DOCSLIB.ORG

Hearts of Dystonia Musculorum Mice Display Normal Morphological and Histological Features but Show Signs of Cardiac Stress

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Hearts of Dystonia Musculorum Mice Display Normal Morphological and Histological Features but Show Signs of Cardiac Stress Hearts of Dystonia musculorum Mice Display Normal Morphological and Histological Features but Show Signs of Cardiac Stress Justin G. Boyer2,4,5., Kunal Bhanot4,5., Rashmi Kothary4,5,Ce´line Boudreau-Larivie`re1,2,3* 1 School of Human Kinetics, Laurentian University, Sudbury, Ontario, Canada, 2 Department of Biology, Laurentian University, Sudbury, Ontario, Canada, 3 Biomolecular Sciences Program, Laurentian University, Sudbury, Ontario, Canada, 4 Regenerative Medicine Program, Ottawa Hospital Research Institute, Ottawa, Ontario, Canada, 5 Department of Cellular and Molecular Medicine, University of Ottawa, Ottawa, Ontario, Canada Abstract Dystonin is a giant cytoskeletal protein belonging to the plakin protein family and is believed to crosslink the major filament systems in contractile cells. Previous work has demonstrated skeletal muscle defects in dystonin-deficient dystonia musculorum (dt) mice. In this study, we show that the dystonin muscle isoform is localized at the Z-disc, the H zone, the sarcolemma and intercalated discs in cardiac tissue. Based on this localization pattern, we tested whether dystonin- deficiency leads to structural defects in cardiac muscle. Desmin intermediate filament, microfilament, and microtubule subcellular organization appeared normal in dt hearts. Nevertheless, increased transcript levels of atrial natriuretic factor (ANF, 66%) b-myosin heavy chain (beta-MHC, 95%) and decreased levels of sarcoplasmic reticulum calcium pump isoform 2A (SERCA2a, 26%), all signs of cardiac muscle stress, were noted in dt hearts. Hearts from two-week old dt mice were assessed for the presence of morphological and histological alterations. Heart to body weight ratios as well as left ventricular wall thickness and left chamber volume measurements were similar between dt and wild-type control mice. Hearts from dt mice also displayed no signs of fibrosis or calcification. Taken together, our data provide new insights into the intricate structure of the sarcomere by situating dystonin in cardiac muscle fibers and suggest that dystonin does not significantly influence the structural organization of cardiac muscle fibers during early postnatal development. Citation: Boyer JG, Bhanot K, Kothary R, Boudreau-Larivie`re C (2010) Hearts of Dystonia musculorum Mice Display Normal Morphological and Histological Features but Show Signs of Cardiac Stress. PLoS ONE 5(3): e9465. doi:10.1371/journal.pone.0009465 Editor: Gianni Parise, McMaster University, Canada Received October 17, 2009; Accepted February 8, 2010; Published March 1, 2010 Copyright: ß 2010 Boyer et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: This work was supported by research grants from the National Science and Engineering Research Council of Canada (C.B.-L.) and Canadian Institutes of Health Research (R.K.). J.G.B. was a recipient of a Canada Graduate Scholarship from Natural Sciences and Engineering Research Council of Canada at the time this study was completed. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] . These authors contributed equally to this work. Introduction The dystonia musculorum (dt) mouse mutant has been studied as a model of sensory neuropathy since its initial identification [17,18]. Plakin crosslinking proteins such as dystonin and plectin have Several allelic variants of dt exist in which mutations of the been implicated in regulating the cytoskeletal organization and dystonin gene result in a dramatic reduction and virtual loss of function of muscle (recently reviewed in [1,2]). While a number of dystonin gene expression [19]. In the dtTg4 mouse model [20], recent studies have further defined the role of plectin in muscle intrinsic skeletal muscle defects have previously been reported tissue [3,4,5,6], much less progress has been made in elucidating [21]. Specifically, skeletal muscles from the dtTg4 mice have thick the functions of dystonin in contractile cells. and poorly defined Z- discs and display a reduction in sarcomere Several different dystonin isoforms are produced through length as well as abnormal mitochondrial clumping under the alternative splicing of the dystonin gene [7,8,9]. Dystonin isoforms sarcolemma [21]. Furthermore, the dtTg4 skeletal muscles are weak are expressed in a tissue-specific manner and include an epithelial and fragile. These skeletal muscle defects likely contribute to the isoform (dystonin-e) [10], neuronal isoforms (dystonin-a) [8,11,12], limb incoordination phenotype displayed by these mice. Dystonin as well as muscle isoforms (dystonin-b) [8]. The muscle and appears to play a more critical role in maintaining the stability of neuronal isoforms can be further characterized by three unique N- the cytoarchitecture in skeletal muscle fibers, rather than in the terminal regions (dystonin-b1, b2, b3/a1, a2, a3) that influence the establishment of the cytoskeletal networks during muscle forma- subcellular localization of these proteins [13,14,15,16]. The tion and development [21]. This notion is further supported by dystonin-b muscle isoforms are the largest (834 kDa) and consist primary myogenic cell culture experiments where it was shown of several domains: an N-terminal actin-binding domain (ABD), a that the proliferation and differentiation potential of dtTg4 plakin domain, a spectrin repeat containing rod domain, a myogenic cells is similar to that of wild-type (wt) cells [22]. centrally located intermediate filament binding domain (IFBD2) Collectively, these findings support the idea that dystonin and a microtubule-binding domain (MTBD) at the C-terminus maintains the structural integrity of skeletal muscle cells although [8]. the precise cellular mechanisms by which it does so, has not been PLoS ONE | www.plosone.org 1 March 2010 | Volume 5 | Issue 3 | e9465 Dystonin in Cardiac Muscle fully described [21,23]. Dystonin is highly expressed in cardiac Table 1. Primers used for QPCR experiments. muscle [8] and yet very little is known about the role of this molecule in heart tissue. Given the apparent function of dystonin in skeletal muscle cells, it is reasonable to expect that this Targets Sense primer 59-39 Antisense primer 59-39 crosslinking protein would have a key function in maintaining the structural integrity of cardiac tissue. In the present study, we show ANF GAGTGGGCAGAGACAGCAAA CAGGTGAGACCCGAGGTTAG using a muscle isoform-specific dystonin antibody, that dystonin is BNF CATGGATCTCCTGAAGGTGC CAACACCGTCAAACACGAGG localized at the Z-disc and H zone in cardiac muscle. We assessed SERCA2a GAATCTGTCTCCGTCATCAAGC GATTCGTCCACCACTACTGTCGTC the expression of genes routinely used as early indicators of cardiac beta-MHC GAAGATGCGGCGGGACCTGG GAACGCTGCGTCTCCTCGGC myopathy, particularly cardiac hypertrophy and show that the PLB CGATCACCGAAGCCAAGGTCTCC CGGTGCGTTGCTTCCCCCAT expression profile of these markers in dystonin-deficient in comparison to wt hearts is suggestive of early signs of cardiac S12 rRNA GGAAGGCATAGCTGCTGG CCTCGATGACATCCTTGG myopathy. However, our analysis did not reveal any morpholog- MACF GGGCCTGATCTGGACCATTATC AAGTGCCTTTAGTTCAACAGGG ical defects in early development which may be attributed in part Plectin CAAGGCTCAAAGGCACATCAG CAGAAACTGGCACCATAGGA to the young age of the animals. Dp TGGGTACCTGCCAAGATGT TGAGCTCGTTGATTTTCACG Materials and Methods ANF, atrial natriuretic factor; BNF, b-type