DOCSLIB.ORG

Gprc5b Modulates Inflammatory Response in Glomerular Diseases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gprc5b Modulates Inflammatory Response in Glomerular Diseases BASIC RESEARCH www.jasn.org GPRC5b Modulates Inflammatory Response in Glomerular Diseases via NF-kB Pathway Sonia Zambrano,1 Katja Möller-Hackbarth,1 Xidan Li,1 Patricia Q. Rodriguez,1 Emmanuelle Charrin,1 Angelina Schwarz,1 Jenny Nyström,2 Annika Östman Wernerson,3 Mark Lal,4 and Jaakko Patrakka1 1Karolinska Insitutet/AstraZeneca Integrated Cardio Metabolic Center, Department of Laboratory Medicine, Karolinska Institutet at Karolinska University Hospital Huddinge, Stockholm, Sweden; 2Department of Physiology, Institute of Neuroscience and Physiology, University of Gothenburg, Gothenburg, Sweden; 3Division of Renal Medicine, Department of Clinical Sciences, Intervention and Technology, Karolinska Institutet, Stockholm, Sweden; and 4Division of Bioscience, Department of Cardiovascular, Renal and Metabolic Diseases, Innovative Medicines Biotech Unit, AstraZeneca, Gothenburg, Sweden ABSTRACT Background Inflammatory processes play an important role in the pathogenesis of glomerulopathies. Finding novel ways to suppress glomerular inflammation may offer a new way to stop disease progression. However, the molecular mechanisms that initiate and drive inflammation in the glomerulus are still poorly understood. Methods We performed large-scale gene expression profiling of glomerulus-associated G protein– coupled receptors (GPCRs) to identify new potential therapeutic targets for glomerulopathies. The expression of Gprc5b in disease was analyzed using quantitative PCR and immunofluorescence, and by analyzing published microarray data sets. In vivo studies were carried out in a podocyte-specificGprc5b knockout mouse line. Mechanistic studies were performed in cultured human podocytes. Results We identified an orphan GPCR, Gprc5b, as a novel gene highly enriched in podocytes that was significantly upregulated in common human glomerulopathies, including diabetic nephropathy, IgA ne- phropathy, and lupus nephritis. Similar upregulation of Gprc5b was detected in LPS-induced nephropathy in mice. Studies in podocyte-specific Gprc5b knockout mice showed that Gprc5b was not essential for normal development of the glomerular filtration barrier. However, knockout mice were partially protected from LPS-induced proteinuria and recruitment of inflammatory cells. Mechanistically, RNA sequencing in Gprc5b knockouts mice and experiments in cultured human podocytes showed that Gpr5cb regulated inflammatory response in podocytes via NF-kB signaling. Conclusions GPRC5b is a novel podocyte-specific receptor that regulates inflammatory response in the glomerulus by modulating the NF-kB signaling pathway. Upregulation of Gprc5b in human glomerulopathies suggests that it may play a role in their pathogenesis. JASN 30: 1573–1586, 2019. doi: https://doi.org/10.1681/ASN.2019010089 Glomerular disease processes are the most common Received January 28, 2019. Accepted May 9, 2019. cause of ESRD. Glomerular injury can be caused by Published online ahead of print. Publication date available at systemic diseases, such as in diabetic nephropathy www.jasn.org. (DN) and lupus nephritis (LN), or more glomerulus- fi Correspondence: Dr. Jaakko Patrakka, KI/AZ Integrated Cardio speci c disorders, such as IgA nephropathy (IgAN). Metabolic Center, Department of Laboratory Medicine, Karolinska Patients with glomerulopathies are treated with Institute at Karolinska University Hospital Huddinge, Blickagången 6, angiotensin-converting enzyme inhibitors and/or 141 57 Huddinge, Sweden. Email: [email protected] angiotensin receptor II blockers to diminish proteinuria. Copyright © 2019 by the American Society of Nephrology JASN 30: 1573–1586, 2019 ISSN : 1046-6673/3009-1573 1573 BASIC RESEARCH www.jasn.org When disease progresses rapidly, steroids and other immu- Significance Statement nosuppressive drugs can be used. These pharmaceuti- cal treatment options do not specifically target kidney Mechanisms regulating inflammatory response in glomeruli are tissue, and currently we lack molecular targets in the poorly understood. In this study, the authors identify a novel – glomerulus to develop more kidney-directed therapeutic G protein coupled receptor (GPCR) that is highly enriched in podocytes, called