REDEFINITION AND REVISION OF THE GENUS TAENIAPTERA MACQUART, 1835
(DIPTERA: MICROPEZIDAE)
A Thesis
Presented to
The Faculty of Graduate Studies
of
The University of Guelph
by
MORGAN D. JACKSON
In partial fulfillment of requirements
for the degree of
Master of Science
April, 2011
© Morgan D. Jackson, 2011 Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition
395 Wellington Street 395, rue Wellington OttawaONK1A0N4 Ottawa ON K1A 0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-80009-6 Our file Notre reference ISBN: 978-0-494-80009-6
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
I+l Canada ABSTRACT
REDEFINITION AND REVISION OF THE GENUS TAENIAPTERA MACQUART, 1835 (D1PTERA: MICROPEZIDAE)
Morgan D. Jackson Advisors: University of Guelph, 2011 Professor S.A. Marshall Special Graduate Faculty J.H. Skevington
The genus Taeniaptera Macquart is redefined and revised following a phylogenetic analysis of select Taeniapterinae. The phylogenetic analysis utilized DNA characters (12S rRNA, cytochrome-c-oxidase subunit I, wingless, and a portion of the c- p-s region of CAD) as well as morphological characters (external structure, male & female genitalia). Data was analyzed primarily using maximum parsimony with Bayesian
Inference used for total molecular evidence. The existing Taeniapterine tribal classifications were recovered as paraphyletic. Taeniaptera, Hemichaeta Hennig,
ParagraUomyia Hendel and GraUomyia Rondani were all elevated to the generic level.
Taeniaptera is redefined to include only species with a closed wing cell T4+5
{Taeniaptera trivittata Macquart, T. lasciva (Fabricius), T. nigriceps Hennig, T. vulpes
Cresson, T. knutsonii n. sp., T. longapilis n. sp., and T. promiscua n. sp.), and belong to a larger clade characterized by an axe-shaped maxillary palpus.
Taeniaptera is revised with an illustrated key to species and detailed species
(re)descriptions. Acknowledgements
I'd like to begin by thanking my supervisors, Drs. Stephen A. Marshall and
Jeffrey H. Skevington. Steve first introduced me to the fascinating world of systematic entomology during my undergraduate studies, and has provided me with multiple opportunities to explore the never ending diversity of flies through class work and independent study, which has culminated in this study. Steve's encyclopedic knowledge of the lnsecta, endless patience critiquing and improving my writing, and prowess with a camera have all been invaluable to my education and career development. Jeff provided me a glimpse into the world of molecular phylogenetics and the potential gains and pitfalls associated with this field of study, and an alternative yet complimentary approach to systematics and taxonomy. Steve and Jeff also supported my research financially, with
NSERC Discovery Grants (SAM, JHS), University of Guelph funding (SAM), AAFC funding (JHS), and NSF funds through the Fly Tree of Life project (JHS). I'd also like to thank my third committee member, Dr. Robert Hanner for yet another viewpoint on the science of taxonomy.
I'd like to thank my friends and colleagues in the University of Guelph Insect collection (Matthew Bergeron, Adam Brunke, Dr. Matthias Buck, Phil Careless, Dave
Cheung, Gil Goncalves Miranda, Adam Jewiss-Gaines, Joel Kits, John Klymko, Nichelle
Lomas, Stephen Luk, Dr. Owen Lonsdale, Steve Paiero, Rob Pivar, and Andrew Young) for their continual support, academic opinions and debate, and for making the insect systematics lab a hell of a lot of fun, even on the most stressful of days. A special thank you to Scott Kelso, who taught me the art of the PCR, the way of the pipette, and showed me how a molecular lab should be run. I owe a large portion of my data to him, and he made my transition to the "dark side" (mostly) painless. Likewise,
Joel Gibson was always around to discuss troubles with techniques or new theories. The
CNC lunch crew (Drs. Jim O'Hara, Brad Sinclair, Scott Brooks, Jim Cumming, Pat
Bouchard and Gary Gibson) provided me with more opinions on entomology and academia than I can remember while also providing a source of daily entertainment as I listened to their "debates".
I'd like to thank the University of Guelph and the North American Dipterists
Society (NADS) for providing me travel grants to attend the International Congress of
Dipterology in Costa Rica and explore the wilderness of Costa Rica in search of more flies.