natriuretic factor; SERCA2a, sarcoplasmic reticulum calcium pump isoform 2A; beta-MHC, beta-myosin Ethics Statement heavy chain; PLB, phospholamban; S12 rRNA, ribosomal RNA; MACF, microtubule-actin crosslinking factor; Dp, desmoplakin. The mice were cared for according to the Canadian Council on doi:10.1371/journal.pone.0009465.t001 Animal Care (CCAC) guidelines. Ethical approval for experiments conducted was obtained from the Laurentian University Animal known amounts of input RNA ranging from 200 ng to 3 ng. Gene Care Committee. expression data for each target were normalized to rRNA S12 (internal control). Mice and Tissue Excision Tg4 The dystonia musculorum Tg4 (dt ) line of transgenic mice used in Morphologic and Histological Analyses of Heart Tissue this study is from the CD1 strain background and has an Heart weight/body weight (h.w./b.w.) ratios were determined by insertional mutation within the dystonin gene [11,20]. The mice weighing the mice and hearts using a Denver Instrument APX-602 were housed at the Laurentian University Animal Care Facility scale and a Sartorius ISO 9001 analytical scale respectively. To and cared for according to the Canadian Council on Animal Care assess the left ventricular wall thickness and chamber area, tissue (CCAC) guidelines. sections at a thickness of 8 mm were collected from the same area of Postnatal day 14 animals were anaesthetized with ketamine/ frozen wt and dt hearts using a Leica CM 3050 S cryostat set at rompun (0.1 mg/g, 0.01 mg/g) delivered by intraperitoneal 222 C. The muscle sections were stained with hematoxylin and injection before excising the tissues. The endpoint for the study u was 14 days after birth as most dtTg4 mice do not survive past two eosin using a standard staining procedure then visualized using a weeks of age. The hearts
Load more

Recommended publications
  • The Spectraplakin Dystonin Antagonizes YAP Activity and Suppresses Tumourigenesis Praachi B
    www.nature.com/scientificreports OPEN The spectraplakin Dystonin antagonizes YAP activity and suppresses tumourigenesis Praachi B. Jain1,2,3, Patrícia S. Guerreiro1,2,3, Sara Canato1,2,3 & Florence Janody 1,2,3* Aberrant expression of the Spectraplakin Dystonin (DST) has been observed in various cancers, including those of the breast. However, little is known about its role in carcinogenesis. In this report, we demonstrate that Dystonin is a candidate tumour suppressor in breast cancer and provide an underlying molecular mechanism. We show that in MCF10A cells, Dystonin is necessary to restrain cell growth, anchorage-independent growth, self-renewal properties and resistance to doxorubicin. Strikingly, while Dystonin maintains focal adhesion integrity, promotes cell spreading and cell-substratum adhesion, it prevents Zyxin accumulation, stabilizes LATS and restricts YAP activation. Moreover, treating DST- depleted MCF10A cells with the YAP inhibitor Verteporfn prevents their growth. In vivo, the Drosophila Dystonin Short stop also restricts tissue growth by limiting Yorkie activity. As the two Dystonin isoforms BPAG1eA and BPAG1e are necessary to inhibit the acquisition of transformed features and are both downregulated in breast tumour samples and in MCF10A cells with conditional induction of the Src proto-oncogene, they could function as the predominant Dystonin tumour suppressor variants in breast epithelial cells. Thus, their loss could deem as promising prognostic biomarkers for breast cancer. Breast cancer progression depends on cell autonomous regulatory mechanisms, driven by mutations and epi- genetic changes, and on non-cell autonomous interactions with the surrounding tumour microenvironment1,2. During this multistep process, normal breast epithelial cells acquire various cellular properties arising from dereg- ulated cellular signalling3,4.
