DOCSLIB.ORG

Full Text (PDF)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Full Text (PDF) Published OnlineFirst April 26, 2017; DOI: 10.1158/0008-5472.CAN-16-3146 Cancer Molecular and Cellular Pathobiology Research tRF/miR-1280 Suppresses Stem Cell–like Cells and Metastasis in Colorectal Cancer Bingqing Huang1,2, Huipeng Yang1, Xixi Cheng1, Dan Wang1, Shuyu Fu1, Wencui Shen3, Qi Zhang1, Lijuan Zhang1, Zhenyi Xue1, Yan Li1, Yurong Da1, Qing Yang4,5, Zesong Li6, Li Liu7, Liang Qiao8, Ying Kong9, Zhi Yao1, Peng Zhao4,5, Min Li10,11, and Rongxin Zhang1,12 Abstract Several studies have shown that tRNAs can be enzymatically tasis. Notably, tRF/miR-1280–mediated inactivation of Notch cleaved to generate distinct classes of tRNA-derived fragments signaling suppressed CSC phenotypes, including by direct (tRF). Here, we report that tRF/miR-1280, a 17-bp fragment transcriptional repression of the Gata1/3 and miR-200b genes. derived from tRNALeu and pre-miRNA, influences Notch sig- These results were consistent with findings of decreased levels naling pathways that support the function of cancer stem-like of miR-200b and elevated levels of JAG2, Gata1, Gata3, Zeb1, cells (CSC) in colorectal cancer progression. tRF/miR-1280 and Suz12 in colorectal cancer tissue specimens. Taken togeth- expression was decreased in human specimens of colorectal er, our results established that tRF/miR-1280 suppresses colo- cancer. Ectopic expression of tRF/miR-1280 reduced cell pro- rectal cancer growth and metastasis by repressing Notch sig- liferation and colony formation, whereas its suppression naling pathways that support CSC phenotypes. Furthermore, reversed these effects. Mechanistic investigations implicated they provide evidence that functionally active miRNA can be the Notch ligand JAG2 as a direct target of tRF/miR-1280 derived from tRNA, offering potential biomarker and thera- binding through which it reduced tumor formation and metas- peutic uses. Cancer Res; 77(12); 3194–206. Ó2017 AACR. Introduction Transfer RNA-derived RNA fragments (tRF) belong to a family of short noncoding RNAs (ncRNA) that are present in most Colorectal cancer, which is oneofthemostlethaldiseases organisms (4). tRNA-derived fragments were first confirmed and the third leading cause of cancer-related deaths, is a disease in the 1970s (5). Recently, many studies have shown that caused by genetic and epigenetic alterations (1, 2). Approxi- these tRNA-derived fragments can be produced by multiple mately 40% to 50% of human colorectal cancer cases present RNA enzymes and ribonuclease, which play important roles in with metastasis at the time of diagnosis or develop distant regulating translation, similar to miRNAs (6–9). Most miRNA recurrence after therapy, and the median overall survival of genes are intergenic or originate from an antisense to neigh- metastatic colorectal cancer is less than 2 years (3). Therefore, bouring genes and are transcribed as independent units (10). new diagnostic markers and therapeutic targets are needed. Maute and colleagues have reported that a tRNA-derived Small non–protein-coding RNAs (ncRNA; including miRNA, miRNA named CU1276 is dicer dependently derived from piRNA, etc.) play important roles in regulating gene expression. cleavage in the 30 T arm loop of tRNA (7). The stress-activated 1Department of Immunology, Research Center of Basic Medical Sciences, Key Oklahoma Health Sciences Center, Oklahoma City, Oklahoma. 11Department of Laboratory of Immune Microenvironment and Diseases of Educational Ministry Surgery, The University of Oklahoma Health Sciences Center, Oklahoma City, of China, Tianjin Medical University, Tianjin, China. 2Department of Pathology, Oklahoma. 12Laboratory of Immunology and Inflammation, Guangdong Phar- Institute of Hematology and Blood Diseases Hospital, Chinese Academy of maceutical University, Guangzhou, China. Medical Sciences and Peking Union Medical College, Tianjin, China. 