I'd like to thank the institutions that allowed me access to their collections or provided loans of Taeniaptera specimens to Dr. Stephen Marshall: CMNH - Section of
Insects and Spiders, Carnegie Museum of Natural History, Pittsburgh, PA; CNCI -
Canadian National Collection of Insects, Agriculture and Agri-Food Canada, Ottawa,
ON; INPA - Colecao Sistematica da Entomologia, Instituto Nacional de Pesquisas da
Amazonia, Manaus; MTEC - Montana State University Entomology Collection,
Entomology Research Laboratory, Montana State University, Bozeman, MT; UNCB
Museo de Historia Natural, Instituto de Ciencias Naturales, Universidad Nacional de
Colombia, Sante Fe' de Bogota', Colombia USNM - United States National Museum,
Smithsonian Institute, Washington DC. Last but certainly not least, 1 want to thank my wife, Renee, who has always supported and stood by me. She has put up with my collecting on vacations, long hours working in the lab or at home, and has always been waiting with a smile whenever I return from a collecting trip or conference.
m Table of Contents
Acknowledgements i
Table of Contents iv
List of Figures vii
List of Tables xiv
1. Introduction 1
1.1 General Biology 1
1.2 Classification of the Taeniapterinae 3
1.4 The Genus Taeniaptera Macquart 1835 4
2. Phylogeny of the Taeniapterinae 7
2.1 Introduction 7
2.2 Methodology - Molecular Phylogeny 8
2.2.1 Taxon Sampling and Storage 8
2.2.2 DNA Extraction 9
2.2.3 DNA Amplification 9
2.2.4 DNA Sequencing and editing 10
2.2.5 Sequence Alignment 11
2.2.6 Concatenated Molecular Dataset Parsimony Analysis 11
2.2.7 Bayesian Analysis 12
2.2.8 Sequence Congruency Test 13
2.2.9 Taxon Sampling - Morphological Parsimony Analysis 14
2.2.10 Matrix Coding and Specimen Preparation 14
2.2.11 Morphological Dataset & Total Evidence Parsimony Analyses 15
iv 2.3 Results 15
2.3.1 Sequencing Success and phylogenetic utility-white, EF-la and 28S 15
2.3.2 12S 16
2.3.3 COI 16
2.3.4 wingless 17
2.3.5 CAD 18
2.3.6 Concatenated Molecular Dataset Parsimony Analysis 18
2.3.7 Molecular Dataset Bayesian Analyses 19
2.3.8 Molecular Data Congruency 19
2.3.9 Morphological Dataset Parsimony Analyses 20
2.3.10 Total Evidence Parsimony Analysis 20
2.4 Discussion of Relationships 21
2.4.1 Total Evidence Parsimony Analysis 21
2.4.2 Bayesian Analysis of Concatenated Molecular Dataset 27
2.4.3 Gene sampling and utility 28
2.5 Taxonomic Recommendations Based on Total Evidence Analysis 30
3. Redefinition of the genus Taeniaptera Macquart 1835 and revision of the
Taeniaptera s.s 35
4. Conclusions & Future Work 66
5. Figures & Tables 68
6. References 145
7. Appendices 157
7.1 List of Abbreviations 157
v 7.2 Illustration of Characters used in Morphological Analysis 159
VI List of Figures
Figure 1: Graphical representation of Hennig's generic relationships of the
Taeniapterinae (Hennig, 1934; 1935a; 1935b; 1936) 68
Figure 2: Phylogeny of the Taeniapterinae from Albuquerque 1986 69
Figure 3: The subgenera of Taeniaptera and included species according to Albuquerque
(1986). ** - type species for the subgenus 70
Figure 4: Preferred tree for 12S parsimony analysis (tree length = 798, CI = 0.503, RI =
0.672). Numbers below nodes represent; bootstrap support/Total Bremer support.
Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Blue -
Paragrallomyia, Grey - Poecilotylus 71
Figure 5: Preferred tree for COI HEB parsimony analysis (tree length = 1492, CI =
0.286, RI = 0.478). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera,
Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus.
72
Figure 6: Single most parsimonious tree for COI PJ parsimony analysis (tree length =
1737, CI = 0.341, RI = 0.518). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red -
Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey -
Poecilotylus 73
vii Figure 7: Preferred most parsimonious tree for total COI dataset parsimony analysis (tree length = 3304, CI = 0.308, RI = 0.483). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations:
Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia,
Grey -Poecilotylus 74
Figure 8: Preferred most parsimonious tree for total wingless parsimony analysis (tree length = 498, CI = 0.574, RI = 0.643). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations:
Red - Taeniaptera, Green - Grallomyia, Blue - Paragrallomyia, Grey - Poecilotylus. 75
Figure 9: Preferred most parsimonious tree for wingless parsimony analysis with
Micropeza and Cryogonus species removed (tree length = 430, CI = 0.593, RI = 0.667).
