Structural Basis and Genotype-Phenotype Correlations of INSR Mutations

Diabetes Page 2 of 62

Structural Basis and Genotype-phenotype Correlations of INSR Mutations

Causing Severe Insulin Resistance

Jun Hosoe1*, Hiroko Kadowaki2*, Fuyuki Miya1,3,4,5*, Katsuya Aizu6, Tomoyuki

Kawamura7, Ichiro Miyata8, Kenichi Satomura9, Takeru Ito10, Kazuo Hara11,

Masaki Tanaka12, Hiroyuki Ishiura12, Shoji Tsuji12, Ken Suzuki1, Minaka

Takakura1, Keith A. Boroevich4, Tatsuhiko Tsunoda3,4,5, Toshimasa Yamauchi1,

Nobuhiro Shojima1** & Takashi Kadowaki1**

* J.H., H.K., and F.M. contributed equally to this work.

** Corresponding authors: Takashi Kadowaki, kadowaki[email protected]tokyo.ac.jp, and

Nobuhiro Shojima, nshojima[email protected].

1Department of Diabetes and Metabolic Diseases, Graduate School of Medicine, The

University of Tokyo, Tokyo, Japan

2Department of Pediatrics, Sanno Hospital, Tokyo, Japan.

3Department of Medical Science Mathematics, Medical Research Institute, Tokyo

Medical and Dental University, Tokyo, Japan

4Laboratory for Medical Science Mathematics, RIKEN Center for Integrative Medical

Diabetes Publish Ahead of Print, published online August 1, 2017 Page 3 of 62 Diabetes

Sciences, Yokohama, Japan

5CREST, JST, Tokyo, Japan

6Division of Endocrinology and Metabolism, Saitama Children's Medical Center,

Saitama, Japan

7Department of Pediatrics, Osaka City University Graduate School of Medicine, Osaka,

Japan

8Department of Pediatrics, The Jikei University School of Medicine, Tokyo, Japan

9Department of Pediatric Nephrology and Metabolism, Osaka Medical Center and

Research Institute for Maternal and Child Health, Izumi, Japan

10Department of Pediatrics, Atsugi City Hospital, Kanagawa, Japan

11Department of Endocrinology and Metabolism, Saitama Medical Center, Jichi Medical

University, Saitama, Japan

12Department of Neurology, Graduate School of Medicine, The University of Tokyo,

Tokyo, Japan

Diabetes Page 4 of 62

Abstract

The insulin receptor (INSR) gene was analyzed in four patients with severe insulin resistance, revealing 5 novel mutations and a deletion that removed exon 2. A patient with Donohue syndrome (DS) had a novel p.V657F mutation in the second fibronectin type III domain (FnIII2), which contains the αβ cleavage site and part of the insulinbinding site. The mutant INSR was expressed in Chinese hamster ovary cells, revealing that it reduced insulin proreceptor processing and impaired activation of downstream signaling cascades. Using online databases, we analyzed 82 INSR missense mutations and demonstrated that mutations causing DS were more frequently located in the FnIII domains than those causing the milder type A insulin resistance (p = 0.016). In silico structural analysis revealed that missense mutations predicted to severely impair hydrophobic core formation and stability of the FnIII domains all caused DS, while those predicted to produce localized destabilization and not affect folding of the FnIII domains all caused the less severe RabsonMendenhall syndrome. These results suggest the importance of the FnIII domains, provide insight into the molecular mechanism of severe insulin resistance, and will aid early diagnosis, as well as providing potential novel targets for treating extreme insulin resistance.

Page 5 of 62 Diabetes

Introduction

Mutations of the insulin receptor (INSR) gene result in extreme insulin resistance and

dysglycemia (1), leading to several syndromes with various abnormal phenotypes that

depend on the severity of INSR dysfunction. Patients with Donohue syndrome (DS,

formerly known as leprechaunism) have the most severe insulin resistance (2,3) and

patients with type A insulin resistance syndrome (type AIR) display somewhat less

severe manifestations (4,5), while RabsonMendenhall syndrome (RMS) represents an

intermediate condition (6,7). Patients with type AIR can live beyond middle age and

present with hypertrichosis, acanthosis nigricans, and female hyperandrogenism.

Patients with RMS generally survive into childhood or early adulthood and their

characteristic symptoms are hypertrichosis, dysplastic dentition, and coarse and

dysmorphic facial features. Patients with DS seldom live beyond infancy. They have

dysmorphic facial features (socalled ‘elfin’appearance) and little subcutaneous fat.

INSR is a gene consisting of 22 exons and 21 introns. The proreceptor undergoes

glycosylation and dimerization, followed by translocation to the Golgi apparatus, and

then processing of the dimer to yield a heterotetramer composed of two αsubunits and

two βsubunits (8). Although there are no clear genotype–phenotype correlations for

INSR mutations causing severe insulin resistance, it has been suggested that

Diabetes Page 6 of 62

homozygous or compound heterozygous mutations of the αsubunit cause more severe syndromes (DS and RMS), whereas heterozygous βsubunit mutations lead to milder insulin resistance (9,10). Longo et al. reported that missense mutations causing the most severe manifestations affected the extracellular portion of INSR and markedly reduced binding of insulin (11).

Some researchers have performed structural analysis of mutations of various proteins other than INSR to predict clinical manifestations and establish structure– phenotype correlations (1214), and a structural bioinformatics approach should be useful for predicting the diverse phenotypes caused by monogenic mutations. However, there is no clear evidence of structurephenotype correlations in patients with severe insulin resistance due to INSR mutations. McKern et al. presented data on the structure of the extracellular portion of INSR, reporting that the extracellular portion of the monomer consists of a leucinerich repeat domain (L1), a cysteinerich region (CR), a second leucinerich repeat domain (L2), and three fibronectin type III (FnIII) domains

(FnIII1 to FnIII3) (15). Insulin binds to two sites on INSR, and the FnIII domains contain parts of the primary and secondary insulinbinding sites (15,16). FnIII2 contains the insert domain (ID) within which there is the αβ cleavage site and the

Page 7 of 62 Diabetes

carboxyterminal region of the αchain (αCT) involved in the primary insulinbinding

site.

In this study, we examined 4 unrelated families with severe insulin resistance, and

we identified 5 novel mutations of INSR and a gross deletion that removed exon 2. To

assess the impact of mutations causing DS on INSR expression, INSR activity, and

downstream signaling, we conducted a functional study in Chinese hamster ovary

(CHO) cells. Using mutation data from the NCBI ClinVar database, Human Gene

Mutation Database (HGMD), and UniProt database, we analyzed the distribution of

INSR missense mutations in patients with severe insulin resistance to investigate the

relationship between the mutation location and the severity of insulin resistance. We

also performed in silico structural analysis of pathogenic missense mutations, with the

aim of establishing structure–phenotype correlations.

Research Design and Methods

Subjects

We studied 4 patients with suspected insulin receptor abnormalities who were referred

to our hospital (Table 1). Two patients had RMS (RMS1 and RMS2), one patient had

DS (DS1), and one patient had type AIR (TypeAIR1). Detailed clinical information

Diabetes Page 8 of 62

is provided in the Supplementary Data. This research was approved by the ethics committee of The University of Tokyo (approval number: G3414 and G10077) and was implemented according to the approved guidelines. Parents gave written informed consent for genetic testing of their children. Genomic DNA was extracted from peripheral blood samples.

Sequencing of INSR

The 22 exons of INSR and its intronexon junctions were amplified by PCR using the 21 pairs of primers listed in Supplementary Table 1. Then the PCR products were purified and directly sequenced.

Comparative Genome Hybridization (CGH) Microarray

A 60mer oligonucleotidebased 4×44K CGH microarray (INSR array) was customdesigned using the Agilent SureDesign webbased application

(https://earray.chem.agilent.com/suredesign/). The INSR array contained 40,335 probes covering the entire INSR gene. The median probe spacing was 193 bp and the array focused on the 14.1 Mb genomic region encompassing INSR in 19p13.2. Normal male human reference DNA provided by Agilent in the SureTag Complete DNA Labeling Kit

Page 9 of 62 Diabetes

(Agilent Technologies, Santa Clara, CA) was the control for CGH analysis. After

digestion with AluI and RsaI, genomic DNA from the DS1 patient and his parents was

labeled with Cy5dUTP, while normal male human reference DNA was labeled with

Cy3dUTP. Purification of labeled products, array hybridization, washing, and scanning

were conducted according to the CGH Enzymatic Labeling kit protocol v.7.1 (Agilent

Technologies). Data analysis was performed using Agilent CytoGenomics 3.0.1.1

(Agilent Technologies). Copy number aberration calls were based on a minimum

regional absolute average log2 ratio of 0.25 and minimum contiguous probe count of 3.

For breakpoint analysis, a pair of primers was used to amplify the segment across the

breakpoint junction (Supplementary Table 1). Amplified junction fragments were

directly sequenced.

Plasmid construction

GFP taggedpCMVhuman INSR cDNA (Origene, Rockville, MD) was used. A mutant

INSR expression vector (p.V657F) with the point mutation (NM_000208.2:c.1969G>T)

was constructed by using the GeneArt SiteDirected Mutagenesis System (Invitrogen,

Carlsbad, CA) according to the manufacturer’s instructions. In the same way, mutant

INSR expression vectors with the following mutations of the FnIII domains (except for

Diabetes Page 10 of 62

the insert domain) were constructed: c.2504G>T (p.S835I), c.2525C>T (p.A842V), c.2453A>G (p.Y818C), c.1904C>T (p.S635L), c.2465T>C (p.L822P), c.2776C>T

(p.R926W), c.2810C>T (p.T937M), c.2621C>T (p.P874L), c.1975T>C (p.W659R), c.2633A>G (p.N878S), and c.2774T>C (p.I925T). Presence of the mutations were verified by Sanger sequencing.

Transfection of CHO cells and stimulation with insulin

CHO cells were maintained at 37oC in Nutrient F12 Mixture (HAM) medium

(Invitrogen) supplemented with 10% fetal calf serum in a humidified incubator with 5%

CO2/95% air. Transfections of either wildtype (WT) constructs or mutant constructs with FnIII mutations was performed with Lipofectamine 3000 (Invitrogen). After 72 hours, cells were starved of serum for 4 hours and stimulated with insulin (0, 10, or 100 nM) (Sigma, St. Louis, MO) for 5 min at 37°C before the phosphorylation assay. Cells were rinsed with icecold PBS and proteins were purified using MPER Mammalian

Protein Extraction Reagent (Thermo Scientific, Hudson, NH).