3Tianjin Eye Hospital, Tianjin Key Laboratory of Ophthalmology and Vision Science, Clinical Note: Supplementary data for this article are available at Cancer Research College of Ophthalmology, Tianjin Medical University, Tianjin, China. 4Depart- Online (http://cancerres.aacrjournals.org/). ment of Colorectal Cancer, Tianjin Medical University Cancer Institute and B. Huang and H. Yang contributed equally to this article. Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer 5 Prevention and Therapy, Tianjin, China. Department of Genitourinary Oncology, Corresponding Authors: Rongxin Zhang, Tianjin Medical University, No. 22 Tianjin Medical University Cancer Institute and Hospital, National Clinical Qi Xiang Tai Road, Mail Box 197, Tianjin 300070, China. Phone: 8622-8333- Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, 6563; Fax: 8622-8333-6517; E-mail: [email protected]; Peng Zhao, 6 Tianjin, China. Shenzhen Key Laboratory of Genitourinary Tumor, Shenzhen Department of Colorectal Cancer, Tianjin Medical University Cancer Institute Second People's Hospital, First Affiliated Hospital of Shenzhen University, and Hospital, Tianjin, China. E-mail: [email protected]; and Ying Kong, 7 Shenzhen, China. Department of Radiology, The University of Texas South- Department of Biochemistry and Molecular Biology, Dalian Medical Univer- 8 western Medical Center, Dallas, Texas. Storr Liver Centre, Westmead Millennium sity, Dalian, China. E-mail: [email protected] Institute for Medical Research, The University of Sydney at Westmead Hospital, 9 Westmead, New South Wales, Australia. Department of Biochemistry and doi: 10.1158/0008-5472.CAN-16-3146 Molecular Biology, Liaoning Key Lab of Glycobiology and Glycoengn, Dalian Medical University, Dalian, China. 10Department of Medicine, The University of Ó2017 American Association for Cancer Research. 3194 Cancer Res; 77(12) June 15, 2017 Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst April 26, 2017; DOI: 10.1158/0008-5472.CAN-16-3146 tRF/miR-1280 Represses Colorectal Cancer via Notch Signaling ribonuclease angiogenin can also cleave mature tRNA in the Patients and clinical tissue specimens anticodon loop to produce tRF/tiRNAs (8, 9). One recent study The collection of human colorectal cancer tissues consisted of showed that a novel class of tRFs suppresses the stability of surgically resected primary colorectal cancer specimens, which multiple oncogenic transcripts in breast cancer cells by displa- were obtained from the Shenzhen Second People's Hospital and cing their 30 untranslated regions (UTR) from the RNA-binding Tianjin Medical University Cancer Institute and Hospital (Tianjin, protein YBX1 (11). Therefore, tRFs/tiRNA could be new diag- China). Total RNA of fresh-frozen material was isolated using nostic markers and therapeutic targets in cancer therapy. TRIzol reagent (Invitrogen). Total RNA (2 mg) was used for the Many recent studies have reported the expression and role of synthesis of first-strand cDNA using M-MLV reverse transcriptase "miR-1280" in various cancer types (12–17). In melanoma (Invitrogen). qRT-PCR was performed using the SYBR Green Mix cells, "miR-1280" displays antitumor activity by regulating the (Roche). proto-oncogene Src (12). "miR-1280" can inhibit invasion and metastasis by targeting Rock1 in bladder cancer cells, and the Northern blotting high-miR-1280 bladder cancer group had significantly higher RNA was extracted with the RNA Sample Loading Buffer overall survival probability compared with the low-miR-1280 without Ethidium Bromide (Sigma) to the RNA sample at a group (13). In medulloblastoma, the inhibition of "miR-1280" ratio of 2:1. Just before loading, the samples were heated to 65C increases JAG2 expression; thus, there