Gprc5b. Gprc5b is upregulated in common 1 options. human glomerular diseases, such as IgA nephropathy, lupus ne- As podocyte loss is a key event in the progression of glo- phritis, and diabetic nephropathy. Studies in knockout animals merulopathies, many studies have concentrated on analyzing and human podocytes grown in culture show that Gprc5b pro- molecular mechanisms of podocyte death.2 However, podo- motes glomerular inflammation via regulation of NF-kB pathway cyte loss is often a late event in the disease and it is likely that in podocytes. Upregulation of Gprc5b in human diseases sug- fi gests that this mechanism may play an important role in the targeting earlier changes is a more ef cient approach. Glomer- pathogenesis of common glomerulopathies. ular inflammation and recruitment of inflammatory cells is occurring early in glomerulopathies.3 Involvement of inflam- mation in the progression of glomerulopathies, such as LN and Transgenic Mouse Lines IgAN, is obvious. Similarly, although traditionally DN has been Gene targeting of Gprc5b gene was performed by The European considered a noninflammatory glomerular disease, global Conditional Mouse Mutagenesis Program (www.eucomm.org). transcript profiling studies have shown inflammatory signal- The construct was targeted to surround the exon 2 of the tm1a(EUCOMM)Wtsi ing and recruitment of immune cells in diabetic glomeruli.4 GPRC5b gene, allele Gprc5b . The mice were The inflammatory signature in glomerulopathies and in a mixed C57bl/6 and 129Sv background. We crossed these fl diabetic glomeruli includes activation of key transcriptional mice with an FLP-deleter line to generate a oxed mouse line, fl Gprc5b Gprc5b-fl Gprc5b-fl regulator NF-kB and JAK/STAT pathways, which are known ox ( ). was crossed with a podocin-cre Gprc5b fi Gprc5b- to drive cytokine production and influx of inflammatory line to inactivate speci cally in podocytes ( cKO). cells.527 The role of podocytes in this process is poorly The genotyping was done by PCR using genomic DNA understood. extracted from ear biopsy specimens. Primers for genotyp- G protein–coupled receptors (GPCRs) are a large family of ing were as follows: CAS-R1-Term: tcgtggtatcgttatgcgcc; Gprc5b Gprc5b proteins that participate in a wide variety of biologic processes. -87598-F: gctggaaggtttctccctct; -87598-R: They have been successfully exploited by the pharmaceutical aagagacaaccaccagacagg. tm14(CAG-td-Tomato)Hze/J industry as 20%–30% of the market share of clinically used The Gt(ROSA)26Sor mice were drugs target members of this family.8,9 To identify potential crossed with a podocin-cre line to activate the td-Tomato ex- fi new pharmaceutical targets in the glomerulus, we recently pression speci cally in podocytes. Breeding and genotyping performed a high-throughput expressional profiling of glo- were done according to standard procedures. merular GPCRs.10 In this study, we follow up on our previous All animal studies were carried out in Preclinical Laboratory study and describe an orphan GPCR, Gprc5b, as a novel, (Karolinska Institutet) and were approved by the Ethical highly podocyte-enriched molecule. We show that Gprc5b Committee on Research Animal Care. expression is induced in common human glomerulopathies andthatitmodulatesinflammatory response in podocytes LPS-Induced Proteinuria Mouse Model via NF-kB pathway. We speculate that Gprc5b could be a Ten-week-old mice were treated by a single intraperitoneal novel molecular target to suppress inflammatory response injection of 13 mg/g body wt of LPS (L9641; Sigma). A total in glomerular disease processes. of 18 littermate control controls and 19 Gprc5b-cKO animals were included. Urine was collected before the injection and at 6, 12, 24, 36, and 56 hours after the injection. Albumin and METHODS creatinine values were measured using Albuwell kit (catalog number 1011; Exocell) and Quantichrome creatinine assay kit Human Material (catalog number DICT-500; BioAssay Systems), respectively. Control human kidney tissue was from kidneys that were re- moved because of renal carcinoma or from renal biopsy spec- Immunofluorescence imens taken from healthy, living, related donor kidneys at We used frozen human and mouse samples fixed in cold ace- Karolinska University Hospital (Stockholm, Sweden). Only tone and blocked with normal goat serum (G9023; Sigma). The kidney tissue that