DOCSLIB.ORG

Yeast Mating for Combinatorial Fab Library Generation and Surface Display

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Yeast Mating for Combinatorial Fab Library Generation and Surface Display FEBS Letters 564 (2004) 24^34 FEBS 28262 View metadata, citation and similar papers at core.ac.uk brought to you by CORE Yeast mating for combinatorial Fab library generationprovided and by Elsevier - Publisher Connector surface display Jane M. Weaver-Feldhausa;1, Jianlong Loub;1, James R. Colemana, Robert W. Siegela, James D. Marksb;Ã, Michael J. Feldhausa;ÃÃ aPaci¢c Northwest National Laboratory, MSIN:K4-12, 902 Battelle Boulevard, P.O. Box 999, Richland, WA 99352, USA bDepartment of Anesthesia and Pharmaceutical Chemistry, Rm 3C-38, NH, San Francisco General Hospital, University of California San Francisco, 1001 Potrero, San Francisco, CA 94110, USA Received 5 January 2004; revised 28 February 2004; accepted 14 March 2004 First published online 23 March 2004 Edited by Horst Feldmann to su¡er the growth mediated diversity loss seen with phage Abstract Yeast display of antibody fragments has proven to be an e⁄cient and productive means for directed evolution of single and phagemid antibody libraries [8] and antigen size is not chain Fv antibodies for increased a⁄nity and thermal stability, limited as in bacterial display. Yeast and bacterial display and more recently for the display and screening of a non-im- both allow selection of well expressing scFv and more precise mune library. In this paper, we describe an elegant and simple selection for higher a⁄nity antibodies using £uorescence acti- method for constructing large combinatorial Fab libraries for vated cell sorting (FACS) [8,9]. FACS analysis also allows for display on the surface of Saccharomyces cerevisiae, from mod- more rapid clone characterization including KD determina- estly sized, and easily constructed, heavy and light chain libra- tion, koff measurement, and epitope binning of mutually ex- ries. To this end, we have constructed a set of yeast strains and clusive clones directly on the surface of yeast [10]. This elim- a two vector system for heavy chain and light chain surface inates the need for puri¢cation of scFv protein to perform display of Fab fragments with free native amino termini. these characterizations, saving considerable time. If the scFv Through yeast mating of the haploid libraries, a very large heterodimeric immune Fab library was displayed on the diploids are of inadequate a⁄nity, yeast display has proven highly and high a⁄nity antigen speci¢c Fabs were isolated from the e¡ective for a⁄nity maturation [8,11,12]. library. Non-immune antibody libraries typically contain more than ß 2004 Published by Elsevier B.V. on behalf of the Federation 1 billion members to ensure isolation of a panel of antibodies of European Biochemical Societies. of adequate a⁄nity; library size is the single most important determinant of antibody diversity and a⁄nity [13]. Creating Key words: Fab; Yeast display; Selection; Library; such large yeast antibody libraries is quite time and labor Antibody; Single chain Fv intensive, due to the lower transformation e⁄ciency of yeast compared to bacteria. The recent successful display of Fab antibody fragments on yeast suggests a simpler approach to 1. Introduction large library construction [14]. Since Fab are composed of two distinct polypeptide chains, it is possible to encode the two Creating