cells with Gal-Trm1-II-GFP mislocalization phenotype compared to WT. + + + = strongest). SS= single spot, DS= double or multiple spots, CS= cytoplasmic spots, HM= half-moons, SGD= Saccharomyces Genome Database

Gal-Trm1-II-GFP is Mislocalized in Cells Treated with α-factor, DTT and Brefeldin A

We obtained from our screen for Gal-Trm1-II-GFP INM location, a number of ts mutants that mislocalize the protein to a predominant spot phenotype. The two major groups found are ts mutants that encode proteins involved in SPB structure/duplication, ER-Golgi processes. Therefore, we decided to test whether chemical compounds that also affect these structures/processes, are able to mislocalize Gal-Trm1-II-GFP in a similar way to the ts mutants. Haploid a and α yeast cells produce the mating pheromone a-factor and α–factor, respectively. Each mating type carries the receptor to recognize the pheromone produced by the opposite type. In preparation for mating the cells arrest in G1 of the cell cycle and the SPB duplication is prevented. It is known that in a cells treated with the opposite pheromone, α–factor, the SPB structure is altered and its duplication is prevented (Page and Snyder, 1992; Yoder et al., 2003). The SPB in these cells is smaller and the amount of one core component, Spc110, is reduced to nearly fifty percent. Therefore, we hypothesized that WT cells arrested with α-factor could mislocalize Gal-Trm1-II-GFP in a similar fashion to the SPB ts mutants, if this phenotype is caused as a consequence of an alteration of the SPB. As we utilized cells of the a mating type in our studies, we took advantage of the availability of the α-factor pheromone to test our hypothesis. When we treated WT cells with α-factor, we found that Gal-Trm1-II-GFP mislocalizes in a very similar manner to the SPB ts mutants found in our screen (Figure 23). The majority of the cells showed the spot phenotype characteristic of the mutations affecting Gal-Trm1-II- GFP. Therefore, Gal-Trm1-II-GFP localization is altered in WT cells treated with α- factor and the SPB structure changes may cause this phenotype. This result, supports our previous discovery (screen) and suggests that mislocalization of Gal-Trm1-II-GFP in the SPB ts mutants is a consequence of an alteration of the SBP that, directly or indirectly, affects INM localization.

The ER is a site for protein maturation. Many of the ts mutants that encode proteins involved in ER-Golgi processes and were found in our screen, cause ER stress as a consequence of their defects in trafficking and ER homeostasis. The chemical Dithiothreitol (DTT) is a reducing agent that increases the accumulation of unfolded proteins in the cell, especially in the ER lumen. As a result, ER stress increases and activates the ER quality control pathways and changes the ER shape. Indeed treatment with DTT was shown to cause ER expansion to alleviate ER stress (Schuck et al., 2009). Similar to cells treated with α-factor, we hypothesized that treatment of WT cells with DTT could mislocalize Gal-Trm1-II-GFP. In support of this hypothesis, we learned that DTT treated cells mislocate Gal-Trm1-II-GFP, similar to the ts mutants for SPB and ER- Golgi processes (Figure 23). This outcome supports our results from our screen and confirms that defects at the ER can prevent INM location of Gal-Trm1-II-GFP. We also tested Gal-Trm1-II-GFP localization in WT cells treated with Brefeldin- A (BFA). BFA is an antibiotic produced by some fungi. This metabolite inhibits transport of proteins from ER to Golgi, by its reversible effect on Golgi structure (Pelham, 1991) and its interference with vesicle trafficking (Bednarek et al., 1995; Sata et al., 1998). As a consequence, retrograde protein transport from the Golgi to the ER is induced (Klausner et al., 1992). Gal-Trm1-II-GFP in WT cells treated with BFA mislocates to spots near the NE, similar to ts mutants (Figure 23). The results obtained from the treatment of WT cells with chemical compounds that alter the same structure/processes as the ts mutants found in our screen, confirm that in fact, Gal-Trm1-II-GFP mislocalization is caused by alterations in the SPB structure/duplication as well as ER homeostasis.

Figure 23. Gal-Trm1-II-GFP is mislocalized in cell treated with factor, DTT and BFA DIC and fluorescence images of WT cells with and without α–factor, DTT and BFA. Bar= 5µm

Discussion

A Genomic Screen of Essential Genes Affecting Gal-Trm1-II-GFP INM Localization

In order to complete the screen for essential genes affecting Trm1-II localization, we incorporated several changes to the approach that was previously utilized for the screen of unessential genes (Murthi and Hopper, 2005). The transformation step was performed in a very similar manner. An important change was that we reduced the time for the heat shock during the transformation, as these cells are sensitive to temperature and long exposure to high temperatures could be lethal to the cells or promote the acquisition of suppressors. We obtained transformants for about 90% of the strains in the collection. Probably, the most important change in our approach is that the plasmid utilized for localization of Trm1-II-GFP contains a galactose inducible promoter which differs from the plasmid used in the screen for unessential genes where Trm1-II-GFP was regulated by its endogenous promoter and constitutively expressed. We selected to control Trm1-II-GFP expression with galactose because it is important to learn the location of newly synthesized protein after shift to the non-permissive temperature We attempted to induce synthesis of Gal-Trm1-II-GFP by addition of galactose in in the 96-well plate format to accelerate the screen, but good induction for the majority of the transformants was not achieved using this format. It is possible that slow growth compared to standard conditions avoided appropriate galactose induction. Therefore, we elected to grow all strains in the collection individually in test tubes to perform the induction and temperature shift steps. We also incubated the cells 30 minutes at permissive temperature, before the temperature shift as a precaution in case the galactose induction could be affected if temperature was shifted at the same time of induction. For temperature shift, we used 37⁰C as the non-permissive temperature for all strains despite the fact that some strains are temperature sensitive at lower temperatures in SC media according to Boone’s lab. However, a limitation to this approach is that some strains were

74 not able to induce because the temperature is too high to be tolerated. We solved that limitation by performing the experiment at the correct non-permissive temperature for those who did not induced in the first round, that in fact, were a very low number (less than 10 strains). The screen was completely blind as we never knew the identity of the mutated genes until we identify the positive candidates for Gal-Trm1-II-GFP mislocalization. Instead of the real allele name, we identified them during the whole screen by their position in the 96-well plate. A former member of our group, Terri Harchar, performed a similar screen for Gal-Trm1-II-GFP localization in essential genes using the first version of the collection developed by Dr. C. Boone’s laboratory (unpublished). At that time, the collection contained 333 strains. The general strategy was similar, but the steps for induction and temperature shift were completed in solid media and not liquid media. The results from this screen, revealed only seven ts mutants (represented in some cases by more than one allele), affecting Gal-Trm1-II-GFP INM location. The predominant group of mutants affecting Gal-Trm1-II-GFP localization (5 of 7) corresponded to genes that encode components of the SPB. These mutants showed a spot phenotype after shift to non- permissive temperature. These results were confirmed when Gal-Trm1-II-GFP localization was examined in cells containing tetracycline-regulatable genes for the SPB by using the commercially available Tet-off collection (Open Biosystems). In these cells, the gene transcription is turned off upon addition of doxycycline (Hughes et al., 2000; Mnaimneh et al., 2004). Despite the differences between the two ts screens, we were able to confirm the results obtained from the first one.

Trm1-II INM Localization in Temperature Sensitive Mutants for Essential Genes

The SPB Effect on Trm1-II INM Targeting

It is very interesting that among all the essential genes that were screened, many of the ts mutations of genes that encode SPB proteins affected Gal-Trm1-II-GFP INM

distribution. Finding that the SPB function could affect INM targeting, was an unexpected result. The SPB is the yeast equivalent to the centrosome and functions as a microtubule organizing center. However, it is known that there are some components of the SPB that are also components of the NPC and the nuclear membrane where they play different roles from those on the SPB (Chial et al., 1998; Friederichs et al., 2011). Two examples are Ndc1 and Mps3, which were found in our screen as affecting Gal-Trm1-II- GFP localization when mutated. The SPB ts mutants that showed the strongest phenotype, compared to WT, are components of the SPB central plaque and membrane proteins responsible for SPB anchoring. Nonetheless, according to our results, it seems that affecting the SPB function/structure in general is affecting the way that Trm-1-II is targeted to the INM. The effect of α–factor pheromone in Trm1-II localization is in agreement with this idea. The SPB may play a direct or indirect role in INM targeting. For a direct role, a component (s) of the SPB may interact with Trm1-II and/or its membrane tether. We do not have evidence to support this idea. Conversely, SPB alterations may cause a membrane defect that disrupts Trm1-II association to the membrane tether or could activate a signaling pathway that prevents INM targeting. There are some observations from our studies with the SPB ts mutants discussed in Chapters 4, 5 and 6, which are consistent with this idea.

The ER-Golgi Effect on Trm1-II INM Targeting

Another intriguing result from our screen is that many mutated proteins with a role in ER-Golgi related processes affect Trm1-II INM location. More surprising is that the phenotypes observed are almost identical to those observed in the SPB ts mutant. It was previously shown by our group that a strain defective in ER inheritance, ice2∆, showed a nucleoplasmic phenotype for Trm1-II-GFP (Murthi and Hopper, 2005). Further analysis of this protein by our group, revealed a possible connection to lipid biosynthesis/regulation (Murthi and Díaz, unpublished) in addition to the known roles in

ER inheritance and septin organization (de Martin et al., 2005; Loewen et al., 2007). In addition, strains lacking the NatC complex proteins, Mak3, Mak10 and Mak31, also relocate Trm1-II-GFP to the nucleoplasm (Murthi and Hopper, 2005). The information about this particular acetylation complex is not abundant, but previous studies suggested a role in membrane targeting of a Golgi protein (Behnia et al., 2004; Setty et al., 2004). In general the Nat complexes seems to have a role in membrane targeting (Arnesen, 2011). We confirmed that ER defects are able to mislocalize Trm1-II as shown for WT cells treated with DTT. As the ER and Golgi processes are connected and disruption of the Golgi structure and trafficking to it result in ER stress and altered ER homeostasis, we hypothesize that the ts mutants for secretion and the effect of BFA are directly related to the possible relationship between Trm1-II and the ER. However, it is possible that Trm1- II tether at the INM is processed at the Golgi apparatus before it reaches the INM. All this evidence, and our results from the screen, led us to question the connection between Trm1-II and the ER membrane. Only INM transmembrane proteins are known to be synthesized at the ER in a process called co-translational translocation. There is no evidence that peripheral membrane proteins are synthesized in the same manner as the transmembrane counterparts. In addition, Trm1-II does not contain the N- terminal signal which is recognized by a signal recognition particle (SRP). Moreover, our group showed that Trm1-II import is dependent on the Ran cycle and the protein accumulates at the cytoplasm in the Ran-GAP ts mutant, rna1-1, which indicates that the protein is translocated post-translation (Lai et al., 2009). Thus, it is unlikely that the effect of the ts mutants is caused by disruption of co-translational translocation of Trm1-II that prevents its subsequent INM targeting. An intriguing possibility is that Trm1-II interacts with ER membranes prior to its INM targeting. This would be a novel mechanism for localization of peripheral INM proteins. In agreement with this idea, previous work in our group suggests that Trm1-II can interact with ER membranes and that it localizes to the cortical ER when vastly over expressed (Stauffer, unpublished).

The Effect of the Proteosome on Trm1-II INM Targeting

Curiously, a set of mutants affecting Trm1-II INM targeting corresponded to subunits of the 26S proteosome and an ubiquitin ligase. We classified them as a different group as the proteosome participates in quality control of different cellular processes. However, is tempting to propose that a possible cause for the mislocalized phenotype for Gal-Trm1-II-GFP is also related to ER-quality control. The protesome plays a critical role in ER quality control process; ERAD which targets ER misfolded proteins for ubiquitination and subsequent degradation (Raasi and Wolf, 2007). Like the processes of the ER and Golgi which are linked, ER stress is also known to impair the proteosome system (Menéndez-Benito et al., 2005). Interestingly, the protesomal subunit Rpt4 plays a role in SPB duplication (McDonald et al., 2002). However, the ts strains present in the collection for the RPT4 gene did not displayed mislocation of Gal-Trm1-II-GFP. On the other hand, we cannot discard the idea of a SPB defect in the ts strains found in our screen. The specific function of the proteosome in SPB dynamics is unclear.

Other proteins affecting Trm1-II INM Targeting

Among other ts mutants affecting Trm1-II INM localization the most interesting is the mutant that encode Kap121 (Pse1). An important role for this Kap protein is transport of the transcription factor, Ste12 to the nucleus, essential for mating response (Leslie et al., 2002). Unfortunately, Kap121 is the only essential karyopherin protein included in the ts collection. Having the other essential karyopherins represented in the collection could help us to a better understanding of the Ran-dependent import step for Trm1-II. Regardless of the absence of Kap proteins in the ts collection, it is interesting that Kap121, when mutated, affected Trm1-II. The ts mutant showed the spot phenotype and not a cytoplasmic phenotype for defects in nuclear import. However, we cannot rule out a possible role of this karyopherin in Gal-Trm1-II-GFP transport.

To learn how Trm1-II INM targeting is affected, we selected the SPB mutants to perform further experiments that may elucidate the INM targeting mechanism of peripherally associated INM proteins.

Chapter 4: Co-localization experiments for Gal-Trm1-II-GFP

Abstract

In order to understand how the SPB ts mutants affect Gal-Trm1-II-GFP location, we selected the SPB ts mutant spc110-220 and employed co-localization experiments to characterize the region where Gal-Trm1-II-GFP accumulates. We tested several subnuclear regions including the SPB, DNA chromatin, nucleolus, nucleus-vacuole junctions, NPCs, and ER-nucleus junctions. Gal-Trm1-II-GFP does not co-localize to the SPB, nucleolus, DNA chromatin and nucleus-vacuole junctions in the SPB ts mutant at non-permissive temperature. Rather, Gal-Trm1-II-GFP appears to localize to a pore-less region of the NE in some cells and in other cells it appears to be excluded from the NE. Employing IF to Scs2-HA, a marker for the perinuclear ER (pER), we uncovered that Gal-Trm1-II-GFP was located close to the ER-nucleus junction in a majority of SPB ts mutant cells and in WT cells treated with α-factor. In addition, we found that the previously characterized Trm1-II INM binding motif which localizes as a spot in WT cells also localizes close to the ER-nucleus junctions. Our results suggest that Trm1-II spreading at the INM requires a functional SPB and that the region close to the ER- nucleus junction is the initial tethering location for Trm1-II.

Introduction

There are different sub-nuclear domains that are organized according to their function in the nucleus. The most prominent in yeast cells are the SPB, the NPC, the nucleolus and the region containing the DNA chromatin (for more detail, see Chapter 1). In addition to these sub-nuclear domains, there are interconnected regions that communicate the nucleus with two other important organelles, the vacuole and the ER. 80

The connection between the vacuole and the nucleus is called the nucleus-vacuole junction (NVJ). In S. cerevisiae, the NVJ is formed by the interaction of the vacuolar protein, Vac8, and the integral NE protein, Nvj1 (Pan et al., 2000). When invaginated, the NVJ releases vesicles to start a process called the piecemeal microautophagy of the nucleus (PMN) (Dawaliby and Mayer, 2010). The connections between the nucleus and the ER are referred to as the ER-nucleus junctions. The junction is formed by an extension of the perinuclear ER (pER), which is continuous with the ONM and connects with the cortical ER (cER) at the cytoplasm and cell periphery. Normally, in yeast cells there are one or two of these connections. Proteins such as Kar2 and Scs2 are predominant at the pER. As shown in Chapter 3, we found SPB ts mutants that affect Gal-Trm1-II-GFP location such that the protein accumulates as a spot near or at the NE rather than being distributed throughout the INM. However, the exact location of the protein was not evident because other subnuclear locations were not monitored in the initial search. To determine the exact location of Gal-Trm1-II-GFP in the SPB ts mutants, we employed markers corresponding to the various sub-nuclear domains mentioned above.

Specific Aim

To determine where Gal-Trm1-II-GFP was located in cells with altered SPB structure and to identify the initial tethering region of Trm1-II in WT cells.

Materials and Methods

Co-localization Studies for mislocalized Gal-Trm1-II-GFP

All the co-localization experiments (IF and live microscopy) were performed using WT and SPB ts mutant spc110-220 containing Gal-Trm1-II-GFP.

Spindle Pole Body

Gal-Trm1-II-GFP subnuclear distribution is altered in SPB ts mutants. We hypothesized that Gal-Trm1-II-GFP spots might co-localize with the SPB. To test this hypothesis, a SPB component Spc97 was genomically tagged at the C-terminus by homologous recombination with the fluorescent protein mCherry in WT and the SPB ts mutant spc110-220. Spc97 is an essential protein, and it is a component of the inner plaque of the SPB (Knop et al., 1997). Gene replacement at SPC97 with SPC97-mCherry was verified by PCR (oligonucleotides GDM015, GDM016 and GDM017, Table 1) and confirmed by the co-localization with another SPB component, Spc72, that was tagged with GFP at the C-terminus and was expressed from a CEN plasmid (pXC224) (Chen et al., 1998) (provided by Dr. K. Bloom, University of North Carolina, Chapel Hill). WT and a ts mutant containing endogenous Spc97-mCherry and Gal-Trm1-II-GFP were grown to log phase in raffinose media. Gal-Trm1-II-GFP was induced with 2% galactose for 30 minutes at 23⁰C and the cells were shifted to 37⁰C for 2 hours. For microscopy and imaging, slides with agarose slants were prepared as described in methods (Chapter 2). Slides were maintained at 37-38⁰C using a microscope stage warmer.

NPC and nucleolus

We employed IF to localize the NPC and the nucleolus, using monoclonal mouse anti-Nsp1 and anti-Nop1 antibodies, respectively. Nsp1 is a FG-domain protein of the NPC. Nop1 is a nucleolar protein (Henríquez et al., 1990). WT and spc110-220 cells containing Gal-Trm1-II-GFP were grown to log phase in raffinose media. Gal-Trm1-II- GFP was induced with 2% galactose for 30 minutes at 23⁰C and the cells were shifted to 37⁰C for 2 hours. The cells were processed for IF as described in Chapter 2 (methods).

Chromatin and NVJ

To localize the DNA chromatin, we used a plasmid containing H2B protein under the ADH2 promoter and tagged with mCherry. H2B is a histone protein associated with chromatin (Hereford et al., 1979). To localize the nucleus-vacuole junction (NVJ), staining with the membrane-selective FM-dye, FM4–64 (Invitrogen) was performed for 35-40 min (Vida and Emr, 1995). FM4-64 is an amphiphilic dye that is fluorescent in hydrophobic environments, such as lipid-rich membrane and was extensively used to study endocytosis and to localize the vacuolar membrane in a variety of organisms (Bolte et al., 2004). The membrane region of the vacuole that is in contact with the ONM of the NE is the NVJs. WT and spc110-220 cells containing Gal-Trm1-II-GFP were grown to log phase in raffinose media. Gal-Trm1-II-GFP was induced with 2% galactose for 30 minutes at 23⁰C and the cells were shifted to 37⁰C for 2 hours. For microscopy and imaging, slides with agarose slants were prepared as described in Chapter 2. Slides were maintained at 37-38⁰C using the stage warmer.

ER-Nucleus Junctions

To localize the ER in WT and SPB ts mutants, we transformed cells with a plasmid containing Scs2 tagged with HA (Scs2-MORF) and controlled by a galactose inducible promoter (Gelperin et al., 2005) To locate Scs2, the HA tag was detected by IF using a monoclonal mouse anti-HA antibody (Babco). Scs2p is an ER protein that locates mainly to the pER (Kagiwada and Hashimoto, 2007). WT and spc110-220 cells containing Gal-Trm1-II-GFP were grown to log phase in raffinose media. Gal-Trm1-II- GFP was induced with 2% galactose for 30 minutes at 23⁰C and the cells were shifted to 37⁰C for 2 hours. The cells were processed for IF (Chapter 2) with a fixation time of 25 minutes.

Co-localization Studies for Trm1-II INM Binding Motif in WT Cells

To test if the Trm1-II INM binding motif (Lai et al., 2009) locates to the ER- nucleus junctions, WT cells were transformed with a plasmid (NLS-(130-151)-Trm7- GFP) containing a NLS (from the H2B protein) and the Trm1-II INM binding motif fused to the cytoplasmic protein Trm7 (Lai et al., 2009). Protein expression was controlled by a galactose inducible promoter. Cells were induced with 2% galactose and incubated at 23⁰C for 2 hours, before processing for IF. IF was performed using the monoclonal rabbit anti-Kar2 antibody, as described in Chapter 2. Kar2p is ER luminal protein concentrated at the pER (Vogel et al., 1990).The fixation period for IF was 30 minutes.