Western blot analysis

Protein samples were mixed with NuPAGE sample buffer with or without NuPAGE

Page 11 of 62 Diabetes

sample reducing agent (Invitrogen). The final concentration of DTT in samples with

reducing agent was 50 mM. Electrophoresis was performed using NuPAGE Novex

38% TrisAcetate Protein Gels (Life Technologies, Carlsbad, CA) and proteins were

transferred to a HybondP PVDF membrane (GE Healthcare, Milwaukee, WI). After

blocking with 5% skim milk in TBST, membranes were probed overnight at 4oC with

primary antibodies diluted in TBST, followed by secondary antibodies for detection

using ECL Prime Western Blotting Detection Reagent. An antibody specific for the

βsubunit of human INSR was purchased from Santa Cruz Technologies (sc711), while

antibodies targeting Akt (9272), phosphoINSR (Tyr1150/1151) (3024), and

phosphoAkt (Thr308) (9275) were from Cell Signaling Technology Japan. As the

secondary antibody, goat antirabbit IgGHRP (sc2004) was obtained from SantaCruz

Technologies. Images were captured with an LAS3000 (Fujifilm, Tokyo, Japan) and

were quantified using ImageJ software (NIH, Bethesda, MD).

Enrichment analysis of protein domains for missense mutations

We analyzed the distribution of INSR mutations in the four patients. We counted

missense mutations within the FnIII domains or the other domains of INSR that were

identified in our study or were registered in the HGMD, ClinVar, and UniProt databases.

Diabetes Page 12 of 62

Each mutation was assigned as a cause of DS, RMS, or type AIR based on source articles, and the diagnosis was checked against information from OMIM

(http://www.ncbi.nlm.nih.gov/omim). Next, we used Fisher's exact test to investigate whether mutations classified as causing DS or RMS were more frequent in the FnIII domains than mutations classified as causing the milder type AIR, with reference to

Guo et al. (17). We also similarly examined whether mutations causing type AIR were more frequent in the tyrosine kinase (TK) domain than mutations causing DS or RMS.

Structural analysis

The Xray crystal structure of INSR was obtained from PDB entry 4ZXB (18). Croll et al. presented 4ZXB, which only consists of the relatively wellordered protein and glycan residues, but they also presented an extended model of human INSR (Model S1) including the insert domain, which was subjected to energy minimization to obtain a physically reasonable configuration. Model S1 has also been used for in silico structural analysis, but it lacked the atomic coordinates for R759 S763 (including the αβ proteolytic processing site). To obtain these missing residues, loop modeling was performed with the SWISSMODEL homology modeling server

(http://swissmodel.expasy.org/) (19). Structural models of mutant INSR were built using

Page 13 of 62 Diabetes

SwissPdb viewer (20). Each amino acid residue was substituted and energy

minimization was performed to avoid steric hindrance. Then each mutant model and

wildtype structure were compared using Waals (Altif Laboratories, Inc. Tokyo).

Calculations for surface structure construction and electrostatic potential mapping were

performed by using eFsurf (http://efsite.hgc.jp/eFsurf/), and the resulting data were

visualized with Waals. To identify the folding nucleus of FnIII2 and FnIII3, nucleation

positions were detected by comparison with the third FnIII domain of human tenascin

(TNfn3), as described previously (21). TNfn3 was the first βsandwich protein to be

characterized in detail by Φvalue analysis and was deposited as PDBentry 1TEN (22).

Statistical data analysis

Fisher's exact test was performed for comparisons and p < 0.05 was considered

statistically significant. All analyses were done with R software.

Results

Identification of INSR mutations in the patients and parents

Sanger sequencing of INSR in the patients and their families revealed the mutations

shown in Fig. 1A. In this report, numbering of the amino acid residues in INSR is based

Diabetes Page 14 of 62

on the UniProtKB/SwissProt file P06213, in the same manner as previously reported

(23). Patient RMS1 was a compound heterozygote for two novel mutations, c.2504G>T

(p.S835I) and c.2525C>T (p.A842V), both of which were within FnIII. Patient RMS2 was a compound heterozygote for a novel mutation, c.2997T>G (p.Y999*), and c.766C>T (p.R256C) which was previously identified in a heterozygous patient with

RMS (24). Tyr999 is located near Pro997, which was affected by an INSR missense mutation previously detected in RMS (11). Patient TypeAIR1 was a compound heterozygote for a novel mutation, c.1465A>G (p.N489D), and c.3160G>A

(p.V1054M) which has not previously been identified in type AIR, although the same mutation was previously reported in a patient with DS (compound heterozygous with p.Trp659Arg in the αsubunit) (25). With regard to p.N489D, another mutation c.1466A>G (p.N489S) at the same amino acid position was previously described in a patient with type AIR (26). The mutant alleles were confirmed to have been inherited from the parents of each patient. Patient DS1 was heterozygous for a novel mutation, c.1969G>T (p.V657F), in FnIII inherited from his mother. The location of

V657 is near W659, which was affected by a missense mutation previously detected in another patient with DS (25). No other candidate mutations of INSR were detected in the four patients.

Page 15 of 62 Diabetes

Identification of a deletion involving exon 2 of INSR in the DS patient and his

father

To investigate the existence of a mutant allele not detected by Sanger sequencing, we

performed CGH microarray analysis in the DS1 patient and his parents. We found that

the patient and his father were heterozygous for a deletion mutation of INSR that

removed a sequence containing exon 2 (Fig. 1B), while there was no such deletion in

his mother. To determine the breakpoint, we created primers for the flanking sites and

performed PCR, obtaining a fragment of about 800 bp in the patient and his father, but

not in his mother (Fig. 1C). We determined the breakpoint junction by Sanger

sequencing (Fig. 1D), revealing a 24,792 bp deletion (Chr19:7,266,0557,290,846). The

junction sequences were a long interspersed element (LINE) and a short interspersed

element (SINE), with only two base pairs of microhomology at the breakpoint

(Supplementary Fig. 1).

Functional assessment of mutant INSR protein

To assess the impact of the p.V657F mutation in the FnIII domains of INSR, CHO cells

were transfected with WT or mutant forms of INSR and cell lysates were analyzed by

Diabetes Page 16 of 62

western blotting under reducing and nonreducing conditions using antiINSR antibodies.

Under reducing conditions, there was an increase of the proreceptor and a decrease of the mature receptor in mutant cells (Fig. 2A). To evaluate whether this mutation affected

INSR activity and downstream signaling, insulininduced phosphorylation was assayed in vitro. In cells expressing p.V657F, insulininduced autophosphorylation of INSR was significantly decreased compared with autophosphorylation in cells expressing the WT form (Fig. 2B). Posttranslational receptor processing involves multiple steps, including dimerization of the precursor form (proreceptor) and proteolytic cleavage of the dimeric form to yield the α2β2 tetramer. To investigate which step of posttranslational processing was impaired, western blot analysis was conducted under nonreducing conditions, revealing a predominance of high molecular weight oligomeric forms with both the WT and mutant receptors. These results showed that the mutant insulin proreceptor also underwent dimerization (Fig. 2C). Furthermore, phosphorylation of

Akt protein downstream target of the signaling pathway was also reduced in cells expressing the INSR p.V657F mutant compared to cells expressing WT INSR, but unphosphorylated Akt levels were not different (Fig. 2D). We also investigated the other missense mutations in the FnIII domains (Supplementary table 2, Supplementary table

3). It was found that mutations causing both DS and RMS showed substantially lower

Page 17 of 62 Diabetes

amount of the mature IR βsubunit expression than in cells with the WT receptor, while

amount of the mature IR βsubunit was higher with FnIII mutations causing RMS than

with mutations causing DS (Supplementary Fig. 2).

Analysis of the distribution of INSR mutations causing severe insulin resistance

Among our four patients with extreme insulin resistance, the patient with DS (DS1)

and one of the two patients with RMS (RMS1) had FnIII domain mutations, but the

other RMS patient (RMS2) and the patient with type AIR (TypeAIR1) did not.

Structural analysis of the extracellular portion of INSR (15) has provided insight into its

domain structure, which is shown in Fig. 3A. Because the αβ cleavage site and some

residues of both the primary and secondary insulinbinding sites are located within the

FnIII domains (Fig. 3A), we suspected that FnIII mutations might be associated with

more severe phenotypes. Therefore, we analyzed the distribution of INSR mutations to

identify the domains preferentially affected by mutations causing more severe insulin

resistance. We only assessed missense mutations, in the same manner as previously

reported (27), because it is more difficult to determine the impact of mutations and

localize important functional regions by analyzing nonsense mutations as well as

rearrangements and insertions/deletions compared with missense mutations (17). We

Diabetes Page 18 of 62

analyzed 82 INSR missense mutations that were detected in our study or registered as pathogenic in databases (Fig. 3B, Supplementary Table 4), and we found that the frequency of mutations affecting the FnIII domains was significantly higher in patients with DS (28.1%) than in patients with type AIR (3.7%) (p = 0.016, Fisher's exact test).

The frequency of FnIII mutations was also higher in patients with RMS (17.4%) than in patients with type AIR (3.7%), but the difference was not significant (p = 0.17). In addition, mutations of the TK domain showed a significantly higher frequency in patients with type AIR (59.3%) than in patients with DS (12.5%) (p = 0.00025) or patients with RMS (26.1%) (p = 0.024).

Structure-phenotype correlations

Mutations causing DS were preferentially associated with the FnIII domains of INSR, although there were also some mutations causing RMS or type AIR. Therefore, we performed structural analysis of missense mutations located in the FnIII domains to elucidate the relations with phenotypic severity.