was histologically normal was used. Renal primary antibodies, incubated overnight at 4°C, were: Gprc5b biopsy samples from patients with DN were collected at (catalog number HPA015247, 1:500; Atlas Antibodies), CD31 Karolinska University Hospital (Stockholm, Sweden) and (catalog number 303106, 1:2000; Biolegend), PDGFRb (catalog Sahlgrenska University Hospital (Gothenburg, Sweden). number MAB1263, 1:1000; R&D System), CD45 (catalog num- The local ethical committees at both sites approved the study ber ab64100, 1:250; Abcam), mouse nephrin (catalog number (approval no. 2010/579-31/1, Stockholm, Sweden; approval BP5030, 1:200; Acris). The human nephrin antibody has been no. 413-09, Gothenburg, Sweden). described previously.11 1574 JASN JASN 30: 1573–1586, 2019 www.jasn.org BASIC RESEARCH Histologic Analysis and Electron Microscopy Signaling Technology), b-actin (catalog number 8227, For histologic analyses, kidney samples were fixed in 4% para- 1:2000; Abcam). formaldehyde followed by dehydration and embedding
Load more

Recommended publications
  • Genome-Wide Sirna Screen for Mediators of NF-Κb Activation
    Genome-wide siRNA screen for mediators SEE COMMENTARY of NF-κB activation Benjamin E. Gewurza, Fadi Towficb,c,1, Jessica C. Marb,d,1, Nicholas P. Shinnersa,1, Kaoru Takasakia, Bo Zhaoa, Ellen D. Cahir-McFarlanda, John Quackenbushe, Ramnik J. Xavierb,c, and Elliott Kieffa,2 aDepartment of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; bCenter for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114; cProgram in Medical and Population Genetics, The Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142; dDepartment of Biostatistics, Harvard School of Public Health, Boston, MA 02115; and eDepartment of Biostatistics and Computational Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02115 Contributed by Elliott Kieff, December 16, 2011 (sent for review October 2, 2011) Although canonical NFκB is frequently critical for cell proliferation, (RIPK1). TRADD engages TNFR-associated factor 2 (TRAF2), survival, or differentiation, NFκB hyperactivation can cause malig- which recruits the ubiquitin (Ub) E2 ligase UBC5 and the E3 nant, inflammatory, or autoimmune disorders. Despite intensive ligases cIAP1 and cIAP2. CIAP1/2 polyubiquitinate RIPK1 and study, mammalian NFκB pathway loss-of-function RNAi analyses TRAF2, which recruit and activate the K63-Ub binding proteins have been limited to specific protein classes. We therefore under- TAB1, TAB2, and TAB3, as well as their associated kinase took a human genome-wide siRNA screen for novel NFκB activa- MAP3K7 (TAK1). TAK1 in turn phosphorylates IKKβ activa- tion pathway components. Using an Epstein Barr virus latent tion loop serines to promote IKK activity (4).
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • IKBKB Polyclonal Antibody
    IKBKB polyclonal antibody Gene Summary: NFKB1 (MIM 164011) or NFKB2 (MIM 164012) is bound to REL (MIM 164910), RELA (MIM Catalog Number: PAB18155 164014), or RELB (MIM 604758) to form the NFKB complex. The NFKB complex is inhibited by I-kappa-B Regulatory Status: For research use only (RUO) proteins (NFKBIA, MIM 164008, or NFKBIB, MIM 604495), which inactivate NF-kappa-B by trapping it in Product Description: Rabbit polyclonal antibody raised the cytoplasm. Phosphorylation of serine residues on the against synthetic peptide of IKBKB. I-kappa-B proteins by kinases (IKBKA, MIM 600664, or IKBKB) marks them for destruction via the ubiquitination Immunogen: A synthetic peptide corresponding to pathway, thereby allowing activation of the NF-kappa-B human IKBKB. complex. Activated NFKB complex translocates into the nucleus and binds DNA at kappa-B-binding motifs such Host: Rabbit as 5-prime GGGRNNYYCC 3-prime or 5-prime Reactivity: Human,Mouse,Rat HGGARNYYCC 3-prime (where H is A, C, or T; R is an A or G purine; and Y is a C or T pyrimidine).[supplied by Applications: ELISA, IHC-P, WB-Ce OMIM] (See our web site product page for detailed applications information) References: 1. NIBP, a novel NIK and IKK(beta)-binding protein that Protocols: See our web site at enhances NF-(kappa)B activation. Hu WH, Pendergast http://www.abnova.com/support/protocols.asp or product JS, Mo XM, Brambilla R, Bracchi-Ricard V, Li F, Walters page for detailed protocols WM, Blits B, He L, Schaal SM, Bethea JR. J Biol Chem. 2005 Aug 12;280(32):29233-41.