may be a PDGFRb/c- for 10 minutes and chilled on ice. All appliances were treated by myc/miR-1280/JAG2 regulating axis, and higher JAG2 levels are 0.1% DEPC water. RNAs were separated using 15% denaturing associated with high metastatic dissemination at diagnosis and polyacrylamide gel and electrophoretically transferred to Bright- a poor outcome in medulloblastoma patients (14). However, Star-Plus Positively Charged Nylon Membranes (Thermo). whether "miR-1280" can directly target JAG2 and regulate its Hybridization with 50 and 30-bioth–labeled DNA probes downstream signaling is still unclear. Meng and colleagues (tRF/miR-1280 (probe 1): GGGTGGCAGCGGTGGGA; pre- found that "miR-1280" can suppress the proliferation and 1280 (probe 2): GTGAGTGCTGATGCCTGG; tRNALeu (probe invasion of thyroid carcinoma by targeting estrogen receptor 3): GCCTTAGACCGCTCGGCCACGCTA; U6: ATATGGAACG- a (15). Interestingly, Xu and colleagues found a higher expres- CTTCACGAATT) was performed in PerfectHyb Plus hybridiza- sion of "miR-1280" in 72 non–small cell lung cancer tissues tion buffer (Sigma) at 42C overnight. Membranes were then compared with distal normal tissues by RT-PCR (16). Another washed, blocked, and incubated with an anti-bioth antibody. group has reported that "miR-1280" is upregulated 2.1-fold in The antibody–antigen complexes were washed and equilibrated colorectal cancer and downregulated 2.3-fold in pancreatic and then detected using the Chemiluminescent Nucleic Acid cancer by microarray analysis (17). "miR-1280" shows antitu- Detection Module (Thermo Fisher Scientific) following the mor activity in most cancers. However, Schopman and collea- manufacturer's protocol. tRF/miR-1280 mimics fragment: 50- gues proposed that the sequence annotated as miR-1280 is a UCCCACCGCUGCCACCC-30 and mimics control: 50-UUGUA- noncoding
Load more

Recommended publications
  • Angiocrine Endothelium: from Physiology to Cancer Jennifer Pasquier1,2*, Pegah Ghiabi2, Lotf Chouchane3,4,5, Kais Razzouk1, Shahin Rafi3 and Arash Rafi1,2,3
    Pasquier et al. J Transl Med (2020) 18:52 https://doi.org/10.1186/s12967-020-02244-9 Journal of Translational Medicine REVIEW Open Access Angiocrine endothelium: from physiology to cancer Jennifer Pasquier1,2*, Pegah Ghiabi2, Lotf Chouchane3,4,5, Kais Razzouk1, Shahin Rafi3 and Arash Rafi1,2,3 Abstract The concept of cancer as a cell-autonomous disease has been challenged by the wealth of knowledge gathered in the past decades on the importance of tumor microenvironment (TM) in cancer progression and metastasis. The sig- nifcance of endothelial cells (ECs) in this scenario was initially attributed to their role in vasculogenesis and angiogen- esis that is critical for tumor initiation and growth. Nevertheless, the identifcation of endothelial-derived angiocrine factors illustrated an alternative non-angiogenic function of ECs contributing to both physiological and pathological tissue development. Gene expression profling studies have demonstrated distinctive expression patterns in tumor- associated endothelial cells that imply a bilateral crosstalk between tumor and its endothelium. Recently, some of the molecular determinants of this reciprocal interaction have been identifed which are considered as potential targets for developing novel anti-angiocrine therapeutic strategies. Keywords: Angiocrine, Endothelium, Cancer, Cancer microenvironment, Angiogenesis Introduction of blood vessels in initiation of tumor growth and stated Metastatic disease accounts for about 90% of patient that in the absence of such angiogenesis, tumors can- mortality. Te difculty in controlling and eradicating not expand their mass or display a metastatic phenotype metastasis might be related to the heterotypic interaction [7]. Based on this theory, many investigators assumed of tumor and its microenvironment [1].