    [Show full text]
  • Drp1 Overexpression Induces Desmin Disassembling and Drives Kinesin-1 Activation Promoting Mitochondrial Trafficking in Skeletal Muscle
    Cell Death & Differentiation (2020) 27:2383–2401 https://doi.org/10.1038/s41418-020-0510-7 ARTICLE Drp1 overexpression induces desmin disassembling and drives kinesin-1 activation promoting mitochondrial trafficking in skeletal muscle 1 1 2 2 2 3 Matteo Giovarelli ● Silvia Zecchini ● Emanuele Martini ● Massimiliano Garrè ● Sara Barozzi ● Michela Ripolone ● 3 1 4 1 5 Laura Napoli ● Marco Coazzoli ● Chiara Vantaggiato ● Paulina Roux-Biejat ● Davide Cervia ● 1 1 2 1,4 6 Claudia Moscheni ● Cristiana Perrotta ● Dario Parazzoli ● Emilio Clementi ● Clara De Palma Received: 1 August 2019 / Revised: 13 December 2019 / Accepted: 23 January 2020 / Published online: 10 February 2020 © The Author(s) 2020. This article is published with open access Abstract Mitochondria change distribution across cells following a variety of pathophysiological stimuli. The mechanisms presiding over this redistribution are yet undefined. In a murine model overexpressing Drp1 specifically in skeletal muscle, we find marked mitochondria repositioning in muscle fibres and we demonstrate that Drp1 is involved in this process. Drp1 binds KLC1 and enhances microtubule-dependent transport of mitochondria. Drp1-KLC1 coupling triggers the displacement of KIF5B from 1234567890();,: 1234567890();,: kinesin-1 complex increasing its binding to microtubule tracks and mitochondrial transport. High levels of Drp1 exacerbate this mechanism leading to the repositioning of mitochondria closer to nuclei. The reduction of Drp1 levels decreases kinesin-1 activation and induces the partial recovery of mitochondrial distribution. Drp1 overexpression is also associated with higher cyclin-dependent kinase-1 (Cdk-1) activation that promotes the persistent phosphorylation of desmin at Ser-31 and its disassembling. Fission inhibition has a positive effect on desmin Ser-31 phosphorylation, regardless of Cdk-1 activation, suggesting that induction of both fission and Cdk-1 are required for desmin collapse.
    [Show full text]
  • Gene Expression Signatures and Biomarkers of Noninvasive And
    Oncogene (2006) 25, 2328–2338 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE Gene expression signatures and biomarkers of noninvasive and invasive breast cancer cells: comprehensive profiles by representational difference analysis, microarrays and proteomics GM Nagaraja1, M Othman2, BP Fox1, R Alsaber1, CM Pellegrino3, Y Zeng2, R Khanna2, P Tamburini3, A Swaroop2 and RP Kandpal1 1Department of Biological Sciences, Fordham University, Bronx, NY, USA; 2Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, MI, USA and 3Bayer Corporation, West Haven, CT, USA We have characterized comprehensive transcript and Keywords: representational difference analysis; micro- proteomic profiles of cell lines corresponding to normal arrays; proteomics; breast carcinoma; biomarkers; breast (MCF10A), noninvasive breast cancer (MCF7) and copper homeostasis invasive breast cancer (MDA-MB-231). The transcript profiles were first analysed by a modified protocol for representational difference analysis (RDA) of cDNAs between MCF7 and MDA-MB-231 cells. The majority of genes identified by RDA showed nearly complete con- Introduction cordance withmicroarray results, and also led to the identification of some differentially expressed genes such The transformation of a normal cell into a cancer cell as lysyl oxidase, copper transporter ATP7A, EphB6, has been correlated to altered expression of a variety of RUNX2 and a variant of RUNX2. The altered transcripts genes (Perou et al., 2000; Becker et al., 2005). The identified by microarray analysis were involved in cell–cell expression of some of these genes is a direct result of or cell–matrix interaction, Rho signaling, calcium home- sequence mutation, whereas other changes occur due to ostasis and copper-binding/sensitive activities.