Results

Gal-Trm1-II-GFP does not Localizes to the SPB, the Nucleolus, the Chromatin and the Nucleus-Vacuole Junctions

To understand how defects of the SPB structure affect protein targeting to the INM, it was important to learn where Gal-Trm1-II-GFP mislocates in the SPB ts mutants. We initially hypothesized that in the SPB ts mutants, Gal-Trm1-II-GFP spots would mislocalize to the SPB. To test this hypothesis, we utilized a SPB marker, Spc97. Spc97 was endogenously–tagged with mCherry in both WT and the SPB ts mutant, spc110-220. As anticipated, the endogenously tagged Spc97 and plasmid encoded Spc72-GFP co- localized to a spot at the NE in both WT and cells with a ts mutation in the SPB gene, SPC110. When WT cells were induced with galactose, at non-permissive temperature, Gal-Trm1-II-GFP was evenly distributed through the INM, as expected (Figure 24). However, in the SPB ts mutant, Gal-Trm1-II-GFP displayed a spot phenotype. In about 40% of the ts mutant cells, the Gal-Trm1-II-GFP spot localized close to the SPB, but it never co-localized with the SPB signal. Moreover, the remaining 60% of the cells displayed opposite location for Gal-Trm1-II-GFP and Spc97mCherry signals. Therefore,

our results indicate that the Gal-Trm1-II-GFP spot does not co-localize with the SPB in the SPB ts mutant, spc110-220. Since Gal-Trm1-II-GFP failed to co-localize with the SPB in the SPB ts mutant, we explored other nuclear subdomains to learn whether the mislocalized protein might be located to any of them. Therefore, we used protein markers for other sub-nuclear domains. We tested if the Gal-Trm1-II-GFP spot in the ts mutant co-localizes with chromatin (Figure 25). We monitored the location of the histone protein H2B, tagged with mCherry, as a chromatin marker in WT and mutants cells containing Gal-Trm1-II- GFP. The majority of the nucleoplasm in yeast cells is occupied by DNA, with a small portion occupied by the nucleolus. Both WT and ts mutant showed a nucleoplasmic location for H2B, as expected. After galactose induction at non-permissive temperature, WT cells showed the INM distribution for Gal-Trm1-II-GFP, where the SPB ts mutant showed the spot phenotype. In the majority of the cells (~80%) the spot is located close to the chromatin signal and the remaining 20% are located far from it, perhaps at the cytoplasm or the ER. The results indicate that the Gal-Trm1-II-GFP spot does not co- localize with chromatin or the nucleoplasm in the SPB ts mutant, spc110-220. To localize the nucleolus, we performed IF using an antibody for the nucleolar protein Nop1. In both WT and ts mutant cells, Nop1 localizes to a subdomain of the nucleoplasm, as expected (Figure 26). Upon galactose induction at non-permissive temperature, WT and mutant cells showed the expected phenotypes for Gal-Trm1-II- GFP. The Gal-Trm1-II-GFP spot in the SPB ts mutant was close to the nucleolus in some cells (~40%) and in an opposite location in other cells (~50%), but the signals never co- localized. A minor group of cells (10%) showed a partial co-localization with Nop1, but it is not clear if they are in the same exact position as they seem to be in different focal planes. Therefore, the Gal-Trm1-II-GFP spot does not co-localize with the nucleolus in the SPB ts mutant, spc110-220. The Gal-Trm1-II-GFP spot usually appeared to be located close to the NE. Therefore, we tested whether the Gal-Trm1-II-GFP spot co-localizes to the connections between the nucleus and the vacuole, the NVJ. We stained the vacuole membrane of live

cells with the vacuolar dye FM4-64. WT and ts mutant showed the expected phenotypes for Gal-Trm1-II-GFP at the non-permissive temperature (Figure 27). In most cases, the FM4-64 signal showed some invaginations that are typical in yeast vacuoles. It is important to mention that these cells also contained the SPB marker, Spc97, and for that reason it was also visible when the red microscope filter was used. The NVJ is observed (yellow) in many WT cells due to partial co-localization of the Gal-Trm1-II-GFP and the stained vacuolar membrane (see merge, Figure 27). However, in the ts mutant the NVJ was not visible as Gal-Trm1-GFP localizes as a spot and the spot does not co-localize with the vacuolar membrane in the majority of the cells (~95%). The Gal-Trm1-II-GFP spot does not co-localize with the NVJ in the SPB ts mutant, spc110-220. In summary, Gal-Trm1-II-GFP failed to co-localize with the SPB, chromatin, nucleolus, and the NVJ when it is mislocalized in cells with defective SPB.

Figure 24. Gal-Trm-II-GFP spots does not co-localize with the SPB. Live imaging of WT (A) and ts mutant spc110-220 (C) expressing Gal-Trm1-II-GFP (A’, C’) and endogenously tagged Spc97-mCherry (B, D) at 37°C and overlay image (B’, D’). Bar = 5µm.

Figure 25. Gal-Trm1-II-GFP does not co-localize with the chromatin. Live imaging of WT (A) and ts mutant spc110-220 (C) expressing Gal-Trm1-II-GFP (A’, C’) and the histone protein H2B tagged with mCherry (B, D) at 37°C and overlay image (B’, D’). Bar = 5µm.

Figure 26. Gal-Trm-II-GFP spots do not localize with the nucleolus. Immunofluorescence of WT and ts mutant spc110-220 at 37⁰C, expressing Gal-Trm1-II-GFP (A, C) and using primary antibody to the nucleolus (anti-Nop1, A’, C’). Green and red overlaid (B, D) and DAPI staining overlaid (B’, D’). Bar = 1µm. 89

Figure 27. Gal-Trm1-GFP spots does not co-localize with the NVJ. WT and ts mutant spc110-220 (A, C) expressing Gal-Trm1- II-GFP (A’, C’), vacuolar membrane stained with FM4-64 (B,D) and overlaid image (B’, D’) at 37°C. The red spot corresponds to Spc97-mCherry. Bar = 5µm.

Gal-Trm1-II-GFP Localizes to a Pore-less Region of the Nucleus, Close to ER- Nucleus Junctions

The co-location of Gal-Trm1-II-GFP with the nuclear envelope was analyzed by performing IF in WT and SPB ts mutant spc110-220 using the peripheral NPC protein, Nsp1, to mark the NE boundaries and the nucleopores (Figure 28). In both WT and ts mutant, Nsp1 showed a punctuate pattern characteristic of NPC proteins. Upon galactose induction at non-permissive temperature, Gal-Trm1-II-GFP in WT cells showed the smooth ring distribution characteristic of its INM location. In the ts mutant, Gal-Trm1-II- GFP located as a spot. In the majority of the cells (~75%) the spot was close to the NE. Interestingly, in the cells showing Gal-Trm1-II-GFP spot close to the NE, the accumulation often occurred in a pore-less region. In the remaining 25% of the cells, Gal- Trm1-II-GFP was completely excluded from the NE. Thus, Gal-Trm1-II-GFP spot in the ts mutant was usually close to the NE. A remaining subnuclear domain close to the NE that was not previously tested is the ER-nucleus junctions. We explored whether Gal-Trm1-II-GFP spot was located to a region of the NE that coincides with the ER-nucleus junctions. We tested a perinuclear ER (pER) marker, Scs2. We performed IF using a galactose-inducible HA-tagged version of Scs2. After galactose induction, at non-permissive temperature, Scs2 located to the nuclear periphery in WT and ts mutants cells (Figure 29). In addition, Scs2 formed one or two extensions towards the cytoplasm. These extensions are the ER-nucleus junctions. In WT cells, Gal-Trm1-II-GFP locates as a ring at the NE, while the ts mutant showed the expected spot phenotype. In the SPB ts mutant, spc110-220, the Gal-Trm1-II-GFP spot localizes to a region close to the ER-nucleus junction. Because the ER-nucleus junctions are not visible in all cells, it was not possible to determine the exact location in many of the cells showing the spot phenotype. However, among those where the ER-nucleus junctions were visible, about 80% of the time the spot was located in this region (Figure 30). Normally, one junction per cell was visible. However in some cells two junctions can be detected. We predict that in ts mutant cells showing more than one spot for Gal- Trm1-II-GFP, the spots will localize to both junctions, but it was very difficult to see 91

such type of cells in our experiment, as there were very few and not all were induced for Trm1-II. We analyzed whether the Gal-Trm1-II-GFP spot also localized to the ER-nucleus junctions in another SPB ts mutant, spc42-10 (Figure 29). We found that the Gal-Trm1- II-GFP spot also located close to ER-nucleus junctions in the majority of the cells when junctions were visible. We showed that in WT cells treated with α-factor, Gal-Trm1-II- GFP is mislocalized in a similar manner to SPB ts mutants (Chapter 3). Interestingly, when we tested the location of the Gal-Trm1-II-GFP spot in WT cells treated with α- factor, we found that the protein was located close to the ER-nucleus junctions (Figure 29). Our results suggest that in cells with an altered SPB structure, Gal-Trm1-II-GFP is located preferentially to the ER-nucleus junctions.

Figure 28. Gal-Trm1-II-GFP localizes to a pore-less region at the NE. Immunofluorescence of WT and ts mutant spc110-220 at 37⁰C, expressing Gal-Trm1-II-GFP (A, C) and using primary antibody to the NPC, (anti-Nsp1, A’, C’). Green and red overlaid image (B, D) and DAPI staining overlaid (B’, D’). Bar = 1µm.

Figure 29. Gal-Trm1-II-GFP spots co-localize with a region close to the ER-nucleus junctions in cells with altered SPB structure. Immunofluorescence of WT, spc110-220, spc42-10 and α-factor treated cells at 37⁰C, expressing Gal-Trm1-II-GFP (A, C, E, G) and using an antibody for the ER maker Scs2 tagged with HA (anti-HA, A’, C’, E’, G’). Green and red overlaid image (B, D, F, H) and DAPI overlaid (B’, D’, F’, H’). Bar = 1µm.

Figure 30. Gal-Trm1-II-GFP at the ER-nucleus junctions. Immunofluorescence of spc110-220 at 37⁰C, expressing Gal-Trm1-II-GFP and using an antibody for the ER maker Scs2 tagged with HA (anti-HA, A, B, C). Green and red overlaid image (A’, B’, C’). Bar = 1µm.

Trm1-II may Initiates “Spreading” in a Region Close to the ER-Nucleus Junctions

A possible idea to explain the localization of Gal-Trm1-II-GFP in the SPB defective cells is that the “spreading” process at the INM is prevented and the spot localization corresponds to the initial tethering site for Trm1-II. Our group reported that when the Trm1-II binding motif was tagged with GFP or was fused to a cytoplasmic reporter protein (Trm7-GFP), it was localized to the NE as a single or multiple spots, but was unable to “spread” at the INM (Lai et al., 2009). We reasoned that in a situation where Trm1-II binds the membrane, but is unable to spread in WT cells could reveal the location of the initial tethering site for Trm1-II. Therefore, we analyzed the location of galactose inducible NLS-130-151-Trm7-GFP in WT cells. Trm7 is a cytoplasmic methyltransferase enzyme that modifies tRNAs (Pintard et al., 2002). We performed IF utilizing the luminal protein Kar2 as an ER marker. In WT cells, Kar2 localizes to the pER, in a similar way to Scs2 (Figure 31). After galactose induction, NLS-130-151- Trm7-GFP localizes as multiple spots close to the NE. The majority of the cells (~60%) showed at least one spot that localizes close to the ER-nucleus junction. When analyzed in more detail we found that NLS-130-151-Trm7-GFP is also located at other regions that co-localize with the Kar2 signal and are excluded from the NE. It seems that this binding motif is able to bind not only to the membrane system around the NE, but perhaps to the ER membrane as well. The co-localization data is consistent with a model which indicates that the ER- nucleus junction is the location where Trm1-II initiates “spreading” throughout the INM. Thus, we envision a two-step process for correct subnuclear Trm1-II location. In the first step, Trm1-II is targeted to a region close to the ER-nucleus junctions. In the second step, Trm1-II is “spread” throughout the INM perhaps by interaction with another INM protein or by polymerization. Indeed, preliminary studies from T.P Lai suggest the existence of protein self interactions for Trm1-II (unpublished). It seems that the second step has different requirements and it appears that is dependent on functional SPBs.

9 7

Figure 31. NLS-130-151-Trm7-GFP localizes close to the ER-nucleus junction and to the ER. Immunofluorescence of WT cells expressing NLS-130-151-Trm7-GFP and using an antibody to identify the ER (anti-Kar2). The majority of the cells showed multiple spots localizing close to the ER-nucleus junctions (A-D’) and to the cortical ER (E-F’) (white arrows). Bar = 5µm. 97

Discussion

In cells with altered SPB, Gal-Trm1-II-GFP does not locate uniformly around the INM. Rather, in the majority of the cells, Gal-Trm1-II-GFP accumulates as one or a few spots. In order to understand how defects in the SPB alter INM targeting, we analyzed the location of Gal-Trm1-II-GFP in SPB defective cells. Our observations suggested that the spots in the SPB ts mutant were mainly located to the NE. Our first hypothesis was that the Gal-Trm1-II-GFP spot localizes to the SPB because the SPB defect somehow causes an accumulation of the protein to that structure. The SPB in S. cerevisiae is anchored to the NE during the entire cell cycle. Some of the SPB defects in the ts mutants affecting Gal-Trm1-II-GFP location are related to SPB duplication and insertion, which often results in inappropriate anchoring of the new SPB. It is possible to extend this observation to propose that in the ts SPB mutants, Gal-Trm1-II-GFP accumulates at the SPB as a result of an abnormality at the nuclear membrane. However, in the SPB ts mutant, the SPB and Gal-Trm1-II-GFP do not co-localize. Moreover, in some cases Gal- Trm1-II-GFP is far from the SPB. In addition, our group, has tried to determine the proteins that interact with Trm1-II in order to identify a Trm1-II INM tether (T.P. Lai, unpublished), but none of the known SPB proteins appear to have a direct interaction with Trm1-II. According to the Saccharomyces Genome Database (www.yeastgenome.org), there are previous reports of physical interactions between SPB core components and other yeast proteins. Since the initial hypothesis was proven to be incorrect, we tested additional sub-nuclear domains. The proposed INM targeting model for Trm1-II suggests that the protein is translocated from the cytoplasm to the nucleoplasm before it finds its INM tether (Lai et al., 2009) and that the protein is nucleoplasmic in certain conditions (Murthi and Hopper, 2005; Lai et al., 2009). However, we found that the Gal-Trm1-II-GFP spot in the SPB ts mutant was not in the nucleoplasm as it does not co-localize with chromatin or the nucleolus. These observations suggest that the spot phenotype in the SPB ts mutants differs from what was found previously by our group. When we tested sub-domains at the nuclear membrane, we found that the Gal-Trm1-II-GFP spot in the SPB ts mutant 98

partially co-localized with the membrane, and predominantly localized to a pore-less (less Nsp1) region of the membrane. The cells containing these pore-less regions at the membrane appeared in both WT and ts SPB mutant cells. Therefore, we do not consider that the pore-less region is the result of a membrane defect that causes a mislocation of Nsp1 and subsequent Gal-Trm1-II-GFP accumulation. Indeed, current work from T.P. Lai (unpublished) indicates that Gal-Trm1-II-GFP location is not affected in an Nsp1 ts mutant. It seems that inappropriate distribution or absence of NPC proteins does not affect considerably the INM location of Gal-Trm1-II-GFP. In agreement with this, Gal- Trm1-II-GFP was correctly located at the INM in the null mutant nup133∆ where NPCs are clustered to a sub-domain of the nuclear membrane as well as in cells with defects in other NPC components (Lai et al., 2009). It is possible that the clustering observed in WT and ts mutant cells is part of the normal dynamics of the NPC. The NPC distribution at the NE changes during the cell cycle (Winey et al., 1997). In fact, the NPC density seems to reach a peak in S-phase and in early mitotic cells. Normally, the NPCs were found in clusters, mostly associated with the SPB. The biological reason for this clustering, especially close to the SPB is unknown, but it is in agreement to our observations indicating that the Gal-Trm1-II-GFP spot does not co-localize with either the SPB, or the clustered NPCs. The localization of the Gal-Trm1-II-GFP spot to the ER-nucleus junctions in the SPB defective cells was an unexpected result. We initially thought that Gal-Trm1-II-GFP was accumulated at an INM region which is connected to the ONM region that eventually forms the junctions with the ER. Nonetheless, even if this is true for many cells, this idea does not explain the presence of spots that are obviously excluded from the nucleus. A possible explanation for the localization of the Gal-Trm1-II-GFP spot at the ER-nucleus junctions is that this is the first location of the protein before it “spreads” through the INM. In agreement with our hypothesis, the fusion protein NLS-130-151-Trm7-GFP was localized to the ER-nucleus in the majority of the WT cells where the junctions were visible. In addition, we observed that many of the spots formed by this fusion protein

were located far from the NE and always co-localized with the ER signal. A possible explanation for this phenotype is that the Trm1-II motif binds directly to membranes. Possibly, in full length WT Trm1-II, this motif is not available to interact with the membranes until it is close enough to the NE where a change in conformation occurs. Therefore, it is possible that this binding motif of the fusion protein used in our experiment was partially exposed, causing a premature interaction with membranes. Our observations suggest that the initial tethering site for Trm1-II may occur at the ER or more specifically, the ER-nucleus junctions and that perhaps in the SPB ts mutants, Gal-Trm1-II-GFP “spreading” is prevented. This is an intriguing result as the proposed model for Trm1-II implies that the protein utilizes the soluble pathway for import and is translocated to the nucleoplasm before it is tethered to the INM. Therefore, neither Gal-Trm1-II-GFP nor the fusion protein NLS-130-151-Trm7-GFP should interact with the ER/ONM, unless it is able to be exported out from the INM to the ONM, which is unlikely. As we are looking at a terminal phenotype (after ~2 hours of induction) it is possible that we are missing important steps in the INM targeting process of Trm1-II. Therefore, we sought a more comprehensive analysis of the Gal-Trm1-II-GFP dynamics in vivo.

100

Chapter 5: Nuclear Targeting Dynamics of Galactose Inducible Proteins

Abstract

Here we report the dynamics of intracellular movement of galactose inducible nuclear proteins Trm1-II, Pus1 and Heh2, in WT and SPB ts mutant spc110-220. By monitoring the targeting process of Gal-Trm1-II-GFP, we learned that its inappropriate distribution when the SPB structure/function is altered, results mainly from a failure to move from the initial contact with the NE throughout the INM. However, we found that maintenance of Gal-Trm1-II-GFP at the INM is also affected by the changes in the SPB. Newly synthesized Trm1-GFP accumulates at the ER suggesting that the ER might be the initial Trm1 tethering site. Surprisingly, SPB defects also affect the nuclear distrbution of an integral INM protein, but not a soluble nucleoplasmic, suggesting that appropriate SPBs are required for INM targeting of both integral and peripheral INM proteins, but not nucleoplasmic proteins. Our evidence suggests Trm1-GFP is alternatively transported via soluble mechanism when unable to tether to the ER. We propose a novel mechanism for peripherally associated INM proteins that combines targeting mechanisms for both integral and soluble proteins.

Introduction

In order to study the dynamics of nuclear resident proteins and compare these dynamics to Trm1-II-GFP, we monitored the galactose inducible fusion proteins Pus1- GFP and Heh2-GFP. Pus1 (PseudoUridine Synthase) is a non-essential tRNA pseudouridine synthase that was also suggested to have a role in tRNA transport and in modification of spliceosomal U small nuclear RNAs (Massenet et al., 1999; Grosshans et al., 2001). Pus1 locates to the nucleoplasm and does not associate with nucleopores, even though a functional link with the NPC protein, Nsp1, was suggested (Simos, 1996). As a 101

soluble nuclear protein, Pus1 is expected to be transported to the nucleoplasm by the classical soluble machinery of the Ran pathway. In this pathway, karyopherin proteins are responsible to import soluble cargo into the nucleus. Pus1 has been used as a nucleoplasmic marker in yeast (Campbell et al., 2006; Webster et al., 2010). The INM integral protein Heh2 (Helix-Extension-Helix domain), along with Heh1 is a conserved member of the LEM (Lap2, emerin, MAN1) integral INM proteins. Most of the information about INM targeting of integral proteins in yeast has been acquired using Heh2 as a reporter (King et al., 2006; Liu et al., 2010; Meinema et al., 2011). Heh2 is synthesized at the ER, but utilizes the soluble machinery for its translocation to the INM in a Ran-dependent manner. Heh2 contains an NLS that facilitates the interaction with the Kap95/Kap60 complex (King et al., 2006).

The Microfluidics System

We employed the microfluidics system that was developed by Cell Asic (www.cellasic.com/ONIX) to monitor the dynamics of nuclear galactose inducible proteins. The microfluidics system consists of different features that allow the tracking of living cells in optimal growth conditions over the time. The microfluidic plate contains four independent subunits composed of 8 wells (six inlets, one waste, and one cell inlet) and four cell culture chambers that are centralized under a single large imaging window (four microchambers). The plate also contains an elastic ceiling which is expanded by pressure to trap the cells in an x, y, z space. Then, after cells are trapped, solutions can be exchanged without perturbations to the plate. The flow rate for the solutions and loading pressure is controlled by an external manifold. Cells receive media and nutrients over time for optimal growth. The plates also contain a network of gas permeable air diffusion channels for gas mixture. Using this system it is possible to achieve a variety of analyses that are not possible by conventional approaches. Using conventional methods for microscopy that require the use of slides and cover slips do not permit appropriate aeration and it is impossible to exchange media.

102

Specific Aim

To analyze the dynamics of galactose inducible nuclear proteins in the SPB ts mutant and compare to the dynamics in WT cells

Methods

Dynamics of galactose inducible Trm1-GFP, Heh2-GFP and Pus1-GFP

An ER marker for WT and SPB ts mutant spc110-220 was created by genomically tagging (homologous recombination) the essential protein Sec63, at the C- terminus with mCherry, as described in Chapter 2. Insertion was verified by PCR using oligonucleotides GDM086-086 (Table 1). Sec63 is a protein that localizes to both, the perinuclear ER and the cortical ER (Deshaies et al., 1991). Strains containing Sec63mCherry and one of the plasmids for Gal-Trm1-GFP or Gal-Pus1-GFP or Gal- Heh2-GFP were used for these experiments. The dynamics of nuclear galactose inducible proteins, Trm1-II, Pus1 and Heh2 were monitored using the microfluidics perfusion system following the same procedure for each. First, 50 µl of log phase cells were loaded into the Y04C plate at 8psi for 8 seconds. Immediately, SC –URA 2% raffinose media was flowed through the chamber while the cells where focused and selected for imaging. Once the desired cells were selected, the raffinose media was switched to SC –URA 2% galactose media for 60 minutes to induce the protein of interest. Next, galactose media was switched to SC – URA 2% glucose media until the end of the experiment to stop the production of galactose-induced protein. Changes in the media were programmed using the ONIXTM FG Software. The pressure used in all the experiments was 2psi. We conducted the experiment at room temperature for all strains, as the SPB ts mutant, spc110-220, exhibited the predominant spot phenotype for Gal-Trm1-II-GFP at the permissive temperature.