    [Show full text]
  • Inverse Expression States of the BRN2 and MITF Transcription Factors in Melanoma Spheres and Tumour Xenografts Regulate the NOTCH Pathway
    Oncogene (2011) 30, 3036–3048 & 2011 Macmillan Publishers Limited All rights reserved 0950-9232/11 www.nature.com/onc ORIGINAL ARTICLE Inverse expression states of the BRN2 and MITF transcription factors in melanoma spheres and tumour xenografts regulate the NOTCH pathway AE Thurber1, G Douglas1, EC Sturm1, SE Zabierowski2, DJ Smit1, SN Ramakrishnan1, E Hacker3, JH Leonard3, M Herlyn2 and RA Sturm1,2 1Institute for Molecular Bioscience, Melanogenix Group, The University of Queensland, Brisbane, Queensland, Australia; 2The Wistar Institute, Philadelphia, PA, USA and 3Queensland Institute of Medical Research, Brisbane, Queensland, Australia The use of adherent monolayer cultures have produced Introduction many insights into melanoma cell growth and differentia- tion, but often novel therapeutics demonstrated to act on Despite several decades of research on the causes and these cells are not active in vivo. It is imperative that new potential treatments for melanoma, little improvement methods of growing melanoma cells that reflect growth has been made in the prognosis of this cancer, which in vivo are investigated. To this end, a range of human remains at less than 15% survival after 5 yrs for patients melanoma cell lines passaged as adherent cultures or diagnosed with metastatic disease (Miller and Mihm, induced to form melanoma spheres (melanospheres) in 2006). One issue slowing progress is the large disparity stem cell media have been studied to compare cellular that often exists between experimental results and characteristics and protein expression. Melanoma spheres clinical outcomes. In order to screen new therapeutic and tumours grown from cell lines as mouse xenografts drugs more quickly and cost effectively, new culture had increased heterogeneity when compared with adherent models representative of the clinical setting are needed.
    [Show full text]
  • DLL1- and DLL4-Mediated Notch Signaling Is Essential for Adult Pancreatic Islet
    Page 1 of 41 Diabetes DLL1- and DLL4-mediated Notch signaling is essential for adult pancreatic islet homeostasis (running title –Role of Delta ligands in adult pancreas) Marina Rubey1,2,6*, Nirav Florian Chhabra1,2*, Daniel Gradinger1,2,7, Adrián Sanz-Moreno1, Heiko Lickert2,4,5, Gerhard K. H. Przemeck1,2, Martin Hrabě de Angelis1,2,3** 1 Helmholtz Zentrum München, Institute of Experimental Genetics and German Mouse Clinic, Neuherberg, Germany 2 German Center for Diabetes Research (DZD), Neuherberg, Germany 3 Chair of Experimental Genetics, Centre of Life and Food Sciences, Weihenstephan, Technische Universität München, Freising, Germany 4 Helmholtz Zentrum München, Institute of Diabetes and Regeneration Research and Institute of Stem Cell Research, Neuherberg, Germany 5 Technische Universität München, Medical Faculty, Munich, Germany 6 Present address Marina Rubey: WMC Healthcare GmbH, Munich, Germany 7 Present address Daniel Gradinger: PSI CRO AG, Munich, Germany *These authors contributed equally **Corresponding author: Prof. Dr. Martin Hrabě de Angelis, Helmholtz Zentrum München, German Research Center for Environmental Health, Institute of Experimental Genetics, Ingolstädter Landstr.1, 85764 Neuherberg, Germany. Phone: +49-89-3187-3502. Fax: +49- 89-3187-3500. E-mail address: [email protected] Word count – 4088 / Figures – 7 Diabetes Publish Ahead of Print, published online February 6, 2020 Diabetes Page 2 of 41 Abstract Genes of the Notch signaling pathway are expressed in different cell types and organs at different time points during embryonic development and adulthood. The Notch ligand Delta- like 1 (DLL1) controls the decision between endocrine and exocrine fates of multipotent progenitors in the developing pancreas, and loss of Dll1 leads to premature endocrine differentiation.
