Loss of Twist1 in the Mesenchymal Compartment Promotes Increased

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12 This information is current as of October 2, 2021. Jiangning Tan, John R. Tedrow, Mehdi Nouraie, Justin A. Dutta, David T. Miller, Xiaoyun Li, Shibing Yu, Yanxia Chu, Brenda Juan-Guardela, Naftali Kaminski, Kritika Ramani, Partha S. Biswas, Yingze Zhang and Daniel J. Kass J Immunol 2017; 198:2269-2285; Prepublished online 8 Downloaded from February 2017; doi: 10.4049/jimmunol.1600610 http://www.jimmunol.org/content/198/6/2269 http://www.jimmunol.org/ Supplementary http://www.jimmunol.org/content/suppl/2017/02/07/jimmunol.160061 Material 0.DCSupplemental References This article cites 65 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/198/6/2269.full#ref-list-1 Why The JI? Submit online. by guest on October 2, 2021 • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Author Choice Freely available online through The Journal of Immunology Author Choice option Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2017 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Loss of Twist1 in the Mesenchymal Compartment Promotes Increased Fibrosis in Experimental Lung Injury by Enhanced Expression of CXCL12 Jiangning Tan,* John R. Tedrow,* Mehdi Nouraie,* Justin A. Dutta,* David T. Miller,* Xiaoyun Li,* Shibing Yu,* Yanxia Chu,* Brenda Juan-Guardela,† Naftali Kaminski,† Kritika Ramani,‡ Partha S. Biswas,‡ Yingze Zhang,* and Daniel J. Kass* Idiopathic pulmonary fibrosis (IPF) is a disease characterized by the accumulation of apoptosis-resistant fibroblasts in the lung. We have previously shown that high expression of the transcription factor Twist1 may explain this prosurvival phenotype in vitro. However, this observation has never been tested in vivo. We found that loss of Twist1 in COL1A2+ cells led to increased fibrosis characterized by very significant accumulation of T cells and bone marrow–derived matrix-producing cells. We found that Twist1- Downloaded from null cells expressed high levels of the T cell chemoattractant CXCL12. In vitro, we found that the loss of Twist1 in IPF lung fibroblasts increased expression of CXCL12 downstream of increased expression of the noncanonical NF-kB transcription factor RelB. Finally, blockade of CXCL12 with AMD3100 attenuated the exaggerated fibrosis observed in Twist1-null mice. Tran- scriptomic analysis of 134 IPF patients revealed that low expression of Twist1 was characterized by enrichment of T cell pathways. In conclusion, loss of Twist1 in collagen-producing cells led to increased bleomycin-induced pulmonary fibrosis, which is mediated by increased expression of CXCL12. Twist1 expression is associated with dysregulation of T cells in IPF patients. Twist1 may http://www.jimmunol.org/ shape the IPF phenotype and regulate inflammation in fibrotic lung injury. The Journal of Immunology, 2017, 198: 2269–2285. ne theory of the pathogenesis of idiopathic pulmonary proapoptotic stimuli compared with normal human fibroblasts fibrosis (IPF) suggests that a fibroblast of a very distinct (4). Recent data suggest that signals derived from the extracel- O phenotype, following an unknown injury, accumulates in lular matrix (5) drive the so-called IPF phenotype. Persistence of the lung—a fibroblast that paradoxically demonstrates little apo- fibroblasts in fibrotic lungs may be due to soluble survival factors ptosis (1) despite a microenvironment in the lung that is hostile to (6) or may result from cell-autonomous prosurvival signaling, cell survival (2, 3). Evidence for this theory comes from ex vivo possibly through Akt-related pathways (7, 8). We have previ- fibroblasts derived from IPF lungs that demonstrate resistance to ously shown that the transcription factor Twist1 is one of the most by guest on October 2, 2021 highly expressed transcription factors by gene expression profiling of *Dorothy P. and Richard P. Simmons Center for Interstitial Lung Disease and the IPF lungs and may mediate the pathologic prosurvival phenotype of Division of Pulmonary, Allergy, and Critical Care Medicine, University of Pittsburgh, Pittsburgh, PA 15213; †Section of Pulmonary, Critical Care, and Sleep Medicine, fibroblasts in vitro (3). However, in vivo data demonstrating the rel- Department of Internal Medicine, Yale University, New Haven, CT 06520; and evance of Twist1 to human or experimental pulmonary fibrosis have ‡Division of Rheumatology and Clinical Immunology, Department