    [Show full text]
  • Supplementary Table 1 Genes Tested in Qrt-PCR in Nfpas
    Supplementary Table 1 Genes tested in qRT-PCR in NFPAs Gene Bank accession Gene Description number ABI assay ID a disintegrin-like and metalloprotease with thrombospondin type 1 motif 7 ADAMTS7 NM_014272.3 Hs00276223_m1 Rho guanine nucleotide exchange factor (GEF) 3 ARHGEF3 NM_019555.1 Hs00219609_m1 BCL2-associated X protein BAX NM_004324 House design Bcl-2 binding component 3 BBC3 NM_014417.2 Hs00248075_m1 B-cell CLL/lymphoma 2 BCL2 NM_000633 House design Bone morphogenetic protein 7 BMP7 NM_001719.1 Hs00233476_m1 CCAAT/enhancer binding protein (C/EBP), alpha CEBPA NM_004364.2 Hs00269972_s1 coxsackie virus and adenovirus receptor CXADR NM_001338.3 Hs00154661_m1 Homo sapiens Dicer1, Dcr-1 homolog (Drosophila) (DICER1) DICER1 NM_177438.1 Hs00229023_m1 Homo sapiens dystonin DST NM_015548.2 Hs00156137_m1 fms-related tyrosine kinase 3 FLT3 NM_004119.1 Hs00174690_m1 glutamate receptor, ionotropic, N-methyl D-aspartate 1 GRIN1 NM_000832.4 Hs00609557_m1 high-mobility group box 1 HMGB1 NM_002128.3 Hs01923466_g1 heterogeneous nuclear ribonucleoprotein U HNRPU NM_004501.3 Hs00244919_m1 insulin-like growth factor binding protein 5 IGFBP5 NM_000599.2 Hs00181213_m1 latent transforming growth factor beta binding protein 4 LTBP4 NM_001042544.1 Hs00186025_m1 microtubule-associated protein 1 light chain 3 beta MAP1LC3B NM_022818.3 Hs00797944_s1 matrix metallopeptidase 17 MMP17 NM_016155.4 Hs01108847_m1 myosin VA MYO5A NM_000259.1 Hs00165309_m1 Homo sapiens nuclear factor (erythroid-derived 2)-like 1 NFE2L1 NM_003204.1 Hs00231457_m1 oxoglutarate (alpha-ketoglutarate)
    [Show full text]
  • Human Induced Pluripotent Stem Cell–Derived Podocytes Mature Into Vascularized Glomeruli Upon Experimental Transplantation
    BASIC RESEARCH www.jasn.org Human Induced Pluripotent Stem Cell–Derived Podocytes Mature into Vascularized Glomeruli upon Experimental Transplantation † Sazia Sharmin,* Atsuhiro Taguchi,* Yusuke Kaku,* Yasuhiro Yoshimura,* Tomoko Ohmori,* ‡ † ‡ Tetsushi Sakuma, Masashi Mukoyama, Takashi Yamamoto, Hidetake Kurihara,§ and | Ryuichi Nishinakamura* *Department of Kidney Development, Institute of Molecular Embryology and Genetics, and †Department of Nephrology, Faculty of Life Sciences, Kumamoto University, Kumamoto, Japan; ‡Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Hiroshima, Japan; §Division of Anatomy, Juntendo University School of Medicine, Tokyo, Japan; and |Japan Science and Technology Agency, CREST, Kumamoto, Japan ABSTRACT Glomerular podocytes express proteins, such as nephrin, that constitute the slit diaphragm, thereby contributing to the filtration process in the kidney. Glomerular development has been analyzed mainly in mice, whereas analysis of human kidney development has been minimal because of limited access to embryonic kidneys. We previously reported the induction of three-dimensional primordial glomeruli from human induced pluripotent stem (iPS) cells. Here, using transcription activator–like effector nuclease-mediated homologous recombination, we generated human iPS cell lines that express green fluorescent protein (GFP) in the NPHS1 locus, which encodes nephrin, and we show that GFP expression facilitated accurate visualization of nephrin-positive podocyte formation in
    [Show full text]
  • Basal Cells As Stem Cells of the Mouse Trachea and Human Airway Epithelium
    Basal cells as stem cells of the mouse trachea and human airway epithelium Jason R. Rocka, Mark W. Onaitisb, Emma L. Rawlinsa, Yun Lua, Cheryl P. Clarka, Yan Xuea, Scott H. Randellc, and Brigid L. M. Hogana,1 Departments of aCell Biology and bSurgery, Duke University Medical Center, Durham, NC 27710; and cCystic Fibrosis/Pulmonary Research and Treatment Center, University of North Carolina, Chapel Hill, NC 27559 Contributed by Brigid L. M. Hogan, June 18, 2009 (sent for review May 16, 2009) The pseudostratified epithelium of the mouse trachea and human Results and Discussion airways contains a population of basal cells expressing Trp-63 (p63) In Vivo Lineage Tracing of Mouse Tracheal BCs. Previous lineage T2 and cytokeratins 5 (Krt5) and Krt14. Using a KRT5-CreER trans- tracing of mouse tracheal BCs after injury used a KRT14-CreER genic mouse line for lineage tracing, we show that basal cells transgene (8). However, this allele is inefficient for labeling BCs generate differentiated cells during postnatal growth and in the in steady state. We therefore made a new line in which a 6-kb adult during both steady state and epithelial repair. We have human keratin 5 (KRT5) promoter drives CreERT2 (Fig. 1A). We fractionated mouse basal cells by FACS and identified 627 genes used this allele, in combination with the Rosa26R-lacZ reporter, preferentially expressed in a basal subpopulation vs. non-BCs. to lineage trace BCs in adult mice for up to 14 weeks (Fig. 1B). Analysis reveals potential mechanisms regulating basal cells and Soon after the last tamoxifen (Tmx) injection, most of the allows comparison with other epithelial stem cells.