reagents which bind with high speci¢city and af- chains on di¡erent vectors in di¡erent yeast strains. The two ¢nity to relevant biomolecules is one of the most critical and chains can then be brought together in a single diploid yeast challenging tasks facing biologists. Identi¢cation and charac- by mating, a highly e⁄cient process (Fig. 1). For this work we terization of such reagents can be technically di⁄cult and time report the successful construction of yeast vectors and strains consuming. A number of antibody discovery technologies cur- for construction of large heterodimeric Fab libraries by mat- rently employed, from in vivo platforms used to produce poly- ing Saccharomyces cerevisiae. We show that this system func- clonal or monoclonal antibodies to in vitro platforms of ribo- tions to recreate binding Fab from scFv heavy (VH) and light somal [1^3], phage [4,5], bacterial display [6,7], and yeast (Vk) chain variable region genes and can be used to rapidly display [8], all identify novel reagents. Compared to other in construct large Fab libraries from which multiple high a⁄nity vitro display technologies, yeast display of non-immune single Fab can be isolated. This system should greatly simplify con- chain fragment variable (scFv) antibody libraries using the a- struction of large antibody libraries and could also be used for agglutinin adhesion receptor complex Aga1 and Aga2 has a a⁄nity maturation or humanization by chain shu¥ing [15]. number of advantages. Yeast antibody libraries do not appear 2. Materials and methods *Corresponding author. 2.1. Yeast strains **Corresponding author. The heavy chain library was constructed and displayed in JAR300, E-mail addresses: [email protected] (J.D. Marks), which has the following auxotrophic markers, ura3-52, trp1, leu2N200, [email protected] (M.J. Feldhaus). his3N200, pep4:HIS3, prbd1.6R, can1, and GAL (a gracious gift from Andrew Rakeshaw, MIT). The strain is based on EBY100 that was 1 Contributed equally to this work. derived from BJ5465 and is MATa [11]. The KanMU4 gene, confer- ring resistance to G418, was inserted through homologous recombi- Abbreviations: scFv, single chain fragment variable; mAb, monoclo- nation of a polymerase chain reaction (PCR) product encoding the nal antibody; SDCAA, synthetic dextrose plus casein amino acids; KanMU4 gene £anked by 45 bp of the URA3 gene. The light chain EGF, epidermal growth factor; VH, variable heavy; Vk, variable light Fab is expressed in YVH10 (Ura3, Trp3, BJ5464, MATK). 0014-5793 / 04 / $30.00 ß 2004 Published by Elsevier B.V. on behalf of the Federation of European Biochemical Societies. doi:10.1016/S0014-5793(04)00309-6 FEBS 28262 14-4-04 J.M. Weaver-Feldhaus et al./FEBS Letters 564 (2004) 24^34 25 2.2. Media 2.4. Antigens YPD and synthetic dextrose plus casein amino acids (SDCAA) were C-terminal biotinylated 12 amino acid peptides were used to gen- prepared as in Current Protocols, Chapter 13. For induction media, erate the scFv antibodies 18a, 18-36, 9, and 378 (a gracious gift from prepare SDCAA medium, substituting 20 g/l each of galactose and Ettore Apella, NCI). Epidermal growth factor (EGF) and calmodulin ra⁄nose for the dextrose. Uracil and/or tryptophan are added to were biotinylated using the Pierce (Rockford, IL, USA) NHS EZ link SDCAA depending on strain requirements. Minus HUT and minus kit, and are the antigens bound by EGF and CaM scFv, respectively. HUL plates were from TekNova (Halfmoon Bay, CA, USA). Botulinum neurotoxin serotype A was purchased from Metabiologics (Madison, WI, USA). 