of Medicine, been lacking. University of Pittsburgh, Pittsburgh, PA 15261 Twist1 is a member of the basic helix–loop–helix family of ORCIDs: 0000-0002-4236-4430 (J.R.T.); 0000-0002-7223-3925 (D.T.M.); 0000- 0001-6947-2901 (Y.Z.); 0000-0001-6597-7830 (D.J.K.). transcription factors and is critical for mesoderm differentiation in Drosophila (9). Twist1 mutations in humans lead to Saethre– Received for publication April 7, 2016. Accepted for publication January 12, 2017. Chotzen syndrome (10), and Twist1 knockout mice die in utero due This work was supported by the Dorothy P. and Richard P. Simmons Center for Interstitial Lung Disease as funded by National Institutes of Health Grants to incomplete neural tube closure (11). Twist1 has multiple func- R01HL095397 and RC2HL101715 (to N.K.), DK104680-01A1 (to P.S.B.), and tions that may be relevant to the pathogenesis of pulmonary fibrosis, R01HL126990 (to D.J.K.). The Human Airway Cell and Tissue Core (supported in part by National Institutes of Health Grant P30 DK072506 and by a Cystic Fibrosis including inhibition of NF-kB inflammatory cells (12, 13). In Foundation research development program grant) provided human lung fibroblasts. cancer, Twist1 expression is a potent prosurvival factor portending a J.T., J.A.D., Y.C., B.J.-G., D.T.M., S.Y., X.L., and K.R. performed experiments; J.T., poor prognosis (14) and contributes to the resistance of cancers to J.R.T., M.N., N.K., P.S.B., Y.Z., and D.J.K. designed the experiments and analyzed chemotherapy-induced apoptosis (14). Related to the cancer phe- data; and J.T., J.R.T., Y.Z., and D.J.K. wrote the manuscript. notype, and perhaps most relevant to fibrosis is the role of Twist1 in Address correspondence and reprint requests to Dr. Daniel J. Kass, University of Pittsburgh, 3459 Fifth Avenue, MUH NW628, Pittsburgh, PA 15213. E-mail address: epithelial–mesenchymal transition (15, 16), a process that has been [email protected] suggested as a source of matrix-producing cells in fibrosis. We The online version of this article contains supplemental material. hypothesized that a strategy to silence expression of Twist1 in fi- Abbreviations used in this article: BAL, bronchoalveolar lavage; CAF, cancer- broblasts would block fibrosis by counteracting the prosurvival associated fibroblast; ChIP, chromatin immunoprecipitation; DLCO, diffusing capac- phenotype and thus promote a fibroblast that is susceptible to ap- ity for carbon monoxide; FVC, forced vital capacity; IPF, idiopathic pulmonary fibrosis; LGRC, Lung Genomics Research Consortium; MIF, macrophage migration optosis. For this study, we tested the hypothesis that transgenic mice inhibitory factor; siRNA, short interfering RNA; a-SMA, a-smooth muscle actin; with loss of Twist1 in the mesenchymal compartment would be Twist1 FL, Twist1 locus flanked by loxP sites; Twist1 WT, wild-type control Twist1. protected from experimental lung fibrosis. These animals, in the This article is distributed under The American Association of Immunologists, Inc., presence of tamoxifen, are engineered to express Cre recombinase Reuse Terms and Conditions for Author Choice articles. in collagen-expressing cells (COL1A2) (17) and to excise the Twist1 Copyright Ó 2017 by The American Association of Immunologists, Inc. 0022-1767/17/$30.00 locus flanked by loxP sites (Twist1 FL) (18). www.jimmunol.org/cgi/doi/10.4049/jimmunol.1600610 2270 Twist1 AND PULMONARY FIBROSIS Materials and Methods for a-SMA and surfactant protein C (Seven Hills Bioreagents, Cincinnati, Ethical statement OH) and CD45 (eBioscience, San Diego, CA). Cy5-conjugated secondary Abs were from Jackson ImmunoResearch Laboratories. Tissue was This work was approved by the Institutional Review Board and the In- mounted with DAPI and anti-fade solution. stitutional Animal Care and Use Committee of the University of Pittsburgh. Sircol assay for acid-soluble collagen Reagents Mouse lungs were perfused through the right ventricle with PBS. The left mAb against Twist (clone 2C1a) was purchased from Abcam (Cambridge, lungs were excised and flash-frozen in liquid nitrogen, followed by MA). Abs to RelB (clone C1E4) and RelA (clone C22B4) were from Cell lyophilization in preparation for collagen determination by the Sircol Signaling Technology (Danvers, MA). Anti-CXCL12 (clone K15C) was collagen assay. Lungs were homogenized in 0.5 M acetic acid with protease
Recommended publications
  • Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous

    Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous

    ONCOLOGY LETTERS 21: 58, 2021 Circular RNA hsa_circ_0005114‑miR‑142‑3p/miR‑590‑5p‑ adenomatous polyposis coli protein axis as a potential target for treatment of glioma BO WEI1*, LE WANG2* and JINGWEI ZHAO1 1Department of Neurosurgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130033; 2Department of Ophthalmology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China Received September 12, 2019; Accepted October 22, 2020 DOI: 10.3892/ol.2020.12320 Abstract. Glioma is the most common type of brain tumor APC expression with a good overall survival rate. UALCAN and is associated with a high mortality rate. Despite recent analysis using TCGA data of glioblastoma multiforme and the advances in treatment options, the overall prognosis in patients GSE25632 and GSE103229 microarray datasets showed that with glioma remains poor. Studies have suggested that circular hsa‑miR‑142‑3p/hsa‑miR‑590‑5p was upregulated and APC (circ)RNAs serve important roles in the development and was downregulated. Thus, hsa‑miR‑142‑3p/hsa‑miR‑590‑5p‑ progression of glioma and may have potential as therapeutic APC‑related circ/ceRNA axes may be important in glioma, targets. However, the expression profiles of circRNAs and their and hsa_circ_0005114 interacted with both of these miRNAs. functions in glioma have rarely been studied. The present study Functional analysis showed that hsa_circ_0005114 was aimed to screen differentially expressed circRNAs (DECs) involved in insulin secretion, while APC was associated with between glioma and normal brain tissues using sequencing the Wnt signaling pathway. In conclusion, hsa_circ_0005114‑ data collected from the Gene Expression Omnibus database miR‑142‑3p/miR‑590‑5p‑APC ceRNA axes may be potential (GSE86202 and GSE92322 datasets) and explain their mecha‑ targets for the treatment of glioma.
  • Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice

    Genetic and Genomic Analysis of Hyperlipidemia, Obesity and Diabetes Using (C57BL/6J × TALLYHO/Jngj) F2 Mice