103

Imaging and counting

Images were collected at time points 0, 45, 60, 90, 120 and 150 minutes after galactose induction. Before we established the time points at which cells were collected, we performed preliminary experiments collecting cells every 15 minutes to determine the best time points. For counting, we collected additional images of different cells in the microfluidics plate after 150 minutes. Image capture was performed as described in Chapter 2. Image processing and the number of cells per phenotype observed were determined by using the Cell Counter tool from the Image J software.

Dynamics of Gal-Trm1-II-(A147D)-GFP

We monitored the dynamics of a point mutant for Trm1-II that it was shown to mislocalize to the nucleoplasm (Lai et al., 2009). This experiment was performed as indicated above.

Dynamics of galactose inducible Trm1-GFP in WT cells arrested with α-factor

The dynamics of Gal-Trm1-II-GFP in WT cells arrested with α-factor were monitored as described above, with the following changes: SC –URA 2% raffinose media was flowed through the chamber while the cells were focused and selected for imaging. Once the cells were selected, raffinose media was switched to raffinose media containing 2µg/ml of α-factor pheromone and media was flowed until a large number of cells were arrested and showed the shmoo shape (1-2 hours). Once cells were arrested, the media was switched to SC –URA 2% galactose media containing the same concentration of α- factor, for 60 minutes to induce Gal-Trm1-II-GFP during arrest. Then, galactose media was switched to SC –URA 2% glucose media containing α-factor for 60 minutes to stop the protein induction. Finally, to follow the movement of Gal-Trm1-II-GFP upon release from α-factor, the media was switched to SC –URA 2% glucose without α-factor until the

104 end of the experiment (release). The time for this last step was variable (from 3 to 6 hours). We also monitored Gal-Trm1-II-GFP that was induced and targeted to the INM before the cell cycle arrest with α-factor in order to analyze if INM located Gal-Trm1-II- GFP is maintained at the INM after the arrest. To do this experiment, SC –URA 2% raffinose media was flowed through the chamber while the cells where focused and selected for imaging. Once the cells were selected, raffinose media was switched to SC – URA 2% galactose media for 60 minutes. Next, galactose media was switched to SC – URA 2% glucose media for an additional 120 minutes. Finally, media was switched to SC –URA 2% glucose media containing α-factor pheromone until a large number of cells were arrested (shmoo shape).

Imaging and counting for arrested cells

To study the dynamics of Gal-Trm1-II-GFP after α-factor arrest, then release, images were collected before the arrest, after the arrest, after galactose induction, and every 60 minutes after release, until the end of the experiment. To study the dynamics of INM located Gal-Trm1-II-GFP during the α-factor arrest images were collected at 120 minutes after galactose induction, then every 60 minutes during the arrest, until the end of the experiment. Image capture was performed as described in Chapter 2. Image processing was performed using the Image J software.

Results

Gal-Trm1-II-GFP is mislocalized to the ER or a region of NE in the SPB ts mutant spc110-220

Gal-Trm1-II-GFP dynamics were monitored in WT and SPB ts mutant, spc110- 220 at room temperature. The spinning disc confocal microscope we utilized is not equipped with an environmental chamber which makes the observations for our study at

105 elevated temperatures more difficult. However, since the SPB ts mutant shows the Gal- Trm1-II-GFP spot phenotype at permissive temperature, we were able to study the role of the SPB in INM localization of Gal-Trm1-II-GFP at room temperature. In WT cells, as expected, the characteristic Trm1-II localization at the nuclear rim was viewed in the majority of the cells expressing the galactose inducible version tagged with GFP (Figure 32). Gal-Trm1-II-GFP showed a predominant (71%) ring phenotype at the NE (Figure 33-A). The GFP signal appeared around 90 minutes after induction with galactose (Figure 32). A group of WT cells showed a spot phenotype (29%, data not shown) and the accumulation of Gal-Trm1-II-GFP in the cells, normally show brighter signal, compared to rings at the NE. Curiously, we never detected a nucleoplasmic pool of Gal- Trm1-II-GFP at any time point. We interpreted this to mean that the nucleoplasmic step in the targeting mechanism either is very transient and difficult to be detected, or it does not exist. However, we detected the presence of a spot in WT cells that showed a final ring phenotype. We interpreted this to means that the spot is transient and visible in specific circumstances (SPB defect). When we monitored the dynamics of Gal-Trm1-II-GFP in the SPB ts mutant, spc110-220, we observed that the vast majority of the cells (84%) showed abnormal accumulation of the protein (Figure 32 and Figure 33-A) that corresponded to various phenotypes: single spot (SS), double or multiple spots (DS), cytoplasmic spots (CS) and half-moons (HM). These are the exact same phenotypes that were initially observed during the screen that identified the role of the SPB in Gal-Trm1-II-GFP INM location (Chapter 3). Additional information from this experiment shows that the cytoplasmic spots (CS) correspond to Gal-Trm1-II-GFP located specifically at the cortical ER (cER), as they co-localize with the ER marker, Sec63-mCherry (Figure 32). Moreover, this phenotype (CS) is a sub-category of the others as SS, DS and HM sometimes localizes to the cytoplasmic region of the ER. We counted only SS, DS and HM to calculate the percentage of cells showing Gal-Trm1-II-GFP accumulation and then determined how many of them were at the cER (Figure 33).

106

Among the ts mutant cells showing the spot phenotype for Gal-Trm1-II-GFP, the majority were single spots (SS, 68%) (Figure 33-B). The GFP signal appeared as soon as 45 minutes and become brighter with time. We also observed some cells with two or more spots (DS, 7%) and a group of cells showing the half-moon phenotype (HM, 25%). In addition, for this group that includes SS, DS and HM, we determined if Gal-Trm1-II- GFP was located close to the NE or at the cER. For about 68%, the signal always co- localizes with the ER marker (Figure 33-C), close to the NE and many times towards the ER-nucleus junctions, but it was difficult to determine whether the Gal-Trm1-II-GFP was at the perinuclear ER (pER) which is continuous with the ONM, or if it was located at the INM. The number of cells showing ER location could be easily underestimated by fluorescence microscopy. For the remaining 32% of the total ts mutant cells showing mislocalized Gal-Trm1-II-GFP, the accumulation occurs at the cER, far from the NE, sometimes close to the cell periphery (Figure 33-C). Although, the above experiments were conducted by using different periods of galactose induction (30, 45 and 90 minutes), and the overall outcome was almost identical. The results employing microfluidics confirmed our observations from the genetic screen (Chapter 3) and the co-localization experiments (Chapter 4). Furthermore, the evidence supports our previous suggestions, indicating that the ER/ONM might be the initial tethering region for Gal-Trm1-II-GFP (Chapter 4).

107

Figure 32. Gal-Trm1-II-GFP is mislocalized in the SPB ts mutant, spc110-220. WT and SPB ts mutant, containing an endogenously-tagged Sec63-mCherry and Gal-Trm1- II-GFP. Upon galactose induction, WT cells show typical ring localization, where the mutant cells show accumulation at one region of the NE and the ER. Bar= 5µm.

108

109

90 80 70 60 50 40 ring at NE 30 no ring at NE

Percentage of Cells 20 10 0 WT spc110-220 Strains

80 C 70 80 60 50 60 40 40 30 20 20 Percentage of of Percentage Cells Percentage of Cells 0 10 NE cER 0 SS DS HM Phenotypes of mislocalized Gal-Trm1-II-GFP in spc110-220

Figure 33. SPB ts mutant spc110-220 shows a higher percentage of cells without Gal- Trm1-II-GFP rings at the NE, compared to WT. A. Percentage of cell showing localization of Gal-Trm1-II-GFP in WT and spc110-220. B. Percentage of the different mislocalized (no ring) phenotypes in spc110-220. SS= single spot, DS= double or multiple spots, HM= half moon. C. Comparison of mislocalized (no ring) Gal-Trm1-II- GFP that localizes to the NE (includes INM and ONM) vs. the cER (far from NE) in spc110-220. cER= cortical ER. n= 138 (WT), 173 (ts).

110

Transport to the nucleus of the soluble protein Gal-Pus1-GFP is not altered in the SPB ts mutant spc110-220

We reasoned that if the SPB defect affects targeting of Gal-Trm1-II-GFP, which was proposed to follow the classical import pathway, then, the import of other soluble proteins could be affected as well, unless the effect is exclusive to Trm1-II. Therefore, we compared the dynamics of Gal-Trm1-II-GFP, a soluble peripheral INM protein, with the dynamics of a soluble nuclear protein, Gal-Pus1-GFP in WT and spc110-220. The phenotypes for Gal-Pus1-GFP in WT cells and the SPB ts mutant were identical (Figure 34) with all the induced cells showing Gal-Pus1-GFP in the nucleoplasm with no detectable pool at the ER or the nuclear membrane (Figure 35). The nucleoplasmic localization was visible early, around 45 minutes after induction for both, WT and spc110-220 cells (Figure 34). In contrast to Gal-Trm1-II-GFP, Gal-Pus1-GFP nuclear targeting was not affected. This defect affecting Gal-Trm1-II-GFP is not a general import problem and may indicate a specific effect on Gal-Trm1-II-GFP. Another interpretation is that Trm1-II and Pus1 follow separate pathways to their subnuclear destination. If true, then maybe the SPB function would be required for other nuclear membrane proteins that follow the Trm1-II pathway.

111

Figure 34. Gal-Pus1-GFP is not mislocalized in the SPB ts mutant, spc110-220. WT and SPB ts mutant, spc110-220 containing an endogenously-tagged Sec63-mCherry (ER marker) and Gal-Pus1-GFP. Upon galactose induction at permissive temperature, WT and SPB ts mutant cells show typical nucleoplasmic localization.Time points from 0 to 150 minutes after galactose induction.Bar= 5µm.

112

113

120

100

60 nucleoplasmic not nucleoplasmic 40 Percentage of of Cells Percentage 20

0 WT spc110-220 Strains

Figure 35. Gal-Pus1 localization was identical in WT cells and the SPB ts mutant spc110- 220. Percentage of cells showing that nuclear localization in both, WT and mutant. Nucleoplasmic localization was 100%. n= 100 (WT), 125 (ts).

114

The INM localization of the integral protein Gal-Heh2-GFP is affected in the SPB ts mutant spc110-220

As we learned from the previous experiment that targeting of a nuclear soluble protein is not altered in the SPB ts mutant, we investigated whether targeting of an integral INM protein could be affected by defects of the SPB. If Gal-Trm1-II-GFP follows the classical transport pathway as other soluble proteins, but the SPB defect affects exclusively Gal-Trm1-II-GFP, targeting of an integral protein should not be altered by the SPB mutation. On the other hand, if Gal-Trm1-II-GFP follows a similar pathway to INM integral proteins, the SPB defect should affect the localization of an integral INM protein. To test this idea, we monitored the dynamics of the integral protein Gal-Heh2-GFP in WT and spc110-220. In WT cells, Gal-Heh2-GFP localizes as a ring to the NE, as previously reported (King et al., 2006) (Figure 36). Some cells showed a little “tail” corresponding to protein at the ER, which normally appear in WT cells because this protein is synthesized at the ER and is anchored by its transmembrane domain. After induction with galactose, some signal appeared at 45-60 minutes, but the rings were completely visible after 90 minutes. No intermediate phenotype for Gal-Heh2-GFP was observed during the time course. Interestingly, when we examined the dynamics of Gal-Heh2-GFP in the SPB ts mutant by microfluidics, we observed that in addition to its location to the NE as a ring, Gal-Heh2-GFP also localizes to areas far from the NE that co-localize with the ER marker (Figure 36). It seems that a pool of Gal-Heh2-GFP was able to reach the INM in the SPB ts mutant, but a portion of the protein was retained at the ER. We also observed an increase in the cER localization for Gal-Heh2-GFP in the SPB ts mutant, when compared to WT. The aberrant localization of Gal-Heh2-GFP was observed in the majority (70%) of the induced spc110-220 cells, compared to WT cells (11%) (Figure 37). It is known that over expression of INM proteins can cause expansion of the nuclear membrane (Ma et al., 2007; Linde and Stick, 2010). We do not predict that this is the explanation for the observed phenotype as it did not happened in WT cells under the 115 same conditions, but also because most of those ER areas to where Gal-Heh2-GFP localizes, were visible before galactose induction. Furthermore, cells with low GFP signal also showed the ER location. Still, we cannot eliminate the possibility that the changes in Gal-Heh2-GFP localization are caused by defects at the ER. The results show that the location of an INM integral protein is altered in the SPB ts mutant. The effect of the SPB is not unique to Trm1-II. Again, it seems that general transport was not altered, but a considerable pool of Gal-Heh2-GFP was unable to complete the translocation process to the INM. The results also indicate that some type of defect at the membrane level must occur in the SPB ts mutant that is affecting only membrane associated proteins, but not a soluble nuclear protein. The evidence supports the idea that Trm1-II may utilize an INM targeting mechanism more similar to integral INM proteins. Thus, Gal-Trm1-II-GFP locates transiently at the ER/ONM before translocating to the INM, instead of being at the nucleoplasm before tethering to the INM, as previously suggested (Lai et al., 2009; Burns and Wente, 2012).

116

Figure 36. Gal-Heh2-GFP is mislocalized in the SPB ts mutant, spc110-220. WT and SPB ts mutant, containing an endogenously-tagged Sec63-mCherry (ER marker) and Gal-Heh2-GFP. Upon galactose induction, WT cells show typical ring localization, where the mutant cells show additional location to the cER (white arrows). Last panel (150 m, bottom) shows a different focal plane of the same cells at the left. Time points from 0 to 150 minutes after galactose induction. Bar= 5µm.

117

118

100 90 80 70 60 50 NE 40 NE + ER

Percentage of Cells 30 20 10 0 WT spc110-220 Strains

Figure 37. SPB ts mutant spc110-220 shows a higher percentage of cells with Gal-Heh2-GFP at the ER, compared to WT. Percentage of cell showing Gal- Heh2-GFP localization in WT and spc110-220. n= 160 (WT), 167 (ts).

119

Gal-Trm1-II-GFP is at the ER before its translocation to the INM

The data acquired using microfluidics to analyze Gal-Trm1-II-GFP dynamics in the SPB ts mutant, led to the model that the protein is in contact with the ER/ONM before targeting to the INM. To test this model further we needed to be able to follow the dynamics of the Gal-Trm1-II-GFP from its initial location at the ER/ONM until it forms a ring at the INM. This was not possible to achieve with the SPB ts mutant because it appear to have high amount of cells showing a spot “terminal” phenotype (does not spread with time) even at permissive temperature. Therefore, we elected to employ WT

cells arrested with α-factor as the arrest in G1 of the cell cycle is reversible and this facilitates our analysis. After cell arrest using α-factor (Figure 38), Gal-Trm1-II-GFP was induced with galactose for one hour with the continued presence of α-factor. We observed that the spot phenotype for Gal-Trm1-II-GFP was visible for some shmoo cells after 1 hour post- induction, but more evident at two hours post-induction. Then, shmoo cells were released from the arrest by elimination of α-factor from the media flowed to the cells. Three hours after release, some cells which previously showed the spot phenotype during the arrest demonstrated that Gal-Trm1-II-GFP re-locates to the NE (Figure 38). Even a cell containing an obvious ER localization for Gal-Trm1-II-GFP (close to the cell periphery), demonstrated that the protein is re-located to the NE after release (Figure 39). Most of the cells at that time started to bud, documenting their release from the G1 arrest by α-factor. However, some cells showed re-location of Gal-Trm1-II-GFP when they still had a shmoo shape. We interpreted this to mean that the cells re-arranged the nuclear membrane that is happening while the changes in the cell wall recovery were still in progress. Our results suggest that Gal-Trm1-II-GFP is located at the ER, at least transiently, before it is translocated to the INM. The data supports the idea that Trm1-II targeting to the INM is more similar to integral proteins than soluble nuclear proteins. It is possible that Gal-Trm1-II-GFP reaches the ER/ONM membrane to interact with its primary membrane tether, before it is translocated to the INM. The experiment also sheds light on 120

how altering the SPB structure/function is affecting INM protein targeting. Perhaps, when the SPB structure/function is altered, the membrane system that forms part of the ER and the NE undergoes a change that affect INM membrane proteins, to different degrees, depending of their nature (integral vs peripheral) as their interactions with the membranes are different.

121

Figure 38. Gal-Trm1-II-GFP distribution at the INM is recovered during release from cell cycle arrest with α-factor. WT cells, containing an endogenously-tagged Sec63-mCherry (ER marker) and Gal-Trm1-II-GFP. Cells were arrested with α- factor and induced with galactose for 1 hour. Cells were maintained in cell cycle arrest for an extra hour before they were released. After induction during the arrest, cells showed the spot phenotype. After release, some cells showed the typical ring localization. White arrows are pointing to the same cells before and after release. Bar= 5µm.

122

123

124

Figure 39. Gal-Trm1-II-GFP is located at the ER before its translocation to the INM. (A-C). WT cells containing an endogenously-tagged Sec63-mCherry and Gal-Trm1-II-GFP. (A/B/C-3) Upon galactose induction during α-factor arrest, Gal- Trm1-II-GFP was mislocalized as a spot at the NE or the cER (white arrows). (A3’-3’’, B/C-3’) After release, cells re-located Gal-Trm1-II-GFP to the INM (white arrows). Bar= 5µm.

124

Gal-Trm1-GFP Maintenance at the INM is affected during Cell Arrest by α-factor in WT cells

Our previous results suggest that a change at the NE occurrs as a result of the SPB alterations in both the SPB ts mutant and WT cells arrested with α-factor. The changes in the NE delay the INM targeting process. We do not know whether the NE defect is happening at the ONM, the INM, or both. Our results are indicative of a change at the ER/ONM that prevents Gal-Trm1-II-GFP to access the INM. However, it is possible that the change occurs also at the INM. Although, previous work demonstrated that maintenance of Gal-Tm1-II-GFP at the INM is not dependent on the Ran cycle (Lai et al., 2009), we tested the role of the SPB structure/function in Gal-Trm1-II-GFP maintenance at the INM. To accomplish this, Gal-Trm1-II-GFP was induced before the arrest with α-factor. The INM localization for Gal-Trm1-II-GFP was followed by live cell imaging to learn whether the protein located at the INM was maintained there during the arrest with α-factor. Surprisingly, the Gal-Trm1-II-GFP rings at the INM collapsed to a single region of the NE (Figure 40). During the exposure to α-factor, some cells were able to complete the budding process before they were arrested. For those cells, in both the mother and daughter cells that showed an initial ring phenotype, the protein collapsed with time (Figure 40, cells 1 and 5). When observed in more detail, we noted that the spots resulting from the collapse were not located at the cortical ER (cER), but instead appeared to be located at the nuclear interior, to a region of the INM. Indeed, calculations of the number of spots located to the cER, in additional cells after 3 hours of arrest, showed that only a 7% had signal at the cER (Figure 41). This is in contrast to the amount of spots we reported to be located at the cER when Gal-Trm1-II-GFP was induced in the SPB ts mutant were the SPB was defective before induction (32%, Figure 33-C). In a more detailed analysis of the dynamics of Gal-Trm1-II-GFP in spc110-220, we found that the collapse of the INM located protein was also observed (Figure 42). However, a difference in this experiment was that the protein production and the SPB alterations were concurrent. Possibly, because this experiment was at permissive 125

temperature, Gal-Trm1-II-GFP accessed the INM in some cells, but at some point the protein collapsed as a consequence of the SPB alterations. If Gal-Trm1-II-GFP is located to the INM when the SPB structure/function is altered, the protein will collapse to a region of the INM. This intriguing result brings additional support to the idea that a change at the NE membranes or membrane factor(s) is occurring when the SPB structure/function is affected.

126

Figure 40. Gal-Trm1-II-GFP maintenance is affected during cell cycle arrest. (A-L’). WT cells containing an endogenously-tagged (D-F’) Sec63-mCherry and (G-I’) Gal- Trm1-II-GFP. Cells of interest are numbered 1-7. (A,D,G,J) Cells were induced with galactose 1 hour and then protein expression turned off before the arrest. (B,E,H,K) Cells after two hour arrest. Primer letters are showing a different focal plane of the same group of cells. (C,F,I,L) Most rings at the NE “collapses” to a single region of the INM after 3 hour arrest. (Cells 1 and 5) Mother and daughter cells also showed the “collapse” phenotype. Bar= 5µm.

127

128

100 90 80 70 60 50 NE 40 cER

Percentage of Cells 30 20 10 0 WT α-factor Spot Localization

Figure 41. The majority of the spots after Gal-Trm1-II-GFP “collapse” are located to the NE, mainly, the INM. Percentage of cell showing mislocalized Gal-Trm1-II-GFP after arrest post-induction. n= 125.