    [Show full text]
  • NFKBIB & FBXW11 Protein Protein Interaction Antibody Pair
    NFKBIB & FBXW11 Protein Protein Interaction Antibody Pair Catalog # : DI0194 規格 : [ 1 Set ] List All Specification Application Image Product This protein protein interaction antibody pair set comes with two In situ Proximity Ligation Assay (Cell) Description: antibodies to detect the protein-protein interaction, one against the NFKBIB protein, and the other against the FBXW11 protein for use in in situ Proximity Ligation Assay. See Publication Reference below. Reactivity: Human Quality Control Protein protein interaction immunofluorescence result. Testing: Representative image of Proximity Ligation Assay of protein-protein interactions between NFKBIB and FBXW11. HeLa cells were stained with anti-NFKBIB rabbit purified polyclonal antibody 1:1200 and anti- FBXW11 mouse monoclonal antibody 1:50. Each red dot represents the detection of protein-protein interaction complex. The images were analyzed using an optimized freeware (BlobFinder) download from The Centre for Image Analysis at Uppsala University. Supplied Antibody pair set content: Product: 1. NFKBIB rabbit purified polyclonal antibody (20 ug) 2. FBXW11 mouse monoclonal antibody (40 ug) *Reagents are sufficient for at least 30-50 assays using recommended protocols. Storage Store reagents of the antibody pair set at -20°C or lower. Please aliquot Instruction: to avoid repeated freeze thaw cycle. Reagents should be returned to - Page 1 of 4 2016/5/19 20°C storage immediately after use. MSDS: Download Publication Reference 1. An analysis of protein-protein interactions in cross-talk pathways reveals CRKL as a novel prognostic marker in hepatocellular carcinoma. Liu CH, Chen TC, Chau GY, Jan YH, Chen CH, Hsu CN, Lin KT, Juang YL, Lu PJ, Cheng HC, Chen MH, Chang CF, Ting YS, Kao CY, Hsiao M, Huang CY.
    [Show full text]
  • UNIVERSITY of CALIFORNIA Los Angeles Dissecting the Regulatory
    UNIVERSITY OF CALIFORNIA Los Angeles Dissecting the Regulatory Strategies of NFkappaB RelA Target Genes in the Inflammatory Response A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Microbiology, Immunology, and Molecular Genetics by Kim Anh Ngo 2019 © Copyright by Kim Anh Ngo 2019 ABSTRACT OF THE DISSERTATION Dissecting the Regulatory Strategies of NFkappaB RelA Target Genes in the Inflammatory Response by Kim Anh Ngo Doctor of Philosophy in Microbiology, Immunology, and Molecular Genetics University of California, Los Angeles, 2019 Professor Alexander Hoffmann, Chair The NFkB family member RelA is a ubiquitously expressed potent transcriptional activator that is induced by exposure to pathogens and inflammatory cytokines to activate the expression of a large number of inflammatory and immune-response genes. Its nuclear activity is induced from a latent cytoplasmic pool by stimulus-responsive degradation of IkB proteins, and the complex signaling mechanisms that regulate its activity are well understood. Less well characterized are the mechanisms that allow nuclear NFkB RelA activity to select its target genes and produce gene-specific expression. While many genes have been identified to be potentially NFkB regulated, there is no database that lists the NFkB target genes in a particular physiological condition, defined cell types and stimulus. ii Chapter 1 presents a general overview of IKK-IkB-NFkB signaling system. Chapter 2 reports the primary study in this dissertation in which includes approaches such as biochemistry, molecular biology, mouse genetics, Next-Generation Sequencing, and mathematical modeling to dissect the regulatory strategies of NFkB RelA endogenous target genes in the inflammatory response.