    [Show full text]
  • Analysis of Gene Expression in Human Dermal Fibroblasts Treated with Senescence-Modulating COX Inhibitors
    eISSN 2234-0742 Genomics Inform 2017;15(2):56-64 G&I Genomics & Informatics https://doi.org/10.5808/GI.2017.15.2.56 ORIGINAL ARTICLE Analysis of Gene Expression in Human Dermal Fibroblasts Treated with Senescence-Modulating COX Inhibitors Jeong A. Han1*, Jong-Il Kim2,3,4** 1Department of Biochemistry and Molecular Biology, Kangwon National University School of Medicine, Chuncheon 24341, Korea, 2Department of Biochemistry and Molecular Biology, Seoul National University College of Medicine, Seoul 03080, Korea, 3Cancer Research Institute, Seoul National University College of Medicine, Seoul 03080, Korea, 4Department of Biomedical Sciences, Seoul National University Graduate School, Seoul 03080, Korea We have previously reported that NS-398, a cyclooxygenase-2 (COX-2)–selective inhibitor, inhibited replicative cellular senescence in human dermal fibroblasts and skin aging in hairless mice. In contrast, celecoxib, another COX-2–selective inhibitor, and aspirin, a non-selective COX inhibitor, accelerated the senescence and aging. To figure out causal factors for the senescence-modulating effect of the inhibitors, we here performed cDNA microarray experiment and subsequent Gene Set Enrichment Analysis. The data showed that several senescence-related gene sets were regulated by the inhibitor treatment. NS-398 up-regulated gene sets involved in the tumor necrosis factor β receptor pathway and the fructose and mannose metabolism, whereas it down-regulated a gene set involved in protein secretion. Celecoxib up-regulated gene sets involved in G2M checkpoint and E2F targets. Aspirin up-regulated the gene set involved in protein secretion, and down-regulated gene sets involved in RNA transcription. These results suggest that COX inhibitors modulate cellular senescence by different mechanisms and will provide useful information to understand senescence-modulating mechanisms of COX inhibitors.