2.3. Oligonucleotides 2.5. Light chain vector pPNL30 For construction of pPNL30: The light chain vector was built on a scFv secretion vector pPNL9 StepA for: TCGAAAAAAGAGAGGCTGAAGCTCTCGAGGC- which was originally a modi¢ed vector pYC2/CT from Invitrogen GGCCGCG [16]. pPNL9 was digested with XhoI/EcoRI to excise the HA epitope StepA rev: AATTCCGGCCGCCTCGAGAGCTTCAGCCTCTC- tag and linker and replaced with the Kex2 cleavage site. The annealed TTTTT oligos (stepA for/rev) were cloned into the XhoI/EcoRI site with a Ck1 for: AGCTCTCGAGGCTCGTACGGTGGCTGCACCATC- NotI site in the middle. The resulting vector was digested with TGTC XhoI/EcoRI and the Ck gene was PCR ampli¢ed with primers de- Ck1 rev: TAGAATTCCGCCACACTCTCCCCTGTTGAAGCT- signed to insert XhoI/EcoRI restriction enzyme sites (accession num- CTTTG ber CK P01834). The PCR amplicon was subsequently digested with For construction of pPNL20: XhoI/EcoRI and ligated into the prepped vector to create the pPNL30 Aga primer 1: ATGAATTCTACTTCATACATTTTCAATTAA- light chain Fab vector. Restriction enzyme digestion with XhoI/BsiWI GATGAAGGTTTTGATTGTCT linearized and gapped the vector for direct yeast transformation. Aga primer 2: CTTTGCCATTGGCTCTAGCTCAACCGGTTA- Cloning of PCR ampli¢ed variable light chains with appropriate link- TTTCTACTACCGTCGGTTCCGCTGCAGAA ers was achieved by co-transforming (by the method of Gietz and Aga rev 3: GCTAGAGCCAATGGCAAAGCAGCGAAGATAG- Schiestl [17]) vector and PCR products and utilizing yeast gap repair CCAACAAGACAATCAAAACCTTCTA [18^20]. YVH10 was used for pPNL30+V transformation, and the Aga rev 4: ATGCGGCCGCGGATCCAGAGTTTCTCTTGTCC- k transformants selected on SDCAA+tryptophan. AAAGAGCCTTCTGCAGCGGAACCGAC Aga-18 for: CTCTGGATCCGCGGCCGCCAGGAACTGACAA- CTATATGCGAG 2.6. Heavy chain vector pPNL20 Aga-18 rev: AATCTCGAGCCTAGCACTAGTAACATACTGT- pCTcon was digested with EcoRI/XhoI to remove the insert con- GTGTTTATGGGGC taining the leader sequence, HA epitope tag, and Aga2 [8]. A synthetic cmyc stop: CTAGTGAACAAAAACTTATTTCTGAAGAAGAT- prepro region was built based on oligos (Aga primers 1 and 2, Aga rev CTGTAATGAC primers 3 and 4) using the outside primers and PCR to amplify the cmycr stop: TCGAGTCATTACAGATCTTCTTCAGAAATAA- construct. BamHI and NotI restriction sites were included on the GTTTTTGTTCA oligos for later cloning steps. Aga2 was ampli¢ed without the leader CH1 for: CTCTGGATCCGCTAGCACCAAGGGCCCATC sequence but with a 5P-NotI and 3P-SpeI site for cloning with the CH1 rev: GTCAGTTCCTGGCGGCCGCTACCTCCGCCACAA- primer set Aga primer 1 and Aga-18 Rev. The c-myc tag was built GATTTGGGCTCAACTTTCTTGTCC with the oligos cmyc stop and cmycr stop. This amplicon and the pCTcon vector were digested with EcoRI/XhoI, ligated together, and For cloning VH and Vk genes into Fab vectors: variable gene spe- ci¢c primers for heavy and light chains containing the following gap the resulting construct was transformed into Escherichia coli. Trans- repair tails were used to PCR amplify their respective variable regions. formants were isolated, sequenced to verify the correct insert, and then prepped for the cloning of the CH1 domain by digesting with Gap repair tails for VH : NheI/NotI. The CH1 constant domain was PCR ampli¢ed with the For: 5P-AAGGCTCTTTGGACAAGAGAAACTCTGGATCC VH speci¢c forward oligo primers CH1 for/rev, digested with NheI/NotI, and ligated into the pCTcon vector.