    [Show full text]
  • And DLL4-Mediated Notch Signaling Is Essential for Adult Pancreatic Islet Homeostasis
    Diabetes Volume 69, May 2020 915 DLL1- and DLL4-Mediated Notch Signaling Is Essential for Adult Pancreatic Islet Homeostasis Marina Rubey,1,2 Nirav Florian Chhabra,1,2 Daniel Gradinger,1,2 Adrián Sanz-Moreno,1 Heiko Lickert,2,3,4 Gerhard K.H. Przemeck,1,2 and Martin Hrabe de Angelis1,2,5 Diabetes 2020;69:915–926 | https://doi.org/10.2337/db19-0795 Genes of the Notch signaling pathway are expressed in with type 2 diabetes (3), sparking investigation into their different cell types and organs at different time points roles in glucose metabolism. The highly conserved D/N during embryonic development and adulthood. The Notch signaling pathway is crucial for embryonic development ligand Delta-like 1 (DLL1) controls the decision between in a wide range of different tissues (4). Although Notch ac- endocrine and exocrine fates of multipotent progenitors in tivity is required during pancreatic development (5), some the developing pancreas, and loss of Dll1 leads to pre- D/N components have also been reported to be active mature endocrine differentiation. However, the role of during adulthood. D/N signaling mediates cell-cycle regu- Delta-Notch signaling in adult tissue homeostasis is not lation via transmembrane-bound ligands (DLL1, DLL3, DLL4, ISLET STUDIES well understood. Here, we describe the spatial expression JAGGED1, and JAGGED2) and receptors (NOTCH1–4). pattern of Notch pathway components in adult murine Studies have shown that DLL1 and DLL4 regulate tissue pancreatic islets and show that DLL1 and DLL4 are renewal and maintain intestinal progenitor cells (6). Fur- specifically expressed in b-cells, whereas JAGGED1 is thermore, NOTCH/NEUROG3 signaling is active in adult expressed in a-cells.
    [Show full text]
  • Prognostic Significance of Notch Ligands in Patients with Non‑Small Cell Lung Cancer
    506 ONCOLOGY LETTERS 13: 506-510, 2017 Prognostic significance of Notch ligands in patients with non‑small cell lung cancer 1 2 JOANNA PANCEWICZ-WOJTKIEWICZ , ANDRZEJ ELJASZEWICZ , 3 1 3 OKSANA KOWALCZUK , WIESLAWA NIKLINSKA , RADOSLAW CHARKIEWICZ , 4 1 2 MIROSLAW KOZŁOWSKI , AGNIESZKA MIASKO and MARCIN MONIUSZKO Departments of 1Histology and Embryology, 2Regenerative Medicine and Immune Regulation, 3Clinical Molecular Biology and 4Thoracic Surgery, Medical University of Bialystok, 15-269 Bialystok, Poland Received June 14, 2016; Accepted September 29, 2016 DOI: 10.3892/ol.2016.5420 Abstract. The Notch signaling pathway is deregulated in cancer patients are diagnosed with non-small-cell lung cancer numerous solid types of cancer including non-small cell (NSCLC) (3). Currently, lung cancer therapy is mainly based lung cancer (NSCLC). However, the profile of Notch ligand on Tumor-Node-Metastasis (TNM) disease staging and expression remains unclear. Therefore, the present study tumor histological classification. However, despite progress aimed to determine the profile of Notch ligands in NSCLC in surgical techniques, chemotherapy and radiotherapy, the patients and to investigate whether quantitative assessment 5-year survival rate of patients with lung cancer remains low of Notch ligand expression may have prognostic significance (~16%) (4,5). Therefore, there is a continuous need to identify in NSCLC patients. The study was performed in 61 pairs of specific and sensitive biomarkers that may improve cancer tumor and matched unaffected lung tissue specimens obtained patient management. Such markers should allow prediction from patients with various stages of NSCLC, which were and prognostication of patient survival, disease free survival analyzed by reverse transcription-polymerase chain reac- or treatment response (6).