    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Nutrition Publications and Other Works Nutrition 12-19-2010 Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P. Stewart Marshall University Hyoung Y. Kim University of Tennessee - Knoxville, [email protected] Arnold M. Saxton University of Tennessee - Knoxville, [email protected] Jung H. Kim Marshall University Follow this and additional works at: https://trace.tennessee.edu/utk_nutrpubs Part of the Animal Sciences Commons, and the Nutrition Commons Recommended Citation BMC Genomics 2010, 11:713 doi:10.1186/1471-2164-11-713 This Article is brought to you for free and open access by the Nutrition at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Nutrition Publications and Other Works by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. Stewart et al. BMC Genomics 2010, 11:713 http://www.biomedcentral.com/1471-2164/11/713 RESEARCH ARTICLE Open Access Genetic and genomic analysis of hyperlipidemia, obesity and diabetes using (C57BL/6J × TALLYHO/JngJ) F2 mice Taryn P Stewart1, Hyoung Yon Kim2, Arnold M Saxton3, Jung Han Kim1* Abstract Background: Type 2 diabetes (T2D) is the most common form of diabetes in humans and is closely associated with dyslipidemia and obesity that magnifies the mortality and morbidity related to T2D. The genetic contribution to human T2D and related metabolic disorders is evident, and mostly follows polygenic inheritance. The TALLYHO/ JngJ (TH) mice are a polygenic model for T2D characterized by obesity, hyperinsulinemia, impaired glucose uptake and tolerance, hyperlipidemia, and hyperglycemia.
  • Gwas Meta-Analysis of Intelligence – Supplementary Note 1

    Gwas Meta-Analysis of Intelligence – Supplementary Note 1

    GWAS META-ANALYSIS OF INTELLIGENCE – SUPPLEMENTARY NOTE 1 Supplementary Note for GWAS meta-analysis (N=279,930) identifies new genes and functional links to intelligence Jeanne E Savage1#, Philip R Jansen1,2#, Sven Stringer1, Kyoko Watanabe1, Julien Bryois3, Christiaan A de Leeuw1, Mats Nagel1, Swapnil Awasthi4, Peter B Barr5, Jonathan R I Coleman6,7, Katrina L Grasby8, Anke R Hammerschlag1, Jakob Kaminski4,9, Robert Karlsson3, Eva Krapohl6, Max Lam10, Marianne Nygaard11,12, Chandra A. Reynolds13, Joey W. Trampush14, Hannah Young15, Delilah Zabaneh6, Sara Hägg3, Narelle K Hansell16, Ida K Karlsson3, Sten Linnarsson17, Grant W Montgomery8,18, Ana B. Muñoz-Manchado17, Erin B Quinlan6, Gunter Schumann6, Nathan Skene17, Bradley T Webb19,20,21, Tonya White2, Dan E Arking22, Deborah K Attix23,24, Dimitrios Avramopoulos22,25, Robert M Bilder26, Panos Bitsios27, Katherine E Burdick28,29,30, Tyrone D Cannon31, Ornit Chiba-Falek32, Andrea Christoforou23, Elizabeth T Cirulli33, Eliza Congdon26, Aiden Corvin34, Gail Davies35, 36, Ian J Deary35,36, Pamela DeRosse37, Dwight Dickinson38, Srdjan Djurovic39,40, Gary Donohoe41, Emily Drabant Conley42, Johan G Eriksson43,44, Thomas Espeseth45,46, Nelson A Freimer26,Stella Giakoumaki47, Ina Giegling48, Michael Gill34, David C Glahn49, Ahmad R Hariri50, Alex Hatzimanolis51,52,53, Matthew C Keller54, Emma Knowles49, Bettina Konte48, Jari Lahti55,56, Stephanie Le Hellard23,40, Todd Lencz37,57,58, David C Liewald36, Edythe London26, Astri J Lundervold59, Anil K Malhotra37,57,58, Ingrid Melle40,46, , Derek Morris41,
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene

    Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene

    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
  • A Meta-Analysis of Gene Expression Data Highlights Synaptic Dysfunction