Load more

Recommended publications
  • Physical and Functional Interaction Between SET1/COMPASS Complex Component CFP-1 and a Sin3s HDAC Complex in C. Elegans
    Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans Flore Beurton, Przemyslaw Stempor, Matthieu Caron, Alex Appert, Yan Dong, Ron A-J Chen, David Cluet, Yohann Couté, Marion Herbette, Ni Huang, et al. To cite this version: Flore Beurton, Przemyslaw Stempor, Matthieu Caron, Alex Appert, Yan Dong, et al.. Physical and functional interaction between SET1/COMPASS complex component CFP-1 and a Sin3S HDAC complex in C. elegans. Nucleic Acids Research, Oxford University Press, 2019, 47 (21), pp.11164- 11180. 10.1093/nar/gkz880. hal-02375443 HAL Id: hal-02375443 https://hal.archives-ouvertes.fr/hal-02375443 Submitted on 25 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. bioRxiv preprint doi: https://doi.org/10.1101/436147; this version posted October 5, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Physical and functional interaction between SET1/COMPASS complex component CFP- 1 and a Sin3 HDAC complex Beurton F.
    [Show full text]
  • 2019 Abstracts
    We are delighted EDITORIAL to welcome the worldwide yeast community in Gothenburg for ICYGMB2019! The “International Yeast Conferences” started in the 1960s with a handful of delegates and since then have become THE most important event in yeast research. Now the yeast meeting to returns to Gothenburg. Many yeast researchers still remember the meeting in 2003 with over 1,100 delegates, a truly memorable event. The Life Sciences are changing, and yeast research remains at their forefront. Advancements in genome sequencing and genome editing just make yeast more exciting as model organism in basic cell biological research, genome evolution and as a tool for synthetic biology and biotechnology. One of the most important reasons for the enormous success of yeast research lies in the unique character of the international yeast research community. No other community employs such a free exchange and access to information and research tools. Nor has any other community had the ability to build – even intercontinental – consortia of critical mass to tackle large‐scale projects, such as in sequencing the first eukaryotic genome or the first comprehensive yeast knockout library. Yeast2019 is the meeting of the international yeast research community where the latest, and even unpublished results are exchanged, and new projects, alliances, and collaborations are founded. A do‐not‐miss‐event. We attempt to incorporate the present excitement in yeast research in the programme of yeast2019. We are confident that this conference will contain important news and information for all yeast researchers. Taken together, yeast2019 will provide an up‐ to‐date overview in yeast research and it will set the scene for years to come.
    [Show full text]
  • SPC72: a Spindle Pole Component Required for Spindle Orientation in the Yeast Saccharomyces Cerevisiae
    Journal of Cell Science 111, 2809-2818 (1998) 2809 Printed in Great Britain © The Company of Biologists Limited 1998 JCS3813 SPC72: a spindle pole component required for spindle orientation in the yeast Saccharomyces cerevisiae Sylvie Souès* and Ian R. Adams Laboratory of Molecular Biology, Medical Research Council Centre, Hills Road, Cambridge CB2 2QH, UK *Author for correspondence at present address: Institut de Génétique et de Microbiologie, Bât. 400, Université de Paris-Sud XI, 91 405 Orsay Cédex, France (e-mail: [email protected]) Accepted 7 July; published on WWW 27 August 1998 SUMMARY The monoclonal antibody 78H6 recognises an 85 kDa mating capability. Precisely, deletion of SPC72 resulted in component of the yeast spindle pole body. Here we identify a decreased number of astral microtubules: early in the cell and characterise this component as Spc72p, the product of cycle only few were detectable, and these were unattached YAL047C. The sequence of SPC72 contains potential coiled- to the spindle pole body in small-budded cells. Later in the coil domains; its overexpression induced formation of large cell cycle few, if any, remained, and they were unable to polymers that were strictly localised at the outer plaque align the spindle properly. We conclude that Spc72p is not and at the bridge of the spindle pole body. Immunoelectron absolutely required for nucleation per se, but is needed for microscopy confirmed that Spc72p was a component of normal abundance and stability of astral microtubules. these polymers. SPC72 was found to be non-essential for cell growth, but its deletion resulted in abnormal spindle Key words: Yeast, Spindle Pole Body, Astral microtubule, positioning, aberrant nuclear migration and defective Microtubule dynamic, Nuclear migration, Mating INTRODUCTION fails to orient the spindle towards the bud neck, with the consequence that nuclei fail to segregate appropriately (Palmer Microtubules play a key role in mitosis and mating of yeast.