    [Show full text]
  • Insights Into the Genomic Landscape of MYD88 Wild-Type Waldenström
    REGULAR ARTICLE Insights into the genomic landscape of MYD88 wild-type Waldenstrom¨ macroglobulinemia Zachary R. Hunter,1,2 Lian Xu,1 Nickolas Tsakmaklis,1 Maria G. Demos,1 Amanda Kofides,1 Cristina Jimenez,1 Gloria G. Chan,1 Jiaji Chen,1 Xia Liu,1 Manit Munshi,1 Joshua Gustine,1 Kirsten Meid,1 Christopher J. Patterson,1 Guang Yang,1,2 Toni Dubeau,1 Mehmet K. Samur,2,3 Jorge J. Castillo,1,2 Kenneth C. Anderson,2,3 Nikhil C. Munshi,2,3 and Steven P. Treon1,2 1Bing Center for Waldenstrom¨ ’s Macroglobulinemia, Dana-Farber Cancer Institute, Boston, MA; 2Harvard Medical School, Boston, MA; and 3Jerome Lipper Myeloma Center, Dana-Farber Cancer Institute, Boston, MA Activating MYD88 mutations are present in 95% of Waldenstrom¨ macroglobulinemia (WM) Key Points patients, and trigger NF-kB through BTK and IRAK. The BTK inhibitor ibrutinib is active • MUT Mutations affecting in MYD88-mutated (MYD88 ) WM patients, but shows lower activity in MYD88 wild-type k WT WT NF- B, epigenomic (MYD88 ) disease. MYD88 patients also show shorter overall survival, and increased regulation, or DNA risk of disease transformation in some series. The genomic basis for these findings remains damage repair were to be clarified. We performed whole exome and transcriptome sequencing of sorted tumor identified in MYD88 WT samples from 18 MYD88 patients and compared findings with WM patients with wild-type WM. MUT MYD88 disease. We identified somatic mutations predicted to activate NF-kB(TBL1XR1, • k NF- B pathway muta- PTPN13, MALT1, BCL10, NFKB2, NFKBIB, NFKBIZ, and UDRL1F), impart epigenomic tions were downstream dysregulation (KMT2D, KMT2C, and KDM6A), or impair DNA damage repair (TP53, ATM, and of BTK, and many TRRAP).
    [Show full text]
  • The Human Homologue of the RNA Polymerase II-Associated Factor 1 (Hpaf1), Localized on the 19Q13 Amplicon, Is Associated with Tumorigenesis
    Oncogene (2006) 25, 3247–3257 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE The human homologue of the RNA polymerase II-associated factor 1 (hPaf1), localized on the 19q13 amplicon, is associated with tumorigenesis N Moniaux1,4, C Nemos1,4, BM Schmied2, SC Chauhan1, S Deb1, K Morikane2, A Choudhury1, M VanLith2, M Sutherlin2, JM Sikela3, MA Hollingsworth1,2 and SK Batra1,2 1Department of Biochemistry and Molecular Biology, University of Nebraska Medical Center, Omaha, NE, USA; 2Eppley Institute, University of Nebraska Medical Center, Omaha, NE, USA and 3Department of Pharmacology, University of Colorado Health Sciences Center, Denver, CO, USA The 19q13 amplicon in pancreatic cancer cells contains a somes, chromosomal translocations, and gene amplifi- novel pancreatic differentiation 2 (PD2) gene (accession cations, induce a transformed phenotype leading to number AJ401156), which was identified by differential cancer. These genetic alterations constitute key events screening analysis. PD2 is the human homologue of the contributing to tumor progression and metastasis. They RNA polymerase II-associated factor 1 (hPaf1). In yeast, are often stabilized when they confer a growth or Paf1 is part of the transcription machinery, acting as a survivaladvantage to the cells(Lengauer et al., 1998). docking protein in between the complexes Rad6-Bre1, Gene amplification (HSR, homogeneously staining COMPASS-Dot1p, and the phosphorylated carboxyl region and DM, double minute) is one of the most terminal domain of the RNA polymerase II. As such, important mechanisms leading to the alteration of gene Paf1 is directly involved in transcription elongation via expression in solid tumors.