129

Figure 42.. Maintenance at the INM is also affected in the SPB ts mutant. (A and B) two examples of the SPB ts mutant, spc110-220 containing an endogenously-tagged Sec63-mCherry and Gal-Trm1-II-GFP. The cells showed an initial ring phenotype that was disappearing with time in an apparent “collapse”. * The last panel at the right shows the same cells at lower intensity to a better visualization of the protein accumulated. Time points from 0 to 150 minutes after galactose induction. Bar= 5µm.

130

131

Gal-Trm1-II-GFP utilizes the soluble import pathway to ensure its location to the nucleus, when it does not bind to the initial tethering site

Experiments employing live cell imaging of the dynamics of Gal-Trm1-II-GFP location to the INM indicate that Trm1-II INM targeting mechanism does not require that the protein access the nucleoplasm before being located at the INM. One possible explanation for the nucleoplasmic phenotype shown in previous work (Murthi and Hopper, 2005; Lai et al., 2009) is that Trm1-II is able to utilize the classical import pathway for soluble proteins when the protein is defective in binding to its tether. To test this idea, we monitored the dynamics of an INM binding motif point mutant for Gal- Trm1-II-GFP, which was previously shown to cause it to be nucleoplasmic in WT cells (Lai et al., 2009). When the point mutant, Gal-Trm1-II-A147D-GFP was monitored in WT cells, we observed the expected nucleoplasmic phenotype in all the induced cells (Figure 43). However among those cells showing a nucleoplasmic phenotype, we found a variety of sub-phenotypes: the majority of the cells (87%) were only nucleoplamsic (Figure 44). A small number of cells showed additional protein accumulated at the ER (3%) in addition to the nucleoplasmic pool. Also, we observed cells with a minor pool of the protein at the INM (ring) in addition to the nucleoplasmic pool (10%). The mutation in the INM binding motif disrupts the targeting/tethering of Gal-Trm1-II-GFP to the INM. From our experiment we learned that the disruption was enough to mislocalize the majority of the protein, but the protein still retained some binding ability explaining why a few cells showed accumulation at the ER and INM localization. When we monitored Gal-Trm1-II-A147D-GFP in the SPB ts mutant, spc110-220, all the induced cells showed a nucleoplasmic phenotype (Figure 44 and Figure 44). The nucleoplasmic phenotype includes cells that also contained a small spot that seems to locate at the INM. As in WT, the SPB ts mutant cells showed ER localization in addition to the nucleoplasmic pool (15%) and showed protein at the INM (ring) in addition to the nucleoplasmic localization (1%). We noted that Gal-Trm1-II-A147D-GFP as WT Gal- Trm1-II-GFP, showed the same distribution for ER and INM localization. This means 132 that in the SPB ts mutant, a higher amount of cells showed a pool of Gal-Trm1-II- A147D-GFP at the ER than as a ring at the INM, in addition to their nucleoplasmic pool, and when compared to WT cells (Figure 44). The presence of protein at the ER/NE was a consequence of its partial binding ability. We showed in this experiment that the SPB defect is not altering the nucleoplasmic localization of the INM binding motif mutant, Gal-Trm1-II(A147D)-GFP. This result is in agreement to our previous evidence showing that the SPB defect does not affect nuclear targeting of soluble proteins, such as Gal-Pus1-GFP. Our results indicate that only when Gal-Trm1-II-GFP is unable to bind to its membrane tether, as occurs in Gal-Trm1-II-(A147D)-GFP, the protein will utilize the classical import pathway to ensure its nuclear localization.

133

Figure 43.Gal-Trm1-II(A147D)-GFP nucleoplasmic location is not affected by alterations of the SPB. WT and spc110-220 cells containing an endogenously-tagged Sec63-mCherry and Gal-Trm1-II(A147D)-GFP. Gal-Trm1-II(A147D)-GFP is a mutant for the INM binding motif that is unable to bind Trm1-II tether. In both WT and SPB ts mutant, the mutant protein is located at the nucleoplasm. Time points from 0 to 150 minutes after galactose induction. Bar= 5µm.

134

135

100 90 80 70 60 50 Nucleoplasm 40 Nucleoplasm + ER Nucleoplasm + INM Percentage of Cells 30 20 10 0 WT spc110-220 Strains

Figure 44. Gal-Trm1-II(A147D)-GFP localizes to the nucleoplasm in both, WT and spc110-220. WT and SPB ts mutant spc110-220 . The nucleoplasmic poll was sometimes accompanied by a pool of protein at the ER or the INM. n=100 (WT), 164 (ts)

136

Discussion

To gain an understanding of the INM targeting mechanism of Trm1-II in live cells, we employed microfluidics. Microfluidics and the spinning disc confocal microscopy provide a very powerful approach for this purpose, as we were able to monitor the subcellular dynamics of galactose inducible nuclear proteins including Trm1- II, Pus1 and Heh2. As these proteins represent three different types of proteins in the nucleus, our analysis comparing them led to new insights about how Trm1-II is targeted and tethered to the INM. First, we confirmed that Gal-Trm1-II-GFP was mislocalized to the ER or to a discrete region of the NE in the SPB ts mutant spc110-220, even at permissive temperature. Most of the Gal-Trm1-II-GFP pool failed to access the INM when the SPB was altered. The phenotypes for mislocalized protein were identical to those found in our screen (Chapter 1). We learned that the cytoplasmic spots that we initially view in our screen corresponded to protein located at the cortical ER. Additionally, when we monitored a soluble nuclear protein, Gal-Pus1-GFP, in the SPB ts mutant, we learned that the transport/translocation was not altered compared to WT. This result shows that the SPB ts mutant does not have a general defect in nuclear import and therefore indicated that Gal-Trm1-II-GFP accumulation at spots was unlikely due to a failure to reach the nucleoplasm in the SPB ts mutant. Moreover, we found that the integral protein Gal- Heh2-GFP localized to the nuclear membrane, as expected, which supports the idea that there is no general transport defect when the SPB was altered. However, Gal-Heh2-GFP not only localized to the NE, but also to the cortical ER, indicating that a pool of the protein was unable to acces the INM. The effect of the SPB alterations is not unique to Gal-Trm1-II-GFP, but affects targeting of another nuclear membrane associated protein. Prior evidence supported the idea that Trm1-II, a peripheral INM protein, follows a similar pathway as soluble nuclear proteins, but with additional steps for INM tethering. Disruption of Trm1 N-acetylation and mutations in the INM binding motif, re-locates the protein to the nucleoplasm (Murthi and Hopper, 2005; Lai et al., 2009). Also, Trm1-II was cytoplasmic when the Ran pathway was disrupted, indicating that the protein was 137

synthesized in free polysomes and that karyopherin proteins were responsible for its translocation to the INM. The evidence led to the model where Trm1-II is tethered to the INM after it reaches the nucleoplasm., but our study is expanding our knowledge about how the process occurs. Our new evidence indicates, in contradiction with the previous model (Lai et al., 2009), that Trm1-II accesses the INM via the ER. By analyzing the dynamics of Gal-Trm1-II-GFP using microfluidics, we confirmed that Gal-Trm1-II-GFP was mislocalized as a spot in WT cells arrested with α- factor in the same manner as the SPB ts mutant. Moreover, we observed that Gal-Trm1- II-GFP located at the ER was able to eventually reach the INM during release from the cell cycle arrest. The data shows that Trm1-II is in transient contact with the ER/ONM before locating to the INM. Perhaps, the importance of this first contact of Gal-Trm1-II- GFP to the ER/ONM is to maintain its tethering during all the targeting process. For that reason, when the binding properties of Gal-Trm1-II-GFP are abolished, the protein is unable to interact with the ER/ONM in the first place. As the protein is able to interact with the karyopherin complex, it is imported into the nucleoplasm. Therefore, being nucleoplasmic might not be a required step in Gal-Trm1-II-GFP INM targeting mechanism, but an alternative way to access the nuclear interior when the protein is not tethered before translocation. Additional evidence in support of this idea is that Gal-Trm1-II-GFP that was at the INM, before the SPB was altered, “collapses” and remained attached to a region of the INM, instead of being re-located to the nucleoplasm, which suggests that the nucleoplasmic phenotype shown before (Murthi and Hopper, 2005; Lai et al., 2009) should take place in a situation where Trm1-II’s ability to bind its tether at the INM is abolished and not necessarily because of the unavailability of the tether (s). Another important conclusion from this experiment is that INM maintenance of Gal-Trm1-II-GFP is disrupted when the SPB structure/function is altered, which provides a better understand on how the SPB affects INM targeting. It seems that there are two different ways to mislocalize Gal-Trm1-II-GFP. First, protein synthesized after the SPB defect accumulates at the cortical and peripheral ER, where the evenly distribution of protein

138 that is already located at the INM before the SPB defect, is not maintained, promoting a protein “collapse” to a discrete region of the INM. Published (Murthi and Hopper, 2005) and unpublished (Murthi and Díaz) results from our group suggest a possible role of the ER in Trm1-II targeting. For example, in cells lacking the ER protein Ice2, Trm1-II-GFP was located in the nucleoplasm in addition to the INM. Our preliminary observation in ice2∆ cells expressing Gal-Trm1-II- GFP, revealed that the protein locates initially to the INM and with time accumulates in the nucleoplasm (appendix). Ice2 is involved in cortical ER inheritance (de Martin et al., 2005; Loewen et al., 2007). Our preliminary studies indicate that ice2∆ cells are inositol auxotrophs and that there is some type of membrane defect (Murthi and Díaz, unpublished). Indeed, Trm1-II-GFP INM localization was completely restored in ice2∆ cells when combined with a second deletion of the gene that encodes the lipid biosynthesis regulator, Spo7 (ice2∆spo7∆, appendix). Spo7 is a negative regulator of lipid biosynthesis that when deleted causes NE and ER expansion as a consequence of constitutive expression of lipid genes (Siniossoglou et al., 1998; Santos-Rosa et al., 2005; Campbell et al., 2006). Perhaps, the membrane tether for Trm1-II at the ER/ONM is altered in ice2∆ cells. Therefore, Trm1-II that is unable to bind initially to the ER/ONM is translocated to the nucleoplasm. In fact, our preliminary observations by fluorescent recovery after photo bleaching (FRAP), indicate that Trm1-II-GFP is a very dynamic protein (high mobility) as bleaching of a small region of interest (ROI) at the INM was replaced by unbleached Trm1-II-GFP very rapidly, a typical observation for lipid binding proteins (Brough et al., 2005). Finally, a member of our group found that Trm1-II is likely a lipid binding protein. Moreover, the Trm1-II region that is sufficient and necessary for NE localization appears to be responsible for this interaction (T.P. Lai, unpublished). Our evidence led us to propose a new model for INM targeting of Trm1-II: (1) Trm1-II is translated on free polysomes, (2) In a Ran-dependent manner via the NLS, Trm1-II is directed to the NE, where it contact its initial tether at the ER/ONM. (3) Trm1- II is translocated by assistance of the importin complex while it remains attached to the

139

membrane. (4) Once it is translocated to the INM, Trm1-II is evenly distributed throughout the INM. When Trm1-II is unable to bind its membrane tether, it follows the classical import pathway and the protein remains located at the nucleoplasm. .

140

Chapter 6: A Possible Connection between the Spindle Pole Body and the

Endoplasmic Reticulum

Abstract

Here we describe our efforts to investigate a possible connection between the SPB and ER dynamics. ER-related processes such as the unfolded protein response (UPR), ER-associated degradation (ERAD), the secretory pathway and mating require the function of the essential chaperone, Kar2. Interestingly, by indirect immunofluorescence, we uncovered a change in the distribution of Kar2 in the temperature sensitive (ts) SPB mutants, spc110-220, spc42-10, and a mild change in WT cells treated with α-factor. Kar2 was predominant at the perinuclear ER (pER) in WT cells, but in cells with defective SPB, Kar2 was instead evenly distributed throughout the cell. Thus, the change in Kar2 distribution in the SPB mutants may affect ER homeostasis. We selected different SPB ts mutants to test whether ER-related processes were affected. We found that the spc110-220 mutant has a defect in invertase secretion when compared to WT. However, other SPB ts mutants tested had no defect in secretion. We tested if the UPR response was altered in the SPB ts mutants, but they were able to respond to an accumulation of unfolded proteins. Importantly, we found that addition of inositol to the media restored growth at the non-permissive temperature for some of the SPB mutants. It is possible that there is a connection between lipid metabolism and the SPB.

Introduction

The Endoplasmic Reticulum (ER) is the main site for lipid biosynthesis and is responsible for folding and maturation of secretory and membrane proteins.

141

Accumulation of unfolded proteins is known to cause ER stress. Cells utilize two main processes for ER quality control: The unfolded protein response (UPR) and ER- associated degradation (ERAD). UPR is activated upon accumulation of misfolded or unfolded proteins at the ER lumen. Then, chaperones assist to correct the damaged proteins. When UPR is unable to correct unfolded proteins, they are retro-translocated from the ER to the cytoplasm where they are degraded by the proteosome in a pathway called ERAD. UPR and ERAD are coordinated processes. A genomic analysis revealed that ERAD requires an intact UPR. Second, UPR induction increases ERAD capacity. Third, disruption of ERAD causes constitutive UPR induction. Finally, the absence of both pathways decrease cell viability (Travers et al., 2000). The secretion pathway is a cellular process that is coordinated between the ER, the Golgi apparatus and the plasma membrane (Novick et al., 1981). Proteins that are destined for secretion are synthesized at the ER and transported in vesicles to the Golgi apparatus (early secretion) where they are glycosylated. After modifications, these proteins exit the Golgi apparatus in vesicles that are directed to the plasma membrane (late secretion) in order to be secreted to the cell exterior in a process called exocytosis. A very abundant protein in eukaryotic cells, the luminal ER protein Kar2 (Bip), has a role in UPR, ERAD and secretion/ER translocation. In yeast, Kar2 plays an additional role in mating. Numerous studies indicate that Kar2 is an essential ATPase chaperone of the perinuclear ER that interacts with different components of the processes mentioned above (Vogel et al., 1990; Ng and Walter, 1996; Kabani et al., 2003; Kimata et al., 2003; Hsu et al., 2012). Thus, Kar2 localization and activation is important for cell viability. The ER is also the site for lipid biosynthesis. Lipid biosynthesis and regulation plays a role in membrane plasticity and organization. Coordination between lipid dynamics and ER homeostasis is crucial for cell survival. Lipid biosynthesis and ER- quality control receive feedback from one another to achieve their functions (Jesch et al., 2006; Han et al., 2010). Kar2 plays an indirect role in lipid biosynthesis and regulation as UPR has a function in regulation of inositol as well in secretion, at least in yeast cells (Chang et al., 2002; Chang et al., 2004).

142

Our studies using Gal-Trm1-II-GFP as a reporter, suggest that its INM localization is affected by ER-Golgi homeostasis and lipid dynamics as the protein was mislocalized in ts mutants encoding proteins involved in these processes. Moreover, new evidence from our group shows that Trm1-II binds a lipid in vitro (T.P. Lai, unpublished). In addition, our new proposed model for INM targeting of Trm1-II indicates that it transits the ER/ONM before its translocation to the INM. Previous studies concerning integral INM proteins as well as our new evidence for peripheral INM proteins show that the events occurring at the ER could affect their INM targeting. Interestingly, we found in our screen for INM localization, that all the mutants mislocalized Gal-Trm1-II-GFP in a similar manner (spot phenotype). However, among the ts mutants found in our screen, only the SPB ts mutants are not known to participate in or affect any ER-related process. As we learned that in the SPB defective cells, INM targeting and maintenance is affected, we hypothesized the SPB may play an indirect role on INM dynamics by affecting processes that take place at the membrane system that forms the ER and the NE. The accumulation of unfolded proteins, defects in the secretory pathway and/or defects in lipid biosynthesis cause ER stress. However, is not clear whether defects of the NE or a structure at the NE such as the SPB cause ER stress and, as a consequence, activate signaling pathways to counteract such an effect. In addition, to the previous observations, we found a change in the distribution of Kar2 when cells have an alteration of the SPB function/structure. We hypothesized that there may be a connection between the SPB and ER dynamics.

Specific Aim

To test whether the function of ER-related processes is affected when the structure/function of the SPB is altered.

143

Methods

Kar2 IF

Log phase cultures of WT and ts mutant containing Gal-Trm1-II-GFP were induced with galactose for 30 minutes and then shifted to 37⁰C for 1.5 hour. Cells were fixed and processed for IF by using an anti-Kar2 antibody, as described in Chapter 2. The fixation time was 30 minutes. Also, WT cells arrested with α-factor were analyzed. Arrest with α-factor was achieved by adding 2 µm/ml of pheromone to the culture. After arrest, cells were induced with galactose, incubated and processed for IF as indicated above.

Invertase Assay

Invertase is an enzyme that catalyzes the hydrolysis of sucrose, with optimal activity at pH 4.5. This enzyme is secreted from the cells in response to glucose starvation. We analyzed the ability of the SPB ts mutants to secrete the enzyme invertase at the non-permissive temperature in response to low glucose. We performed an invertase assay for strains WT, spc110-220, spc42-10, sec7-1 (positive control) and abf1-102 (negative control). Culture conditions from a previous study were adapted to our experiment (Ryan and Wente, 2002). First, 15 ml of culture was grown in YEPD 2% glucose overnight to OD600nm ~0.35. The culture was washed twice with YEPD 0.05% glucose and resuspended in 12ml of the same media (glucose starvation). The culture was split into two cultures of 6 ml each. Each 6 ml culture was incubated at 23⁰C or 37⁰C for a total of 3 hours. The incubation was ended by adding equal amount of 20mM of sodium azide was added to the culture, followed by a second wash using 10mM sodium azide. Samples were resuspended in 600-800 µl of 10mM

sodium azide. OD600nm was measured to determine the amount of sample to be used for the invertase assay (to start with the same amount of cells).

144

The invertase assay was performed as described previously (Goldstein and Lampen, 1975). 50µl of 0.2M of sodium acetate buffer (pH 4.9) was combined with 5-20 µl of sample (cell extract) and placed in 30⁰C water bath. The reaction was started by addition of 25 µl of 0.5M of sucrose followed by 10 minutes incubation at 30⁰C. The reaction was stopped by 100 µl of 0.5M potassium phosphate buffer, pH7 and immediately heated 3 minutes in a boiling water bath. After tubes cooled down to 30⁰C, 1 ml of fresh solution C (1 ml Solution A, 500 µl fresh solution B and 8.5 ml of 45% glycerol) was added and incubated for 20 minutes at 30⁰C. Solution A was composed of 10 ml of glucose oxidase (Sigma), 10 mg of horseradish peroxidase (Sigma) and 90 ml of 0.1M of potassium phosphate buffer, pH7. Solution B was composed of 300 mg of o- dianisidine in 50 ml of water. After incubation, oxidation reaction was stopped by addition of 1.5 ml of 6M HCl. Developed red color was determined at 540 nm. The absorbance measures the glucose produced during the enzymatic hydrolysis of sucrose generated in the first reaction, which is proportional to the amount of invertase released.

β-galactosidase Assay (UPR)

WT, SPB ts mutants spc42-10, mps2-2, mps3-1, deletion strain ire1∆ (positive control) and ts mutants abf1-102 (negative control) were used for this experiment. In order to test whether the SPB ts mutants have a defect in UPR response, we transformed cells with plasmid pPW344/pJC104 (provided by P. Walter, UCSF). This reporter construct contains a triple repeat of the KAR2-derived UPRE (UPR element) fused to the β-galactosidase gene. An UPRE is a cis-acting element that consists of a palindrome sequence. An activator of UPR (Hac1) binds to the UPRE which is necessary and sufficient for UPR induction (Mori et al., 1998). For this assay, the UPRE element drives activation of the β-galactosidase gene in response to accumulation of unfolded proteins which allows the indirect measure of the UPR response. We induced the UPR response by using the reducing agent, DTT. Log phase cells were incubated at permissive and non-permissive temperature with or without DTT for 3

145 hours. To measure β-galactosidase activity, we used the Yeast β-galactosidase Assay Kit (Thermo Scientific) as indicated by the manufacturer.

Growth in Inositol Media

Inositol assay media (Difco) lacking or containing inositol (100 µg/ml), was prepared according to manufacturer’s instructions. WT, SPB ts mutants spc110-220, spc42-10, spc42-11, mps2-2, mps3-1, deletion strain ire1∆ (positive control) and ts mutants abf1-102 (negative control) were used for this experiment. Cells were serially diluted and from each dilution, 10 µl of cells were spotted on an appropriate plate and allowed to grow at the designated temperatures: 23⁰C, 34⁰C and 37⁰C.

Results

ER protein kar2 is Mislocalized when the SPB Structure/Function is Altered

Gal-Trm1-II-GFP was mislocalized in SBP defective cells. Our first approach to understand the effect of the SPB in INM targeting was to study the new location of Gal- Trm1-II-GFP. Kar2 was initially employed as an ER marker for the co-localization experiments. However, Kar2 was aberrantly located in the SPB mutant spc110-220 and spc42-10 at non-permissive temperature (Figure 45 and data not shown). Although other ER proteins such as Scs2 and Sec63 were not mislocalized in the SPB ts mutants, they were employed for the co-localization studies. On the other hand, we pursued the altered location of Kar2 as it is an abundant ER protein involved in many important processes. In WT cells, Kar2 locates to the perinuclear ER. In the SPB ts mutants Kar2 was evenly distributed in the cell, in a way that was difficult to view the NE. When we analyzed WT cells arrested with α-factor, we found that Kar2 localization at the NE is not as WT un- treated cells, but rather displays an intermediate phenotype between WT and the SPB ts mutant. The NE was visible, but not well defined by the Kar2 signal. These observations

146 and previous results with Trm1-II led us to hypothesize that perhaps there is a functional connection between SPB and ER homeostasis.