    [Show full text]
  • DISCOVERY and CHARACTERIZATION of PATHWAYS INVOLVED in FUS and TDP43-INDUCED TOXICITY in YEAST a Thesis Submitted in Partial
    DISCOVERY AND CHARACTERIZATION OF PATHWAYS INVOLVED IN FUS AND TDP43-INDUCED TOXICITY IN YEAST A thesis submitted in partial fulfillment of the requirement for the degree of Master of Science By WESTON JOSEPH SHAW B.S., Wright State University, 2017 2020 Wright State University WRIGHT STATE UNIVERSITY GRADUATE SCHOOL DATE OF DEFENSE 04 / 30 /2020 I HEREBY RECOMMEND THAT THE THESIS PREPARED UNDER MY SUPERVISION BY WESTON JOSEPH SHAW ENTITLED DISCOVERY AND CHARACTERIZATION OF FUS AND TDP43-INDUCED TOXICITY IN YEAST BE ACCEPTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF MASTER OF SCIENCE. Shulin Ju, Ph.D. Thesis Director Eric Bennett, Ph.D. Chair, Department of Neuroscience, Cell Biology and Physiology Committee on Final Examination Chris Wyatt, Ph.D. Thomas Brown, Ph.D. Barry Milligan, Ph.D. Interim Dean of the Graduate School ABSTRACT ShaW, Weston Joseph. M.S., Department of Neuroscience, Cell Biology, and Physiology, Wright State University, 2020. Discovery and characterization of pathways involved in FUS and TDP43-induced toxicity in yeast. High-throughput genome-scale studies are becoming increasingly common as a means to discover genetic interactions. This methodology is particularly efficient When performed in the budding yeast Saccharomyces cerevisiae. Here, We (1) overexpress a large human gene library in yeast to assess how many of them are toxic, and (2) use the list of genes generated above to refine and analyze human genes previously identified to enhance toxicity of tWo ALS-associated proteins, FUS and TDP-43. By introducing each of 13,500 human genes into yeast, we demonstrated that the majority of these genes (about 97%) are not toxic to yeast When overexpressed.
    [Show full text]
  • Telomere Length Homeostasis Is Achieved Via a Switch Between Telomerase- Extendible and -Nonextendible States
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Elsevier - Publisher Connector Cell, Vol. 117, 323–335, April 30, 2004, Copyright 2004 by Cell Press Telomere Length Homeostasis Is Achieved via a Switch between Telomerase- Extendible and -Nonextendible States M. Teresa Teixeira,1,3 Milica Arneric,1 acts telomere shortening (reviewed in Kelleher et al. Peter Sperisen,2 and Joachim Lingner1,* [2002]). It extends the 3Ј end of chromosomes by reverse 1Swiss Institute for Experimental Cancer Research transcribing in an iterative fashion the template region and National Center of Competence in Research of its tightly associated telomerase RNA moiety. The “Frontiers in Genetics” complementary DNA strand is presumably synthesized 2 Swiss Institute for Bioinformatics by the conventional DNA polymerases ␣ and ␦ (Diede CH-1066 Epalinges/s Lausanne and Gottschling, 1999; Ray et al., 2002). Telomerase Switzerland expression is required for unlimited proliferation of uni- cellular organisms such as yeast or protozoa as well as for immortal cells in multicellular organisms such as Summary germ cells, some stem cells, and many cancer cells. In humans, a decline in telomere length correlates with the Telomerase counteracts telomere erosion that stems onset of age-dependent mortality (Cawthon et al., 2003). from incomplete chromosome end replication and Short telomeres and reduced levels of telomerase have nucleolytic processing. A precise understanding of been observed in individuals that carry a defective tel- telomere length homeostasis has been hampered by omerase RNA gene or a defective allele of the tel- the lack of assays that delineate the nonuniform telo- omerase-associated dyskerin protein (Mitchell et al., mere extension events of single chromosome mole- 1999; Vulliamy et al., 2001).