The Xray crystal structures derived from PDB entry 4ZXB and its extended model (Model S1) were used for structural analysis. The structure of the dimeric extracellular portion of INSR (Model S1) (18) is shown in Fig. 3C. Because the model

Page 19 of 62 Diabetes

lacked residues encoding the αβ cleavage site, we complemented it by using

SWISSMODEL (Fig. 3D). FnIII2 has the same topology as other proteins in the

fibronectin type III family, i.e., seven βstrands composing two βsheets. The first sheet

consists of the A, B and E βstrands, while the second sheet consists of the C’, C, F and

G βstrands. The B, C, E and F βstrands form the common hydrophobic core of the

FnIII domains (Fig. 4A). The folding nucleus of TNfn3 (in layer 3 of the B, C, E, and F

strands), another protein belonging to the fibronectin type III family, is essential for

forming its topology, while the residues in layers 2 and 4 of the strands that pack onto

the folding nucleus contribute significantly towards stabilizing the transition state for

folding (21) (28). We compared folding of FnIII2 in INSR with that of TNfn3. When

the structure of FnIII2 in INSR was superimposed on the structure of TNfn3, a

rootmeansquare deviation (RMSD) of only 1.06 Å was observed over the structurally

equivalent positions (72 residues). TNfn3 residues I20, Y36, I59, and V70, which form

the folding nucleus, overlapped with L640, W659, I809, and I820 of FnIII2 and the

RMSD was only 0.40Å (Fig. 4B and C). These four residues of FnIII2 form the folding

nucleus. That is, residues W659 and I820 in one βsheet and residues I809 and L640 in

the opposite sheet form the folding nucleus of FnIII2 through hydrophobic interactions

(Supplementary Fig. 3). In the same way, the structure of FnIII3 was superimposed on

Diabetes Page 20 of 62

that of TNfn3, and the RMSD was only 1.29 Å over the structurally equivalent positions

(62 residues). The TNfn3 residues forming the folding nucleus overlapped with L869,

Y888, L913, and V923 of FnIII3 and the RMSD was only 0.43Å. These four residues were considered to form folding nucleus of FnIII3 (Supplementary Fig. 3,

Supplementary Fig. 4). In FnIII2 and FnIII3 of INSR, the hydrophobic core corresponding to the residues in layers 24 of the B, C, E, and F strands are also critical for stabilization of the FnIII domains.

Wildtype V657 is structurally close to the folding nucleus of FnIII2 and forms the hydrophobic core. This residue is in contact with L640, W659, I809, and I820, which form the folding nucleus. Using the SwissPdb viewer program, we substituted

V657 with phenylalanine in INSR. Insertion of a bulky phenylalanine caused steric clashes with residues L640, I809, and I820 of the neighboring folding nucleus, which destabilized the folding process and led to defective protein folding (Fig. 4D, E, F and

G). We found that S835I and A842V in FnIII2 caused RMS, and S835I created steric clashes with two neighboring residues (P625 and A824), while A842V produced a steric clash with the neighboring residue S630 (Supplementary Fig. 5). However, these mutations are distant from the folding nucleus and structural changes may be small, resulting in only localized structural destabilization.

Page 21 of 62 Diabetes

We analyzed 12 missense mutations located in FnIII, except for the insert domain,

identified in our study or registered as pathogenic in databases (Fig. 4H and I), and we

divided these mutations into three groups (Supplementary Table 2, Supplementary Data).

Group 1a mutations directly affect the folding nucleus that comprises critical residues

for folding of the FnIII domains (Fig. 4G and Supplementary Fig. 6A, B, and C),

resulting in defective folding. Group 1b mutations affect the hydrophobic core residues

packed onto the folding nucleus (Supplementary Fig. 6D, E, and F), and also

significantly destabilize the FnIII domains. Group 1 (1a and 1b) mutations cause DS.

The group 2 mutation causes loss of the hydrophobic interaction contributing to

stabilization of the domain structure (Supplementary Fig. 6G) and thus destabilizes the

domain to some degree. It has been registered in HGMD as causing DS, while Grasso et

al. reported an intermediate phenotype between DS and RMS in the mutation data

source article (29). Group 3 mutations are located away from the folding nucleus and

lead to small structural changes (Supplementary Fig. 5, Supplementary Fig. 6H and I),

only producing localized destabilization. These mutations cause RMS. The extent of the

structural changes caused by mutations in groups 13 is consistent with the clinical

phenotype. On the other hand, two other missense mutations of the insert domain

contained in FnIII have been reported (D734A and R762S (30,31)) that do not influence

Diabetes Page 22 of 62

the domain structure, but affect the functional region or processing site (Supplementary

Fig. 6J and K). The influence of these mutations is determined by factors other than structural defects, leading to a range of phenotypes.

Discussion

We studied 4 unrelated families with severe insulin resistance, and identified 5 novel mutations and a deletion that removed exon 2 of INSR. The patient with DS and one of two RMS patients had FnIII mutations. Using online databases, we demonstrated that missense mutations causing DS were significantly more frequent in the FnIII domains than mutations causing type AIR. This finding supports the importance of the FnIII domains, which contain the αβ cleavage site and part of the insulinbinding site of

INSR. We also found that missense mutations causing type AIR were significantly more frequent in the TK domain than those causing DS or RMS. Patients with DS or

RMS (extreme conditions presenting in infancy) have biallelic INSR defects that almost always display recessive inheritance, while patients with type AIR (less severe and usually diagnosed around puberty) may have a heterozygous mutation of the TK domain that causes insulin resistance by a dominant negative effect, unlike mutations of other INSR domains (3234). Heterozygosity of the mutation should lead to the

Page 23 of 62 Diabetes

formation of some fully functional wt/wt receptors, which would result in a less severe

phenotype.

INSR contains three tandem FnIII domains in its extracellular juxtamembrane

region (35). Each FnIII domain is a βsandwich protein with a Greek key motif and is

formed by packing two antiparallel βsheets to construct a hydrophobic core (36,37).

TNfn3 also belongs to the fibronectin type III family and previous studies have shown

that the folding mechanism is similar throughout this family. For structural analysis, we

compared folding of FnIII2 in INSR with folding of TNfn3, and identified the folding

nucleus of FnIII2. We substituted V657 in FnIII2 of patient DS1 with phenylalanine,

which was predicted to cause steric clashes with the folding nucleus that destabilized

the folding process and led to defective folding. While S835I and A842V (identified in

FnIII2 of patient RMS1 as causing RMS) also caused steric clashes with neighboring

residues, they were located away from the folding nucleus and unlikely to significantly

destabilize the domain structure.

Review of online databases showed that missense mutations of the FnIII domains

predicted to result in protein folding defects or significant destabilization of the domain

structure all caused DS (Supplementary Table 2). One mutation (D734A) causing DS

was not predicted to destabilize the hydrophobic core of the FnIII domains, but it is

Diabetes Page 24 of 62

located in αCT (part of the insulinbinding domain) and would cause distortion of the insulinbinding site (30). Mutations causing the less severe RMS probably did not have a large effect on FnIII folding or stability. These results indicate that prediction of the phenotypic expression of INSR mutations might be improved by adopting a structural bioinformatics approach in addition to biochemical data, particularly assessment of the reduction of insulin binding that Longo et al. proposed as corresponding to clinical severity (11).

Transfection of CHO cells with V657F mutation of INSR led to impaired receptor processing and autophosphorylation, as well as reduced phosphorylation of Akt. Under nonreducing conditions, the high molecular weight form of INSR (oligomeric form) was predominant when both WT and mutant receptors were analyzed. Therefore, the mutant proreceptor undergoes dimerization before excision of the subunit processing site, as does the native proreceptor (38). Thus, the mutation probably impairs proreceptor processing by disturbing the threedimensional structure of FnIII2 containing the αβ cleavage site. Several mutations outside the cleavage site that disturb

αβ cleavage have been reported, e.g., p.H236R (39) and p.N42K (40) are not within the cleavage site but retard several posttranslational processing steps, including proteolytic

αβ cleavage of INSR. In our patients, reduced expression of the mature receptor

Page 25 of 62 Diabetes

probably contributed to impaired intramolecular signal transduction, as reported

previously (41,42). Furthermore, we also conducted functional assessment of INSR

proteins with the other missense mutations in the FnIII domains (except for the insert

domain). Patient RMS1 was compound heterozygous for p.S835I and p.A842V.

Though the level of the mature IR βsubunit in cells expressing the p.S835I mutation

was much lower than in cells expressing the WT receptor, proreceptor processing was

less impaired in cells expressing p.A842V, resulting in a less severe phenotype in

patient RMS1 (Supplementary Fig. 2). The level of the mature IR βsubunit was

substantially lower in cells expressing mutations causing DS and RMS than in cells

expressing the WT receptor, while the mature IR βsubunit was not as low in cells

expressing the other FnIII mutations causing RMS (p.S635L and p.N878S) as in cells

expressing mutations causing DS. (Supplementary Fig. 2).

It is desirable to consider the properties of mutations causing DS or RMS in the

context of two mutant alleles. The severity of insulin resistance would be related to the

functional impact of the two mutations. The patients identified with 12 missense

mutations of the FnIII domains (except for the insert domain) showed either

homozygous or compound heterozygous mutations (Supplementary Table 3). Of the

FnIII mutations, those causing DS (Donohue syndrome) were either homozygous or

Diabetes Page 26 of 62

compound heterozygous with protein truncating mutation (nonsense and frameshift mutations) or deletions as well as missense mutations (p.A119V and p.A1055V) situated in functionally important sites. As for the missense mutations, it was reported that p.A119V markedly impaired insulin binding when the mutant receptor was expressed in vitro (11), whereas p.V1054M is located in the consensus sequence for

ATP binding and a patient with severe insulin resistance was reported to be heterozygous for another mutation p.A1055V at the neighboring amino acid position

(43). Taking into account results from functional assessment of INSR proteins with

FnIII mutations in this study, we speculated that severe FnIII domains mutations compound heterozygous with other mutations causing severe functional impairment result in deleterious functional impact, leading to DS. On the other hand, severe mutations, such as FnIII domains mutations, compound heterozygous with other mutations causing less severe functional impairment result in less severe form of RMS.

Detailed functional analysis (at the cellular and molecular levels) of mutations causing severe insulin resistance, combined with accumulation of clinical data would further delineate the properties of each mutation.

In patient DS1, we identified an inframe deletion in the region covering exon 2 of INSR. EBVtransformed lymphocytes from a patient with type AIR due to an

Page 27 of 62 Diabetes

inframe deletion of exon 2 of INSR mRNA were reported to show impairment of

insulin binding (44). The L1 domain of INSR coded by exon 2 interacts extensively

with αCT, which in turn interacts directly with insulin (16). Deletion of exon 2 is

thought to cause destabilization of αCT that binds to insulin in FnIII, leading to

impaired insulin binding by INSR mutants.