    A Meta-Analysis of Gene Expression Data Highlights Synaptic Dysfunction

    www.nature.com/scientificreports OPEN A meta-analysis of gene expression data highlights synaptic dysfunction in the hippocampus of brains with Alzheimer’s disease Saeedeh Hosseinian1, Ehsan Arefan2,3 ✉ , Hassan Rakhsh-Khorshid4, Mehdi Eivani 5, Ameneh Rezayof6, Hamid Pezeshk 7,8 & Sayed-Amir Marashi 1 Since the world population is ageing, dementia is going to be a growing concern. Alzheimer’s disease is the most common form of dementia. The pathogenesis of Alzheimer’s disease is extensively studied, yet unknown remains. Therefore, we aimed to extract new knowledge from existing data. We analysed about 2700 upregulated genes and 2200 downregulated genes from three studies on the CA1 of the hippocampus of brains with Alzheimer’s disease. We found that only the calcium signalling pathway enriched by 48 downregulated genes was consistent between all three studies. We predicted miR-129 to target nine out of 48 genes. Then, we validated miR-129 to regulate six out of nine genes in HEK cells. We noticed that four out of six genes play a role in synaptic plasticity. Finally, we confrmed the upregulation of miR-129 in the hippocampus of brains of rats with scopolamine-induced amnesia as a model of Alzheimer’s disease. We suggest that future research should investigate the possible role of miR-129 in synaptic plasticity and Alzheimer’s disease. This paper presents a novel framework to gain insight into potential biomarkers and targets for diagnosis and treatment of diseases. Alzheimer’s disease (AD) is the most common form of dementia. It mostly afects people aged 65 and older, pro- gresses slowly and leads to death in an average of nine years afer diagnosis.
  • Data Sheet 140

    Data Sheet 140

    Rudolf-Wissell-Str. 28a Background 37079 Göttingen, Germany Phone: +49 551-50556-0 RIMs are presynaptic active zone proteins that regulate Ca2+ triggered release of neurotransmitters. Fax: +49 551-50556-384 RIM 1α and RIM 2α are composed of an N-terminal zinc-finger domain, a central PDZ domain and two E-mail: [email protected] C-terminal C2 domains that are seperated by long alternatively spliced sequences. Web: www.sysy.com RIM 2β consists of a specific N-terminus, the central PDZ domain and the C-terminal C2 domains. The RIM 2 mRNA for RIM 2β is transcribed from an internal promoter of the RIM 2α gene. Shorter variants of RIM 2 which comprise only the C-terminal C2B domain and some flanking regions Cat.No. 140 303; Polyclonal rabbit antibody, 50 µg specific antibody (lyophilized) are referred to as NIM 2 / RIM 2γ and NIM 3 / RIM 3γ. Data Sheet Selected References for 140 303 RIM1/2-Mediated Facilitation of Cav1.4 Channel Opening Is Required for Ca2+-Stimulated Release in Mouse Rod Reconstitution/ 50 µg specific antibody, lyophilized. Affinity purified with the immunogen. Photoreceptors. Grabner CP, Gandini MA, Rehak R, Le Y, Zamponi GW, Schmitz F Storage Albumin was added for stabilization. For reconstitution add 50 µl H2O to get a 1mg/ml solution in PBS. Then aliquot and store at -20°C to -80°C until use. The Journal of neuroscience : the official journal of the Society for Neuroscience (2015) 3538: 13133-47. IHC, WB For detailed information, see back of the data sheet. Analysis of RIM Expression and Function at Mouse Photoreceptor Ribbon Synapses.
  • Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral

    Role of PDZ-Binding Motif from West Nile Virus NS5 Protein on Viral

    www.nature.com/scientificreports OPEN Role of PDZ‑binding motif from West Nile virus NS5 protein on viral replication Emilie Giraud1*, Chloé Otero del Val2, Célia Caillet‑Saguy2, Nada Zehrouni2, Cécile Khou5, Joël Caillet4, Yves Jacob3, Nathalie Pardigon5 & Nicolas Wolf2 West Nile virus (WNV) is a Flavivirus, which can cause febrile illness in humans that may progress to encephalitis. Like any other obligate intracellular pathogens, Flaviviruses hijack cellular protein functions as a strategy for sustaining their life cycle. Many cellular proteins display globular domain known as PDZ domain that interacts with PDZ‑Binding Motifs (PBM) identifed in many viral proteins. Thus, cellular PDZ‑containing proteins are common targets during viral infection. The non‑structural protein 5 (NS5) from WNV provides both RNA cap methyltransferase and RNA polymerase activities and is involved in viral replication but its interactions with host proteins remain poorly known. In this study, we demonstrate that the C‑terminal PBM of WNV NS5 recognizes several human PDZ‑ containing proteins using both in vitro and in cellulo high‑throughput methods. Furthermore, we constructed and assayed in cell culture WNV replicons where the PBM within NS5 was mutated. Our results demonstrate that the PBM of WNV NS5 is important in WNV replication. Moreover, we show that knockdown of the PDZ‑containing proteins TJP1, PARD3, ARHGAP21 or SHANK2 results in the decrease of WNV replication in cells. Altogether, our data reveal that interactions between the PBM of NS5 and PDZ‑containing proteins afect West Nile virus replication. Arboviruses include numerous human and animal pathogens that are important global health threats responsible for arboviroses.
  • The Molecular Machinery of Neurotransmitter Release Nobel Lecture, 7 December 2013

    The Molecular Machinery of Neurotransmitter Release Nobel Lecture, 7 December 2013

    The Molecular Machinery of Neurotransmitter Release Nobel Lecture, 7 December 2013 by Thomas C. Südhof Dept. of Molecular and Cellular Physiology, and Howard Hughes Medical Institute, Stanford University, USA. 1. THE NEUROTRANSMITTER RELEASE ENIGMA Synapses have a long history in science. Synapses were frst functionally demon- strated by Emil duBois-Reymond (1818–1896), were morphologically identifed by classical neuroanatomists such as Rudolf von Kölliker (1817–1905) and San- tiago Ramon y Cajal (1852–1934), and named in 1897 by Michael Foster (1836– 1907). Although the chemical nature of synaptic transmission was already sug- gested by duBois-Reymond, it was long disputed because of its incredible speed. Over time, however, overwhelming evidence established that most synapses use chemical messengers called neurotransmitters, most notably with the pioneer- ing contributions by Otto Loewi (1873–1961), Henry Dale (1875–1968), Ulf von Euler (1905–1983), and Julius Axelrod (1912–2004). In parallel, arguably the most important advance to understanding how synapses work was provided by Bernard Katz (1911–2003), who elucidated the principal mechanism of syn- aptic transmission (Katz, 1969). Most initial studies on synapses were carried out on the neuromuscular junction, and central synapses have only come to the fore in recent decades. Here, major contributions by many scientists, including George Palade, Rodolfo Llinas, Chuck Stevens, Bert Sakmann, Eric Kandel, and Victor Whittaker, to name just a few, not only confrmed the principal results obtained in the neuromuscular junction by Katz, but also revealed that synapses 259 6490_Book.indb 259 11/4/14 2:29 PM 260 The Nobel Prizes exhibit an enormous diversity of properties as well as an unexpected capacity for plasticity.
  • Rabbit Anti-Epac2/FITC Conjugated Antibody