    [Show full text]
  • Combining Biochemical Signaling and Mechanics to Understand Yeast Mating Morphogenesis
    University of California Santa Barbara Combining Biochemical Signaling and Mechanics to Understand Yeast Mating Morphogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Mechanical Engineering by Michael D. Trogdon Committee in charge: Professor Linda Petzold, Chair Professor Otger Camp`as Professor Megan Valentine Professor Robert McMeeking September 2018 The Dissertation of Michael D. Trogdon is approved. Professor Otger Camp`as Professor Megan Valentine Professor Robert McMeeking Professor Linda Petzold, Committee Chair May 2018 Combining Biochemical Signaling and Mechanics to Understand Yeast Mating Morphogenesis Copyright c 2018 by Michael D. Trogdon iii For my mom, who made all of this possible. And my childhood best friend Julius, gone too soon. iv Acknowledgements I would first and foremost like to thank my PhD advisor, Linda Petzold, for her guidance, mentorship and support. I would also like to thank the rest of my committee: Otger Camp`as,Megan Valentine and Robert McMeeking for their time and insight. I would like to thank all of my close scientific collaborators. In particular, thanks to Tau-Mu Yi for his guidance and for providing new ideas at every juncture. I would like to thank Otger Camp`asfor being a wealth of knowledge in physics and biology. Also thanks to Samhita Banavar for all of the discussions, mutual encouragement and support. Lastly, I would like to thank Carlos Gomez for always being a good source of experimental knowledge and data. For much of my growth over the last several years, I am grateful for the everyone in the Petzold lab, both past and present.
    [Show full text]
  • Dissertation
    DISSERTATION Signalling in space and time: Catching dynamic interactions using a novel enzymatic tagging approach in the S. cerevisiae HOG pathway Dissertation zur Erlangung des akademischen Grades Doktor rerum naturalium Verfasserin: Christina Friedmann Matrikel-Nummer: 9804625 Dissertationsgebiet (lt. Studienblatt): Mikrobiologie und Genetik Betreuer: Gustav Ammerer Wien, im März 2010 Index 1 Abstract ............................................................................................................................. 4 2 Zusammenfassung ............................................................................................................. 5 3 Introduction ....................................................................................................................... 6 3.1 Architecture of MAPK signalling cascades .............................................................. 6 3.1.1 The basics modules of MAPK signal transduction ........................................... 6 3.1.2 Regulation of MAPK-cascades ......................................................................... 8 3.1.3 MAPK-cascades and cancer ............................................................................ 10 3.1.4 Yeast MAPK cascades .................................................................................... 11 3.1.4.1 Spore Wall Assembly Pathway ................................................................... 12 3.1.4.2 The Cell Wall Integrity Pathway ................................................................. 13
    [Show full text]
  • The Basidiomycota Marco Coelho, Guus Bakkeren, Sheng Sun, Michael Hood, Tatiana Giraud
    Fungal Sex: The Basidiomycota Marco Coelho, Guus Bakkeren, Sheng Sun, Michael Hood, Tatiana Giraud To cite this version: Marco Coelho, Guus Bakkeren, Sheng Sun, Michael Hood, Tatiana Giraud. Fungal Sex: The Ba- sidiomycota. Microbiology Spectrum, American Society for Microbiology, 2017, 5 (3), pp.147-175. 10.1128/microbiolspec.FUNK-0046-2016. hal-02328823 HAL Id: hal-02328823 https://hal.archives-ouvertes.fr/hal-02328823 Submitted on 10 Mar 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. The Fungal Kingdom Edited by J. Heitman, B. J. Howlett, P. W. Crous, E. H. Stukenbrock, T. Y. James, and N. A. R. Gow © 2018 American Society for Microbiology, Washington, DC doi:10.1128/microbiolspec.FUNK-0046-2016 Fungal Sex: The Basidiomycota Marco A. Coelho,1 Guus Bakkeren,2 Sheng Sun,3 4 5 7 Michael E. Hood, and Tatiana Giraud BREEDING SYSTEMS AND LIFESTYLES pendently evolving lineages are strongly within the IN THE BASIDIOMYCOTA Basidiomycota (Fig. 2) (3). The subphylum Agarico- In the phylum Basidiomycota, a wide variety of life- mycotina contains most of the described species (ca. styles are represented. These range from well-known 21,000), including many mushrooms as saprophytes and conspicuous wood-decaying mushrooms, plant or mycorrhizal symbionts of plants, the jelly fungi, and growth-promoting and mutualistic mycorrhizae, and a large diversity of yeasts, some of which are important crop-destroying smut and rust fungi, to yeast-like hu- pathogens of humans (viz., Cryptococcus neoformans) man pathogens.