The syndromes caused by INSR mutations (DS, RMS, and type AIR) seem to

represent a broad spectrum of disease due to considerable variation in the severity of

receptor dysfunction, rather than each one being a distinct entity. Since each of the

syndromes caused by INSR mutations (DS, RMS, and type AIR) is rare, diagnosis of

the syndrome remains challenging. Ongoing efforts to apply genomics to health care on

a larger scale should allow collaboration in identifying patients with severe insulin

resistance and the causal mutations, leading to refinement of the diagnostic criteria for

these syndromes.

In conclusion, we identified 5 novel mutations of INSR and a deletion that

removed exon 2 in 4 patients with extreme insulin resistance. Missense mutations

causing DS were significantly more frequently located in the FnIII domains than those

causing the milder type AIR. According to structural analysis, DS was caused by all of

the missense mutations that were predicted to severely impair formation of the

Diabetes Page 28 of 62

hydrophobic core and stability of the FnIII domains, while RMS was caused by all of the mutations predicted to produce localized destabilization and not affect folding of the

FnIII domains. Thus, the genotypephenotype and structurephenotype correlations of

INSR mutations identified in this study provide insights into the molecular mechanisms of severe insulin resistance, would assist with early diagnosis of these syndromes, and could lead to new treatment approaches.

Data Availability.

The INSR mutations identified in this study have been deposited in NCBI ClinVar with accession numbers SCV000503034, SCV000503035, SCV000503036, and

SCV000503037.

Acknowledgments.

Parts of this study were presented at the 77th Scientific Sessions of the American

Diabetes Association, San Diego, California, 913 June 2017. The authors thank K.

Ishinohachi (Department of Diabetes and Metabolic Diseases, Graduate School of

Medicine, The University of Tokyo) for providing excellent technical support during this study.

Page 29 of 62 Diabetes

Funding.

This study was supported by a GrantinAid to N.S. for Scientific Research in Priority

Areas (C) from the Ministry of Education, Culture, Sports, Science and Technology of

Japan (MEXT). This work was also partly supported by a grantinaid for scientific

research from MEXT (to F.M., grant no. 16K07211) and by CREST, JST (grants to F.M.

and T.T.).

Duality of Interest.

No potential conflicts of interest relevant to this article were reported.

Author Contributions.

J.H., H.K., F.M., N.S. and T. Kadowaki designed the study and wrote the manuscript.

J.H., F.M., K.H., M.Tanaka, K.Suzuki, M.Takakura and N.S. conducted the

experimental research and analyzed the data. H.K., K.A., T. Kawamura, I.M.,

K.Satomura, T.I., K.A.B., T.T. and T.Y. contributed to data analysis and preparation of

the manuscript. H.I., S.T., and all coauthors read the manuscript and contributed to the

final version of the manuscript. T. Kadowaki is the guarantor of this work, and as such,

Diabetes Page 30 of 62

had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of data analysis.

Page 31 of 62 Diabetes

References

1. Kahn CR, Flier JS, Bar RS, Archer JA, Gorden P, Martin MM, et al. The syndromes of insulin resistance and acanthosis nigricans. Insulinreceptor disorders in man. N Engl J Med. 1976;294:739745. 2. Kadowaki T, Bevins CL, Cama A, Ojamaa K, MarcusSamuels B, Kadowaki H, et al. Two mutant alleles of the insulin receptor gene in a patient with extreme insulin resistance. Science. 1988;240:787790. 3. Krook A, Brueton L, O'Rahilly S. Homozygous nonsense mutation in the insulin receptor gene in infant with leprechaunism. Lancet. 1993;342:277278. 4. O'Rahilly S, Moller DE. Mutant insulin receptors in syndromes of insulin resistance. Clin Endocrinol (Oxf). 1992;36:121132. 5. Hegele RA. Monogenic forms of insulin resistance: apertures that expose the common metabolic syndrome Trends Endocrinol Metab. 2003;14:371377. 6. alGazali LI, Khalil M, Devadas K. A syndrome of insulin resistance resembling leprechaunism in five sibs of consanguineous parents. J Med Genet. 1993;30:470475. 7. Kadowaki H, Takahashi Y, Ando A, Momomura K, Kaburagi Y, Quin JD, et al. Four mutant alleles of the insulin receptor gene associated with genetic syndromes of extreme insulin resistance. Biochem Biophys Res Commun. 1997;237:516520. 8. De Meyts P, Whittaker J. Structural biology of insulin and IGF1 receptors: implications for drug design. Nature reviews Drug discovery. 2002;1:769783. 9. Musso C, Cochran E, Moran SA, Skarulis MC, Oral EA, Taylor S, et al. Clinical course of genetic diseases of the insulin receptor (type A and RabsonMendenhall syndromes): a 30year prospective. Medicine (Baltimore). 2004;83:209222. 10. Huang Z, Li Y, Tang T, Xu W, Liao Z, Yao B, et al. Hyperinsulinaemic hypoglycaemia associated with a heterozygous missense mutation of R1174W in the insulin receptor (IR) gene. Clin Endocrinol (Oxf). 2009;71:659665. 11. Longo N, Wang Y, Smith SA, Langley SD, DiMeglio LA, GiannellaNeto D. Genotypephenotype correlation in inherited severe insulin resistance. Hum Mol Genet. 2002;11:14651475. 12. Haider S, Islam B, D'Atri V, Sgobba M, Poojari C, Sun L, et al. Structurephenotype correlations of human CYP21A2 mutations in congenital adrenal hyperplasia. Proc Natl Acad Sci U S A. 2013;110:26052610. 13. Pallan PS, Lei L, Wang C, Waterman MR, Guengerich FP, Egli M. Research Resource: Correlating Human Cytochrome P450 21A2 Crystal Structure and Phenotypes of Mutations in Congenital Adrenal Hyperplasia. Mol Endocrinol.

Diabetes Page 32 of 62

2015;29:13751384. 14. Shabbeer J, Yasuda M, Benson SD, Desnick RJ. Fabry disease: identification of 50 novel alphagalactosidase A mutations causing the classic phenotype and threedimensional structural analysis of 29 missense mutations. Human genomics. 2006;2:297309. 15. McKern NM, Lawrence MC, Streltsov VA, Lou MZ, Adams TE, Lovrecz GO, et al. Structure of the insulin receptor ectodomain reveals a foldedover conformation. Nature. 2006;443:218221. 16. Menting JG, Whittaker J, Margetts MB, Whittaker LJ, Kong GK, Smith BJ, et al. How insulin engages its primary binding site on the insulin receptor. Nature. 2013;493:241245. 17. Guo YY, Zhang JY, Li XF, Luo HY, Chen F, Li TJ. PTCH1 gene mutations in Keratocystic odontogenic tumors: a study of 43 Chinese patients and a systematic review. PLoS One. 2013;8:e77305. 18. Croll TI, Smith BJ, Margetts MB, Whittaker J, Weiss MA, Ward CW, et al. HigherResolution Structure of the Human Insulin Receptor Ectodomain: MultiModal Inclusion of the Insert Domain. Structure. 2016;24:469476. 19. Biasini M, Bienert S, Waterhouse A, Arnold K, Studer G, Schmidt T, et al. SWISSMODEL: modelling protein tertiary and quaternary structure using evolutionary information. Nucleic Acids Res. 2014;42(Web Server issue):W252258. 20. Guex N, Peitsch MC. SWISSMODEL and the SwissPdbViewer: an environment for comparative protein modeling. Electrophoresis. 1997;18:27142723. 21. Lappalainen I, Hurley MG, Clarke J. Plasticity within the obligatory folding nucleus of an immunoglobulinlike domain. J Mol Biol. 2008;375:547559. 22. Leahy DJ, Hendrickson WA, Aukhil I, Erickson HP. Structure of a fibronectin type III domain from tenascin phased by MAD analysis of the selenomethionyl protein. Science. 1992;258:987991. 23. Goustin AS, AbouSamra AB. The "thrifty" gene encoding Ahsg/FetuinA meets the insulin receptor: Insights into the mechanism of insulin resistance. Cell Signal. 2011;23:980990. 24. Thiel CT, Knebel B, Knerr I, Sticht H, MullerWieland D, Zenker M, et al. Two novel mutations in the insulin binding subunit of the insulin receptor gene without insulin binding impairment in a patient with RabsonMendenhall syndrome. Mol Genet Metab. 2008;94:356362. 25. Jiang L, Liu C, Wang WQ, Ye L, Zhu N, Zhou WW, et al. Leprechaunism: an inherited insulin resistance syndrome caused by the defect of insulin receptor. Zhonghua

Page 33 of 62 Diabetes

Nei Ke Za Zhi. 2006;45:730733. 26. Kadowaki T, Kadowaki H, Rechler MM, SerranoRios M, Roth J, Gorden P, et al. Five mutant alleles of the insulin receptor gene in patients with genetic forms of insulin resistance. J Clin Invest. 1990;86:254264. 27. Lyst MJ, Ekiert R, Ebert DH, Merusi C, Nowak J, Selfridge J, et al. Rett syndrome mutations abolish the interaction of MeCP2 with the NCoR/SMRT corepressor. Nat Neurosci. 2013;16:898902. 28. Hamill SJ, Steward A, Clarke J. The folding of an immunoglobulinlike Greek key protein is defined by a commoncore nucleus and regions constrained by topology. J Mol Biol. 2000;297:165178. 29. Grasso V, Colombo C, Favalli V, Galderisi A, Rabbone I, Gombos S, et al. Six cases with severe insulin resistance (SIR) associated with mutations of insulin receptor: Is a Bartterlike syndrome a feature of congenital SIR? Acta Diabetol. 2013;50:951957. 30. Hart LM, Lindhout D, Van der Zon GC, Kayserilli H, Apak MY, Kleijer WJ, et al. An insulin receptor mutant (Asp707 > Ala), involved in leprechaunism, is processed and transported to the cell surface but unable to bind insulin. J Biol Chem. 1996;271:1871918724. 31. Yoshimasa Y, Seino S, Whittaker J, Kakehi T, Kosaki A, Kuzuya H, et al. Insulinresistant diabetes due to a point mutation that prevents insulin proreceptor processing. Science. 1988;240:784787. 32. Taylor SI. Lilly Lecture: molecular mechanisms of insulin resistance. Lessons from patients with mutations in the insulinreceptor gene. Diabetes. 1992;41:14731490. 33. Hojlund K, Wojtaszewski JF, Birk J, Hansen BF, Vestergaard H, BeckNielsen H. Partial rescue of in vivo insulin signalling in skeletal muscle by impaired insulin clearance in heterozygous carriers of a mutation in the insulin receptor gene. Diabetologia. 2006;49:18271837. 34. Leiter SM, Semple RK. Syndromes associated with mutations in the insulin signaling pathway. In Diabetes associated with single gene defects and chromosomal abnormalities. Barbetti F, Ghizzoni L, Guaraldi F, Eds. Front Diabetes. Basel, Karger, 2017, vol.25, p. 104118. 35. MarinoBuslje C, Mizuguchi K, Siddle K, Blundell TL. A third fibronectin type III domain in the extracellular region of the insulin receptor family. FEBS Lett. 1998;441:331336. 36. Hutchinson EG, Thornton JM. The Greek key motif: extraction, classification and analysis. Protein Eng. 1993;6:233245. 37. Zhang C, Kim SH. A comprehensive analysis of the Greek key motifs in protein