Numbers above and below nodes represent; bootstrap support/jackknife support/Total
Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Blue
- Paragrallomyia, Grey - Poecilotylus 76
Figure 10: Preferred most parsimonious tree for CAD parsimony analysis (tree length =
350, CI = 0.462, RI = 0.536). Numbers above and below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red -
Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey -
Poecilotylus 77
viii Figure 11: Phylogram of preferred most parsimonious tree with branches proportional to lengths. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow -
Hemichaeta, Blue -Paragrallomyia, Grey -Poecilotylus 78
Figure 12: Preferred most parsimonious tree for combined data set including all genes examined (tree length = 8046, CI = 0.399, RI = 0.516). Numbers above and below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow -Hemichaeta, Blue -
Paragrallomyia, Grey - Poecilotylus 79
Figure 13: Preferred most parsimonious tree for combined data set including all genes examined (tree length = 8046, CI = 0.399, RI = 0.516). Values below branches are partitioned Bremer supports in the following order; 12S/COI HEB/COI PJ/WING/CAD.
Numbers following species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow -
Hemichaeta, Blue -Paragrallomyia, Grey - Poecilotylus 80
Figure 14: Congruent Topology Information (CTI) of data partitions (using strict consensus tree) when compared to total evidence strict consensus tree and adjusted for number of species represented compared to total evidence analysis 81
Figure 15: Majority Rule Consensus tree from Bayesian analysis of complete dataset.
Numbers at nodes are posterior probabilities. Numbers following species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red -
ix Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey -
Poecilotylus 82
Figure 16: Majority Rule Consensus tree from Bayesian analysis of complete dataset with 3rd codon positions of nuclear coding genes removed. Numbers at nodes are posterior probabilities. Numbers following species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera,
Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus.
83
Figure 17: Unweighted morphological parsimony analysis strict consensus tree (2 most parsimonious trees, length = 584, CI = 0.357, RI = 0.452). Numbers above nodes are bootstrap supports, numbers below nodes are Bremer supports. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow -
Hemichaeta, Blue -Paragrallomyia, Grey — Poecilotylus 84
Figure 18: Implied weighting morphological parsimony analysis tree (length = 50.55, CI
= 0.352, RI = 0.442). Numbers above nodes are bootstrap supports, numbers below nodes are Bremer supports. Coloured boxes represent new generic combinations: Red -
Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey -
Poecilotylus 85
Figure 19: Combined total evidence parsimony analysis including molecular and morphological character data. Preferred tree of 3 most parsimonious trees (length = 8686,
CI = 0.393, RI = 0.507). Numbers above nodes represent bootstrap supports/jackknife supports, numbers below nodes represent Bremer supports. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow -
Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus 86
Figure 20: Combined total evidence parsimony analysis including molecular and morphological character data. Preferred tree of 3 most parsimonious trees (length = 8686,
CI = 0.393, RI = 0.507). Boxes represent morphological characters (character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species.
87
Figure 21: Expanded view of Figure 20. Boxes represent morphological characters
(character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species 88
Figure 22: Expanded view of Figure 20. Boxes represent morphological characters
(character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species 89
Figure 23: Expanded view of Figure 20. Boxes represent morphological characters
(character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species 90
Figure 24: Higher classification of Micropezidae through the years 91
Figure 25: Taeniaptera trivittata -A: head (lateral) displaying maxillary palpus. -B: head
(anterior). -C: wing. -D: wing WIP. Abbreviations: Ar = arista; CI = clypeus; Ep =
xi epicephala; FF = first antenna] flagellomere; Fr = frontal; Mf = mesofrons; MP = maxillary palpus; OT = ocellar triangle; Pc = paracephala; Pfc = paraface; Pfr = parafrontal 92
Figure 26: Taeniaptera trivittata ($) -A: fore tarsomeres. -B: male genital fork. -C: general habitus 93
Figure 27: Taeniaptera trivittata -A: male genitalia. -B: female genitalia. Abbreviations:
AA = adeagal apodeme; ADi = apical distiphallus; Ba = basiphallus; BDi = basal distiphallus; Bu = bulb; Ce = cercus; EjA = Ejaculatory apodeme; Ep = epandrium; HA = hypandrial apodeme; Hp = hypandrium; PD = pair spermafhecal duct; PSp = paired spermatheca; SD = single spennathecal duct; SSp = single spermatheca; Va = vagina.. 94
Figure 28: Taeniaptera lasciva -A: wing. -B: wing WIP 95
Figure 29: Taeniaptera lasciva -A: head and thorax chaetotaxy. -B: head and fore tarsomeres. -C: male genital fork 96
Figure 30: Taeniaptera lasciva -A: general habitus (<$)• -B: live specimen ($), staged,
Henri Pittier National Park, Venezuela 97
Figure 31: Taeniaptera lasciva -A: male genitalia. -B: female genitalia 98
Figure 32: Taeniaptera nigriceps lectotype (9) -A: head, wing and thorax, displaying 4 dorsocentral bristles (photo by S. A. Marshall). -B: lateral habitus (photo by S. A.