147

148

Figure 45. Kar2 distribution changes when the SPB structure/function is altered. Immunofluorescence of WT, spc110-220 and WT cells arrested α-with factor. Comparing the localization of Kar2 antibody, WT cells show the typical perinuclear localization, while the SPB ts mutant and WT α-factor arrested cells show an evenly distribution that do not permit to distinct the NE. Bar= 1µm 148

Secretion is not altered in all SPB ts mutants

The secretion process is connected to ER homeostasis. We hypothesized that if the secretion pathway is altered in cells with defects in SPB structure/function, we would detect a deficiency in invertase secretion. Therefore, we tested the ability of the SPB ts mutants to secrete invertase in response to glucose starvation. The invertase assay is widely used to determine cell defects in secretion (Ryan and Wente, 2002; Chang et al., 2004). The absorbance at 540nm corresponds to the amount of glucose in solution, which was generated from the hydrolysis of fructose by the secreted invertase. The spc110-220 mutant was defective in invertase secretion when compared to WT (Figure 46). The results were reproducible whether the cells were grown in SC or YEPD media, but the difference between spc110-220 cells at permissive temperature vs. non-permissive was not as the extent of the control ts strain sec7-1, which is known to be defective in secretion (Achstetter et al., 1988). Curiously, in our screen, sec7-1 showed mislocalization of Gal-Trm1-II-GFP. On the other hand, the additional SPB ts mutants tested, mps1-6, mps2-2, mps3-3, spc42-11 and spc110-221, showed no defect in invertase secretion when compared to WT and the positive control (Figure 47). We also used the ts strain abf1-102 as a negative control that is ts but does not affect Gal- Trm1-II-GFP localization. Secretion of this ts strain was unaffected. We concluded that there is no general secretion deficiency in SPB defective cells.

UPR response is not affected in SPB ts mutants

Like secretion, the UPR affects ER homeostasis. When UPR is defective, the ER accumulates unfolded proteins, which causes ER stress. We tested if the SPB ts mutants were able to respond to the accumulation of unfolded proteins by activating UPR. We used a well established β-galactosidase assay to measure the transcriptional activation of the UPRE construct as an indication of the UPR response activation, when cells are treated with the reducing agent DTT. We compared strains with and without DTT at

149

permissive and non-permissive temperature. By this assay, none of the SPB ts mutants were defective in their response when compared to the control strain ire1∆ which is known to have a defective UPR response (Cox et al., 1993; Morl et al., 1993). Their β- galactosidase activity was higher in cells treated with DTT, at both permissive and non- permissive temperature (Figure 48). Under normal conditions (no DTT), cells usually have a basal level of UPR response that does not occur in the ire1∆ mutant, which is completely defective in UPR response. The UPR transcriptional response is higher in the presence of DTT. We observed this response in the SPB ts mutants spc42-10, mps2-2 and mps3-1. Interestingly, we observed that all the SPB ts mutants had very low levels of β-galactosidase activity, compared to WT and the ts strain abf1-102. UPR induction in the presence of DTT occurred, but always at lower levels than WT and the ts strain abf1-102. Moreover, the basal levels of UPR response were extremely low, similar to the levels in the ire1∆ strain. We conclude that SPB defective cells are able to activate the UPR pathway in response to accumulation of unfolded proteins. However, the transcriptional activation of the UPRE element in response to accumulated unfolded proteins seems to be less efficient when compared to the transcriptional activation observed in WT cells.

Growth in Inositol restores growth of some SPB ts mutants at semi-permissive temperature and non-permissive temperature

Lipid biosynthesis occurs at the ER and is important in membrane biogenesis. We tested whether the SPB ts mutants are auxotrophic for inositol. Inositol auxotrophy is used as an indication of the misregulation of genes involved in lipid metabolism. Serially diluted strains of WT, spc110-220, spc42-10, spc42-11, mps2-2, mps3-1, abf1-102 and ire1∆ were spotted on plates with (INO+) or without (INO-) inositol and incubated at 23⁰C, 34⁰C and 37⁰C. ire1∆ strains was used as a control for inositol auxotrophy, and abf1-102 was used as control ts strain that does not affect Gal-Trm1-II-GFP localization. After four days, growth of all strains, including WT cells, was enhanced in the presence of inositol (Figure 49). The control strain ire1∆ was unable to grow in INO- 150

plates at any temperature. The spc110-220 strain was able to grow in all temperatures tested, but this was not a surprising result as growth of this strain is defective at higher temperatures (~39⁰C). According to the growth analysis of the ts strains in the collection by C. Bonne’s laboratory, spc42-10 is temperature sensitive at 30-35⁰C. This strain had no growth in INO- media at 34⁰C, but showed some growth in INO + media at the same temperature and did not grow in any condition at 37⁰C. Temperature sensitivity of strain spc42-11 is at ~35⁰C, but we observed that these cells were able to grow at 37⁰C in INO+ media. Cell growth at non-permissive temperature for strains with ts lesions in the gene that encodes protein Spc42 was restored by adding inositol to the media. We observed that strain mps2-2 was defective at all temperatures in media lacking inositol. Although the mps2-2 strain from Boone’s ts collection was reported to not grow at temperatures above ~35⁰C, we observed previously that this strain was cold sensitive as well. Therefore, mps2-2 growth at 23⁰C was very poor. However, the growth defect of mps2-2 was suppressed by addition of inositol to the media, with the exception of cells grown at 37⁰C. The temperature sensitivity of the strain mps3-1 at 37⁰C was suppressed when cells were growing in INO+ media. Therefore, addition of inositol to the media was able to restore growth at non-permissive temperature for strains with ts lesions in genes that encode SPB proteins of the nuclear membrane (Mps2) and half-bridge (Mps3). Finally, the control strain, abf1-102, which is temperature sensitive at 30-35⁰C, did not show any growth at non-permissive temperature regardless of the presence or absence of inositol in the media. As we observed that the growth defect in the SPB ts strains was partially restored with addition of inositol to the media, we concluded that possibly, alterations in the SPB structure/function may impact lipid dynamics in the cell. The effect could be direct or indirect.

151

0.8

0.7

0.6

0.5

0.4 23 C

Abs Abs at 540 nm 0.3 37⁰C ⁰ 152 0.2

0.1

0 WT spc110-220 mps2-2 mps3-1 sec7-1 abf1-102

Strains

Figure 46. SPB ts mutants have no detectable defect in secretion of invertase. Strains spc110-220, mps2-2 and mps3-1 were tested for their ability to secrete invertase in response to low levels of glucose. Only spc110-220 showed some defect in invertase secretion. Temperature sensitive strain sec7-1 control is defective for secretion. Control strain abf1-102 is a non-SPB ts mutant..

152

0.7

0.6

0.5

0.4

0.3 Abs 540 nmAbs 23 C

0.2 37⁰C 153 ⁰ 0.1

Strains

Figure 47. SPB ts mutants have no detectable defect in secretion of invertase. Strains spc110-221, spc42-11, mps1- 6, mps2-2 and mps3-1 were tested for their ability to secrete invertase in response to low levels of glucose. Temperature sensitive strain sec7-1 control is defective for secretion. Control strain abf1-102 is a non-SPB ts mutant. 153

4000

3500

3000

2500 23 C DTT - 2000 23⁰C DTT+ 1500 37⁰C DTT- galactosidase activity - β

154 37 C DTT+ 1000 ⁰ ⁰ 500

0 WT spc42-10 mps2-2 mps3-1 ire1∆ abf1-102 Strains Figure 48. Basal levels of UPR response are affected in the SPB ts mutants when compared to WT. The β– galactosidase activity unit was defined as OD420/min/ml. Strain ire1∆ is a control defective in UPR induction. Control strain abf1-102 is a non-SPB ts mutant.

154

155

Figure 49. Growth of some SPB ts mutants is improved when inositol is present, at semi-permissive and/or non-permissive temperature. 4 days of growth on medium +/- inositol at 23 C, 34 C and 37 C. ire1∆ is a control for inositol auxotrophy (cells do not survive to the absence of inositol). abf1-102 is a non-SPB ts mutant. SPB ts mutants spc42-11 and mps3-1 temperature sensitivity was partially restored in inositol media. SPB ts mutant⁰ ⁰mps2-2 growth⁰ is improved at semi-permissive temperature.

155

Discussion

The SPB is known to function as a microtubule organizing center (MTOC) in yeast cells. In addition to microtubule nucleation, the SPB functions in microtubule- dependent processes such as chromosome segregation, karyogamy, nuclear positioning and spindle orientation (Byers and Goetsch, 1975; Masson et al., 2002; Melloy et al., 2007; Caydasi et al., 2012) Also, some proteins of the SPB have additional functions (Chial et al., 1998; Witkin et al., 2010; Friederichs et al., 2011). Additional functions of the SPB that are microtubule-independent include the signaling role in the Mitotic Exit Network (MEN) and a role in formation of the prospore wall during meiosis (Knop and Strasser, 2000; Hotz et al., 2012). Our data led to the idea that there may be a role for the SPB in nuclear organization. We hypothesized that the effect of the ts SPB lesions might influence ER homeostasis/membrane biogenesis. Our results showing the effect of defective SPB in INM targeting suggest that there was a change in the membrane system that forms the ER and the NE and, as a consequence, targeting of membrane associated proteins and not soluble nucleoplasmic proteins was altered. Additionally, the localization of the ER luminal protein Kar2 was altered in the SPB ts mutants. Kar2 is an essential protein that is very abundant in the cell and it functions in several cellular processes. One possibility is that Kar2 is re-located from the ER lumen to other subcellular compartments when the SPB structure/function is altered, which would lead to defects in ER homeostasis and, as a consequence, INM targeting is affected. Other studies reported changes in Kar2 distribution in response to ER stress (Nishikawa et al., 1994). Moreover, a recent study shows that availability of Kar2 in the cell can define different types of ER stress (Lajoie et al., 2012). However, we did not find any connection between the change in the distribution of Kar2 in SPB ts mutants and a possible role of the SPB in ER dynamics. Therefore, we tested the SPB ts mutants for different processes that are related to ER dynamics. Among the ER-related processes tested in the SPB ts mutants, no defects were found for invertase secretion and the UPR response. With the exception of spc110-220, SPB ts mutants were able to secrete invertase at levels comparable to WT. The SPB ts

156

mutants tested were able to transcriptionally activate the UPR response at both permissive and non-permissive temperature as judged by the β-galactosidase activity induced upon addition of DTT. However, the levels of activity in all of the ts mutants were always below the levels for WT cells and a control ts mutant, abf1-102. Indeed, basal UPR levels (when no accumulation of unfolded proteins) were as low as ire1∆ in both temperatures. It is unlikely that low basal levels are a consequence of slow growth as the cells were growing similarly to WT at the permissive temperatures and because this deficiency did not occurr in the ts mutant abf1-102, which it is ts at temperatures ~30-35⁰C. The SPB defective cells do not have a defect in ER-related processes such as secretion and UPR response. Lipid biogenesis occurs at the ER, and it is known that defects in lipid content can alter membrane biogenesis. From our data we hypothesized that a change in the membrane system that forms the ER and the NE occurring in SPB defective cells may cause problems in INM targeting. We tested if lipid biosynthesis was affected in the SPB ts mutants. Inositol auxotrophy is indicative of misregulation of INO genes or other genes that are involved in lipid metabolism (Villa-García et al., 2011). Among the five SPB ts mutants tested, four showed some degree of growth enhancement when provided with inositol and, for three, the temperature sensitivity was suppressed at their expected non- permissive temperatures. We also observed an enhancement of WT growth when cells were growing in inositol media, which is expected. However, the WT strain was able to grow at all temperatures regardless of the availability of inositol in the media. This is in contrast to what we observed in the control strain ire1∆ which was able to grow at all temperatures, but only in inositol containing media. Furthermore, the temperature sensitivity of the strain abf1-102 was not suppressed by the presence of inositol in the media. The defect in SPB structure/function could be related to lipid dynamics directly or indirectly. More studies are necessary to understand such a possible connection. Lipid metabolism is extremely complex. A genome-wide study of unessential genes in yeast for inositol auxotrophy revealed more than four hundred genes that, when absent, conferred the Ino- phenotype (Villa-García et al., 2011). Intriguingly, many of the genes found in

157

this study encode proteins involved in lipid metabolism, GPI anchor synthesis/regulation, N-terminal acetylation, secretion and ER-quality control (UPR and ERAD). These are basically the same categories in which we classified the ts mutants identified in our screen for INM localization of Gal-Trm1-II-GFP. If the SPB ts mutants have a defect in lipid metabolism, that could explain our observations concerning Gal-Trm1-II-GFP mislocalization. Perhaps changes in lipid content at the nuclear membrane and the ER are present in the SPB mutants. The intriguing questions are: does the SPB influence this kind of process directly or indirectly? How and why?

158

Chapter 7: General Discussion

Protein sorting is essential for eukaryotic cells as many processes occur in distinct subcellular compartments. Specifically, protein targeting to the INM is of special relevance. It is known that inappropriate location of INM proteins is the cause of various genetic disorders (Worman, 2012). In addition, in eukaryotic cells, including plants, viruses access the nucleus, in part by using the host nuclear targeting system (Alves- Rodrigues et al., 2006; Butterfield-Gerson et al., 2006). Thus, how proteins are targeted to the INM is a fundamental biological question and what we can learn about this process could have a significant impact in life sciences. Two main types of proteins are located at the INM, integral membrane proteins and peripheral membrane proteins. The majority of the previous studies about INM targeting in yeast and higher eukaryotic cells were focused in the targeting mechanism of integral INM proteins (Burns and Wente, 2012). Thus, there is a detailed understanding regarding the diverse mechanisms used by these proteins, although there is still much more to elucidate. On the other hand, the knowledge about INM targeting of peripherally associated proteins is very limited. Previous to the studies described in this dissertation, the general assumption was that their nuclear targeting mechanism is similar to the mechanism utilized by nucleoplasmic soluble proteins. Indeed, studies of peripheral INM proteins of the nuclear lamina, suggests that they follow the soluble transport mechanism (Nigg, 1992). In addition, previous work by our group supported this idea (Lai et al., 2009). In this study, our interest was to understand the INM targeting mechanism used by peripherally associated INM proteins. We utilized budding yeast as a genetic model and galactose-inducible Trm1-II-GFP as a reporter for peripheral INM localization. We employed a genetic approach for our study consisting of a screen of essential yeast genes

159

that when mutated affect Gal-Trm1-II-GFP INM localization. To our knowledge, this is the first time that essential genes were screened to study INM targeting. Our approach revealed many surprising results concerning both INM targeting and the function of essential yeast proteins in this process.

INM Targeting

We uncovered that INM targeting of a peripheral protein Trm1-II, was affected by defects in ER homeostasis. The majority of the mutations affecting the localization of Gal-Trm1-II-GFP were present in genes that encode proteins involved in ER quality control, lipid biogenesis, GPI anchor synthesis/regulation and ER-Golgi trafficking (secretion). In addition, we found a group of mutants that encode genes involved in proteolysis which also participates in ER-related processes. Initially, the discovery of the role of the ER in Trm1-II INM targeting was not surprising as we initially hypothesized that the ER influences INM localization indirectly, by regulating the availability of its INM tether, which perhaps is a lipid, synthesized at the ER. Previous work from our group suggested a possible role of the ER in Trm1-II targeting (Murthi and Hopper, 2005) and were indicative of a role of lipids in INM tethering (Murthi and Díaz, unpublished). Furthermore, recent unpublished work (T.P. Lai) shows that Trm1-II binds lipid in vitro and that the binding motif previously characterized (Lai et al., 2009) appears to be responsible for this interaction. In contrast to integral INM proteins, which are synthesized at the ER, soluble peripheral INM proteins are translated in free polysomes and are thought to be translocated from the cytoplasm to the nucleoplasm through the NPC. Thus, a direct effect of the ER in Trm1-II INM localization cannot be explained by the classical import pathway of soluble proteins which was proposed to govern Trm1-II INM targeting. However, when we analyzed additional strains carrying ts mutations in essential genes, we found evidence that lead us to new ideas about INM targeting of peripherally associated proteins.

160

The most intriguing result was the involvement of the SPB in INM targeting. The majority of the known essential SPB components were represented among the ts mutations that affected the location of Gal-Trm1-II-GFP. Moreover, we found that Gal- Trm1-II-GFP was mislocalized in WT cells arrested with α-factor, where the SPB structure is known to be altered. Our results suggested a possible role of the SPB in INM targeting, directly or indirectly, which constitute the first report of such type of role for the SPB. Therefore, we decided to investigate this possibility in order to learn more about INM targeting. We monitored the dynamics of Gal-Trm1-II-GFP by using the microfluidics system. To our knowledge, this is the first time that this system is utilized to study INM targeting mechanisms. We were able to reproduce our previous results obtained by conventional microscopy methods and to add new valuable information concerning both INM targeting and the role of the SPB. Our group proposed that as part of the targeting mechanism, Trm1-II is translocated to the nucleoplasm before its distribution through the INM in a Ran- dependent manner (Lai et al., 2009). However, by monitoring the dynamics of Gal-Trm1- II-GFP we learned that the protein was accumulated as a spot close to the NE or at the ER in SPB defective cells which was in agreement with our results from the screen and IF analysis. As we had conflicting results on where Gal-Trm1-II-GFP was located before its INM redistribution, two experiments were crucial to elucidate the INM targeting mechanism for Gal-Trm1-II-GFP. First, when we monitored Gal-Trm1-II-GFP in WT cells arrested with α-factor, the protein accumulated as a spot, and it was re-distributed to the NE when cells were released from the arrest, regardless of their initial location (close to the NE or the cortical ER). This result indicates that Gal-Trm1-II-GFP was at the ER/ONM before its translocation to the INM. Second, when we monitored the dynamics of a point mutant version of Gal-Trm1-II-GFP which lacks its ability to bind to the INM, the protein was nucleoplasmic in both, WT and the SPB ts mutant. This result suggests that the SPB affects INM targeting of Gal-Trm1-II-GFP only if the protein is capable to bind its membrane tether and that the protein lacking binding ability, access the nuclear interior regardless of the SPB defect. Therefore, the nucleoplasmic phenotype was a

161 consequence of the inability of Trm1-II to bind its tether and occurred because the protein was imported using the classical import pathway for soluble nucleoplasmic proteins. The results led us to revise the current model for Trm1-II INM targeting and to propose a novel mechanism for targeting of a peripheral protein to the INM (Figure 50). (1) Trm1-II is translated on free polysomes, (2) In a Ran-dependent manner via the NLS, Trm1-II is directed to the NE, where it contact its initial tether at the ER/ONM. (3) Translocation occurs by assistance of the importin complex while Trm1-II remains attached to the membrane. (4) After translocation to the INM, Trm1-II is evenly distributed throughout the INM. Alternatively, when Trm1-II is unable to bind its membrane tether, it follows the classical import pathway as the protein is already bound to the importin complex. The protein remains located at the nucleoplasm (Figure 51). The evidence presented suggests that the INM targeting mechanism for Trm1-II is more similar to the Ran-dependent targeting mechanism of an INM integral protein described in yeast (King et al., 2006). In support of this idea, both INM proteins Gal- Trm1-II-GFP (peripheral) and Gal-Heh2-GFP (integral), but not Gal-Pus1-GFP (nucleoplasmic), were affected by the SPB defect. The two INM proteins we analyzed may share some features of their targeting process, but we do not predict that their mechanisms are identical. There are key differences between Trm1-II and Heh2. Their translation is taught to occur in distinct places (cytoplasm vs. ER) which imply that in contrast to Heh2, Trm1-II is recognized by the import complex before it associates to the ER/ONM. In WT cells, there is likely a small pool of Trm1-II in the nucleoplasm as we hypothesize that there is always some protein accessing the nucleoplasm by following the classical import pathway. However, we propose that most of the protein is in contact with the ER/ONM in order to maintain membrane binding. Additionally, INM tethering for Trm1-II is different from Heh2 tethering as it depends on distinct interaction motifs (lipid modifications/protein interactions vs. transmembrane domain). When Trm1-II targeting to the INM is prevented it accumulates as a discrete spot(s) that sometimes is far from the NE. In contrast, when Heh2 INM targeting is prevented, it accumulates throughout the ER in a characteristic pattern of ER proteins (this work and (King et al., 2006)). It is

162 possible that the Trm1-II spots are located in a cluster corresponding to specific lipids (or lipid-protein complex) to which Trm1-II binds, and that distribution of the clusters is different when the SPB and the ER are defective. The description of nuclear lipid microdomains and their possible function in nuclear regulation, was reported in rat hepatoma cells (Cascianelli et al., 2008). This type of analysis is more difficult to achieve in yeast cells, but the spatial organization of lipid synthesis in yeast was analyzed by high resolution microscopy (Natter et al., 2005). Different lipid requirements or preferences could explain why there is always a pool of Heh2 protein at the INM regardless of the targeting defect as judge by what we (this work) and others observed (King et al., 2006) Our evidence also suggests that the ER effect on INM targeting, could be direct as the ER is the initial tethering site before translocation to the INM, but it could have an additional indirect impact as the ER is the site for lipid and integral proteins biosynthesis. Trm1-II tether is likely a lipid, but we cannot rule out the possibility that interactions with other INM proteins stabilize Trm1-II association with the INM. Other INM proteins have complex mechanisms by which they interact with multiple partners and are often dependent on various posttranslational modifications (Kitten and Nigg, 1991; Clements et al., 2000; Ohba et al., 2004; Tapley et al., 2011). The possibility of multiple effects of the ER (directly or indirectly) on INM targeting could explain why the majority of the ts mutations affecting Trm1-II INM localization where present in genes that encode ER processes. There is still more information to elucidate about Trm1-II INM targeting. For example, our group reported that in a ts Ran mutant (rna1-1), Trm1-II is cytoplasmic (Lai et al., 2009), but we do not know whether some protein is located at the ER when the Ran pathway is interrupted as occur for Heh2 (King et al., 2006). Supported by preliminary observations and published data (Lai et al., 2009), we hypothesize that the steps including importin recognition, targeting to the ER/ONM and translocation through the NPC are Ran-dependent, but that Trm1-II maintenance at the INM is not. However, it is necessary to study these steps in more detail to determine the different requirements.