    [Show full text]
  • Induction of Ectopic Myc Target Gene JAG2 Augments Hypoxic Growth and Tumorigenesis in a Human B-Cell Model
    Induction of ectopic Myc target gene JAG2 augments hypoxic growth and tumorigenesis in a human B-cell model Jason T. Yusteina,1,2, Yen-Chun Liub, Ping Gaoc, Chunfa Jied, Anne Lec, Milena Vuica-Rossb, Wee Joo Chnge,f, Charles G. Eberhartb, P. Leif Bergsagele, and Chi V. Dangb,c,g,2 Departments of aPediatrics, bPathology, and cMedicine, dMicroarray Facility, and gSidney Kimmel Cancer Center, Johns Hopkins University School of Medicine, Baltimore, MD 21205; eComprehensive Cancer Center, Mayo Clinic, Scottsdale, AZ 85259; and fDepartment of Medicine, Yong Loo Lin School of Medicine, National University of Singapore, Singapore 545523 Edited* by Robert N. Eisenman, Fred Hutchinson Cancer Research Center, Seattle, WA, and approved December 22, 2009 (received for review February 5, 2009) Ectopic Myc expression plays a key role in human tumorigenesis, provides an experimentally tractable system to identify putative and Myc dose-dependent tumorigenesis has been well established endogenous and ectopic Myc target genes (6). in transgenic mice, but the Myc target genes that are dependent on The P493-6 cells were derived from human peripheral blood B Myc levels have not been well characterized. In this regard, we used cells immortalized by an Epstein–Barr viral (EBV) genome that is the human P493-6 B cells, which have a preneoplastic state depend- complemented with an EBV nuclear antigen-estrogen receptor ent on the Epstein–Barr viral EBNA2 protein and a neoplastic state (EBNA2-ER) fusion protein and a tetracycline-repressible Myc with ectopic inducible Myc, to identify putative ectopic Myc target transgene (6). We selected P493-6 cells because they exist in at genes.
    [Show full text]
  • Potential New Biomarkers for Endometrial Cancer Michelle H
    Townsend et al. Cancer Cell Int (2019) 19:19 https://doi.org/10.1186/s12935-019-0731-3 Cancer Cell International PRIMARY RESEARCH Open Access Potential new biomarkers for endometrial cancer Michelle H. Townsend1, Zac E. Ence2, Abigail M. Felsted1, Alyssa C. Parker2, Stephen R. Piccolo2,3, Richard A. Robison1 and Kim L. O’Neill1* Abstract Background: Incidence of endometrial cancer are rising both in the United States and worldwide. As endometrial cancer becomes more prominent, the need to develop and characterize biomarkers for early stage diagnosis and the treatment of endometrial cancer has become an important priority. Several biomarkers currently used to diagnose endometrial cancer are directly related to obesity. Although epigenetic and mutational biomarkers have been identi- fed and have resulted in treatment options for patients with specifc aberrations, many tumors do not harbor those specifc aberrations. A promising alternative is to determine biomarkers based on diferential gene expression, which can be used to estimate prognosis. Methods: We evaluated 589 patients to determine diferential expression between normal and malignant patient samples. We then supplemented these evaluations with immunohistochemistry staining of endometrial tumors and normal tissues. Additionally, we used the Library of Integrated Network-based Cellular Signatures to evaluate the efects of 1826 chemotherapy drugs on 26 cell lines to determine the efects of each drug on HPRT1 and AURKA expression. Results: Expression of HPRT1, Jag2, AURKA, and PGK1 were elevated when compared to normal samples, and HPRT1 and PGK1 showed a stepwise elevation in expression that was signifcantly related to cancer grade. To determine the prognostic potential of these genes, we evaluated patient outcome and found that levels of both HPRT1 and AURKA were signifcantly correlated with overall patient survival.