    [Show full text]
  • Saccharomyces Cerevisiae: an Opportunistic Pathogen Causing Fungal Infection in Immunocompromised Condition
    Volume 10, Issue 6, June 2021 International Journal of Innovative Research in Science, Engineering and Technology (IJIRSET) | e-ISSN: 2319-8753, p-ISSN: 2320-6710| www.ijirset.com | Impact Factor: 7.512| || Volume 10, Issue 6, June 2021 || | DOI:10.15680/IJIRSET.2021.1006372 | Saccharomyces cerevisiae: An Opportunistic Pathogen causing Fungal Infection in Immunocompromised Condition. Archana Moon1*, V. G. Meshram2 , Shantanu D. Chilate3, Kanchan K. Thamke4, Simran S. Mankar5, Shivani S. Tayde6, Priyanka V. Bhade7, Vishal K. Kolhe8, Pallavi S. Attram9, Priti V. Durge10, Monali Jariya11 Post Graduate Teaching Department of Biochemistry Rashtrasant Tukadoji Maharaj Nagpur University, Nagpur, India 1-10 Corresponding author: Dr. Archana Moon, Professor, Post Graduate Teaching Department of Biochemistry Rashtrasant Tukadoji Maharaj Nagpur University, Nagpur, India11 ABSTRACT : Baker's yeast (Saccharomyces cerevisiae). It is a well-known yeast for fermentation and a useful research example because of its unicellular nature and fact that having nearly similar mechanism with eukaryotes. Invasive Saccharomyces infections have been documented with multiple risk factors including critical illness and having immunodeficiency. Even some subspecies are most remarkable pathogenic fungi which cause various nosocomial infections annually. As we see, a long time was spent on S. cerevisiae isolation clinically. Bloodstream infection due to S. cerevisiae have been reported in patients suffering from critical illness and immunosuppression so clinically it was difficult to achieve timely diagnosis of the cause of fungemia. Blood culture of patients shows colonies of S. cerevisiae cause fungemia disease which is diagnosed by some molecular techniques. Morbidity rate is more as compared to mortality (due to patients suffering from different critical diseases).
    [Show full text]
  • Regulation of Pheromone Response in Saccharomyces by Ste12-PRE
    Regulation of Pheromone Response in Saccharomyces by Ste12-PRE Interaction and TOR-Cdc55 Signaling by Ting-Cheng Su A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENT FOR THE DEGREE OF Doctor of Philosophy in The Faculty of Graduate Studies (Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) November 2012 © Ting-Cheng Su, 2012 Abstract Ste12 is the key regulator in the yeast pheromone response pathway and works as an important model for understanding gene regulation by MAP kinase cascades. In this thesis I address how the binding strength of pheromone-response element (PRE) sequences, their orientation, and intervening nucleotide distance between two PREs govern the overall response to pheromone. I found that Ste12 binds as a monomer to a single PRE in vitro, and that two PREs upstream of a minimal core promoter cause a level of induction proportional to their relative affinity for Ste12 in vitro. Although consensus PREs are arranged in a variety of configurations in the promoters of pheromone responsive genes, I found there are severe constraints with respect to how they can be positioned in an artificial promoter to cause induction of gene expression. Two closely-spaced PREs can induce transcription in a directly-repeated or tail-to-tail orientation, while PREs separated by at least 40 nucleotides are capable of inducing transcription when oriented in a head-to-head or tail-to-tail configuration. By comparing the constraints defined by analysis of artifical promoters, I found that a single PRE can cause response to pheromone induction in combination with a properly oriented PRE-like sequence.