163

Our contribution adds new insights into an essential biological process, targeting to the INM. In particular, our new working model for INM targeting of peripherally associated proteins, changes the perception of how they are directed to their final destination and suggests that they might have diverse and more complex mechanisms than what was predicted. This possibility opens this field to new ideas and more interesting questions to elucidate. It will be interesting to study other INM peripheral proteins in yeast and higher eukaryotes in order to determine whether they follow a similar mechanism to Trm1-II and if this mechanism occurs only in cells that undergoes close mitosis, like yeast.

164

Figure 50. New model for INM targeting of peripherally associated protein Trm1-II. (1) Trm1-II is translated in free polysomes, (2) in a Ran-dependent manner via the NLS (Kap in yellow), Trm1-II is directed to the NE, where it is in contact with its initial tether at the ER/ONM. (3) translocation occurs by assistance of the importin complex while Trm1-II remains attached to the membrane. (4) After translocation to the INM, Trm1-II is released from the importin complex and evenly distributed. Diagram by Greetchen Díaz.

165

Figure 51. Alternative import mechanism for Trm1-II. When Trm1-II is unable to bind its membrane tether, it follows the classical import pathway as the protein is already bound to the karyopherin complex. Then, the protein remains located at the nucleoplasm. Diagram by Greetchen Díaz.

166

The Possible Role of the SPB in INM Targeting

Our studies of Gal-Trm1-II-GFP dynamics also shed some light about the mechanism by which the SPB affects INM targeting. We learned that the defect at the SPB was preventing INM targeting as Gal-Trm1-II-GFP was unable to spread through the INM in SPB defective cells and remained located at its initial tethering site. The defect of INM targeting in the SPB ts mutants was not caused by a general transport defect as the mutant version of Gal-Trm1-II-GFP that follows the classical import pathway was imported into the nucleus like in WT cells. Moreover, a soluble nucleoplasmic protein Gal-Pus1-GFP was also efficiently transported into nucleus in both, WT cells and the SPB ts mutant. As suggested above, it is possible that in the SPB defective cells, the lipid organization at the membrane system that forms the ER and the NE is different enough to cause defects in INM targeting. The extent to which the INM targeting would be affected might be depending on the nature of the lipid interactions of the different INM proteins. Not only INM targeting was prevented in SPB defective cells. We observed that if Gal-Trm1-II-GFP was located at the INM before the SPB was defective, the protein collapses to a single region of the INM, indicating that the SPB is important for INM maintenance, in contrast to the Ran pathway which is not necessary (Lai et al., 2009). We hypothesize that the defect in INM targeting and INM maintenance are caused by the same membrane defect in SPB defective cells and that mislocalization of Gal-Trm1-II- GFP depends on where the protein was initially located (ER/ONM vs INM) when the SPB defect occurs. Our work suggests the possibility of an indirect role of the SPB in INM targeting. In addition, as we know that other mutations in essential genes that encode proteins involved in ER-Golgi related processes affect Trm1-II INM location and that Trm1-II may be a lipid binding protein (T.P. Lai, unpublished), we hypothesized that perhaps the SPB influences ER/NE membrane dynamics. In agreement with this idea, preliminary observations indicate that it is possible that SBP and lipids dynamics are connected. However, more studies are necessary to confirm such connections. Previous work 167

indicates that the SPB protein Mps3 is involved in NE homeostasis in addition to its role in SPB duplication (Friederichs et al., 2011). They observed that in cells over expressing Mps3 mutant protein, the NE and not the ER, was expanded. The alteration of the membrane affected SPB insertion and changes in lipid composition suppressed the SPB insertion. They suggested that over expression of the mutant Mps3 protein titrates out important factors that are necessary for NE homeostasis and SPB insertion. Our work suggests a more broad effect of the SPB in NE homeostasis that is not restricted to Mps3 and its role in SPB insertion. Rather, the effect of the SPB seems to occur with alterations at all levels of the structure/function and is able to affect targeting of INM proteins. We suggest that as a consequence of some kind of signaling event in SPB defective cells, the membrane composition is altered (Figure 52). However, in order to understand the possible effect of the SPB in membrane dynamics it will be necessary to perform further analysis that may include the study of lipid profiles in SPB defective cells.

Final Remarks

The genetic approach used in this study to learn about INM targeting of peripherally associated proteins was very powerful in identifying the key players in this process. The group of mutations that we found affecting Trm1-II INM localization was not random. Rather, they belong to particular processes and structures that impact INM targeting and membrane homeostasis. After an exhausted analysis of the localization and dynamics of nuclear proteins, we elucidated a new mechanism for targeting peripherally associated proteins to the INM. We uncovered that INM targeting of peripherally associated proteins could be more complex than what was envisioned. Moreover, we were able to uncover a possible new function of the SPB which change our perspective about this structure. Thus, our contribution has implications in both membrane biology and protein sorting which are of great relevance in life sciences.

168

Figure 52. Model for the indirect role of the SPB in INM targeting. A. Trm1-II (green) is evenly distributed throughout the INM after its translocation through the NPC, from the initial tethering site at the ER/ONM (red). Trm1-II tether (blue) is present at the ER/ONM and the INM, but Trm1-II is retained at the INM as it lacks a nuclear export signal (NES) necessary for nuclear export. B. Changes in the SPB structure/function is detected by the NE, perhaps by a signaling pathway. Trm1-II tether distribution at the NE is altered as a consequence of the SPB defect. C(1). Trm1-II “collapses” to a single region of the INM. C(2). INM targeting of newly synthesized Trm1-II is prevented. C(3). If the newly synthesized Trm1-II loss the ability to bind to the NE, it follows the classical import pathway as soluble nucleoplasmic proteins and its import is not affected by the SPB defect. Diagram by Greetchen Díaz.

169

1 7 0

170

References

Achstetter, T., A. Franzusoff, C. Field and R. Schekman (1988). "SEC7 encodes an unusual, high molecular weight protein required for membrane traffic from the yeast Golgi apparatus." Journal of Biological Chemistry 263(24): 11711-11717.

Adams, I. R. and J. V. Kilmartin (1999). "Localization of Core Spindle Pole Body (SPB) Components during SPB Duplication in Saccharomyces cerevisiae." The Journal of Cell Biology 145(4): 809-823.

Aebi, M. and T. Hennet (2001). "Congenital disorders of glycosylation: genetic model systems lead the way." Trends in Cell Biology 11(3): 136-141.

Ahmed, S. and J. H. Brickner (2007). "Regulation and epigenetic control of transcription at the nuclear periphery." Trends in Genetics 23(8): 396-402.

Aitchison, J. D. and M. P. Rout (2012). "The Yeast Nuclear Pore Complex and Transport Through It." Genetics 190(3): 855-883.

Alves-Rodrigues, I., R. P. Galão, A. Meyerhans and J. Díez (2006). "Saccharomyces cerevisiae: A useful model host to study fundamental biology of viral replication." Virus Research 120(1–2): 49-56.

Andersen, J. S., Y. W. Lam, A. K. L. Leung, S.-E. Ong, C. E. Lyon, A. I. Lamond and M. Mann (2005). "Nucleolar proteome dynamics." Nature 433(7021): 77-83.

Andrulis, E. D., D. C. Zappulla, A. Ansari, S. Perrod, C. V. Laiosa, M. R. Gartenberg and R. Sternglanz (2002). "Esc1, a Nuclear Periphery Protein Required for Sir4-Based Plasmid Anchoring and Partitioning." Molecular and Cellular Biology 22(23): 8292-8301.

Araki, Y., C. K. Lau, H. Maekawa, S. L. Jaspersen, T. H. Giddings, E. Schiebel and M. Winey (2006). "The Saccharomyces cerevisiae Spindle Pole Body (SPB) Component Nbp1p Is Required for SPB Membrane Insertion and Interacts with the Integral Membrane Proteins Ndc1p and Mps2p." Molecular Biology of the Cell 17(4): 1959-1970.

Aris, J. P. and G. Blobel (1988). "Identification and characterization of a yeast nucleolar protein that is similar to a rat liver nucleolar protein." The Journal of Cell Biology 107(1): 17-31.

Arnesen, T. (2011). "Towards a Functional Understanding of Protein N-Terminal Acetylation." PLoS Biol 9(5): e1001074. 171

Becker, T., S. Bhushan, A. Jarasch, J.-P. Armache, S. Funes, F. Jossinet, J. Gumbart, T. Mielke, O. Berninghausen, K. Schulten, E. Westhof, R. Gilmore, E. C. Mandon and R. Beckmann (2009). "Structure of Monomeric Yeast and Mammalian Sec61 Complexes Interacting with the Translating Ribosome." Science 326(5958): 1369-1373.

Beckmann, R., D. Bubeck, R. Grassucci, P. Penczek, A. Verschoor, G. Blobel and J. Frank (1997). "Alignment of Conduits for the Nascent Polypeptide Chain in the Ribosome- Sec61 Complex." Science 278(5346): 2123-2126.

Bednarek, S. Y., M. Ravazzola, M. Hosobuchi, M. Amherdt, A. Perrelet, R. Schekman and L. Orci (1995). "COPI- and COPII-coated vesicles bud directly from the endoplasmic reticulum in yeast." Cell 83(7): 1183-1196.

Behnia, R., F. A. Barr, J. J. Flanagan, C. Barlowe and S. Munro (2007). "The yeast orthologue of GRASP65 forms a complex with a coiled-coil protein that contributes to ER to Golgi traffic." The Journal of Cell Biology 176(3): 255-261.

Behnia, R., B. Panic, J. R. C. Whyte and S. Munro (2004). "Targeting of the Arf-like GTPase Arl3p to the Golgi requires N-terminal acetylation and the membrane protein Sys1p." Nat Cell Biol 6(5): 405-413.

Bergès, T., D. Guyonnet and F. Karst (1997). "The Saccharomyces cerevisiae mevalonate diphosphate decarboxylase is essential for viability, and a single Leu-to-Pro mutation in a conserved sequence leads to thermosensitivity." Journal of Bacteriology 179(15): 4664- 4670.

Bione, S., E. Maestrini, S. Rivella, M. Mancini, S. Regis, G. Romeo and D. Toniolo (1994). "Identification of a novel X-linked gene responsible for Emery-Dreifuss muscular dystrophy." Nat Genet 8(4): 323-327.

Boban, M., A. Zargari, C. Andréasson, S. Heessen, J. Thyberg and P. O. Ljungdahl (2006). "Asi1 is an inner nuclear membrane protein that restricts promoter access of two latent transcription factors." The Journal of Cell Biology 173(5): 695-707.

Böhni, P. C., R. J. Deshaies and R. W. Schekman (1988). "SEC11 is required for signal peptide processing and yeast cell growth." The Journal of Cell Biology 106(4): 1035-1042.

Bolte, S., C. Talbot, Y. Boutte, O. Catrice, N. D. Read and B. Satiat-Jeunemaitre (2004). "FM- dyes as experimental probes for dissecting vesicle trafficking in living plant cells." Journal of Microscopy 214(2): 159-173.

172

Braunagel, S. C., S. T. Williamson, S. Saksena, Z. Zhong, W. K. Russell, D. H. Russell and M. D. Summers (2004). "Trafficking of ODV-E66 is mediated via a sorting motif and other viral proteins: Facilitated trafficking to the inner nuclear membrane." Proceedings of the National Academy of Sciences of the United States of America 101(22): 8372-8377.

Brizzio, V., W. Khalfan, D. Huddler, C. T. Beh, S. S. L. Andersen, M. Latterich and M. D. Rose (1999). "Genetic Interactions between KAR7/SEC71,KAR8/JEM1, KAR5, and KAR2 during Nuclear Fusion in Saccharomyces cerevisiae." Molecular Biology of the Cell 10(3): 609-626.

Brough, D., F. Bhatti and R. F. Irvine (2005). "Mobility of proteins associated with the plasma membrane by interaction with inositol lipids." Journal of Cell Science 118(14): 3019- 3025.

Bullitt, E., M. P. Rout, J. V. Kilmartin and C. W. Akey (1997). "The Yeast Spindle Pole Body Is Assembled around a Central Crystal of Spc42p." Cell 89(7): 1077-1086.

Burns, L. T. and S. R. Wente (2012). "Trafficking to uncharted territory of the nuclear envelope." Current Opinion in Cell Biology 24(3): 341-349.

Butterfield-Gerson, K. L., L. Z. Scheifele, E. P. Ryan, A. K. Hopper and L. J. Parent (2006). "Importin-β Family Members Mediate Alpharetrovirus Gag Nuclear Entry via Interactions with Matrix and Nucleocapsid." Journal of Virology 80(4): 1798-1806.

Byers, B. and L. Goetsch (1975). "Behavior of spindles and spindle plaques in the cell cycle and conjugation of Saccharomyces cerevisiae." Journal of Bacteriology 124(1): 511-523.

Campbell, J. L., A. Lorenz, K. L. Witkin, T. Hays, J. Loidl and O. Cohen-Fix (2006). "Yeast Nuclear Envelope Subdomains with Distinct Abilities to Resist Membrane Expansion." Molecular Biology of the Cell 17(4): 1768-1778.

Cardoso, M. C., K. Schneider, R. M. Martin and H. Leonhardt (2012). "Structure, function and dynamics of nuclear subcompartments." Current Opinion in Cell Biology 24(1): 79-85.

Cascianelli, G., M. Villani, M. Tosti, F. Marini, E. Bartoccini, M. Viola Magni and E. Albi (2008). "Lipid Microdomains in Cell Nucleus." Molecular Biology of the Cell 19(12): 5289-5295.

Castillo, A. R., J. B. Meehl, G. Morgan, A. Schutz-Geschwender and M. Winey (2002). "The yeast protein kinase Mps1p is required for assembly of the integral spindle pole body component Spc42p." The Journal of Cell Biology 156(3): 453-465. 173

Caydasi, A. K., M. Lohel, G. Grunert, P. Dittrich, G. Pereira and B. Ibrahim (2012). "A dynamical model of the spindle position checkpoint." Mol Syst Biol 8.

Chahine, M. N. and G. N. Pierce (2009). "Therapeutic Targeting of Nuclear Protein Import in Pathological Cell Conditions." Pharmacological Reviews 61(3): 358-372.

Chang, H. J., S. A. Jesch, M. L. Gaspar and S. A. Henry (2004). "Role of the Unfolded Protein Response Pathway in Secretory Stress and Regulation of INO1 Expression in Saccharomyces cerevisiae." Genetics 168(4): 1899-1913.

Chang, H. J., E. W. Jones and S. A. Henry (2002). "Role of the Unfolded Protein Response Pathway in Regulation of INO1 and in the sec14 Bypass Mechanism in Saccharomyces cerevisiae." Genetics 162(1): 29-43.

Chen, X. P., H. Yin and T. C. Huffaker (1998). "The Yeast Spindle Pole Body Component Spc72p Interacts with Stu2p and Is Required for Proper Microtubule Assembly." The Journal of Cell Biology 141(5): 1169-1179.

Cheng, Z., Y. Jiang, E. C. Mandon and R. Gilmore (2005). "Identification of cytoplasmic residues of Sec61p involved in ribosome binding and cotranslational translocation." The Journal of Cell Biology 168(1): 67-77.

Chial, H. J., M. P. Rout, T. H. Giddings and M. Winey (1998). "Saccharomyces cerevisiae Ndc1p Is a Shared Component of Nuclear Pore Complexes and Spindle Pole Bodies." The Journal of Cell Biology 143(7): 1789-1800.

Cingolani, G., C. Petosa, K. Weis and C. W. Muller (1999). "Structure of importin-[beta] bound to the IBB domain of importin-[alpha]." Nature 399(6733): 221-229.

Clements, L., S. Manilal, D. R. Love and G. E. Morris (2000). "Direct Interaction between Emerin and Lamin A." Biochemical and Biophysical Research Communications 267(3): 709-714.

Coffinier, C., H.-J. Jung, C. Nobumori, S. Chang, Y. Tu, R. H. Barnes, Y. Yoshinaga, P. J. de Jong, L. Vergnes, K. Reue, L. G. Fong and S. G. Young (2011). "Deficiencies in lamin B1 and lamin B2 cause neurodevelopmental defects and distinct nuclear shape abnormalities in neurons." Molecular Biology of the Cell 22(23): 4683-4693.

Conti, E., M. Uy, L. Leighton, G. Blobel and J. Kuriyan (1998). "Crystallographic Analysis of the Recognition of a Nuclear Localization Signal by the Nuclear Import Factor Karyopherin ±." Cell 94(2): 193-204. 174

Cook, A. G. and E. Conti (2010). "Nuclear export complexes in the frame." Current Opinion in Structural Biology 20(2): 247-252.

Cox, J. S., C. E. Shamu and P. Walter (1993). "Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase." Cell 73(6): 1197-1206.

Créancier, L., H. Prats, C. Zanibellato, F. Amalric and B. Bugler (1993). "Determination of the functional domains involved in nucleolar targeting of nucleolin." Molecular Biology of the Cell 4(12): 1239-1250.

Cribb, A. E., M. Peyrou, S. Muruganandan and L. Schneider (2005). "The Endoplasmic Reticulum in Xenobiotic Toxicity." Drug Metabolism Reviews 37(3): 405-442.

Dawaliby, R. and A. Mayer (2010). "Microautophagy of the Nucleus Coincides with a Vacuolar Diffusion Barrier at Nuclear–Vacuolar Junctions." Molecular Biology of the Cell 21(23): 4173-4183. de Martin, P. E., Y. Du, P. Novick and S. Ferro-Novick (2005). "Ice2p is important for the distribution and structure of the cortical ER network in Saccharomyces cerevisiae." Journal of Cell Science 118(1): 65-77.

DeGrasse, J. A., K. N. DuBois, D. Devos, T. N. Siegel, A. Sali, M. C. Field, M. P. Rout and B. T. Chait (2009). "Evidence for a Shared Nuclear Pore Complex Architecture That Is Conserved from the Last Common Eukaryotic Ancestor." Molecular & Cellular Proteomics 8(9): 2119-2130.

Deng, M. and M. Hochstrasser (2006). "Spatially regulated ubiquitin ligation by an ER/nuclear membrane ligase." Nature 443(7113): 827-831.

Denning, D. P., S. S. Patel, V. Uversky, A. L. Fink and M. Rexach (2003). "Disorder in the nuclear pore complex: The FG repeat regions of nucleoporins are natively unfolded." Proceedings of the National Academy of Sciences 100(5): 2450-2455.

Deshaies, R. J., S. L. Sanders, D. A. Feldheim and R. Schekman (1991). "Assembly of yeast Sec proteins involved in translocation into the endoplasmic reticulum into a membrane-bound multisubunit complex." Nature 349(6312): 806-808.

Devos, D., S. Dokudovskaya, F. Alber, R. Williams, B. T. Chait, A. Sali and M. P. Rout (2004). "Components of Coated Vesicles and Nuclear Pore Complexes Share a Common Molecular Architecture." PLoS Biol 2(12): e380. 175

Devos, D., S. Dokudovskaya, R. Williams, F. Alber, N. Eswar, B. T. Chait, M. P. Rout and A. Sali (2006). "Simple fold composition and modular architecture of the nuclear pore complex." Proceedings of the National Academy of Sciences of the United States of America 103(7): 2172-2177.

Doucet, C. and M. Hetzer (2010). "Nuclear pore biogenesis into an intact nuclear envelope." Chromosoma 119(5): 469-477.

Drin, G., J.-F. Casella, R. Gautier, T. Boehmer, T. U. Schwartz and B. Antonny (2007). "A general amphipathic [alpha]-helical motif for sensing membrane curvature." Nat Struct Mol Biol 14(2): 138-146.

Duronio, R. J., D. A. Rudnick, R. L. Johnson, D. R. Johnson and J. I. Gordon (1991). "Myristic acid auxotrophy caused by mutation of S. cerevisiae myristoyl-CoA:protein N- myristoyltransferase." The Journal of Cell Biology 113(6): 1313-1330.

Egea, P. F., R. M. Stroud and P. Walter (2005). "Targeting proteins to membranes: structure of the signal recognition particle." Current Opinion in Structural Biology 15(2): 213-220.

Eisenhaber, B., G. Schneider, M. Wildpaner and F. Eisenhaber (2004). "A Sensitive Predictor for Potential GPI Lipid Modification Sites in Fungal Protein Sequences and its Application to Genome-wide Studies for Aspergillus nidulans, Candida albicans Neurospora crassa, Saccharomyces cerevisiae and Schizosaccharomyces pombe." Journal of Molecular Biology 337(2): 243-253.

Eisenhaber, F., B. Eisenhaber, W. Kubina, S. Maurer-Stroh, G. Neuberger, G. Schneider and M. Wildpaner (2003). "Prediction of lipid posttranslational modifications and localization signals from protein sequences: big-Π, NMT and PTS1." Nucleic Acids Research 31(13): 3631-3634.