    [Show full text]
  • Statistical Methods for Identification of NF-Κb Related Genes and Their Expression Profiles in Channel Catfish After Bacterial Infection
    Statistical methods for identification of NF-κB related genes and their expression profiles in channel catfish after bacterial infection by Xiaozhu Wang A thesis submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Master of Science Auburn, Alabama May 7, 2017 Keywords: Maximum likelihood, hypothesis test, Immune response, Gene expression, Fish Copyright 2017 by Xiaozhu Wang Approved by Ash Abebe, Chair, Professor of Mathematics and Statistics Nedret Billor, Professor of Mathematics and Statistics Peng Zeng, Associate Professor of Mathematics and Statistics Abstract Interactions of NF-κB family, IκB family and IKK complex are key components of NF-κB pathway that is essential for many biological processes including innate and adaptive immunity, and inflammation and stress responses. Despite their importance, systematic analysis of these genes in fish has been lacking. In this project, statistical analysis of NF-κB related genes and their gene expression after bacterial infection was conducted with channel catfish. A total of thirteen NF-κB related genes were identified in the channel catfish genome, including five NF-κB family genes, five IκB family genes and three IKK complex genes. To confirm the annotation of these thirteen NF-κB related genes, maximum likelihood methods were applied to construct phylogenetic tree of each gene with various species. The reliability of these constructed phylogenetic trees was confirmed by the bootstrap test. Syntenic analysis was used to further determine the annotation of those genes which failed to be confirmed by phylogenetic analysis. To determine the evolutionary patterns of these NF-κB related genes, likelihood ratio test was applied for detecting their selective pressures during evolution.
    [Show full text]
  • The Role of Nfκb in Spheroid Formation of Human Breast Cancer Cells
    www.nature.com/scientificreports OPEN The role of NFκB in spheroid formation of human breast cancer cells cultured on the Random Received: 9 May 2017 Accepted: 14 December 2017 Positioning Machine Published: xx xx xxxx Sascha Kopp1, Jayashree Sahana2, Tawhidul Islam2, Asbjørn Graver Petersen2, Johann Bauer3, Thomas J. Corydon 2,4, Herbert Schulz5, Kathrin Saar6, Norbert Huebner6, Lasse Slumstrup2, Stefan Riwaldt2, Markus Wehland1, Manfred Infanger1, Ronald Luetzenberg1 & Daniela Grimm1,2 Human MCF-7 breast cancer cells were exposed to a Random Positioning Machine (RPM). After 24 hours (h) the cells grew either adherently within a monolayer (AD) or within multicellular spheroids (MCS). AD and MCS populations were separately harvested, their cellular diferences were determined performing qPCR on genes, which were diferently expressed in AD and MCS cells. Gene array technology was applied to detect RPM-sensitive genes in MCF-7 cells after 24 h. Furthermore, the capability to form multicellular spheroids in vitro was compared with the intracellular distribution of NF-kappaB (NFκB) p65. NFκB was equally distributed in static control cells, but predominantly localized in the cytoplasm in AD cells and nucleus in MCS cells exposed to the RPM. Gene array analyses revealed a more than 2-fold change of only 23 genes including some whose products are afected by oxygen levels or regulate glycolysis. Signifcant upregulations of the mRNAs of enzymes degrading heme, of ANXA1, ANXA2, CTGF, CAV2 and ICAM1, as well as of FAS, Casp8, BAX, p53, CYC1 and PARP1 were observed in MCS cells as compared with 1g-control and AD cells. An interaction analysis of 47 investigated genes suggested that HMOX-1 and NFκB variants are activated, when multicellular spheroids are formed.
    [Show full text]
  • First Insight Into the Modulation of Noncanonical NF-Κb Signaling
    pathogens Article First Insight into the Modulation of Noncanonical NF-κB Signaling Components by Poxviruses in Established Immune-Derived Cell Lines: An In Vitro Model of Ectromelia Virus Infection Justyna Struzik 1,*, Lidia Szulc-D ˛abrowska 1, Matylda B. Mielcarska 1, Magdalena Bossowska-Nowicka 1, Michał Koper 2 and Małgorzata Giery ´nska 1 1 Division of Immunology, Department of Preclinical Sciences, Institute of Veterinary Medicine, Warsaw University of Life Sciences-SGGW, Ciszewskiego 8, 02-786 Warsaw, Poland; [email protected] (L.S.-D.); [email protected] (M.B.M.); [email protected] (M.B.-N.); [email protected] (M.G.) 2 Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, A. Pawi´nskiego5A, 02-106 Warsaw, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-22-59-360-61 Received: 17 August 2020; Accepted: 1 October 2020; Published: 4 October 2020 Abstract: Dendritic cells (DCs) and macrophages are the first line of antiviral immunity. Viral pathogens exploit these cell populations for their efficient replication and dissemination via the modulation of intracellular signaling pathways. Disruption of the noncanonical nuclear factor κ-light-chain-enhancer of activated B cells (NF-κB) signaling has frequently been observed in lymphoid cells upon infection with oncogenic viruses. However, several nononcogenic viruses have been shown to manipulate the noncanonical NF-κB signaling in different cell types. This study demonstrates the modulating effect of ectromelia virus (ECTV) on the components of the noncanonical NF-κB signaling pathway in established murine cell lines: JAWS II DCs and RAW 264.7 macrophages.