    Rabbit Anti-Epac2/FITC Conjugated Antibody

    SunLong Biotech Co.,LTD Tel: 0086-571- 56623320 Fax:0086-571- 56623318 E-mail:[email protected] www.sunlongbiotech.com Rabbit Anti-Epac2/FITC Conjugated antibody SL10955R-FITC Product Name: Anti-Epac2/FITC Chinese Name: FITC标记的鸟嘌呤核苷酸交换因子4 CAMP GEFII; cAMP regulated guanine nucleotide exchange factor II; cAMP-GEFII; cAMP-regulated guanine nucleotide exchange factor II; CAMPGEFII; CGEF 2; CGEF2; Epac 2; EPAC2; Exchange factor directly activated by cAMP 2; Exchange Alias: protein directly activated by cAMP 2; Nbla00496; Putative protein product of Nbla00496; Rap guanine nucleotide exchange factor (GEF) 4; RAP guanine nucleotide exchange factor 4; RAPGEF 4; RAPGEF4; RPGF4_HUMAN. Organism Species: Rabbit Clonality: Polyclonal React Species: ICC=1:50-200IF=1:50-200 Applications: not yet tested in other applications. optimal dilutions/concentrations should be determined by the end user. Molecular weight: 116kDa Form: Lyophilized or Liquid Concentration: 1mg/ml immunogen: KLHwww.sunlongbiotech.com conjugated synthetic peptide derived from human Epac2 Lsotype: IgG Purification: affinity purified by Protein A Storage Buffer: 0.01M TBS(pH7.4) with 1% BSA, 0.03% Proclin300 and 50% Glycerol. Store at -20 °C for one year. Avoid repeated freeze/thaw cycles. The lyophilized antibody is stable at room temperature for at least one month and for greater than a year Storage: when kept at -20°C. When reconstituted in sterile pH 7.4 0.01M PBS or diluent of antibody the antibody is stable for at least two weeks at 2-4 °C. background: 3',5' cyclic adenosine monophosphate (cAMP)-regulated guanine nucleotide exchange Product Detail: factors Epac1 (cAMP-GEFI) and Epac2 (cAMP-GEFII) activate the ras family GTPases Rap1 and Rap2 by promoting GTP binding in a cAMP-dependent manner (1,2).
  • GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574

    GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574

    Figure S1. Boxplots of normalized samples in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. The x‑axes indicate samples, and the y‑axes represent the expression of genes. Figure S2. Volanco plots of DEGs in five datasets. (A) GSE25604, (B) GSE50161, (C) GSE66354, (D) GSE74195 and (E) GSE86574. Red nodes represent upregulated DEGs and green nodes indicate downregulated DEGs. Cut‑off criteria were P<0.05 and |log2 FC|>1. DEGs, differentially expressed genes; FC, fold change; adj.P.Val, adjusted P‑value. Figure S3. Transcription factor‑gene regulatory network constructed using the Cytoscape iRegulion plug‑in. Table SI. Primer sequences for reverse transcription‑quantitative polymerase chain reaction. Genes Sequences hsa‑miR‑124 F: 5'‑ACACTCCAGCTGGGCAGCAGCAATTCATGTTT‑3' R: 5'‑CTCAACTGGTGTCGTGGA‑3' hsa‑miR‑330‑3p F: 5'‑CATGAATTCACTCTCCCCGTTTCTCCCTCTGC‑3' R: 5'‑CCTGCGGCCGCGAGCCGCCCTGTTTGTCTGAG‑3' hsa‑miR‑34a‑5p F: 5'‑TGGCAGTGTCTTAGCTGGTTGT‑3' R: 5'‑GCGAGCACAGAATTAATACGAC‑3' hsa‑miR‑449a F: 5'‑TGCGGTGGCAGTGTATTGTTAGC‑3' R: 5'‑CCAGTGCAGGGTCCGAGGT‑3' CD44 F: 5'‑CGGACACCATGGACAAGTTT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' PCNA F: 5'‑GAACTGGTTCATTCATCTCTATGG‑3' F: 5'‑TGTCACAGACAAGTAATGTCGATAAA‑3' SYT1 F: 5'‑CAATAGCCATAGTCGCAGTCCT‑3' R: 5'‑TGTCAATCCAGTTTCAGCATCA‑3' U6 F: 5'‑GCTTCGGCAGCACATATACTAAAAT‑3' R: 5'‑CGCTTCACGAATTTGCGTGTCAT‑3' GAPDH F: 5'‑GGAAAGCTGTGGCGTGAT‑3' R: 5'‑AAGGTGGAAGAATGGGAGTT‑3' hsa, homo sapiens; miR, microRNA; CD44, CD44 molecule (Indian blood group); PCNA, proliferating cell nuclear antigen;
  • Analysis and Functional Evaluation of the Hair-Cell Transcriptome