Ellis, S. R., M. J. Morales, J. M. Li, A. K. Hopper and N. C. Martin (1986). "Isolation and characterization of the TRM1 locus, a gene essential for the N2,N2-dimethylguanosine modification of both mitochondrial and cytoplasmic tRNA in Saccharomyces cerevisiae." Journal of Biological Chemistry 261(21): 9703-9709.

Emmott, E. and J. A. Hiscox (2009). "Nucleolar targeting: the hub of the matter." EMBO Rep 10(3): 231-238.

English, A. R., N. Zurek and G. K. Voeltz (2009). "Peripheral ER structure and function." Current Opinion in Cell Biology 21(4): 596-602.

176

Etcheverry, T., D. Colby and C. Guthrie (1979). "A precursor to a minor species of yeast tRNASer contains an intervening sequence." Cell 18(1): 11-26.

Fernandez-Martinez, J. and M. P. Rout (2012). "A jumbo problem: mapping the structure and functions of the nuclear pore complex." Current Opinion in Cell Biology 24(1): 92-99.

Field, M. C. and J. B. Dacks (2009). "First and last ancestors: reconstructing evolution of the endomembrane system with ESCRTs, vesicle coat proteins, and nuclear pore complexes." Current Opinion in Cell Biology 21(1): 4-13.

Friederichs, J. M., S. Ghosh, C. J. Smoyer, S. McCroskey, B. D. Miller, K. J. Weaver, K. M. Delventhal, J. Unruh, B. D. Slaughter and S. L. Jaspersen (2011). "The SUN Protein Mps3 Is Required for Spindle Pole Body Insertion into the Nuclear Membrane and Nuclear Envelope Homeostasis." PLoS Genet 7(11): e1002365.

Friedman, D. B., J. W. Kern, B. J. Huneycutt, D. B. N. Vinh, D. K. Crawford, E. Steiner, D. Scheiltz, J. Yates, K. A. Resing, N. G. Ahn, M. Winey and T. N. Davis (2001). "Yeast Mps1p Phosphorylates the Spindle Pole Component Spc110p in the N-terminal Domain." Journal of Biological Chemistry 276(21): 17958-17967.

Gable, K., G. Han, E. Monaghan, D. Bacikova, M. Natarajan, R. Williams and T. M. Dunn (2002). "Mutations in the Yeast LCB1 and LCB2Genes, Including Those Corresponding to the Hereditary Sensory Neuropathy Type I Mutations, Dominantly Inactivate Serine Palmitoyltransferase." Journal of Biological Chemistry 277(12): 10194-10200.

Galcheva-Gargova, Z., L. Gangwani, K. N. Konstantinov, M. Mikrut, S. J. Theroux, T. Enoch and R. J. Davis (1998). "The Cytoplasmic Zinc Finger Protein ZPR1 Accumulates in the Nucleolus of Proliferating Cells." Molecular Biology of the Cell 9(10): 2963-2971.

Gardner, J. M., C. J. Smoyer, E. S. Stensrud, R. Alexander, M. Gogol, W. Wiegraebe and S. L. Jaspersen (2011). "Targeting of the SUN protein Mps3 to the inner nuclear membrane by the histone variant H2A.Z." The Journal of Cell Biology 193(3): 489-507.

Gelperin, D. M., M. A. White, M. L. Wilkinson, Y. Kon, L. A. Kung, K. J. Wise, N. Lopez- Hoyo, L. Jiang, S. Piccirillo, H. Yu, M. Gerstein, M. E. Dumont, E. M. Phizicky, M. Snyder and E. J. Grayhack (2005). "Biochemical and genetic analysis of the yeast proteome with a movable ORF collection." Genes & Development 19(23): 2816-2826.

Giaever, G., A. M. Chu, L. Ni, C. Connelly, L. Riles, S. Veronneau, S. Dow, A. Lucau-Danila, K. Anderson, B. Andre, A. P. Arkin, A. Astromoff, M. El Bakkoury, R. Bangham, R. Benito, S. Brachat, S. Campanaro, M. Curtiss, K. Davis, A. Deutschbauer, K.-D. Entian, 177

P. Flaherty, F. Foury, D. J. Garfinkel, M. Gerstein, D. Gotte, U. Guldener, J. H. Hegemann, S. Hempel, Z. Herman, D. F. Jaramillo, D. E. Kelly, S. L. Kelly, P. Kotter, D. LaBonte, D. C. Lamb, N. Lan, H. Liang, H. Liao, L. Liu, C. Luo, M. Lussier, R. Mao, P. Menard, S. L. Ooi, J. L. Revuelta, C. J. Roberts, M. Rose, P. Ross-Macdonald, B. Scherens, G. Schimmack, B. Shafer, D. D. Shoemaker, S. Sookhai-Mahadeo, R. K. Storms, J. N. Strathern, G. Valle, M. Voet, G. Volckaert, C.-y. Wang, T. R. Ward, J. Wilhelmy, E. A. Winzeler, Y. Yang, G. Yen, E. Youngman, K. Yu, H. Bussey, J. D. Boeke, M. Snyder, P. Philippsen, R. W. Davis and M. Johnston (2002). "Functional profiling of the Saccharomyces cerevisiae genome." Nature 418(6896): 387-391.

Goldstein, A. and J. Lampen (1975). [76] β-d-Fructofuranoside fructohydrolase from yeast. Methods in Enzymology. W. A. Wood, Academic Press. Volume 42: 504-511.

Gonzalez, Y., A. Saito and S. Sazer (2012). "Fission yeast Lem2 and Man1 perform fundamental functions of the animal cell nuclear lamina." Nucleus 3(1): 60-76.

Grosshans, H., F. Lecointe, H. Grosjean, E. Hurt and G. Simos (2001). "Pus1p-dependent tRNA Pseudouridinylation Becomes Essential When tRNA Biogenesis Is Compromised in Yeast." Journal of Biological Chemistry 276(49): 46333-46339.

Halic, M. and R. Beckmann (2005). "The signal recognition particle and its interactions during protein targeting." Current Opinion in Structural Biology 15(1): 116-125.

Han, S., M. A. Lone, R. Schneiter and A. Chang (2010). "Orm1 and Orm2 are conserved endoplasmic reticulum membrane proteins regulating lipid homeostasis and protein quality control." Proceedings of the National Academy of Sciences 107(13): 5851-5856.

Hattier, T., E. Andrulis and A. Tartakoff (2007). "Immobility, inheritance and plasticity of shape of the yeast nucleus." BMC Cell Biology 8(1): 47.

Henríquez, R., G. Blobel and J. P. Aris (1990). "Isolation and sequencing of NOP1. A yeast gene encoding a nucleolar protein homologous to a human autoimmune antigen." Journal of Biological Chemistry 265(4): 2209-2215.

Hereford, L., K. Fahrner, J. Woolford Jr, M. Rosbash and D. B. Kaback (1979). "Isolation of yeast histone genes H2A and H2B." Cell 18(4): 1261-1271.

Hofemeister, H., K. Weber and R. Stick (2000). "Association of Prenylated Proteins with the Plasma Membrane and the Inner Nuclear Membrane Is Mediated by the Same Membrane-targeting Motifs." Molecular Biology of the Cell 11(9): 3233-3246.

178

Holtz, D., R. A. Tanaka, J. Hartwig and F. McKeon (1989). "The CaaX motif of lamin A functions in conjunction with the nuclear localization signal to target assembly to the nuclear envelope." Cell 59(6): 969-977.

Hotz, M., C. Leisner, D. Chen, C. Manatschal, T. Wegleiter, J. Ouellet, D. Lindstrom, Dan E. Gottschling, J. Vogel and Y. Barral (2012). "Spindle Pole Bodies Exploit the Mitotic Exit Network in Metaphase to Drive Their Age-Dependent Segregation." Cell 148(5): 958- 972.

Hsu, C.-L., R. Prasad, C. Blackman and D. T. W. Ng (2012). "Endoplasmic reticulum stress regulation of the Kar2p/BiP chaperone alleviates proteotoxicity via dual degradation pathways." Molecular Biology of the Cell 23(4): 630-641.

Hu, B., C. Liao, S. H. Millson, M. Mollapour, C. Prodromou, L. H. Pearl, P. W. Piper and B. Panaretou (2005). "Qri2/Nse4, a component of the essential Smc5/6 DNA repair complex." Molecular Microbiology 55(6): 1735-1750.

Hughes, T. R., M. J. Marton, A. R. Jones, C. J. Roberts, R. Stoughton, C. D. Armour, H. A. Bennett, E. Coffey, H. Dai, Y. D. He, M. J. Kidd, A. M. King, M. R. Meyer, D. Slade, P. Y. Lum, S. B. Stepaniants, D. D. Shoemaker, D. Gachotte, K. Chakraburtty, J. Simon, M. Bard and S. H. Friend (2000). "Functional Discovery via a Compendium of Expression Profiles." Cell 102(1): 109-126.

Huisman, S. M., M. F. M. A. Smeets and M. Segal (2007). "Phosphorylation of Spc110p by Cdc28p-Clb5p kinase contributes to correct spindle morphogenesis in S. cerevisiae." Journal of Cell Science 120(3): 435-446.

Ito, H., Y. Fukuda, K. Murata and A. Kimura (1983). "Transformation of intact yeast cells treated with alkali cations." Journal of Bacteriology 153(1): 163-168.

Izaurralde, E., U. Kutay, C. von Kobbe, I. W. Mattaj and D. Gorlich (1997). "The asymmetric distribution of the constituents of the Ran system is essential for transport into and out of the nucleus." EMBO J 16(21): 6535-6547.

Jaspersen, S. L., B. J. Huneycutt, T. H. Giddings, K. A. Resing, N. G. Ahn and M. Winey (2004). "Cdc28/Cdk1 Regulates Spindle Pole Body Duplication through Phosphorylation of Spc42 and Mps1." Developmental cell 7(2): 263-274.

Jaspersen, S. L. and M. Winey (2004). "The Budding Yeast Spindle Pole Body: Structure, Duplication, and Function." Annual Review of Cell and Developmental Biology 20(1): 1- 28. 179

Jesch, S. A., P. Liu, X. Zhao, M. T. Wells and S. A. Henry (2006). "Multiple Endoplasmic Reticulum-to-Nucleus Signaling Pathways Coordinate Phospholipid Metabolism with Gene Expression by Distinct Mechanisms." Journal of Biological Chemistry 281(33): 24070-24083.

Kabani, M., S. S. Kelley, M. W. Morrow, D. L. Montgomery, R. Sivendran, M. D. Rose, L. M. Gierasch and J. L. Brodsky (2003). "Dependence of Endoplasmic Reticulum-associated Degradation on the Peptide Binding Domain and Concentration of BiP." Molecular Biology of the Cell 14(8): 3437-3448.

Kagiwada, S. and M. Hashimoto (2007). "The yeast VAP homolog Scs2p has a phosphoinositide-binding ability that is correlated with its activity." Biochemical and Biophysical Research Communications 364(4): 870-876.

Kapon, R., B. Naim, D. Zbaida, R. Nevo, O. Tsabari and Z. Reich (2010). "Permeating the nuclear pore complex." Nucleus 1(6): 475-480.

Kilmartin, J. V. (2003). "Sfi1p has conserved centrin-binding sites and an essential function in budding yeast spindle pole body duplication." The Journal of Cell Biology 162(7): 1211- 1221.

Kimata, Y., Y. I. Kimata, Y. Shimizu, H. Abe, I. C. Farcasanu, M. Takeuchi, M. D. Rose and K. Kohno (2003). "Genetic Evidence for a Role of BiP/Kar2 That Regulates Ire1 in Response to Accumulation of Unfolded Proteins." Molecular Biology of the Cell 14(6): 2559-2569.

King, M. C., C. Lusk and G. Blobel (2006). "Karyopherin-mediated import of integral inner nuclear membrane proteins." Nature 442(7106): 1003-1007.

Kitten, G. T. and E. A. Nigg (1991). "The CaaX motif is required for isoprenylation, carboxyl methylation, and nuclear membrane association of lamin B2." The Journal of Cell Biology 113(1): 13-23.

Klausner, R. D., J. G. Donaldson and J. Lippincott-Schwartz (1992). "Brefeldin A: insights into the control of membrane traffic and organelle structure." The Journal of Cell Biology 116(5): 1071-1080.

Knop, M., G. Pereira, S. Geissler, K. Grein and E. Schiebel (1997). "The spindle pole body component Spc97p interacts with the [gamma]-tubulin of Saccharomyces cerevisiae and functions in microtubule organization and spindle pole body duplication." EMBO J 16(7): 1550-1564. 180

Knop, M. and K. Strasser (2000). "Role of the spindle pole body of yeast in mediating assembly of the prospore membrane during meiosis." EMBO J 19(14): 3657-3667.

Kupke, T., L. Di Cecco, H.-M. Muller, A. Neuner, F. Adolf, F. Wieland, W. Nickel and E. Schiebel (2011). "Targeting of Nbp1 to the inner nuclear membrane is essential for spindle pole body duplication." EMBO J 30(16): 3337-3352.

Kvam, E. and D. S. Goldfarb (2004). "Nvj1p is the outer-nuclear-membrane receptor for oxysterol-binding protein homolog Osh1p in Saccharomyces cerevisiae." Journal of Cell Science 117(21): 4959-4968.

Lai, T.-P., K. A. Stauffer, A. Murthi, H. H. Shaheen, G. Peng, N. C. Martin and A. K. Hopper (2009). "Mechanism and a Peptide Motif for Targeting Peripheral Proteins to the Yeast Inner Nuclear Membrane." Traffic 10(9): 1243-1256.

Lajoie, P., R. D. Moir, I. M. Willis and E. L. Snapp (2012). "Kar2p availability defines distinct forms of endoplasmic reticulum stress in living cells." Molecular Biology of the Cell 23(5): 955-964.

Lammerding, J., J. Hsiao, P. C. Schulze, S. Kozlov, C. L. Stewart and R. T. Lee (2005). "Abnormal nuclear shape and impaired mechanotransduction in emerin-deficient cells." The Journal of Cell Biology 170(5): 781-791.

Lange, A., L. M. McLane, R. E. Mills, S. E. Devine and A. H. Corbett (2010). "Expanding the Definition of the Classical Bipartite Nuclear Localization Signal." Traffic 11(3): 311-323.

Lange, A., R. E. Mills, C. J. Lange, M. Stewart, S. E. Devine and A. H. Corbett (2007). "Classical Nuclear Localization Signals: Definition, Function, and Interaction with Importin α." Journal of Biological Chemistry 282(8): 5101-5105.

Leslie, D. M., B. Grill, M. P. Rout, R. W. Wozniak and J. D. Aitchison (2002). "Kap121p- Mediated Nuclear Import Is Required for Mating and Cellular Differentiation in Yeast." Molecular and Cellular Biology 22(8): 2544-2555.

Li, J. M., A. K. Hopper and N. C. Martin (1989). "N2,N2-dimethylguanosine-specific tRNA methyltransferase contains both nuclear and mitochondrial targeting signals in Saccharomyces cerevisiae." The Journal of Cell Biology 109(4): 1411-1419.

Li, Y.-P., R. K. Busch, B. C. Valdez and H. Busch (1996). "C23 Interacts with B23, A Putative Nucleolar-Localization-Signal-Binding Protein." European Journal of Biochemistry 237(1): 153-158. 181

Li, Z., F. J. Vizeacoumar, S. Bahr, J. Li, J. Warringer, F. S. Vizeacoumar, R. Min, B. VanderSluis, J. Bellay, M. DeVit, J. A. Fleming, A. Stephens, J. Haase, Z.-Y. Lin, A. Baryshnikova, H. Lu, Z. Yan, K. Jin, S. Barker, A. Datti, G. Giaever, C. Nislow, C. Bulawa, C. L. Myers, M. Costanzo, A.-C. Gingras, Z. Zhang, A. Blomberg, K. Bloom, B. Andrews and C. Boone (2011). "Systematic exploration of essential yeast gene function with temperature-sensitive mutants." Nat Biotech 29(4): 361-367.

Liashkovich, I., A. Meyring, H. Oberleithner and V. Shahin "Structural organization of the nuclear pore permeability barrier." Journal of Controlled Release.

Linde, N. and R. Stick (2010). "Intranuclear membranes induced by lipidated proteins are derived from the nuclear envelope." Nucleus 1(4): 343-353.

Liu, D., X. Wu, M. D. Summers, A. Lee, K. J. Ryan and S. C. Braunagel (2010). "Truncated Isoforms of Kap60 Facilitate Trafficking of Heh2 to the Nuclear Envelope." Traffic 11(12): 1506-1518.

Loewen, C. J. R., B. P. Young, S. Tavassoli and T. P. Levine (2007). "Inheritance of cortical ER in yeast is required for normal septin organization." The Journal of Cell Biology 179(3): 467-483.

Luirink, J. and I. Sinning (2004). "SRP-mediated protein targeting: structure and function revisited." Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1694(1–3): 17-35.

Lusk, C. P., G. Blobel and M. C. King (2007). "Highway to the inner nuclear membrane: rules for the road." Nat Rev Mol Cell Biol 8(5): 414-420.

Ma, Y., S. Cai, Q. Lv, Q. Jiang, Q. Zhang, Sodmergen, Z. Zhai and C. Zhang (2007). "Lamin B receptor plays a role in stimulating nuclear envelope production and targeting membrane vesicles to chromatin during nuclear envelope assembly through direct interaction with importin β." Journal of Cell Science 120(3): 520-530.

Madrid, A. S., J. Mancuso, W. Z. Cande and K. Weis (2006). "The role of the integral membrane nucleoporins Ndc1p and Pom152p in nuclear pore complex assembly and function." The Journal of Cell Biology 173(3): 361-371.

Massenet, S., Y. Motorin, D. L. J. Lafontaine, E. C. Hurt, H. Grosjean and C. Branlant (1999). "Pseudouridine Mapping in the Saccharomyces cerevisiae Spliceosomal U Small Nuclear RNAs (snRNAs) Reveals that Pseudouridine Synthase Pus1p Exhibits a Dual Substrate Specificity for U2 snRNA and tRNA." Molecular and Cellular Biology 19(3): 2142-2154. 182

Masson, I. L., C. Saveanu, A. Chevalier, A. Namane, R. Gobin, M. Fromont-Racine, A. Jacquier and C. Mann (2002). "Spc24 interacts with Mps2 and is required for chromosome segregation, but is not implicated in spindle pole body duplication." Molecular Microbiology 43(6): 1431-1443.

McDonald, H. B., A. H. Helfant, E. M. Mahony, S. K. Khosla and L. Goetsch (2002). "Mutational Analysis Reveals a Role for the C Terminus of the Proteasome Subunit Rpt4p in Spindle Pole Body Duplication in Saccharomyces cerevisiae." Genetics 162(2): 705-720.

McGee, M. D., R. Rillo, A. S. Anderson and D. A. Starr (2006). "UNC-83 Is a KASH Protein Required for Nuclear Migration and Is Recruited to the Outer Nuclear Membrane by a Physical Interaction with the SUN Protein UNC-84." Molecular Biology of the Cell 17(4): 1790-1801.

McLane, L. M. and A. H. Corbett (2009). "Nuclear localization signals and human disease." IUBMB Life 61(7): 697-706.

Meinema, A. C., J. K. Laba, R. A. Hapsari, R. Otten, F. A. A. Mulder, A. Kralt, G. van den Bogaart, C. P. Lusk, B. Poolman and L. M. Veenhoff (2011). "Long Unfolded Linkers Facilitate Membrane Protein Import Through the Nuclear Pore Complex." Science 333(6038): 90-93.

Melloy, P., S. Shen, E. White, J. R. McIntosh and M. D. Rose (2007). "Nuclear fusion during yeast mating occurs by a three-step pathway." The Journal of Cell Biology 179(4): 659- 670.

Menéndez-Benito, V., L. G. G. C. Verhoef, M. G. Masucci and N. P. Dantuma (2005). "Endoplasmic reticulum stress compromises the ubiquitin–proteasome system." Human Molecular Genetics 14(19): 2787-2799.

Miao, M., K. J. Ryan and S. R. Wente (2006). "The Integral Membrane Protein Pom34p Functionally Links Nucleoporin Subcomplexes." Genetics 172(3): 1441-1457.

Mnaimneh, S., A. P. Davierwala, J. Haynes, J. Moffat, W.-T. Peng, W. Zhang, X. Yang, J. Pootoolal, G. Chua, A. Lopez, M. Trochesset, D. Morse, N. J. Krogan, S. L. Hiley, Z. Li, Q. Morris, J. Grigull, N. Mitsakakis, C. J. Roberts, J. F. Greenblatt, C. Boone, C. A. Kaiser, B. J. Andrews and T. R. Hughes (2004). "Exploration of Essential Gene Functions via Titratable Promoter Alleles." Cell 118(1): 31-44.

183

Moore, M. S. and G. Blobel (1993). "The GTP-binding protein Ran/TC4 is required for protein import into the nucleus." Nature 365(6447): 661-663.

Mori, K., N. Ogawa, T. Kawahara, H. Yanagi and T. Yura (1998). "Palindrome with Spacer of One Nucleotide Is Characteristic of thecis-Acting Unfolded Protein Response Element inSaccharomyces cerevisiae." Journal of Biological Chemistry 273(16): 9912-9920.

Morl, K., W. Ma, M.-J. Gething and J. Sambrook (1993). "A transmembrane protein with a cdc2+ CDC28-related kinase activity is required for signaling from the ER to the nucleus." Cell 74(4): 743-756.