    [Show full text]
  • NOTCH2 Participates in Jagged1-Induced Osteogenic Differentiation in Human Periodontal Ligament Cells
    www.nature.com/scientificreports OPEN NOTCH2 participates in Jagged1‑induced osteogenic diferentiation in human periodontal ligament cells Jeeranan Manokawinchoke1, Piyamas Sumrejkanchanakij1, Lawan Boonprakong2, Prasit Pavasant1, Hiroshi Egusa3 & Thanaphum Osathanon1,2,4* Jagged1 activates Notch signaling and subsequently promotes osteogenic diferentiation in human periodontal ligament cells (hPDLs). The present study investigated the participation of the Notch receptor, NOTCH2, in the Jagged1‑induced osteogenic diferentiation in hPDLs. NOTCH2 and NOTCH4 mRNA expression levels increased during hPDL osteogenic diferentiation. However, the endogenous NOTCH2 expression levels were markedly higher compared with NOTCH4. NOTCH2 expression knockdown using shRNA in hPDLs did not dramatically alter their proliferation or osteogenic diferentiation compared with the shRNA control. After seeding on Jagged1‑immobilized surfaces and maintaining the hPDLs in osteogenic medium, HES1 and HEY1 mRNA levels were markedly reduced in the shNOTCH2‑transduced cells compared with the shControl group. Further, shNOTCH2‑transduced cells exhibited less alkaline phosphatase enzymatic activity and in vitro mineralization than the shControl cells when exposed to Jagged1. MSX2 and COL1A1 mRNA expression after Jagged1 activation were reduced in shNOTCH2-transduced cells. Endogenous Notch signaling inhibition using a γ‑secretase inhibitor (DAPT) attenuated mineralization in hPDLs. DAPT treatment signifcantly promoted TWIST1, but decreased ALP, mRNA expression, compared
    [Show full text]
  • Class II Phosphatidylinositol 3-Kinase-C2α Is Essential for Notch
    www.nature.com/scientificreports OPEN Class II phosphatidylinositol 3‑kinase‑C2α is essential for Notch signaling by regulating the endocytosis of γ‑secretase in endothelial cells Shota Shimizu, Kazuaki Yoshioka, Sho Aki & Yoh Takuwa* The class II α‑isoform of phosphatidylinositol 3‑kinase (PI3K‑C2α) plays a crucial role in angiogenesis at least in part through participating in endocytosis and, thereby, endosomal signaling of several cell surface receptors including VEGF receptor‑2 and TGFβ receptor in vascular endothelial cells (ECs). The Notch signaling cascade regulates many cellular processes including cell proliferation, cell fate specifcation and diferentiation. In the present study, we explored a role of PI3K‑C2α in Delta‑like 4 (Dll4)‑induced Notch signaling in ECs. We found that knockdown of PI3K‑C2α inhibited Dll4‑induced generation of the signaling molecule Notch intracellular domain 1 (NICD1) and the expression of Notch1 target genes including HEY1, HEY2 and NOTCH3 in ECs but not in vascular smooth muscle cells. PI3K‑C2α knockdown did not inhibit Dll4‑induced endocytosis of cell surface Notch1. In contrast, PI3K‑C2α knockdown as well as clathrin heavy chain knockdown impaired endocytosis of Notch1‑cleaving protease, γ‑secretase complex, with the accumulation of Notch1 at the perinuclear endolysosomes. Pharmacological blockage of γ‑secretase also induced the intracellular accumulation of Notch1. Taken together, we conclude that PI3K‑C2α is required for the clathrin‑mediated endocytosis of γ‑secretase complex, which allows for the cleavage of endocytosed Notch1 by γ‑secretase complex at the endolysosomes to generate NICD1 in ECs. Phosphatidylinositol 3-kinases (PI3Ks) are a family of lipid kinases which phosphorylate membrane phospho- inositides at the 3′-position of their inositol rings.
    [Show full text]
  • A Comprehensive Bioinformatics Analysis of Notch Pathways in Bladder Cancer
    cancers Article A Comprehensive Bioinformatics Analysis of Notch Pathways in Bladder Cancer Chuan Zhang 1,2 , Mandy Berndt-Paetz 1 and Jochen Neuhaus 1,* 1 Department of Urology, University of Leipzig, 04109 Leipzig, Germany; [email protected] (C.Z.); [email protected] (M.B.-P.) 2 Department of Urology, Chengdu Fifth People’s Hospital Affiliated to the Chengdu University of Traditional Chinese Medicine, Chengdu 611130, China * Correspondence: [email protected]; Tel.: +49-341-971-7688 Simple Summary: The Notch pathway is important in embryology and numerous tumor diseases. However, its role in bladder cancer (BCa) has not been deeply investigated thus far. Gene expression data are available for BCa, and bioinformatics analysis can provide insights into a possible role of the Notch pathway in BCa development and prognosis. Using this information can help in better understanding the origin of BCa, finding novel biomarkers for prediction of disease progression, and potentially opening new avenues to improved treatment. Our analysis identified the Notch receptors NOTCH2/3 and their ligand DLL4 as potential drivers of BCa by direct interaction with basic cell functions and indirect by modulating the immune response. Abstract: Background: A hallmark of Notch signaling is its variable role in tumor biology, ranging from tumor-suppressive to oncogenic effects. Until now, the mechanisms and functions of Notch pathways in bladder cancer (BCa) are still unclear. Methods: We used publicly available data from the GTEx and TCGA-BLCA databases to explore the role of the canonical Notch pathways Citation: Zhang, C.; Berndt-Paetz, in BCa on the basis of the RNA expression levels of Notch receptors, ligands, and downstream M.; Neuhaus, J.