    [Show full text]
  • Alterations of the Pro-Survival Bcl-2 Protein Interactome in Breast Cancer
    bioRxiv preprint doi: https://doi.org/10.1101/695379; this version posted July 12, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Alterations of the pro-survival Bcl-2 protein interactome in 2 breast cancer at the transcriptional, mutational and 3 structural level 4 5 Simon Mathis Kønig1, Vendela Rissler1, Thilde Terkelsen1, Matteo Lambrughi1, Elena 6 Papaleo1,2 * 7 1Computational Biology Laboratory, Danish Cancer Society Research Center, 8 Strandboulevarden 49, 2100, Copenhagen 9 10 2Translational Disease Systems Biology, Faculty of Health and Medical Sciences, Novo 11 Nordisk Foundation Center for Protein Research University of Copenhagen, Copenhagen, 12 Denmark 13 14 Abstract 15 16 Apoptosis is an essential defensive mechanism against tumorigenesis. Proteins of the B-cell 17 lymphoma-2 (Bcl-2) family regulates programmed cell death by the mitochondrial apoptosis 18 pathway. In response to intracellular stresses, the apoptotic balance is governed by interactions 19 of three distinct subgroups of proteins; the activator/sensitizer BH3 (Bcl-2 homology 3)-only 20 proteins, the pro-survival, and the pro-apoptotic executioner proteins. Changes in expression 21 levels, stability, and functional impairment of pro-survival proteins can lead to an imbalance 22 in tissue homeostasis. Their overexpression or hyperactivation can result in oncogenic effects. 23 Pro-survival Bcl-2 family members carry out their function by binding the BH3 short linear 24 motif of pro-apoptotic proteins in a modular way, creating a complex network of protein- 25 protein interactions.
    [Show full text]
  • Computational Simulations to Predict Creatine Kinase-Associated Factors: Protein-Protein Interaction Studies of Brain and Muscle Types of Creatine Kinases
    SAGE-Hindawi Access to Research Enzyme Research Volume 2011, Article ID 328249, 12 pages doi:10.4061/2011/328249 Research Article Computational Simulations to Predict Creatine Kinase-Associated Factors: Protein-Protein Interaction Studies of Brain and Muscle Types of Creatine Kinases Wei-Jiang Hu,1 Sheng-Mei Zhou,2 Joshua SungWoo Yang,3, 4 and Fan-Guo Meng1 1 Zhejiang Provincial Key Laboratory of Applied Enzymology, Yangtze Delta Region Institute of Tsinghua University, Jiaxing 314006, China 2 College of Biology and Chemical Engineering, Jiaxing University, Jiaxing 314001, China 3 Korean Bioinformation Center (KOBIC), Korea Research Institute of Bioscience & Biotechnology (KRIBB), Daejeon 305-806, Republic of Korea 4 Department of Bioinformatics, University of Sciences & Technology, Daejeon 205-305, Republic of Korea Correspondence should be addressed to Fan-Guo Meng, [email protected] Received 17 May 2011; Accepted 26 May 2011 Academic Editor: Jun-Mo Yang Copyright © 2011 Wei-Jiang Hu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Creatine kinase (CK; EC 2.7.3.2) is related to several skin diseases such as psoriasis and dermatomyositis. CK is important in skin energy homeostasis because it catalyzes the reversible transfer of a phosphoryl group from MgATP to creatine. In this study, we predicted CK binding proteins via the use of bioinformatic tools such as protein-protein interaction (PPI) mappings and suggest the putative hub proteins for CK interactions. We obtained 123 proteins for brain type CK and 85 proteins for muscle type CK in the interaction networks.
    [Show full text]