Diabetes Page 34 of 62

betabarrels and betasandwiches. Proteins. 2000;40:409419. 38. Olson TS, Bamberger MJ, Lane MD. Posttranslational changes in tertiary and quaternary structure of the insulin proreceptor. Correlation with acquisition of function. J Biol Chem. 1988;263:73427351. 39. Kadowaki T, Kadowaki H, Accili D, Yazaki Y, Taylor SI. Substitution of arginine for histidine at position 209 in the alphasubunit of the human insulin receptor. A mutation that impairs receptor dimerization and transport of receptors to the cell surface. J Biol Chem. 1991;266:2122421231. 40. Kadowaki T, Kadowaki H, Accili D, Taylor SI. Substitution of lysine for asparagine at position 15 in the alphasubunit of the human insulin receptor. A mutation that impairs transport of receptors to the cell surface and decreases the affinity of insulin binding. J Biol Chem. 1990;265:1914319150. 41. Jiang S, Fang Q, Zhang F, Wan H, Zhang R, Wang C, et al. Functional characterization of insulin receptor gene mutations contributing to RabsonMendenhall syndrome phenotypic heterogeneity of insulin receptor gene mutations. Endocr J. 2011;58:931940. 42. Sugibayashi M, Shigeta Y, Teraoka H, Kobayashi M. Characterization of unprocessed insulin proreceptors in COS 7 cells transfected with cDNA with Arg735Ser735 point mutation at the cleavage site. Metabolism. 1992;41:820826. 43. Rique S, Nogues C, Ibanez L, Marcos MV, Ferragut J, Carrascosa A, et al. Identification of three novel mutations in the insulin receptor gene in type A insulin resistant patients. Clin Genet. 2000;57:679. 44. Moritz W, BoniSchnetzler M, Stevens W, Froesch ER, Levy JR. Inframe exon 2 deletion in insulin receptor RNA in a family with extreme insulin resistance in association with defective insulin binding: a case report. Eur J Endocrinol. 1996;135:35763.

Page 35 of 62 Diabetes

Table 1—Clinical characteristics of patients with severe insulin resistance.

DS1 RMS1 RMS2 Type AIR1

Clinical RabsonMendenhall RabsonMendenhall Type A insulin Donohue syndrome diagnosis syndrome syndrome resistance

Age 1 13 5 15

Sex M F F F

Gestational age 35 weeks 4 days 37 weeks 40 weeks 5 days 38 weeks 5 days

Birth weight (g) 1,470 g 1,511 g 2,340 g 2,090 g

Length at birth 41.0 cm N/A 45.0 cm 45.0 cm (cm) Acanthosis Yes Yes Yes Yes nigricans

Hypertrichosis Yes Yes Yes Yes

elfin appearance of Other physical the face, lack of dental abnormality dental abnormality clitoromegaly findings subcutaneous fat

Abbreviations: N/A not assessed.

Diabetes Page 36 of 62

Figure legends

Fig. 1—INSR mutations in patients with extreme insulin resistance. A: Sanger sequencing of the identified mutations. B: CGH array data of patient DS1 and his

parents. Nucleotide positions are represented on the horizontal axis. Log2

(case/reference signal intensities on CGH array) data are shown on the vertical axis.

Dots with log2 (case/reference signal intensity ratio) <0 are displayed in red and those

>0 are shown in blue. C: The deletion allele could only be amplified in DS1 and his father, and the predicted PCR product size was 800 bp. The wildtype allele was too large to be amplified by these primers (25 kb), so no products were found in his mother.

The rightwards blue arrow represents the forward primer, while the leftwards blue arrow represents the reverse primer. D: Breakpoint junctions of the INSR deletion in patient DS1.

Fig. 2—Assessment of mutant INSR protein. A: Western blotting of wildtype and mutant INSR under reducing conditions. CHO cells were transfected with wildtype

INSR (WT), INSR containing the V657F mutation, or the empty vector (mock).

Western blotting was conducted using 5 g of total cellular protein to evaluate levels of

Page 37 of 62 Diabetes

the proreceptor and the mature βsubunit of the receptor. B: Analysis of

insulinstimulated autophosphorylation of the βsubunit of INSR. Transfected CHO

cells were stimulated with insulin (0, 10, or 100 nM) for 5 min. Then cell lysates were

analyzed to detect the autophosphorylated INSR βsubunit by western blotting using 25

g of total cellular protein under reducing conditions. C: Western blotting under

nonreducing conditions. CHO cells were transfected with wildtype INSR (WT) and

INSR containing the V657F mutation. Western blotting was performed using 5 g of

total cellular protein to assess whether the mutant insulin proreceptor underwent

dimerization. D: Phosphorylated and unphosphorylated Akt were detected by western

blotting using 5 g of total cellular protein under reducing conditions. Abbreviations:

Pproreceptor, phosphorylated proreceptor; Pβsubunit, phosphorylated βsubunit;

PAkt, phosphorylated Akt.

Fig. 3—Structure and missense mutations of INSR. A: Structural map of INSR based

on the result of the structural analysis performed by McKern et al (15). Interchain

disulfide bonds are shown as horizontal lines. B: Domains and mutations of INSR. Pins

show the loci of the missense mutations identified in our study and the known missense

mutations registered as pathogenic in databases as of October 2016. Red and purple pins

Diabetes Page 38 of 62

show biallelic defects (homozygous or compound heterozygous mutations) and heterozygous mutations, respectively. Missense mutations identified in our study are labeled. Rectangles denote the L1/L2 (InterPro ID: IPR000494), CR (IPR006211), FnIII

(IPR003961), and TK (IPR020635) domains, respectively. C: Inverted Vshaped arrangement of the domains within Model S1, an extended model of PDB entry 4ZXB.

The model represents the INSR ectodomain homodimer. One monomer is displayed as a tube structure, and the other as a spacefilling model. The dashed circle shows missing residues encoding the αβ proteolytic processing site. Each domain is colored as follows: L1, blue; CR, green; L2, orange; FnIII1, yellow; FnIII2, magenta; and FnIII3, red. D: Model S1 does not contain residues encoding the αβ cleavage site, and therefore was complemented using SWISSMODEL.

Fig. 4—Structural analysis of INSR missense mutations. A: INSR FnIII2 is formed from seven βstrands. Green triangles show residues forming the folding nucleus of

FnIII2, while magenta and orange pins represent the loci of the novel FnIII mutations we identified causing DS and RMS, respectively. B: Simplified view of the structure of

INSR FnIII2. The core of the protein consists of six layers. Four residues form the folding nucleus, as indicated by the green circle. The hydrophobic core residues are

Page 39 of 62 Diabetes

colored yellow. C: Simplified view of the structure of TNfn3 which also belongs to the

fibronectin type III family. D: Structure of FnIII2. Wildtype V657 (green) is in contact

with the folding nucleus. The hydrophobic core residues are labeled red, and residues

forming the folding nucleus are colored orange. Hydrophobic interactions are shown as

dashed lines. E: Mutation of V657 with insertion of a bulky phenylalanine (magenta)

causes steric clashes with the neighboring residues (L640, I809, and I820). F: Structure

of FnIII2 displayed as sticks and spacefilling models. G: The amino acid residues

involved in steric clashes with F657 are shown. H and I: Structures of FnIII2 (except

for the insert domain) and FnIII3, and location of missense mutations of FnIII

identified in this study or registered as pathogenic in databases. The residues affected by

mutations causing DS and RMS are colored green and light blue, respectively. The B

and E βstrands are colored red, while the C and F βstrands are presented in blue.

These strands form the common hydrophobic core of the FnIII domains.

Diabetes Page 40 of 62

Fig. 1—INSR mutations in patients with extreme insulin resistance.

162x154mm (300 x 300 DPI)

Page 41 of 62 Diabetes

Fig. 2—Assessment of mutant INSR protein.

128x93mm (300 x 300 DPI)

Diabetes Page 42 of 62

Fig. 3—Structure and missense mutations of INSR.

158x150mm (300 x 300 DPI)

Page 43 of 62 Diabetes

Fig. 4—Structural analysis of INSR missense mutations.

175x218mm (300 x 300 DPI)

Diabetes Page 44 of 62

SUPPLEMENTARY DATA

Structural Basis and Genotype-phenotype Correlations of INSR Mutations Causing Severe Insulin Resistance

Jun Hosoe1, Hiroko Kadowaki2, Fuyuki Miya1,3,4,5, Katsuya Aizu6, Tomoyuki Kawamura7, Ichiro Miyata8, Kenichi Satomura9, Takeru Ito10, Kazuo Hara11, Masaki Tanaka12, Hiroyuki Ishiura12, Shoji Tsuji12, Ken Suzuki1, Minaka Takakura1, Keith A. Boroevich4, Tatsuhiko Tsunoda3,4,5, Toshimasa Yamauchi1, Nobuhiro Shojima1 & Takashi Kadowaki1

1Department of Diabetes and Metabolic Diseases, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan 2Department of Pediatrics, Sanno Hospital, Tokyo, Japan. 3Department of Medical Science Mathematics, Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan 4Laboratory for Medical Science Mathematics, RIKEN Center for Integrative Medical Sciences, Yokohama, Japan 5CREST, JST, Tokyo, Japan 6Division of Endocrinology and Metabolism, Saitama Children's Medical Center, Saitama, Japan 7Department of Pediatrics, Osaka City University Graduate School of Medicine, Osaka, Japan 8Department of Pediatrics, The Jikei University School of Medicine, Tokyo, Japan 9Department of Pediatric Nephrology and Metabolism, Osaka Medical Center and Research Institute for Maternal and Child Health, Izumi, Japan 10Department of Pediatrics, Atsugi City Hospital, Kanagawa, Japan 11Department of Endocrinology and Metabolism, Saitama Medical Center, Jichi Medical University, Saitama, Japan 12Department of Neurology, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan

Page 45 of 62 Diabetes

Clinical courses of the 4 patients with extreme insulin resistance due to compound heterozygous mutations identified in the present study.