    [Show full text]
  • Defects in Limb, Craniofacial, and Thymic Development in Jagged2 Mutant Mice
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press Defects in limb, craniofacial, and thymic development in Jagged2 mutant mice Rulang Jiang,1,3 Yu Lan,1,3 Harry D. Chapman,1 Carrie Shawber,2 Christine R. Norton,1 David V. Serreze,1 Gerry Weinmaster,2 and Thomas Gridley1,4 1The Jackson Laboratory, Bar Harbor, Maine 04609 USA; 2Department of Biological Chemistry, University of California, Los Angeles (UCLA), The School of Medicine, Los Angeles, California 90024 USA The Notch signaling pathway is a conserved intercellular signaling mechanism that is essential for proper embryonic development in numerous metazoan organisms. We have examined the in vivo role of the Jagged2 (Jag2) gene, which encodes a ligand for the Notch family of transmembrane receptors, by making a targeted mutation that removes a domain of the Jagged2 protein required for receptor interaction. Mice homozygous for this deletion die perinatally because of defects in craniofacial morphogenesis. The mutant homozygotes exhibit cleft palate and fusion of the tongue with the palatal shelves. The mutant mice also exhibit syndactyly (digit fusions) of the fore- and hindlimbs. The apical ectodermal ridge (AER) of the limb buds of the mutant homozygotes is hyperplastic, and we observe an expanded domain of Fgf8 expression in the AER. In the foot plates of the mutant homozygotes, both Bmp2 and Bmp7 expression and apoptotic interdigital cell death are reduced. Mutant homozygotes also display defects in thymic development, exhibiting altered thymic morphology and impaired differentiation of gd lineage T cells. These results demonstrate that Notch signaling mediated by Jag2 plays an essential role during limb, craniofacial, and thymic development in mice.
    [Show full text]
  • Role of Jagged1-Mediated Notch Signaling Activation in the Differentiation and Stratification of the Human Limbal Epithelium
    cells Article Role of Jagged1-mediated Notch Signaling Activation in the Differentiation and Stratification of the Human Limbal Epithelium Sheyla González, Maximilian Halabi, David Ju, Matthew Tsai and Sophie X. Deng * Cornea Division, Stein Eye Institute, University of California, Los Angeles, CA 90095, USA; [email protected] (S.G.); [email protected] (M.H.); [email protected] (D.J.); [email protected] (M.T.) * Correspondence: [email protected] Received: 17 July 2020; Accepted: 21 August 2020; Published: 22 August 2020 Abstract: The Notch signaling pathway plays a key role in proliferation and differentiation. We investigated the effect of Jagged 1 (Jag1)-mediated Notch signaling activation in the human limbal stem/progenitor cell (LSC) population and the stratification of the limbal epithelium in vitro. After Notch signaling activation, there was a reduction in the amount of the stem/progenitor cell population, epithelial stratification, and expression of proliferation markers. There was also an increase of the corneal epithelial differentiation. In the presence of Jag1, asymmetric divisions were decreased, and the expression pattern of the polarity protein Par3, normally present at the apical-lateral membrane of basal cells, was dispersed in the cells. We propose a mechanism in which Notch activation by Jag1 decreases p63 expression at the basal layer, which in turn reduces stratification by decreasing the number of asymmetric divisions and increases differentiation. Keywords: Notch signaling; stratification; differentiation; limbal epithelium; limbal stem cells 1. Introduction The corneal epithelium is the outermost layer of the eye that functions as a barrier to prevent infections and maintains the corneal transparency.
    [Show full text]