Marshall) 99
Figure 33: Taeniaptera nigriceps lectotype ($), left lateral habitus (photo by S.A.
Marshall) 100
Figure 34: Taeniaptera nigriceps lectotype ($), right lateral habitus (photo by S. A.
Marshall) 101
xn Figure 35: Taeniaptera vulpes holotype, male (photo by S. A. Marshall) 102
Figure 36: Taeniaptera vulpes holotype, male (photo by S. A. Marshall) 103
Figure 37: Taeniaptera vulpes holotype, male (photo by S. A. Marshall) 104
Figure 38: Taeniaptera knutsonii sp. nov. -A: wing. -B: wing WIP. -C: head displaying mesofrontal spot and yellow frons (holotype, S) 105
Figure 39: Taeniaptera knutsonii sp. nov. general habitus ($) 106
Figure 40: Taeniaptera knutsonii sp. nov. -A: male genitalia. -B: male ejaculatory apodeme. -C: female genitalia 107
Figure 41: Taeniaptera longapilis sp. nov. -A: wing. -B: wing WIP. -C: hind femur illustrating knot-like swelling 108
Figure 42: Taeniaptera longapilis sp. nov. holotype ($) -A: general habitus. -B: head and thorax displaying fore tarsomeres, mesofrontal spot and brown frons, and 2 dorsocentral bristles 109
Figure 43: Taeniaptera promiscua sp. nov. holotype (S) -A: wing. -B: wing WIP. -C: hind femur displaying cylindrical apex 110
Figure 44: Taeniaptera promiscua sp. nov. holotype (<$) -A: general habitus. -B: fore tarsomeres Ill
Xlll List of Tables
Table 1: Taxonomy of species included in analyses 112
Table 2: Specimens examined list for molecular study 113
Table 3: Primer oligonucleotides used for PCR amplication with original references and type of polymerase used for each. (S) - sense, (A) - antisense 115
Table 4: Temperature cycles for each primer pair used. CAD cycles included 3 annealing cycles done back to back 117
Table 5: Akaike Information Criterion models selected for Bayesian analysis. Negative log-liklihood (-lnf), number of estimated (free) parameters (K), and Akaike Information
Criterion (AIQ) are provided 118
Table 6: Specimens examined for morphological phylogenetic analyses 119
Table 7: Morphological Character list for the Taeniapterinae 124
Table 8: Morphological character matrix for the Taeniapterinae 136
Table 9: Incongruence Length Difference (ILD) results 139
Table 10: List of new combinations resulting from this study 140
xiv 1. Introduction
In the New World, Micropezidae is represented by four subfamilies;
Micropezinae, Calobatinae, Eurybatinae, and Taeniapterinae. The latter is the most diverse subfamily with 21 genera currently recognized in the New World (Marshall,
2010). Taeniapterines are most diverse in tropical Central and South America with more than 250 species currently described but, despite their large size, abundance in most tropical habitats, and relative ease of collection, they have received little attention from taxonomists and remain difficult to identify without comparison to type material. The genus Taeniaptera Macquart, one of the largest micropezid genera, is especially poorly defined and difficult to distinguish from the closely related Poecilotylus Hennig. This taxonomic impediment is here addressed by examining the relationships between
Taeniaptera and similar genera using multiple data sources. The validity of the current tribal classification of Taeniapterinae is examined, Taeniaptera is redefined, and the newly redefined Taeniaptera is revised.
The nomenclature used throughout this study reflects the most recent catalog of
Neotropical Micropezidae (Steyskal, 1968 (Table 1)), although the combinations in the
Steyskal catalog often differ from the generic concepts used by Marshall (2010) and from the generic concepts accepted in the current work; current generic combinations are colour coded on phylogenetic trees according to current combinations.
1.1 General Biology
Taeniapterine micropezids are common throughout the New and Old World tropics and are particularly diverse in the Neotropics. Several species are routinely encountered as they stand conspicuously on broad leaves, and both sexes of many species are attracted to
1 freshly deposited dung of mammals and birds. Females seem more likely than males to feed on the dung.
The courtship rituals of some Taeniapterinae are intricate and well-documented.
Wheeler's (1924) description of the mating rituals of Plocoscelus arthriticus
(Wiedemann) (as Cardiacephala myrmex (Schiner)) included precopulation "dancing", direct male-to-female oral trophallaxis or placement of fluids on the eye of the female for her to wipe off and consume, and stroking the female's eyes by the male. Similar behaviours have been observed for other genera including Ptilosphen Enderlein (Ortiz,
2001), Taeniaptera Macquart (Marshall, 2006) and Scipopus Enderlein (Marshall, 2010).