    [Show full text]
  • Restoration of Desmosomal Junction Protein Expression and Inhibition Of
    MOLECULAR AND CLINICAL ONCOLOGY 3: 171-178, 2015 Restoration of desmosomal junction protein expression and inhibition of H3K9‑specifichistone demethylase activity by cytostatic proline‑rich polypeptide‑1 leads to suppression of tumorigenic potential in human chondrosarcoma cells KARINA GALOIAN1, AMIR QURESHI1, GINA WIDEROFF1 and H.T. TEMPLE2 1Department of Orthopaedic Surgery; 2University of Miami Tissue Bank Division, Miller School of Medicine, University of Miami, Miami, FL 33136, USA Received September 18, 2014; Accepted October 8, 2014 DOI: 10.3892/mco.2014.445 Abstract. Disruption of cell-cell junctions and the concomi- and inhibits H3K9 demethylase activity, contributing to the tant loss of polarity, downregulation of tumor-suppressive suppression of tumorigenic potential in chondrosarcoma cells. adherens junctions and desmosomes represent hallmark phenotypes for several different cancer cells. Moreover, a Introduction variety of evidence supports the argument that these two common phenotypes of cancer cells directly contribute to Chondrosarcoma is a highly aggressive bone cancer of tumorigenesis. In this study, we aimed to determine the status mesenchymal origin, which is resistant to chemo- and radia- of intercellular junction proteins expression in JJ012 human tion therapies, leaving surgical resection as the only option. malignant chondrosarcoma cells and investigate the effect Metastatic spread of malignant cells eventually develops of the antitumorigenic cytokine, proline-rich polypeptide-1 following surgical resection. The malignant progression to (PRP-1) on their expression. The cell junction pathway array chondrosarcoma has been suggested to involve a degree of data indicated downregulation of desmosomal proteins, mesenchymal-to-epithelial transition (MET) and it has been such as desmoglein (1,428-fold), desmoplakin (620-fold) and demonstrated in an in vitro model that chondrosarcoma cells plakoglobin (442-fold).
    [Show full text]
  • Cytoskeletal Proteins in Neurological Disorders
    cells Review Much More Than a Scaffold: Cytoskeletal Proteins in Neurological Disorders Diana C. Muñoz-Lasso 1 , Carlos Romá-Mateo 2,3,4, Federico V. Pallardó 2,3,4 and Pilar Gonzalez-Cabo 2,3,4,* 1 Department of Oncogenomics, Academic Medical Center, 1105 AZ Amsterdam, The Netherlands; [email protected] 2 Department of Physiology, Faculty of Medicine and Dentistry. University of Valencia-INCLIVA, 46010 Valencia, Spain; [email protected] (C.R.-M.); [email protected] (F.V.P.) 3 CIBER de Enfermedades Raras (CIBERER), 46010 Valencia, Spain 4 Associated Unit for Rare Diseases INCLIVA-CIPF, 46010 Valencia, Spain * Correspondence: [email protected]; Tel.: +34-963-395-036 Received: 10 December 2019; Accepted: 29 January 2020; Published: 4 February 2020 Abstract: Recent observations related to the structure of the cytoskeleton in neurons and novel cytoskeletal abnormalities involved in the pathophysiology of some neurological diseases are changing our view on the function of the cytoskeletal proteins in the nervous system. These efforts allow a better understanding of the molecular mechanisms underlying neurological diseases and allow us to see beyond our current knowledge for the development of new treatments. The neuronal cytoskeleton can be described as an organelle formed by the three-dimensional lattice of the three main families of filaments: actin filaments, microtubules, and neurofilaments. This organelle organizes well-defined structures within neurons (cell bodies and axons), which allow their proper development and function through life. Here, we will provide an overview of both the basic and novel concepts related to those cytoskeletal proteins, which are emerging as potential targets in the study of the pathophysiological mechanisms underlying neurological disorders.
    [Show full text]
  • Small Cell Lung Cancer Young Kwang Chae1,2, Wooyoung M
    www.nature.com/scientificreports OPEN Overexpression of adhesion molecules and barrier molecules is associated with diferential Received: 21 September 2017 Accepted: 12 December 2017 infltration of immune cells in non- Published: xx xx xxxx small cell lung cancer Young Kwang Chae1,2, Wooyoung M. Choi2, William H. Bae2, Jonathan Anker2, Andrew A. Davis2, Sarita Agte1, Wade T. Iams2, Marcelo Cruz2, Maria Matsangou1,2 & Francis J. Giles1,2 Immunotherapy is emerging as a promising option for lung cancer treatment. Various endothelial adhesion molecules, such as integrin and selectin, as well as various cellular barrier molecules such as desmosome and tight junctions, regulate T-cell infltration in the tumor microenvironment. However, little is known regarding how these molecules afect immune cells in patients with lung cancer. We demonstrated for the frst time that overexpression of endothelial adhesion molecules and cellular barrier molecule genes was linked to diferential infltration of particular immune cells in non-small cell lung cancer. Overexpression of endothelial adhesion molecule genes is associated with signifcantly lower infltration of activated CD4 and CD8 T-cells, but higher infltration of activated B-cells and regulatory T-cells. In contrast, overexpression of desmosome genes was correlated with signifcantly higher infltration of activated CD4 and CD8 T-cells, but lower infltration of activated B-cells and regulatory T-cells in lung adenocarcinoma. This inverse relation of immune cells aligns with previous studies of tumor-infltrating B-cells inhibiting T-cell activation. Although overexpression of endothelial adhesion molecule or cellular barrier molecule genes alone was not predictive of overall survival in our sample, these genetic signatures may serve as biomarkers of immune exclusion, or resistance to T-cell mediated immunotherapy.