    Analysis and Functional Evaluation of the Hair-Cell Transcriptome

    Analysis and functional evaluation of the hair-cell transcriptome Brian M. McDermott, Jr.*, Jessica M. Baucom, and A. J. Hudspeth† Howard Hughes Medical Institute and Laboratory of Sensory Neuroscience, The Rockefeller University, 1230 York Avenue, New York, NY 10021-6399 Contributed by A. J. Hudspeth, May 17, 2007 (sent for review March 31, 2007) An understanding of the molecular bases of the morphogenesis, ciated from the lagena, a receptor organ of the zebrafish’s ear. organization, and functioning of hair cells requires that the genes Linear amplification of the RNA from 200 hair cells yielded Ϸ40 expressed in these cells be identified and their functions ascer- ␮g of aRNA, an enhancement of Ϸ1 millionfold. The resultant tained. After purifying zebrafish hair cells and detecting mRNAs labeled aRNA was hybridized to an Affymetrix microarray with oligonucleotide microarrays, we developed a subtractive (Affymetrix, Santa Clara, CA) containing Ϸ15,000 oligonucle- strategy that identified 1,037 hair cell-expressed genes whose otide probe sets. Averaging the outcomes of three experiments cognate proteins subserve functions including membrane trans- (SI Data Set 1) resulted in the identification of 6,472 transcripts port, synaptic transmission, transcriptional control, cellular adhe- scored as ‘‘present’’ (SI Data Set 2). sion and signal transduction, and cytoskeletal organization. To In the second step, we defined the transcriptome from cells of assess the validity of the subtracted hair-cell data set, we verified a nonsensory organ, the liver (SI Data Set 1). Hepatocytes were the presence of 11 transcripts in inner-ear tissue. Functional eval- selected for the subtraction process for three reasons: they are uation of two genes from the subtracted data set revealed their nonneuronal and thus unlikely to express synaptic factors; they importance in hair bundles: zebrafish larvae bearing the seahorse lack cilia (http://members.global2000.net/bowser/cilialist.html) and ift 172 mutations display specific kinociliary defects.
  • Rimbp, a New Marker for the Nervous System of the Tunicate Ciona Robusta

    Rimbp, a New Marker for the Nervous System of the Tunicate Ciona Robusta

    G C A T T A C G G C A T genes Article Rimbp, a New Marker for the Nervous System of the Tunicate Ciona robusta 1,2, , 1, 1 2 Ugo Coppola y z , Paola Olivo y, Enrico D’Aniello , Christopher J. Johnson , Alberto Stolfi 2,* and Filomena Ristoratore 1,* 1 Biology and Evolution of Marine Organisms, Stazione Zoologica Anton Dohrn, 80121 Napoli, Italy; [email protected] (U.C.); [email protected] (P.O.); [email protected] (E.D.) 2 School of Biological Sciences, Georgia Institute of Technology, Atlanta, GA 30332, USA; [email protected] * Correspondence: alberto.stolfi@biosci.gatech.edu (A.S.); fi[email protected] (F.R.) These authors contributed equally to the work. y Current Address: The Heart Institute and Division of Molecular Cardiovascular Biology, Cincinnati z Children’s Hospital Medical Center, Cincinnati, OH 45229, USA. Received: 21 July 2020; Accepted: 25 August 2020; Published: 27 August 2020 Abstract: Establishment of presynaptic mechanisms by proteins that regulate neurotransmitter release in the presynaptic active zone is considered a fundamental step in animal evolution. Rab3 interacting molecule-binding proteins (Rimbps) are crucial components of the presynaptic active zone and key players in calcium homeostasis. Although Rimbp involvement in these dynamics has been described in distantly related models such as fly and human, the role of this family in most invertebrates remains obscure. To fill this gap, we defined the evolutionary history of Rimbp family in animals, from sponges to mammals. We report, for the first time, the expression of the two isoforms of the unique Rimbp family member in Ciona robusta in distinct domains of the larval nervous system.