The larvae and larval habitats of most micropezids remain largely unknown. The larvae of Calobata cibaria L. and C. petronella L. live in decomposing grass piles in
England (Brindle, 1965), and Micropeza corrigiolata L. has been reared from field pea
(Pisum arvense L.), red clover (Trifolium pretense L.), and alfalfa (Medicago sativa L.) in Europe (Miiller, 1957; Ferrar, 1987). Within the Taeniapterinae, Mimegralla albimana
(Doleschall) and M. coeruleifrons (Macquart) have been reared from ginger root intercepted at customs quarantine units in the U.S.A. (Steyskal, 1964). Rainieria brunneipes (Cresson) was reared in eastern Michigan from pupae found in the crotch of an American Elm tree, where they were likely feeding on rotting wood (Sabrosky, 1942).
Fischer (1932) described the larva of Taeniaptera annulata (Fabricius) as occurring in a rotting pile of cut banana stems. Finally, Taeniaptera lasciva (Fabricius) has been found to inhabit decomposing sugar cane cuttings in Puerto Rico (Cresson, 1938) and "infesting roots of fig tree, under the bark" in Jacksonville, FL (Steyskal, 1964), two very different larval habitats that may bear further examination. Marshall (2006) recorded Taeniaptera
2 trivittata ovipositing in the rotting roots of Typha L. Judging by the consistent shape and structure of the female ovipositor across taeniapterine micropezids, it is likely that most oviposit in similar habitats of rotting or softened plant material.
Most species of Taeniapterinae are apparent Batesian mimics of Hymenoptera, specifically Formicidae (McAlpine, 1987), Pompilidae, and Ichneumonoidea. Several species have evolved convincing morphological and behavioural characters to aid in their deception. Many species have lightly coloured fore tarsomeres which are waved in front of their bodies, appearing much like the antennal movements of ichneumonoid wasps. In addition to the front tarsomeres, many species have body colouring similar to their hymenopteran models, and have wing patterns that make the fly appear to have a petiolate waist. Some species in the genus Plocoscelus Enderlein are such convincing ant mimics that males in mid-courtship have been observed attempting to mate with ants, resulting in their swift demise (Eberhard, 1999).
1.2 Classification of the Taeniapterinae
Very little work has been done on the relationships between the genera that comprise the Taeniapterinae. Besides the standard descriptions and synonymies of genera and the close relationships implied by these, there have been few hypotheses made about relationships within the subfamily. The earliest discussion of the relationships within
Taeniapterinae was by Hennig in his early works on the family (Hennig, 1934; Hennig,
1935a; Hennig, 1935b; Hennig, 1936) (Fig. 1). This work shows that Hennig, despite being the father of modern phylogenetics, did not use an explicitly phylogenetic approach to classification in his early papers as he had generic groups arising from within each
3 subgenus of Taeniaptera. Cresson (1938) subdivided the North American Taeniapterinae into the Taeniapterini and the Rainieriini based on wing venation and antennal structure, and Aczel (1951) divided the Argentinian Taeniapterinae into the Taeniapterini and the
Grallipezini based on the length of the anal cell. The simplistic division of the
Taeniapterinae into two tribes on the basis of wing venation will be tested during the course of this project. An unpublished doctoral thesis by Albuquerque (1986) provided the first explicit phylogenetic hypothesis (Fig. 2) of the subfamily including all of the taeniapterine genera found in Brazil, but most branches were only supported by a single character state.
1.4 The Genus Taeniaptera Macquart 1835
The genus Taeniaptera was described by Macquart in 1835 with Taeniaptera trivittata Macquart as type species. The original description was as follows:
"Head slightly prolonged on bottom and sides. Proboscis
thick. Oral margin indented. Third antennal segment
elongate. Wings with the first posterior cell closed; anal
cell elongated and pointed. (Macquart, 1835)
(translated via Google Translate - http://translate.google.com)
Four species have been described in the genus since Steyskal (1968) compiled a catalog of the 38 known Neotropical species, giving a total of 44 species treated as
Taeniaptera. With his key to the genera of Neotropical Micropezidae, Marshall (2010) diagnosed the genus Taeniaptera as a group of species with (among other characters) an elongate anal cell, a bare arista, and an axe-shaped maxillary palpus. This diagnosis left
4 most species that had the first two characters, but lacked a modified maxilliary palpus, in the closely related genus Poecilotylus, and led to the informal transfer of five species out of Taeniaptera and into Poecilotylus. These new combinations, however, were documented only in unpublished catalogs at University of Guelph.
