Published OnlineFirst April 26, 2017; DOI: 10.1158/0008-5472.CAN-16-3146 Cancer Molecular and Cellular Pathobiology Research tRF/miR-1280 Suppresses Stem Cell–like Cells and Metastasis in Colorectal Cancer Bingqing Huang1,2, Huipeng Yang1, Xixi Cheng1, Dan Wang1, Shuyu Fu1, Wencui Shen3, Qi Zhang1, Lijuan Zhang1, Zhenyi Xue1, Yan Li1, Yurong Da1, Qing Yang4,5, Zesong Li6, Li Liu7, Liang Qiao8, Ying Kong9, Zhi Yao1, Peng Zhao4,5, Min Li10,11, and Rongxin Zhang1,12 Abstract Several studies have shown that tRNAs can be enzymatically tasis. Notably, tRF/miR-1280–mediated inactivation of Notch cleaved to generate distinct classes of tRNA-derived fragments signaling suppressed CSC phenotypes, including by direct (tRF). Here, we report that tRF/miR-1280, a 17-bp fragment transcriptional repression of the Gata1/3 and miR-200b genes. derived from tRNALeu and pre-miRNA, influences Notch sig- These results were consistent with findings of decreased levels naling pathways that support the function of cancer stem-like of miR-200b and elevated levels of JAG2, Gata1, Gata3, Zeb1, cells (CSC) in colorectal cancer progression. tRF/miR-1280 and Suz12 in colorectal cancer tissue specimens. Taken togeth- expression was decreased in human specimens of colorectal er, our results established that tRF/miR-1280 suppresses colo- cancer. Ectopic expression of tRF/miR-1280 reduced cell pro- rectal cancer growth and metastasis by repressing Notch sig- liferation and colony formation, whereas its suppression naling pathways that support CSC phenotypes. Furthermore, reversed these effects. Mechanistic investigations implicated they provide evidence that functionally active miRNA can be the Notch ligand JAG2 as a direct target of tRF/miR-1280 derived from tRNA, offering potential biomarker and thera- binding through which it reduced tumor formation and metas- peutic uses. Cancer Res; 77(12); 3194–206. Ó2017 AACR. Introduction Transfer RNA-derived RNA fragments (tRF) belong to a family of short noncoding RNAs (ncRNA) that are present in most Colorectal cancer, which is oneofthemostlethaldiseases organisms (4). tRNA-derived fragments were first confirmed and the third leading cause of cancer-related deaths, is a disease in the 1970s (5). Recently, many studies have shown that caused by genetic and epigenetic alterations (1, 2). Approxi- these tRNA-derived fragments can be produced by multiple mately 40% to 50% of human colorectal cancer cases present RNA enzymes and ribonuclease, which play important roles in with metastasis at the time of diagnosis or develop distant regulating translation, similar to miRNAs (6–9). Most miRNA recurrence after therapy, and the median overall survival of genes are intergenic or originate from an antisense to neigh- metastatic colorectal cancer is less than 2 years (3). Therefore, bouring genes and are transcribed as independent units (10). new diagnostic markers and therapeutic targets are needed. Maute and colleagues have reported that a tRNA-derived Small non–protein-coding RNAs (ncRNA; including miRNA, miRNA named CU1276 is dicer dependently derived from piRNA, etc.) play important roles in regulating gene expression. cleavage in the 30 T arm loop of tRNA (7). The stress-activated 1Department of Immunology, Research Center of Basic Medical Sciences, Key Oklahoma Health Sciences Center, Oklahoma City, Oklahoma. 11Department of Laboratory of Immune Microenvironment and Diseases of Educational Ministry Surgery, The University of Oklahoma Health Sciences Center, Oklahoma City, of China, Tianjin Medical University, Tianjin, China. 2Department of Pathology, Oklahoma. 12Laboratory of Immunology and Inflammation, Guangdong Phar- Institute of Hematology and Blood Diseases Hospital, Chinese Academy of maceutical University, Guangzhou, China. Medical Sciences and Peking Union Medical College, Tianjin, China. 3Tianjin Eye Hospital, Tianjin Key Laboratory of Ophthalmology and Vision Science, Clinical Note: Supplementary data for this article are available at Cancer Research College of Ophthalmology, Tianjin Medical University, Tianjin, China. 4Depart- Online (http://cancerres.aacrjournals.org/). ment of Colorectal Cancer, Tianjin Medical University Cancer Institute and B. Huang and H. Yang contributed equally to this article. Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer 5 Prevention and Therapy, Tianjin, China. Department of Genitourinary Oncology, Corresponding Authors: Rongxin Zhang, Tianjin Medical University, No. 22 Tianjin Medical University Cancer Institute and Hospital, National Clinical Qi Xiang Tai Road, Mail Box 197, Tianjin 300070, China. Phone: 8622-8333- Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, 6563; Fax: 8622-8333-6517; E-mail: [email protected]; Peng Zhao, 6 Tianjin, China. Shenzhen Key Laboratory of Genitourinary Tumor, Shenzhen Department of Colorectal Cancer, Tianjin Medical University Cancer Institute Second People's Hospital, First Affiliated Hospital of Shenzhen University, and Hospital, Tianjin, China. E-mail: [email protected]; and Ying Kong, 7 Shenzhen, China. Department of Radiology, The University of Texas South- Department of Biochemistry and Molecular Biology, Dalian Medical Univer- 8 western Medical Center, Dallas, Texas. Storr Liver Centre, Westmead Millennium sity, Dalian, China. E-mail: [email protected] Institute for Medical Research, The University of Sydney at Westmead Hospital, 9 Westmead, New South Wales, Australia. Department of Biochemistry and doi: 10.1158/0008-5472.CAN-16-3146 Molecular Biology, Liaoning Key Lab of Glycobiology and Glycoengn, Dalian Medical University, Dalian, China. 10Department of Medicine, The University of Ó2017 American Association for Cancer Research. 3194 Cancer Res; 77(12) June 15, 2017 Downloaded from cancerres.aacrjournals.org on October 2, 2021. © 2017 American Association for Cancer Research. Published OnlineFirst April 26, 2017; DOI: 10.1158/0008-5472.CAN-16-3146 tRF/miR-1280 Represses Colorectal Cancer via Notch Signaling ribonuclease angiogenin can also cleave mature tRNA in the Patients and clinical tissue specimens anticodon loop to produce tRF/tiRNAs (8, 9). One recent study The collection of human colorectal cancer tissues consisted of showed that a novel class of tRFs suppresses the stability of surgically resected primary colorectal cancer specimens, which multiple oncogenic transcripts in breast cancer cells by displa- were obtained from the Shenzhen Second People's Hospital and cing their 30 untranslated regions (UTR) from the RNA-binding Tianjin Medical University Cancer Institute and Hospital (Tianjin, protein YBX1 (11). Therefore, tRFs/tiRNA could be new diag- China). Total RNA of fresh-frozen material was isolated using nostic markers and therapeutic targets in cancer therapy. TRIzol reagent (Invitrogen). Total RNA (2 mg) was used for the Many recent studies have reported the expression and role of synthesis of first-strand cDNA using M-MLV reverse transcriptase "miR-1280" in various cancer types (12–17). In melanoma (Invitrogen). qRT-PCR was performed using the SYBR Green Mix cells, "miR-1280" displays antitumor activity by regulating the (Roche). proto-oncogene Src (12). "miR-1280" can inhibit invasion and metastasis by targeting Rock1 in bladder cancer cells, and the Northern blotting high-miR-1280 bladder cancer group had significantly higher RNA was extracted with the RNA Sample Loading Buffer overall survival probability compared with the low-miR-1280 without Ethidium Bromide (Sigma) to the RNA sample at a group (13). In medulloblastoma, the inhibition of "miR-1280" ratio of 2:1. Just before loading, the samples were heated to 65C increases JAG2 expression; thus, there may be a PDGFRb/c- for 10 minutes and chilled on ice. All appliances were treated by myc/miR-1280/JAG2 regulating axis, and higher JAG2 levels are 0.1% DEPC water. RNAs were separated using 15% denaturing associated with high metastatic dissemination at diagnosis and polyacrylamide gel and electrophoretically transferred to Bright- a poor outcome in medulloblastoma patients (14). However, Star-Plus Positively Charged Nylon Membranes (Thermo). whether "miR-1280" can directly target JAG2 and regulate its Hybridization with 50 and 30-bioth–labeled DNA probes downstream signaling is still unclear. Meng and colleagues (tRF/miR-1280 (probe 1): GGGTGGCAGCGGTGGGA; pre- found that "miR-1280" can suppress the proliferation and 1280 (probe 2): GTGAGTGCTGATGCCTGG; tRNALeu (probe invasion of thyroid carcinoma by targeting estrogen receptor 3): GCCTTAGACCGCTCGGCCACGCTA; U6: ATATGGAACG- a (15). Interestingly, Xu and colleagues found a higher expres- CTTCACGAATT) was performed in PerfectHyb Plus hybridiza- sion of "miR-1280" in 72 non–small cell lung cancer tissues tion buffer (Sigma) at 42C overnight. Membranes were then compared with distal normal tissues by RT-PCR (16). Another washed, blocked, and incubated with an anti-bioth antibody. group has reported that "miR-1280" is upregulated 2.1-fold in The antibody–antigen complexes were washed and equilibrated colorectal cancer and downregulated 2.3-fold in pancreatic and then detected using the Chemiluminescent Nucleic Acid cancer by microarray analysis (17). "miR-1280" shows antitu- Detection Module (Thermo Fisher Scientific) following the mor activity in most cancers. However, Schopman and collea- manufacturer's protocol. tRF/miR-1280 mimics fragment: 50- gues proposed that the sequence annotated as miR-1280 is a UCCCACCGCUGCCACCC-30 and mimics control: 50-UUGUA- noncoding