Muller, E. G. D., B. E. Snydsman, I. Novik, D. W. Hailey, D. R. Gestaut, C. A. Niemann, E. T. O'Toole, T. H. Giddings, B. A. Sundin and T. N. Davis (2005). "The Organization of the Core Proteins of the Yeast Spindle Pole Body." Molecular Biology of the Cell 16(7): 3341-3352.

Murthi, A. and A. K. Hopper (2005). "Genome-Wide Screen for Inner Nuclear Membrane Protein Targeting in Saccharomyces cerevisiae." Genetics 170(4): 1553-1560.

Nagano, A., and K. Arahata (2000). "Nuclear envelope proteins and associated diseases." Current Opinion in Neurology 13 (5): 533-539.

Nakatsukasa, K. and J. L. Brodsky (2008). "The Recognition and Retrotranslocation of Misfolded Proteins from the Endoplasmic Reticulum." Traffic 9(6): 861-870.

Natter, K., P. Leitner, A. Faschinger, H. Wolinski, S. McCraith, S. Fields and S. D. Kohlwein (2005). "The Spatial Organization of Lipid Synthesis in the Yeast Saccharomyces cerevisiae Derived from Large Scale Green Fluorescent Protein Tagging and High Resolution Microscopy." Molecular & Cellular Proteomics 4(5): 662-672.

Ng, D. T. and P. Walter (1996). "ER membrane protein complex required for nuclear fusion." The Journal of Cell Biology 132(4): 499-509.

Nigg, E. A., G. T. Kitten and K. Vorburger (1992). "Targeting lamin proteins to the nuclear envelope: the role of CaaX box modifications." Biochem. Soc. Trans. 20: 500-504.

Nishikawa, S., A. Hirata and A. Nakano (1994). "Inhibition of endoplasmic reticulum (ER)-to- Golgi transport induces relocalization of binding protein (BiP) within the ER to form the BiP bodies." Molecular Biology of the Cell 5(10): 1129-1143.

184

Novick, P., S. Ferro and R. Schekman (1981). "Order of events in the yeast secretory pathway." Cell 25(2): 461-469.

Ohba, T., E. C. Schirmer, T. Nishimoto and L. Gerace (2004). "Energy- and temperature- dependent transport of integral proteins to the inner nuclear membrane via the nuclear pore." The Journal of Cell Biology 167(6): 1051-1062.

Page, B. D. and M. Snyder (1992). "CIK1: a developmentally regulated spindle pole body- associated protein important for microtubule functions in Saccharomyces cerevisiae." Genes & Development 6(8): 1414-1429.

Pan, X., P. Roberts, Y. Chen, E. Kvam, N. Shulga, K. Huang, S. Lemmon and D. S. Goldfarb (2000). "Nucleus–Vacuole Junctions in Saccharomyces cerevisiae Are Formed Through the Direct Interaction of Vac8p with Nvj1p." Molecular Biology of the Cell 11(7): 2445- 2457.

Patel, S. S., B. J. Belmont, J. M. Sante and M. F. Rexach (2007). "Natively Unfolded Nucleoporins Gate Protein Diffusion across the Nuclear Pore Complex." Cell 129(1): 83- 96.

Pelham, H. R. B. (1991). "Multiple targets for brefeldin A." Cell 67(3): 449-451.

Pereira, C., I. Coutinho, J. Soares, C. Bessa, M. Leão and L. Saraiva (2012). "New insights into cancer-related proteins provided by the yeast model." FEBS Journal 279(5): 697-712.

Pereira, G., M. Knop and E. Schiebel (1998). "Spc98p Directs the Yeast γ-Tubulin Complex into the Nucleus and Is Subject to Cell Cycle-dependent Phosphorylation on the Nuclear Side of the Spindle Pole Body." Molecular Biology of the Cell 9(4): 775-793.

Pereira, G., T. U. Tanaka, K. Nasmyth and E. Schiebel (2001). "Modes of spindle pole body inheritance and segregation of the Bfa1p-Bub2p checkpoint protein complex." EMBO J 20(22): 6359-6370.

Pesaresi, P., N. A. Gardner, S. Masiero, A. Dietzmann, L. Eichacker, R. Wickner, F. Salamini and D. Leister (2003). "Cytoplasmic N-Terminal Protein Acetylation Is Required for Efficient Photosynthesis in Arabidopsis." The Plant Cell Online 15(8): 1817-1832.

Peters, R. (2005). "Translocation Through the Nuclear Pore Complex: Selectivity and Speed by Reduction-of-Dimensionality." Traffic 6(5): 421-427.

185

Petranovic, D. and J. Nielsen (2008). "Can yeast systems biology contribute to the understanding of human disease?" Trends in Biotechnology 26(11): 584-590.

Phair, R. D. and T. Misteli (2000). "High mobility of proteins in the mammalian cell nucleus." Nature 404(6778): 604-609.

Phizicky, E. M. and A. K. Hopper (2010). "tRNA biology charges to the front." Genes & Development 24(17): 1832-1860.

Pintard, L., F. Lecointe, J. M. Bujnicki, C. Bonnerot, H. Grosjean and B. Lapeyre (2002). "Trm7p catalyses the formation of two 2[prime]-O-methylriboses in yeast tRNA anticodon loop." EMBO J 21(7): 1811-1820.

Polevoda, B. and F. Sherman (2001). "NatC Nα-terminal Acetyltransferase of Yeast Contains Three Subunits, Mak3p, Mak10p, and Mak31p." Journal of Biological Chemistry 276(23): 20154-20159.

Polevoda, B. and F. Sherman (2003). "N-terminal Acetyltransferases and Sequence Requirements for N-terminal Acetylation of Eukaryotic Proteins." Journal of Molecular Biology 325(4): 595-622.

Popoff, V., F. Adolf, B. Brügger and F. Wieland (2011). "COPI Budding within the Golgi Stack." Cold Spring Harbor Perspectives in Biology 3(11).

Pringle, J. R., Adams, A.M., Drubin, D.G., Haarer, B.K., Ed. (1991). Immunofluorescence Methods for Yeast. Methods in Enzymology: Guide to Yeast Genetics and Molecular Biology.

Prüfert, K., A. Vogel and G. Krohne (2004). "The lamin CxxM motif promotes nuclear membrane growth." Journal of Cell Science 117(25): 6105-6116.

Raasi, S. and D. H. Wolf (2007). "Ubiquitin receptors and ERAD: A network of pathways to the proteasome." Seminars in Cell & Developmental Biology 18(6): 780-791.

Rabinovich, E., A. Kerem, K.-U. Fröhlich, N. Diamant and S. Bar-Nun (2002). "AAA-ATPase p97/Cdc48p, a Cytosolic Chaperone Required for Endoplasmic Reticulum-Associated Protein Degradation." Molecular and Cellular Biology 22(2): 626-634.

Ralle, T., C. Grund, W. W. Franke and R. Stick (2004). "Intranuclear membrane structure formations by CaaX-containing nuclear proteins." Journal of Cell Science 117(25): 6095- 6104. 186

Rose, A. M., H. G. Belford, W. C. Shen, C. L. Greer, A. K. Hopper and N. C. Martin (1995). "Location of N2, N2-dimethylguanosine-specific tRNA methyltransferase." Biochimie 77(1–2): 45-53.

Rose, A. M., P. B. Joyce, A. K. Hopper and N. C. Martin (1992). "Separate information required for nuclear and subnuclear localization: additional complexity in localizing an enzyme shared by mitochondria and nuclei." Molecular and Cellular Biology 12(12): 5652-5658.

Rose, M. D., L. M. Misra and J. P. Vogel (1989). "KAR2, a karyogamy gene, is the yeast homolog of the mammalian BiP/GRP78 gene." Cell 57(7): 1211-1221.

Roth, J., C. Zuber, S. Park, I. Jang, Y. Lee, K. Kysela, V. Le Fourn, R. Santimaria, B. Guhl and J. Cho (2010). "Protein glycosylation, protein folding, and protein quality control." Molecules and Cells 30(6): 497-506.

Roux, K. J., M. L. Crisp, Q. Liu, D. Kim, S. Kozlov, C. L. Stewart and B. Burke (2009). "Nesprin 4 is an outer nuclear membrane protein that can induce kinesin-mediated cell polarization." Proceedings of the National Academy of Sciences 106(7): 2194-2199.

Ryan, K. and S. Wente (2002). "Isolation and characterization of new Saccharomyces cerevisiae mutants perturbed in nuclear pore complex assembly." BMC Genetics 3(1): 17.

Ryan, K. J., J. M. McCaffery and S. R. Wente (2003). "The Ran GTPase cycle is required for yeast nuclear pore complex assembly." The Journal of Cell Biology 160(7): 1041-1053.

Santos-Rosa, H., J. Leung, N. Grimsey, S. Peak-Chew and S. Siniossoglou (2005). "The yeast lipin Smp2 couples phospholipid biosynthesis to nuclear membrane growth." EMBO J 24(11): 1931-1941.

Sata, M., J. G. Donaldson, J. Moss and M. Vaughan (1998). "Brefeldin A-inhibited guanine nucleotide-exchange activity of Sec7 domain from yeast Sec7 with yeast and mammalian ADP ribosylation factors." Proceedings of the National Academy of Sciences 95(8): 4204-4208.

Schmidt-Zachmann, M. S. and E. A. Nigg (1993). "Protein localization to the nucleolus: a search for targeting domains in nucleolin." Journal of Cell Science 105(3): 799-806.

Schramm, C., S. Elliott, A. Shevchenko, A. Shevchenko and E. Schiebel (2000). "The Bbp1p- Mps2p complex connects the SPB to the nuclear envelope and is essential for SPB duplication." EMBO J 19(3): 421-433.

187

Schuck, S., W. A. Prinz, K. S. Thorn, C. Voss and P. Walter (2009). "Membrane expansion alleviates endoplasmic reticulum stress independently of the unfolded protein response." The Journal of Cell Biology 187(4): 525-536.

Schutz, A. R. and M. Winey (1998). "New Alleles of the Yeast MPS1 Gene Reveal Multiple Requirements in Spindle Pole Body Duplication." Molecular Biology of the Cell 9(4): 759-774.

Schwartz, T. U. (2007). Origins and Evolution of Cotranslational Transport to the ER Eukaryotic Membranes and Cytoskeleton, Springer New York. 607: 52-60.

Setty, S. R. G., T. I. Strochlic, A. H. Y. Tong, C. Boone and C. G. Burd (2004). "Golgi targeting of ARF-like GTPase Arl3p requires its N[alpha]-acetylation and the integral membrane protein Sys1p." Nat Cell Biol 6(5): 414-419.

Shibata, Y., G. K. Voeltz and T. A. Rapoport (2006). "Rough Sheets and Smooth Tubules." Cell 126(3): 435-439.

Silve, S., P.-H. Dupuy, P. Ferrara and G. Loison (1998). "Human lamin B receptor exhibits sterol C14-reductase activity in Saccharomyces cerevisiae." Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism 1392(2–3): 233-244.

Simos, G., H. Tekotte, H. Grosjean, A. Segref, K. Sharma, D. Tollervey, and E.C. Hurt (1996). "Nuclear pore proteins are involved in the biogenesis of functional tRNA." EMBO J. 15(9): 2270-2284.

Siniossoglou, S., H. Santos-Rosa, J. Rappsilber, M. Mann and E. Hurt (1998). "A novel complex of membrane proteins required for formation of a spherical nucleus." EMBO J 17(22): 6449-6464.

Sirri, V., S. Urcuqui-Inchima, P. Roussel and D. Hernandez-Verdun (2008). "Nucleolus: the fascinating nuclear body." Histochemistry and Cell Biology 129(1): 13-31.

Skrzypek, E., T. Myers-Morales, S. W. Whiteheart and S. C. Straley (2003). "Application of a Saccharomyces cerevisiae Model To Study Requirements for Trafficking of Yersinia pestis YopM in Eucaryotic Cells." Infection and Immunity 71(2): 937-947.

Smith, M. G. and M. Snyder (2001). Yeast as a Model for Human Disease. Current Protocols in Human Genetics, John Wiley & Sons, Inc.

188

Smith, S. and G. Blobel (1993). "The first membrane spanning region of the lamin B receptor is sufficient for sorting to the inner nuclear membrane." The Journal of Cell Biology 120(3): 631-637.

Smith, S. and G. Blobel (1994). "Colocalization of vertebrate lamin B and lamin B receptor (LBR) in nuclear envelopes and in LBR-induced membrane stacks of the yeast Saccharomyces cerevisiae." Proceedings of the National Academy of Sciences 91(21): 10124-10128.

Sommer, T. and D. Wolf (1997). "Endoplasmic reticulum degradation: reverse protein flow of no return." The FASEB Journal 11(14): 1227-1233.

Soullam, B. and H. J. Worman (1995). "Signals and structural features involved in integral membrane protein targeting to the inner nuclear membrane." The Journal of Cell Biology 130(1): 15-27.

Stewart, M. (2007). "Molecular mechanism of the nuclear protein import cycle." Nat Rev Mol Cell Biol 8(3): 195-208.

Strambio-de-Castillia, C., G. Blobel and M. P. Rout (1999). "Proteins Connecting the Nuclear Pore Complex with the Nuclear Interior." The Journal of Cell Biology 144(5): 839-855.

Straube, K., J. S. Blackwell and L. F. Pemberton (2010). "Nap1 and Chz1 have Separate Htz1 Nuclear Import and Assembly Functions." Traffic 11(2): 185-197.

Stutzmann, G. E. and M. P. Mattson (2011). "Endoplasmic Reticulum Ca2+ Handling in Excitable Cells in Health and Disease." Pharmacological Reviews 63(3): 700-727.

Sullivan, T., D. Escalante-Alcalde, H. Bhatt, M. Anver, N. Bhat, K. Nagashima, C. L. Stewart and B. Burke (1999). "Loss of a-Type Lamin Expression Compromises Nuclear Envelope Integrity Leading to Muscular Dystrophy." The Journal of Cell Biology 147(5): 913-920.

Sundberg, H. A. and T. N. Davis (1997). "A Mutational Analysis Identifies Three Functional Regions of the Spindle Pole Component Spc110p in Saccharomyces cerevisiae." Molecular Biology of the Cell 8(12): 2575-2590.

Taddei, A., F. Hediger, F. R. Neumann, C. Bauer and S. M. Gasser (2004). "Separation of silencing from perinuclear anchoring functions in yeast Ku80, Sir4 and Esc1 proteins." EMBO J 23(6): 1301-1312.

189

Tapley, E. C., N. Ly and D. A. Starr (2011). "Multiple mechanisms actively target the SUN protein UNC-84 to the inner nuclear membrane." Molecular Biology of the Cell 22(10): 1739-1752.

Thoz, P. d., #xE9, C. e, dric and M. Ghislain (2006). "ER-Associated Degradation of Membrane Proteins in Yeast." TheScientificWorldJOURNAL 6: 967-983.

Tolerico, L. H., A. L. Benko, J. P. Aris, D. R. Stanford, N. C. Martin and A. K. Hopper (1999). "Saccharomyces cerevisiae Mod5p-II Contains Sequences Antagonistic for Nuclear and Cytosolic Locations." Genetics 151(1): 57-75.

Travers, K. J., C. K. Patil, L. Wodicka, D. J. Lockhart, J. S. Weissman and P. Walter (2000). "Functional and Genomic Analyses Reveal an Essential Coordination between the Unfolded Protein Response and ER-Associated Degradation." Cell 101(3): 249-258.

Turgay, Y., R. Ungricht, A. Rothballer, A. Kiss, G. Csucs, P. Horvath and U. Kutay (2010). "A classical NLS and the SUN domain contribute to the targeting of SUN2 to the inner nuclear membrane." EMBO J 29(14): 2262-2275.

Vallen, E. A., W. Ho, M. Winey and M. D. Rose (1994). "Genetic Interactions Between CDC31 and KAR1, Two Genes Required for Duplication of the Microtubule Organizing Center in Saccharomyces cerevisiae." Genetics 137(2): 407-422.

Vida, T. A. and S. D. Emr (1995). "A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast." The Journal of Cell Biology 128(5): 779-792.

Villa-García, M., M. Choi, F. Hinz, M. Gaspar, S. Jesch and S. Henry (2011). "Genome-wide screen for inositol auxotrophy in Saccharomyces cerevisiae implicates lipid metabolism in stress response signaling." Molecular Genetics and Genomics 285(2): 125-149.

Voeltz, G. K., M. M. Rolls, and T. A. Rapoport (2002). "Structural organization of the endoplasmic reticulum." EMBO Rep. 3(10): 944–950. .

Vogel, J. P., L. M. Misra and M. D. Rose (1990). "Loss of BiP/GRP78 function blocks translocation of secretory proteins in yeast." The Journal of Cell Biology 110(6): 1885- 1895.

Walberg, M. W. (2000). "Applicability of Yeast Genetics to Neurologic Disease." Arch Neurol 57(8): 1129-1134.

190

Webster, M., K. L. Witkin and O. Cohen-Fix (2009). "Sizing up the nucleus: nuclear shape, size and nuclear-envelope assembly." Journal of Cell Science 122(10): 1477-1486.

Webster, M. T., J. M. McCaffery and O. Cohen-Fix (2010). "Vesicle trafficking maintains nuclear shape in Saccharomyces cerevisiae during membrane proliferation." The Journal of Cell Biology 191(6): 1079-1088.

Wente, S. R. and M. P. Rout (2010). "The Nuclear Pore Complex and Nuclear Transport." Cold Spring Harbor Perspectives in Biology 2(10).

Wickner, R. B. and M. J. Leibowitz (1976). "Chromosomal genes essential for replication of a double-stranded RNA plasmid of Saccharomyces cerevisiae: The killer character of yeast." Journal of Molecular Biology 105(3): 427-443.

Wilhelmsen, K., S. H. M. Litjens, I. Kuikman, N. Tshimbalanga, H. Janssen, I. van den Bout, K. Raymond and A. Sonnenberg (2005). "Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin." The Journal of Cell Biology 171(5): 799-810.

Wilkinson, B. M., J. R. Tyson, P. J. Reid and C. J. Stirling (2000). "Distinct Domains within Yeast Sec61p Involved in Post-translational Translocation and Protein Dislocation." Journal of Biological Chemistry 275(1): 521-529.

Winey, M., D. Yarar, T. H. Giddings and D. N. Mastronarde (1997). "Nuclear Pore Complex Number and Distribution throughout theSaccharomyces cerevisiae Cell Cycle by Three- Dimensional Reconstruction from Electron Micrographs of Nuclear Envelopes." Molecular Biology of the Cell 8(11): 2119-2132.

Witkin, K. L., J. M. Friederichs, O. Cohen-Fix and S. L. Jaspersen (2010). "Changes in the Nuclear Envelope Environment Affect Spindle Pole Body Duplication in Saccharomyces cerevisiae." Genetics 186(3): 867-883.

Wolf, D. H. and A. Stolz (2012). "The Cdc48 machine in endoplasmic reticulum associated protein degradation." Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1823(1): 117-124.

Wolf, J., M. Nicks, S. Deitz, E. van Tuinen and A. Franzusoff (1998). "An N-End Rule Destabilization Mutant Reveals Pre-Golgi Requirements for Sec7p in Yeast Membrane Traffic." Biochemical and Biophysical Research Communications 243(1): 191-198.

191

Worman, H. J. (2012). "Nuclear lamins and laminopathies." The Journal of Pathology 226(2): 316-325.

Wu, W., F. Lin and H. J. Worman (2002). "Intracellular trafficking of MAN1, an integral protein of the nuclear envelope inner membrane." Journal of Cell Science 115(7): 1361-1371.

Xu, D., A. Farmer and Y. M. Chook (2010). "Recognition of nuclear targeting signals by Karyopherin-β proteins." Current Opinion in Structural Biology 20(6): 782-790.

Yang, Q., M. P. Rout and C. W. Akey (1998). "Three-Dimensional Architecture of the Isolated Yeast Nuclear Pore Complex: Functional and Evolutionary Implications." Molecular Cell 1(2): 223-234.

Ye, J. and R. A. DeBose-Boyd (2011). "Regulation of Cholesterol and Fatty Acid Synthesis." Cold Spring Harbor Perspectives in Biology 3(7).

Yoder, T. J., C. G. Pearson, K. Bloom and T. N. Davis (2003). "The Saccharomyces cerevisiae Spindle Pole Body Is a Dynamic Structure." Molecular Biology of the Cell 14(8): 3494- 3505.

Zuleger, N., D. A. Kelly, A. C. Richardson, A. R. W. Kerr, M. W. Goldberg, A. B. Goryachev and E. C. Schirmer (2011). "System analysis shows distinct mechanisms and common principles of nuclear envelope protein dynamics." The Journal of Cell Biology 193(1): 109-123.

192

Appendix A: Gal-Trm1-II-GFP in ice2∆ cells

Figure 53. Gal-Trm1-II-GFP localizes to the NE before it accumulates at the nucleoplasm in ice2∆ cells (Chapter 5, discussion). Preliminary observations in group of ice2∆ cells at different time points, after galactose induction. Cells are representative of the predominant phenotype at each time point and were observed by conventional microscopy methods, using slides containing agarose slants (See Chapter 2). Bar= 1µm .

193

Appendix B: Trm1-II-GFP localizes to the INM in ice2∆ if lipids are overproduce 19 4 Figure 54. Trm1-II-GFP localizes to the INM, in ice2∆ when lipids are overproduced. Trm1-II-GFP was expressed in ice2∆ cells containing second deletion of either the SPO7 or NEM1 gene which are negative regulator of lipid biosynthesis. See Chapter 5. Trm1-II-GFP was expressed in from a CEN plasmid and regulated by its own promoter (pRS15Trm1-II-GFP, see Chapter 2). Bar= 1µm.

194