Following the original description by Macquart, numerous authors described species that were later placed within the genus Taeniaptera by Hennig (1934), most of which were originally described in the genus Calobata Meigen (now invalid) or
Grallomyia Rondani. Hennig described several species in his 1934 work and further refined the generic diagnosis of Taeniaptera by stating that most Taeniaptera have a broad maxillary palpus, as opposed to the parallel-sided palpus of his newly designated genus Poecilotylus Hennig. Hennig (1934) also lumped Grallomyia into Taeniaptera on the basis that he could find no consistent character to separate the two genera, and wrote the most comprehensive key to species of Taeniaptera to date. Steyskal (1967) described two new species from Mexico and updated a portion of Hennig's key with these newly added species. Albuquerque described a further three species based on her doctoral studies (Albuquerque, 1980a; 1980b; 1981) and further proposed four subgenera (of which two are junior synonyms of previously proposed subgenera Taeniaptera
(Syntaeniaptera) = Paragrallomyia Hendel, 1933; Taeniaptera (Pseudotaeniaptera) =
Grallomyia Rondani, 1850) and provided keys to subgenus and species in her unpublished doctoral dissertation (Fig. 3). Although the most recently described
Taeniaptera is T. gratula Steyskal 1986, from the American southwest, numerous undescribed species have been recognized in the University of Guelph collection for many years. The lack of an adequate generic concept for the genus, however, has been a
5 roadblock to the fonnal description of these species. In his synopsis of the Micropezidae of Central America, Marshall states that the generic boundaries between Taeniaptera and
Poecilotylus are in need of revision, and that the two genera are likely paraphyletic as currently diagnosed (Marshall, 2010).
The purpose of this project is to redefine the genus Taeniaptera to form a monophyletic and easily recognized genus. A phylogenetic approach is used, including
DNA molecular data as well as morphological character data. The molecular dataset is also used to test the functionality of several genes with regards to Diptera subfamily-level systematics. With a new definition, the genus Taeniaptera is revised.
6 2. Phylogeny of the Taeniapterinae
2.1 Introduction
The Taeniapterinae are appropriate for phylogenetic study using a DNA dataset because suitable material of these relatively large flies is available, and because the group has proven to be remarkably resistant to resolution using morphological characters.
Although micropezids are large, brightly coloured, and possess a number of morphological qualities that would seem to be phylogenetically useful, the potential of these characters has yet to be realized. Unlike some groups where male genitalia are the major defining characters and help group species reliably (e.g. Sphaeroceridae), male taeniapterine genitalia have not proven to be particularly useful in defining clades.
External characters have been even more difficult to use because of frequent homoplasy in colour and other external characters, possibly due in part to the existence of Batesian mimicry complexes that converge on similar models. DNA sequence data provides an alternative or supplementary character set that may provide better phylogenetic resolution than the limited set of morphological characters so far found to be phylogenetically informative in the Micropezidae.
One mitochondrial gene (Cytochrome c oxidase 1 (COI)), four nuclear coding genes (Elongation factor-la (EF-la), wingless, white, and a portion of the carbamoylphosphate synthetase region of rudimentary, commonly referred to as carbamoylphosphate-synthetase-asparate-transcarbamylase-dihydroorotase (CAD)), and two ribosomal RNA genes (12S rRNA and 28S rRNA) were utilized in reconstructing a phylogeny of the Taeniapterinae.
7 With a preliminary hypothesis regarding the relationships of taeniapterine genera via the molecular analyses, a detailed set of morphological characters was coded for species of Micropezidae for which molecular sequences were obtained. This morphological dataset was analysed independently as well as in a combined total evidence analysis with the molecular dataset.
2.2 Methodology - Molecular Phylogeny
2.2.1 Taxon Sampling and Storage
DNA from ten of the 22 taeniapterine genera currently recognized in the New
World (Marshall, 2010) were sequenced, including a large selection of the species treated as Taeniaptera and Poecilotylus by Steyskal (1968) (Table 2). In addition to representatives of Taeniapterinae, all genera and subgenera of Micropezinae known to occur in the Neotropics (Micropeza (Micropeza) Meigen, Micropeza (Neriocephalus)
Enderlein, and Ciyogonus Cresson) are included as outgroups. Although not all taeniapterine genera are represented in this study, most of the major generic groups were included, allowing for species traditionally considered as Taeniaptera or Poecilotylus to be compared to similar genera.
Of the 45 specimens used in this study, 40 were collected from the field into at least 90% alcohol (3 specimens were collected in pan traps and 2 specimens were collected in Malaise traps, see Table 2), and transferred to fresh 95% alcohol on return from the field. Specimens were then stored with identifying information in 20 mL centrifuge tubes for short-term storage in a non-cycling -20°C freezer until time of processing, at which point they were stored in a -80°C freezer. Some of the specimens used for molecular analysis currently remain in 95% alcohol in -80°C freezers at the
8 Canadian National Collection of Insects, but some are retained at University of Guelph
(in a non-cycling -20°C freezer) for further taxonomic study.