Patient DS1 with Donohue syndrome (DS) was a Japanese boy born to phenotypically normal parents. He was delivered at 35 weeks and 4 days of gestation by Caesarean section due to breech presentation. His birth weight was 1,470 g (–2.9 SD) and his length was 41 cm (–1.9 SD). Hypertrichosis and acanthosis nigricans were noted. He had dysmorphic features, including an elfin facial appearance and reduced subcutaneous fat stores. He developed hypoglycemia just after birth with a plasma glucose level of 43 mg/dL, but it resolved with intravenous infusion of glucose. On the 6th day after delivery, Insulin was started because of hyperglycemia, and was continued for 4 days with some effect. Then insulin therapy was stopped. However, hyperglycemia recurred 10 days later. At that time, the fasting plasma glucose and insulin levels were 276 mg/dL and 1630 µU/mL, respectively. Growth retardation was also noted. On day 51 of life, recombinant human IGF1 therapy was initiated, and it showed some effectiveness. At the age of 4 months, hypertrophic obstructive cardiomyopathy was identified by echocardiography. There was no subsequent progression of this cardiomyopathy. Patient RMS1 with Rabson–Mendenhall syndrome (RMS) was a Japanese girl born to healthy unrelated parents. She was delivered at 37 weeks of gestation with intrauterine growth restriction, and her birth weight was 1,511 g (small for gestational age). At the age of 10 years, glycosuria was detected by a school medical examination and she consulted a hospital, after which diabetes was diagnosed. On examination, her weight was 27.7 kg (–1.06 SD) and height was 129.4 cm (–1.76 SD). She had the dental abnormalities, including projecting upper and lower incisors and teeth that were irregularly placed and crowded. The plasma glucose and insulin levels were 266 mg/dL and 389 µU/mL, respectively, while HbA1c was 8.1% (65 mmol/mol). IGF1 therapy was initiated during her third hospital admission and glycemic control improved temporarily, but compliance with treatment decreased after discharge. Followup is ongoing with repeated hospitalization. Patient RMS2 with RMS was a Japanese girl who was small for gestational age when delivered at 40 weeks and 5 days of gestation. Her birth weight was 2,340 g (–2.1 SD) and her length was 45.0 cm (–2.7 SD). She was first seen at our hospital at 2 years and 8 months of age when she was found to have breast enlargement. She had also had acanthosis nigricans on the neck, axilla and groin, generalized hypertrichosis, dental dysplasia, and a small physique. Her weight was 9.7 kg (–1.9 SD), and her height was 83.7 cm (–1.8 SD). An OGTT was performed with dextrose oral solution (1.75 g/kg). Diabetes Page 46 of 62

The fasting plasma glucose and insulin levels were 56 mg/dL and 62.4 µU/mL, and the plasma insulin level increased to over 1,000 U/ml from 1560 min. She was treated with metformin and acarbose, and this treatment prevented hyperglycemia. Both parents were physically normal. Patient Type AIR1 with type A insulin resistance (type AIR) was a Japanese girl to phenotypically normal parents. She was delivered at 38 weeks and 5 days of gestation. Her birth weight was 2,090 g (–2.3 SD) and her length was 45 cm (–1.8 SD). She was first seen at our hospital at 11 years of age when glycosuria was detected by the school medical examination. Examination revealed acanthosis nigricans, generalized hypertrichosis and clitoromegaly. She had extreme insulin resistance with both hyperinsulinemia and severe resistance to exogenous insulin. Fasting glucose and insulin levels were 89 mg/dL and 279.3 µU/mL, respectively. Her HbA1c remained high at around 9.8% (84 mmol/mol) despite treatment with insulin (78 U/day), metformin and miglitol. When she was 14 years of old, recombinant IGF1 was administered with limited effect.

Structural changes introduced by mutations of FnIII (except for the insert domain) causing DS W659R: W659 is located on the Cstrand and was predicted to form the folding nucleus within FnIII2. W659 is in contact with V657, L807, and I809 which form the hydrophobic core. However, substitution of W659 by a smaller arginine residue would result in loss of contact with V657 and L807, creating a cavity within the hydrophobic core. The mutation also causes steric clashes with I809, Y818, and I820 (Supplementary Figure 6A). Y818C: Y818 is positioned on the Fstrand and is in contact with I638, W659, and L812 which form the hydrophobic core. Y818 forms a hydrogen bond with the main chain of R813 located in the EFloop. Substitution of Y818 by a smaller cysteine results in loss of contact with W659, I638, and L812. This mutation also causes loss of the hydrogen bond with the main chain of R813 (Supplementary Figure 6B). I925T: I925 is located on Fstrand and is in contact with V857, W871, V886, and V923, which form the hydrophobic core of FnIII3. Substitution by a smaller threonine would result in loss of contact with these residues and create a cavity within the hydrophobic core (Supplementary Figure 6C). L822P: L822 is located on the Fstrand and is in contact with the side chains of W642 and V657, which form the hydrophobic core. Its substitution by a proline leads to loss of contact with these residues and causes steric clashes with the main chain of A838 Page 47 of 62 Diabetes

(Supplementary Figure 6D). R926W: R926 is located on Fstrand. Substitution of R926 by a bulkier tryptophan would result in steric clashes with E885, T928, and W936, leading to structural changes of the neighboring main chains of A927 and I925, which form the hydrophobic core (Supplementary Figure 6E). T937M: T937 sits on an FGloop and is in contact with V857 and I925 which forms the hydrophobic core. Substitution by methionine would cause steric clashes with V857 and I925 (Supplementary Figure 6F). P874L: P874 is located on the BCloop and is in contact with I853, I881, Y884, and A927, which contribute to stabilizing the domain structure. Substitution of proline by leucine would interrupt these hydrophobic interactions (Supplementary Figure 6G). This mutation was identified in a patient who showed an intermediate phenotype between DS and RMS (1).

Structural changes introduced by mutations of FnIII (except for the insert domain) causing RMS S635L: S635 is located in the ABturn of FnIII2. Its substitution by a bulkier leucine side chain would result in steric clashes with P846 and E847 (Supplementary Figure 6H). N878S: N878 sits on a BCloop of FnIII3 and forms hydrogen bond with the side chain of D851. When N878 is replaced by serine, the hydrogen bond would be lost (Supplementary Figure 6I).

Structural changes introduced by mutations of the insert domain contained in FnIII causing severe insulin resistance D734A: Substitution by alanine would not destabilize the hydrophobic core of FnIII2. D734 is located in the αCT, which is part of the insulinbinding domain. Hart et al. reported that the mutation distorted the insulinbinding site in vitro (2). According to the electrostatic potential map, the mutation was predicted to change the calculated electrostatic potential surface of αCT, and thus might affect insulin binding (Supplementary Figure 6J). R762S: Proteolytic processing of a proreceptor leads to generation of the α and β subunits in INSR. R762 is located within the processing site of the proreceptor molecule. The R762S mutation changes the amino acid sequence within the cleavage site from RKRR to RKRS. Studies using EpsteinBarr virus (EBV)transformed lymphocytes of the patient with this mutation revealed impair processing of the Diabetes Page 48 of 62

proreceptor (3) (Supplementary Figure 6K). Page 49 of 62 Diabetes

Supplementary Fig. 1—Alignment of sequences flanking the breakpoint. The distal sequence (chr19:7,265,9037,266,202), proximal sequence (chr19:7,290,6947,290,994) and junction sequence are aligned. Two base pairs of microhomology (TC) at the breakpoint are shown in red letters. Distal and proximal sequences deleted from the junction fragment are shown in green letters. The proximal breakpoint is embedded within a short interspersed element (SINE) (chr19:7,290,8017,291,092; light blue dotted line), and the distal breakpoint is embedded within a long interspersed element (LINE) (chr19:7,265,9547,266,389; magenta line), as annotated by the RepeatMasker track from the UCSC Genome Browser.

Diabetes Page 50 of 62

Supplementary Fig. 2—Assessment of FnIII mutations in INSR protein. Lysates of CHO cells expressing wildtype and mutant INSR proteins were subjected to western blotting under reducing conditions. CHO cells was transfected with the wildtype INSR (WT) or with INSR proteins containing the following FnIII mutations (except for the insert domain): S835I, A842V, Y818C, S635L, L822P, R926W, T937M, P874L, W659R, N878S, and I925T. Transfected CHO cells were stimulated with insulin (0 or 100 nM) for 5 min. Then western blotting was done with 5 g of total cellular protein to detect the proreceptor and mature βsubunit of INSR. * Clinical phenotype as identified in the present study or in the mutation data source article. † The P874L mutation is registered in HGMD as causing DS, but the source article reported an intermediary phenotype between DS and RMS. Abbreviations: Pproreceptor, phosphorylated proreceptor; Pβsubunit, phosphorylated βsubunit. Page 51 of 62 Diabetes

Supplementary Fig. 3—Orthogonal views of the folding nucleus of fnIII-2 or FnIII-3 of INSR compared to views of TNfn3. The folding nucleus of FnIII2 in INSR is formed by residues L640, W659, I809, and I820 corresponding to I20, Y36, I59, and V70 in the core of TNfn3, while the folding nucleus of fnIII3 in INSR is formed by residues L869, Y888, L913, and V923 corresponding to I20, Y36, I59, and V70 in the core of TNfn3. These four residues are positioned in strands B, C, E, and F in the same core layer. The B and E βstrands are colored red, while the C and F βstrands are presented in blue. These strands form the common hydrophobic core of the FnIII domains.

Diabetes Page 52 of 62

Supplementary Fig. 4—Simplified structures of FnIII-3 in INSR (left) and TNfn3 (right) and the putative folding nucleus. (Upper panel) FnIII3 of INSR is formed by seven βstrands composing two βsheets. Green triangles show four residues forming the folding nucleus of FnIII3. Among FnIII mutations registered as pathogenic in the ClinVar, HGMD, and UniProt databases, magenta pins represent the loci of missense mutations causing DS and the orange pin shows the missense mutation causing RMS. (Lower panel) Simplified structures of FnIII3 of INSR (left) and TNfn3 (right). The core of each protein consists of six layers, while four residues form the folding nucleus (green circle). The hydrophobic core of FnIII3 (corresponding to the yellow residues in layers 24 of the B, C, E, and F strands) is important residues for stabilizing the structure of FnIII.