    [Show full text]
  • Intermediate Filaments and Their Associated Proteins
    93 Intermediate ®laments and their associated proteins: multiple dynamic personalities Megan K Houseweart∗ and Don W Cleveland² A fusion of mouse and human genetics has now proven that regulated by phosphorylation, the recent identi®cation of intermediate ®laments form a ¯exible scaffold essential for several kinases involved strengthens the argument that structuring cytoplasm in a variety of cell contexts. In some these dynamics are true in vivo events. The growing cases, the formation of this scaffold is achieved through a list of intermediate-®lament-associated proteins (IFAPs) newly identi®ed family of intermediate-®lament-associated surely expands the repertoire of possible interactions proteins that form cross-bridges between intermediate permitted to IFs and may also add another layer of ®laments and other cytoskeletal elements, including actin and regulatory complexity. Indeed, the discovery of several microtubules. human and mouse diseases caused by mutations in the IFAP proteins plectin and neuronal bullous pemphigoid antigen (BPAG1n) illustrates the importance of these Addresses molecules in providing links between components of the ∗Ludwig Institute for Cancer Research and Division of Cellular and Molecular Medicine, University of California at San Diego, 9500 cellular cytoskeleton. Most would agree that intermediate Gilman Drive, La Jolla, CA 92093, USA ®laments can no longer be thought of as the least dynamic ²Ludwig Institute for Cancer Research, Division of Cellular and components of the cell cytoskeleton. This review
    [Show full text]
  • The Spectrin Superfamily
    Downloaded from http://cshperspectives.cshlp.org/ on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Cytoskeletal Integrators: The Spectrin Superfamily Ronald K.H. Liem Department of Pathology and Cell Biology, Columbia University Medical Center, New York, New York 10032 Correspondence: [email protected] SUMMARY This review discusses the spectrin superfamily of proteins that function to connect cytoskeletal elements to each other, the cell membrane, and the nucleus. The signature domain is the spectrin repeat, a 106–122-amino-acid segment comprising three a-helices. a-actinin is considered to be the ancestral protein and functions to cross-link actin filaments. It then evolved to generate spectrin and dystrophin that function to link the actin cytoskeleton to the cell membrane, as well as the spectraplakins and plakins that link cytoskeletal elements to each other and to junctional complexes. A final class comprises the nesprins, which are able to bind to the nuclear membrane. This review discusses the domain organization of the various spectrin family members, their roles in protein–protein interactions, and their roles in disease, as determined from mutations, and it also describes the functional roles of the family members as determined from null phenotypes. Outline 1 Introduction 5 Spectraplakins and plakins 2 a-actinin 6 Nesprins 3 Spectrins 7 Concluding remarks 4 Dystrophin and utrophin References Editors: Thomas D. Pollard and Robert D. Goldman Additional Perspectives on The Cytoskeleton available at www.cshperspectives.org Copyright # 2016 Cold Spring Harbor Laboratory Press; all rights reserved; doi: 10.1101/cshperspect.a018259 Cite this article as Cold Spring Harb Perspect Biol 2016;8:a018259 1 Downloaded from http://cshperspectives.cshlp.org/ on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press R.K.H.
    [Show full text]