2.2.2 DNA Extraction
Total DNA was extracted from specimens using a new lab protocol similar to that of Boyer et al. (2005). A Qiagen DNeasy® Blood & Tissue Kit (Qiagen Inc, Santa Clara,
CA, USA) was used, but instead of dissecting tissue from a specimen and masticating it in the supplied proteinase solution, the whole specimen was immersed in proteinase K solution and put in a thermomixer set at 56°C for 3 hours. The rest of the protocol followed the manufacturer's recommendations. This method allows for recovery of morphologically complete voucher specimens that can either be critical point dried for deposition, or returned to 95% ethanol. The other benefit of this method is the ability to reextract total DNA from specimens returned to 95% ethanol, again without losing morphological data. Specimens in this study were reextracted 2 or 3 times, with each extraction following the original protocol and resulting in sufficient total DNA for both mitochondrial and nuclear genetic studies. The digestive process of the proteinase K solution did result in some clearing of the abdominal pleuron of specimens in this study after multiple immersions, but sclerotized structures were unaffected. This protocol is non-destructive, leaving specimens in nearly perfect condition for dried morphological work or for future DNA studies.
2.2.3 DNA Amplification
Two gene amplification protocols were followed, one using Taq DNA polymerase
(Promega Corp., Madison, WI, USA) and one using ExTaq HS DNA polymerase (Takara
Bio USA, Madison, WI, USA) (Table 3). For genes amplified using Taq, amplifications
9 were carried out in 50 uL assays with 30 uL of ddH20, 5 uL of 10X PCR Buffer, 5 uL of
25 mM MgCh solution, 1 (iL of 10 uM dNTPs, 1 uL each of the forward and reverse primers (Table 3)(Gibson et al., In Press), and 2 uL of genomic template. For ExTaq gene amplifications, 25 uL assays contained 16.7 uL of ddH20, 2.5 uL of lOx ExTaq Buffer,
0.63 uL of 25 mM MgCl2, 2uL of 10 mM dNTPs, 1 uL of both forward and reverse primers (Table 3)(Gibson et al., In Press), and 1 uL of genomic template DNA. Primer specific amplification cycles were optimized and perfonned on an Eppendorf ep Gradient
S Mastercycler (Eppendorf AG, Hamburg, Gennany). Amplification cycles for each primer pair are listed in Table 4.
Amplification products and negative controls were visualized on 1% agarose electrophoresis gel containing 2 uL of ethidium bromide/65 mL of agarose. PCR products were purified for sequencing using either the QIAquick PCR Purification Kit
(Qiagen Inc, Santa Clara, CA, USA) or the QIAquick Gel Extraction Kit (Qiagen Inc,
Santa Clara, CA, USA).
2.2.4 DNA Sequencing and editing
Sequencing amplification was carried out in 10 uL reactions with an ABI
BigDye® Tenninator v3.1 Cycle Sequencing kit (PE Applied Biosystems, Foster City,
CA, USA). Reactions were carried out independently using the forward and reverse primers of each gene. Sequencing was perfonned at the Agriculture & Agri-Food
Canada, Eastern Cereal and Oilseed Research Centre Core Sequencing Facility (Ottawa,
ON, Canada). Sequencing products were purified using the ABI/ethanol/EDTA/sodium acetate precipitation protocol and analysed on an ABI 3130x1 Genetic Analyzer (PE
Applied Biosystems, Foster City, CA, USA).
10 Sequence chromatograms were edited and contigs fonned using BioEdit ver.
7.0.9.0 (Hall, 1999).
Pairwise distances were calculated for EF-la and 28S rRNA using PAUP ver. 4.0
(Swofford, 2003) to test whether these genes would be suitably diverse at the generic level.
2.2.5 Sequence Alignment
Final sequence alignments for 12S rRNA and COI sequences were perfonned in
ClustalX2 (Larkin et al., 2007) using the default settings. The two sections of COI sequenced (HEB and P&J) did not have sufficient overlap and were aligned and analysed separately throughout this project.
Preliminary alignments for wingless and CAD were performed in ClustalX2 and then were hand-aligned based on amino acid codons using MacClade ver. 4.06
(Maddison et al., 2000, 2003). For wingless, a 128 bp unalignable intron was identified at positions 378-506 and excised prior to analysis. Contrary to Diptera taxa examined by
Gibson et al. (2010), there was no evidence of introns in the region of CAD sequenced for micropezid taxa.
Final sequences were concatenated using TaxonDNA (Meier et al., 2006) and fonnatted for analysis.
2.2.6 Concatenated Molecular Dataset Parsimony Analysis
TNT ver. 1.1 (Goloboff et al., 2003) was used to perfonn parsimony analyses.