Page 53 of 62 Diabetes

Supplementary Fig. 5—Structural analysis of mutations identified in FnIII-2 in patient RMS-1. A: S835I in FnIII2 causes steric clashes with the neighboring residues P625 and A824. However, the mutation is not close to the folding nucleus. B: A842V in FnIII2 causes a steric clash with the neighboring residue S630, but the mutation is also located away from the folding nucleus. Residues involved in each mutation are colored green (wildtype) and magenta (mutant). (Left panel) The structure of FnIII2 is displayed in ribbon representation. Key residues are labeled and highlighted in stick form. Hydrogen bond is shown as blue dashed line. (Right panel) The structure of FnIII is shown as spacefilling models.

Diabetes Page 54 of 62

Page 55 of 62 Diabetes

Supplementary Fig. 6—Structural analysis of FnIII mutations causing severe insulin resistance. (A, B, C, D, E, F, G, H, I, J, and K) indicate the differences between wildtype and mutant INSR, corresponding to the amino acid substitutions W659R, Y818C, I925T, L822P, R926W, T937M, P874L, S635L, N878S, D734A and Diabetes Page 56 of 62

R762S. Residues involved in each mutation are colored green (wildtype) and magenta (mutant). (Left panel) The structure of FnIII is shown in ribbon representation. Key residues are labeled and highlighted in stick form. The hydrophobic core residues are labeled red and residues forming the folding nucleus are colored orange. Hydrogen bonds are shown as blue dashed lines, and hydrophobic interactions are shown as gray dashed lines. (Right panel) The amino acid residues influenced by the substitution, except for D734 and R762, are displayed as sticks and spacefilling models. For D734, the electrostatic potential surface of αCT, in which the residue is located, is shown. Blue and red surfaces indicate positive and negative potentials, respectively. For R762, the amino acid residues of the αβ cleavage site are shown as sticks and spacefilling models.

Page 57 of 62 Diabetes

Supplementary Table1—Sequences of the primers. Primers for amplification and sequencing of INSR Exon Forward (5'→3') Reverse (5'→3') 1 GCCTCCGCTCAGTATTTGTAGC GCTTCCCGCTCCCCCTACGC 2 TCTGCCCCTGATCCTTCTGATGC TGCCACCACCCACTATTCCCCG 3 GTGTTTGGTTGGCTTTCACTGTC AGAGCAGAGACCTCACTCATAGC 4 AGATGCCTGAGATGTCTGAAGG CTGAACGACCATCCTAAAAGTGC 5 AGGACTTCAGATTGTGTTCTAAGC CGCCTCAAGTGATTCACCCACG 6 ACTGAACAAGATCAACTCCGAGCAT TCCCCACCCACCACCAGTCCAT 7 GGGAATAGCAGCGTCACCTCTG GTGAGATTGTAAAAAGGAACCTAAG 8 GCATTAGATTGTTGGGTGAGTAAC TCTGGTAGTTCCTTCTACTTAGG 9 TAACTTGTGTGTCCCCCGCCATC TCCCTAGAGGTGAAGCAAAGTGC 10 GTATGTGTGGTGTGTTGTGTGATGT GGAAAGGGCTCCATTCAGACTCC 11 TCTAGCAAGTGATGGGAGCGAG TTTAGCAAGAGTGTGTTAGTGAAGG 12 TCCTGGCAGTCTGTATTGTAATCC GGGAATCACTTGACATAGGTGGC 13 AAAAGTTATACGCAGAAAGTAACCC GCACAGTACCTGATGAGAGAAGC 14 AGGAAAAGAAAAGAAACCATCAGGG TCAAAGAGGGCAAGCACCGCAG 15 ACTGCTGGAAAATCAGGATGTGG GCTTCGGATATAAAGGTTTGGGC 16 TCTAGGATTATGGGGATTCTGCTG TCATCTAAGACTACCGAGTGCTAG 17 CAGATGCCTGTCCTGTTCTCGG TTAGTGGAGTGAGGGGTGGGTAG 1819 TGCTGTGTGTGACATAGACACC ACTTAACGGCTCATTATAGACAAC 20 AGCCCATCTTCCCCCTTCACTTC AATGCCTACAGGATTAGTCAGGAC 21 CGTGTGTGTGTGCGTTTGCGTG ATATGGGAACTCAAGTGTGTGTACC 22 CCACACACACAGCCAGCATCTGA AGGAACGATCTCTGAACTCCATTG Primers for determining the breakpoint Forward (5'→3') Reverse (5'→3') CACCAGAAACAGACCCCAAAG TGTTCCACAACACCGGCTTA Diabetes Page 58 of 62

Supplementary Table 2—Results of structural analysis of missense mutations within FnIII (except for the insert domain) found in this study or registered as pathogenic in databases.

Group Mutation Ref. Phenotype* Structural Explanation Deduced Structural Defect of FnIII Group 1a V657F † DS The residue is in the folding The mutation W659R (4) nucleus or is involved in destabilizes the Y818C (5) hydrophobic interaction with folding process, I925T (7) the folding nucleus. resulting in a The mutation directly affects defective folding. the folding nucleus. The mutation introduces unavoidable steric crashed or causes loss of hydrophobic interaction with the folding nucleus.

Group 1b L822P (6) DS The mutation affects the The mutation R926W (7) hydrophobic core residues that results in a T937M (8) pack onto the folding nucleus significant to stabilize the domain destabilization of structure. the domain The mutation introduces structure. unavoidable steric crashes or causes loss of hydrophobic interaction.

Group 2 P874L (1) DS‡ The residue is involved in The mutation hydrophobic interactions that destabilizes the contribute to stabilizing the domain structure to domain structure. some extent. The mutation introduces causes loss of hydrophobic interaction.

Group 3 S635L (12) RMS The residue is located away The mutation S835I † from the folding nucleus. results in localized A842V † The mutation causes minor destabilization of N878S (13) structural change. the structure The mutation introduces steric around the mutation clashes or loss of hydrogen site. bonds.

Abbreviations: DS, Donohue syndrome; RMS, RabsonMendenhall syndrome. * Classification as DS, RMS, or type AIR is based on the mutation data source article. † Identified in the present study. ‡ Registered as causing DS in HGMD, but reported to cause an intermediate phenotype between DS and RMS in the mutation data source article (1). Page 59 of 62 Diabetes

Supplementary Table 3—Patients with severe insulin resistance and homozygous or compound heterozygous FnIII domain mutations of the INSR identified in the present study or in the mutation data source articles.

Patient Disease* Ref Mutation Group of Status No. FnIII mutation 1 DS † p.V657F § 1a het (DS1) A deletion that removes exon 2 § het 2 DS (4) p.W659R 1a het p.V1054M (located in the consensus het sequence for ATP binding in the TK domain) 3 DS (5) p.Y818C 1a het p.R890X het 4 DS (7) p.I925T 1a het p.A119V (located in L1 domain that contains het the primary insulin binding site) 5 DS (6) p.L822P 1b hom 6 DS (7) p.R926W 1b het A frameshift mutation het 7 DS (8) p.T937M 1b het A frameshift mutation het 8 DS‡ (1) p.P874L 2 het An inframe deletion het 9 RMS (12) p.S635L 3 het A deletion that removes exons 9 and 10 het 10 RMS † p.S835I § 3 het (RMS1) p.A842V § 3 het 11 RMS (13) p.N878S 3 het p.A1162V in tyrosine kinase domain het Abbreviations: DS, Donohue syndrome; RMS, RabsonMendenhall syndrome; het, heterozygous; hom, homozygous. * Classification as DS, RMS, or type AIR is based on the mutation data source article. † Examined in the present study. ‡ Registered as causing DS in HGMD, but reported to cause an intermediate phenotype between DS and RMS in the mutation data source article (1). § Novel mutations identified in the present study.

Diabetes Page 60 of 62

Supplementary Table 4—Missense mutations of the FnIII or tyrosine kinase domains of INSR that were found in this study or were registered as pathogenic in databases.