    [Show full text]
  • Building a Genetic System in Yeast to Search for High Affinity Proteins in Sequence Space
    Building a Genetic System in Yeast to Search for High Affinity Proteins in Sequence Space Matthew Douglas Merguerian Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2013 © 2013 Matthew Douglas Merguerian All rights reserved ABSTRACT Building a Genetic System in Yeast to Search for High Affinity Proteins in Sequence Space Matthew Douglas Merguerian Binding proteins (both natural and man-made) have the ability to bind tightly and specifically with small molecules and other biopolymers. Binding proteins can function as human therapeutics, diagnostics, and as tools for scientific research. Given the wide range of potential applications, there is great interest in both academia and industry to develop methods for discovering novel binders. An important step in discovering new binders is called affinity maturation, when an initial hit that shows some ability to bind the target is further mutated in additional steps to improve binding affinity, specificity, solubility, pharmacokinetic profile. Ideally, the methods for affinity maturation would allow for cookbook protocols, be successful for arbitrary targets of interest, and be minimally resource intensive. Although traditional methods for affinity maturation have had some stunning successes over the past, the state of the field is still far from this ideal. In Chapter 1, I discuss the current state of the protein engineering field. In Chapter 2, I discuss the use of phenotypic selection for yeast-display protein binders, and test these systems on simple loop libraries.. In Chapter 3, I construct a genetic system in yeast that can mutate a protein loop via homologous recombination, and test its recombination function.
    [Show full text]
  • Fungal Sex: the Basidiomycota MARCO A
    Fungal Sex: The Basidiomycota MARCO A. COELHO,1 GUUS BAKKEREN,2 SHENG SUN,3 MICHAEL E. HOOD,4 and TATIANA GIRAUD5 1UCIBIO-REQUIMTE, Departamento de Ciências da Vida, Faculdade de Ciências e Tecnologia, Universidade NOVA de Lisboa, 2829-516 Caparica, Portugal; 2Agriculture and Agri-Food Canada, Summerland Research and Development Centre, Summerland, BC, V0H 1Z0, Canada; 3Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, NC 27710; 4Department of Biology, Amherst College, Amherst, MA 01002; 5Ecologie Systématique Evolution, Université Paris-Sud, CNRS, AgroParisTech, Université Paris-Saclay, 91400, Orsay, France ABSTRACT Fungi of the Basidiomycota, representing major and conspicuous wood-decaying mushrooms, plant pathogen lineages and mushroom-forming species, growth-promoting and mutualistic mycorrhizae, and exhibit diverse means to achieve sexual reproduction, crop-destroying smut and rust fungi, to yeast-like hu- with particularly varied mechanisms to determine compatibilities man pathogens. Lifestyle differences have consequences of haploid mating partners. For species that require mating between distinct genotypes, discrimination is usually based on for the mating and breeding systems of these fungi (see both the reciprocal exchange of diffusible mating pheromones, “Glossary,” below, for definitions of specialist terms used rather than sexes, and the interactions of homeodomain protein in this article), which is reflected in the genetic evolution Q1 signals after cell fusion. Both compatibility factors must be of mating-type determination. For over a century fungi heterozygous in the product of mating, and genetic linkage have been recognized as having diverse breeding systems, relationships of the mating pheromone/receptor and from homothallism (i.e., universal compatibility among homeodomain genes largely determine the complex patterns gametes, including among clonemates) to heterothallism of mating-type variation.
    [Show full text]