Disease Domain Position cDNA Protein Ref. DS FnIII chr19:7,163,103 NM_000208.2:c.1969GT NP_000199.2:p.V657F * DS FnIII chr19:7,163,097 NM_000208.2:c.1975TC NP_000199.2:p.W659R (4) DS FnIII chr19:7,152,767 NM_000208.2:c.2201AC NP_000199.2:p.D734A (2) DS FnIII chr19:7,142,916 NM_000208.2:c.2453AG NP_000199.2:p.Y818C (5) DS FnIII chr19:7,142,904 NM_000208.2:c.2465TC NP_000199.2:p.L822P (6) DS FnIII chr19:7,141,749 NM_000208.2:c.2621CT NP_000199.2:p.P874L (1) DS FnIII chr19:7,132,237 NM_000208.2:c.2774TC NP_000199.2:p.I925T (7) DS FnIII chr19:7,132,235 NM_000208.2:c.2776CT NP_000199.2:p.R926W (7) DS FnIII chr19:7,132,201 NM_000208.2:c.2810CT NP_000199.2:p.T937M (8) DS TK chr19:7,125,392 NM_000208.2:c.3160GA NP_000199.2:p.V1054M (4) chr19:7,122,903 NM_000208.2:c.3356GA NP_000199.2:p.R1119Q (9) DS TK chr19:7,122,904 NM_000208.2:c.3355CT NP_000199.2:p.R1119W (10) DS TK chr19:7,120,689 NM_000208.2:c.3601CT NP_000199.2:p.R1201W (11) DS TK chr19:7,120,674 NM_000208.2:c.3616GA NP_000199.2:p.E1206K (10) RMS FnIII chr19:7,163,168 NM_000208.2:c.1904CT NP_000199.2:p.S635L (12) RMS FnIII chr19:7,142,865 NM_000208.2:c.2504GT NP_000199.2:p.S835I * RMS FnIII chr19:7,142,844 NM_000208.2:c.2525CT NP_000199.2:p.A842V * RMS FnIII chr19:7,141,737 NM_000208.2:c.2633AG NP_000199.2:p.N878S (13) RMS TK chr19:7,125,443 NM_000208.2:c.3109GC NP_000199.2:p.V1037L (14) RMS TK chr19:7,125,332 NM_000208.2:c.3220GC NP_000199.2:p.E1074Q (1) RMS TK chr19:7,122,726 NM_000208.2:c.3428TC NP_000199.2:p.I1143T (15) RMS TK chr19:7,122,682 NM_000208.2:c.3472CT NP_000199.2:p.R1158W (15) RMS TK chr19:7,122,669 NM_000208.2:c.3485CT NP_000199.2:p.A1162V (13) RMS TK chr19:7,120,680 NM_000208.2:c.3610GA NP_000199.2:p.A1204T (16) type AIR FnIII chr19:7,143,083 NM_000208.2:c.2286GT NP_000199.2:p.R762S (3) type AIR TK chr19:7,125,485 NM_000208.2:c.3067AT NP_000199.2:p.I1023F (17) type AIR TK chr19:7,125,448 NM_000208.2:c.3104GT NP_000199.2:p.G1035V (18) type AIR TK chr19:7,125,409 NM_000208.2:c.3143GA NP_000199.2:p.G1048D (19) type AIR TK chr19:7,125,392 NM_000208.2:c.3160GA NP_000199.2:p.V1054M * type AIR TK chr19:7,125,388 NM_000208.2:c.3164CT NP_000199.2:p.A1055V (20) type AIR TK chr19:7,125,328 NM_000208.2:c.3224CA NP_000199.2:p.A1075D (21) type AIR TK chr19:7,122,718 NM_000208.2:c.3436GC NP_000199.2:p.G1146R (19) type AIR TK chr19:7,122,684 NM_000208.2:c.3470AG NP_000199.2:p.H1157R (22) type AIR TK chr19:7,122,673 NM_000208.2:c.3481GA NP_000199.2:p.A1161T (23) type AIR TK chr19:7,122,669 NM_000208.2:c.3485CA NP_000199.2:p.A1162E (24) type AIR TK chr19:7,122,663 NM_000208.2:c.3491AC NP_000199.2:p.N1164T (25) type AIR TK chr19:7,120,750 NM_000208.2:c.3540GA NP_000199.2:p.M1180I (26) type AIR TK chr19:7,120,688 NM_000208.2:c.3602GA NP_000199.2:p.R1201Q (27) type AIR TK chr19:7,120,672 NM_000208.2:c.3618GC NP_000199.2:p.E1206D (28) type AIR TK chr19:7,120,631 NM_000208.2:c.3659GT NP_000199.2:p.W1220L (28) type AIR TK chr19:7,119,574 NM_000208.2:c.3680GC NP_000199.2:p.W1227S (29)

Abbreviations: DS, Donohue syndrome; RMS, RabsonMendenhall syndrome; type AIR, type A insulin resistance. *: identified in this study.

Page 61 of 62 Diabetes

Reference

1. Grasso V, Colombo C, Favalli V, Galderisi A, Rabbone I, Gombos S, et al. Six cases with severe insulin resistance (SIR) associated with mutations of insulin receptor: Is a Bartterlike syndrome a feature of congenital SIR? Acta Diabetol. 2013;50(6):951957. 2. Hart LM, Lindhout D, Van der Zon GC, Kayserilli H, Apak MY, Kleijer WJ, et al. An insulin receptor mutant (Asp707 > Ala), involved in leprechaunism, is processed and transported to the cell surface but unable to bind insulin. J Biol Chem. 1996;271:1871918724. 3. Yoshimasa Y, Seino S, Whittaker J, Kakehi T, Kosaki A, Kuzuya H, et al. Insulinresistant diabetes due to a point mutation that prevents insulin proreceptor processing. Science. 1988;240:784787. 4. Jiang L, Liu C, Wang WQ, Ye L, Zhu N, Zhou WW, et al. [Leprechaunism: an inherited insulin resistance syndrome caused by the defect of insulin receptor]. Zhonghua Nei Ke Za Zhi. 2006;45:730733. 5. Nobile S, Semple RK, Carnielli VP. A novel mutation of the insulin receptor gene in a preterm infant with Donohue syndrome and heart failure. J Pediatr Endocrinol Metab. 2012;25:363366. 6. Hovnik T, Bratanic N, Podkrajsek KT, Kovac J, Paro D, Podnar T, et al. Severe progressive obstructive cardiomyopathy and renal tubular dysfunction in Donohue syndrome with decreased insulin receptor autophosphorylation due to a novel INSR mutation. Eur J Pediatr. 2013;172:11251129. 7. Longo N, Wang Y, Smith SA, Langley SD, DiMeglio LA, GiannellaNeto D. Genotypephenotype correlation in inherited severe insulin resistance. Hum Mol Genet. 2002;11:14651475. 8. Kadowaki H, Takahashi Y, Ando A, Momomura K, Kaburagi Y, Quin JD, et al. Four mutant alleles of the insulin receptor gene associated with genetic syndromes of extreme insulin resistance. Biochem Biophys Res Commun. 1997;237:516520. 9. Takahashi Y, Kadowaki H, Momomura K, Fukushima Y, Orban T, Okai T, et al. A homozygous kinasedefective mutation in the insulin receptor gene in a patient with leprechaunism. Diabetologia. 1997;40:412420. 10. DesboisMouthon C, Girodon E, Ghanem N, Caron M, Pennerath A, Conteville P, et al. Molecular analysis of the insulin receptor gene for prenatal diagnosis of leprechaunism in two families. Prenat Diagn. 1997;17:657663. 11. Whitehead JP, Soos MA, Jackson R, Tasic V, Kocova M, O'Rahilly S. Multiple molecular mechanisms of insulin receptor dysfunction in a patient with Donohue syndrome. Diabetes. 1998;47:13621364. 12. Brown RJ, Cochran E, Gorden P. Metreleptin improves blood glucose in patients with insulin receptor mutations. J Clin Endocrinol Metab. 2013;98(11):E17491756. 13. Moreira RO, Zagury RL, Nascimento TS, Zagury L. Multidrug therapy in a patient with RabsonMendenhall syndrome. Diabetologia. 2010;53:24542455. 14. Murphy R, Smith G, Isaac I, Hutchinson D, Semple RK. Novel mutation in insulin receptor gene identified after muscle biopsy in a Niuean woman with severe insulin resistance. Diabet Med. 2015;32:e2428. 15. Longo N, Wang Y, Pasquali M. Progressive decline in insulin levels in RabsonMendenhall syndrome. J Clin Endocrinol Metab. 1999;84:26232629. Diabetes Page 62 of 62

16. Abe Y, Sato T, Takagi M, Watanabe T, Nagayama Y, Hasegawa T, et al. A case of RabsonMendenhall syndrome with a novel mutation in the tyrosine kinase domain of the insulin receptor gene complicated by medullary sponge kidney. J Pediatr Endocrinol Metab. 2012;25:587590. 17. Moritz W, BoniSchnetzler M, Stevens W, Froesch ER, Levy JR. Inframe exon 2 deletion in insulin receptor RNA in a family with extreme insulin resistance in association with defective insulin binding: a case report. Eur J Endocrinol. 1996;135:357363. 18. Odawara M, Kadowaki T, Yamamoto R, Shibasaki Y, Tobe K, Accili D, et al. Human diabetes associated with a mutation in the tyrosine kinase domain of the insulin receptor. Science. 1989;245:6668. 19. Ogawa W, Iwamoto K, Mori H, Hashiramoto M, Miyake K, Sakaguchi K, et al. Two related cases of type A insulin resistance with compound heterozygous mutations of the insulin receptor gene. Diabetes Res Clin Pract. 2009;83:e7577. 20. Rique S, Nogues C, Ibanez L, Marcos MV, Ferragut J, Carrascosa A, et al. Identification of three novel mutations in the insulin receptor gene in type A insulin resistant patients. Clin Genet. 2000;57:6769. 21. Haruta T, Takata Y, Iwanishi M, Maegawa H, Imamura T, Egawa K, et al. Ala1048>Asp mutation in the kinase domain of insulin receptor causes defective kinase activity and insulin resistance. Diabetes. 1993;42:18371844. 22. Vambergue A, Lautier C, Valat AS, CortetRudelli C, Grigorescu F, Dewailly D. Followup study of two sisters with type A syndrome of severe insulin resistance gives a new insight into PCOS pathogenesis in relation to puberty and pregnancy outcome: a case report. Hum Reprod. 2006;21:12741278. 23. Moller DE, Yokota A, White MF, Pazianos AG, Flier JS. A naturally occurring mutation of insulin receptor alanine 1134 impairs tyrosine kinase function and is associated with dominantly inherited insulin resistance. J Biol Chem. 1990;265:1497914985. 24. Cama A, de la Luz Sierra M, Quon MJ, Ottini L, Gorden P, Taylor SI. Substitution of glutamic acid for alanine 1135 in the putative "catalytic loop" of the tyrosine kinase domain of the human insulin receptor. A mutation that impairs proteolytic processing into subunits and inhibits receptor tyrosine kinase activity. J Biol Chem. 1993;268:80608069. 25. DominguezGarcia A, Martinez R, Urrutia I, Garin I, Castano L. Identification of a novel insulin receptor gene heterozygous mutation in a patient with type A insulin resistance syndrome. J Pediatr Endocrinol Metab. 2014;27:561564. 26. Cama A, de la Luz Sierra M, Ottini L, Kadowaki T, Gorden P, ImperatoMcGinley J, et al. A mutation in the tyrosine kinase domain of the insulin receptor associated with insulin resistance in an obese woman. J Clin Endocrinol Metab. 1991;73:894901. 27. Moritz W, Froesch ER, BoniSchnetzler M. Functional properties of a heterozygous mutation (Arg1174>Gln) in the tyrosine kinase domain of the insulin receptor from a type A insulin resistant patient. FEBS Lett. 1994;351:276280. 28. Imamura T, Takata Y, Sasaoka T, Takada Y, Morioka H, Haruta T, et al. Two naturally occurring mutations in the kinase domain of insulin receptor accelerate degradation of the insulin receptor and impair the kinase activity. J Biol Chem. 1994;269:3101931027. 29. Moller DE, Flier JS. Detection of an alteration in the insulinreceptor gene in a Page 63 of 62 Diabetes

patient with insulin resistance, acanthosis nigricans, and the polycystic ovary syndrome (type A insulin resistance). N Engl J Med. 1988;319:15261529.