Each gene was partitioned separately, and each gene was analysed separately and cumulatively for a total evidence tree. New technology searches were performed using all four tree-finding algorithms (sectorial search, ratchet, drift, and tree fusing) all of which
11 were set on default settings. Initial trees were selected via 1000 random addition sequences, and the random seed was set to 1. All characters were weighted equally and gaps were coded as a fifth state. Bootstrap values were calculated using new technology search with the same settings as the parsimony analysis except trees were selected via
100 random addition sequences, and 100 replicates were performed. Jacknife values were calculated with a replacement probability of 36 for 100 replicates using the same settings as the bootstrap analyses described above. Bremer supports (BS) and Partitioned Bremer
Supports (PBS) were calculated in TNT using a script by Pena et al. (2008). Suboptimal trees that were 50 steps different and had a relative fit difference of 0.50 were retained for analysis, and 100,000 reps were performed. When multiple equally parsimonious trees were returned, one was chosen as the preferred tree by qualitatively assessing the species level relationships, and presented with support statistics for applicable nodes.
2.2.7 Bayesian Analysis
Mr.Modeltest ver. 2.3 (Nylander, 2004) was used to calculate the models of evolution of each gene partition in the analysis under Akaike Information Criterion (AIC)
(Table 5). Data were partitioned into 5 partitions (12S, COI HEB, COI PJ, wingless,
CAD). Bayesian analysis was performed using Mr. Bayes ver. 3.1.2 (Ronquist et al.,
2003) submitted remotely to the Cornell Computational Biology Service Unit computing cluster (http://cbsuapps.tc.cornell.edu/mrbayes.aspx). The Monte Carlo Markov Chain
(MCMC) method was used with the default analysis settings. Four chains (three hot, one cold) were run simultaneously for 25,000,000 generations, with tree sampling occurring every 1000 generations. The first 25% of generations (i.e. 6250 generations) were discarded as burn-in.
12 2.2.8 Sequence Congruency Test
Sequences were examined for data congruency using the three comparison methods suggested by Huelsenbeck et al. (1996): total evidence, separate analysis, and conditional combination analysis. PAUP* ver. 4.0beta (Swofford, 2003) was used to perform an incongruence length difference (ILD) test (Farris et al., 1994; Farris et al.,
1995). Sequence data was divided into 18 different partition scenarios, and the analysis was run using the following code (text in bold represents dataset specific changes):
Charpartition partitionname: parti :x-y, part2:(y+l)-z, part3 :(z+l)-n;hompart partition=partitionname nreps-1000 seed=619. Taxon selection was reduced to those species that had sequence data for all genes, and all analyses had the tree space auto increase by 100 when the tree buffer was filled.
Congruent Topological Information (CTI) (Almeida et al., 2009) was used to measure how datasets compared to the complete molecular analysis when analyzed separately. The number of nodes found on the strict consensus tree for ingroup taxa
(obtained by following the parsimony analysis methodology provided above) for each data partition which corresponded exactly with nodes found on the strict consensus tree for the combined dataset were compared using the following formula:
(Nd + Nt) + {Td + Tt)
where AW represents the number of congruent nodes from the individual dataset strict consensus tree; Nt represents the total number of nodes on the total evidence strict consensus tree; Td represents the number of taxa included in the individual dataset; and
Tt represents the number of taxa included in the total evidence analysis.
13 2.2.9 Taxon Sampling - Morphological Parsimony Analysis
Taxon sampling for the morphological analysis included all species treated in the molecular analysis, including each Taeniaptera species and representatives from each of the remaining major clades, for a total of 25 species. Single exemplars of each sex were used for coding the character matrix. Specimens used in the molecular analysis were returned to 95% ethanol for future analyses. Flies in alcohol are difficult to code for morphological characters, so pinned specimens were used to code the morphological matrix. Where possible, specimens from the same collecting event as those included in the molecular analysis were chosen as exemplars, otherwise specimens were chosen in the following order of preference: same locality but collected at a different time; same country or region; only available pinned alternative; specimen used for molecular analysis (see Table 6 for list of examined specimens).
2.2.10 Matrix Coding and Specimen Preparation
Mesquite ver. 2.71 (Maddison et al., 2009) was used for constructing the character matrix (Table 7) and for scoring (Table 8). Pinned specimens were examined with a
Leica Wild M3Z binocular dissecting microscope. Male and female postabdomens were cleared using 10% KOH solution heated on medium-high heat for 10-12 minutes, followed by 10 minute baths in distilled water, and glacial acetic acid, and a final 12 minutes in distilled water. Female spennathecae were dissected from the ovipositor and stained for an hour. Male genitalia (inclusive and posterior of the epandrium) were excised. All genitalic dissections were then immersed in glycerol and placed on a well slide. Genitalia were examined using a Nikon LaboPhot-2 compound microscope using bright field, dark field, and phase contrast microscopy. Genitalia were imaged using a
14 Nikon D70 DSLR mounted on a custom-built Nikon-to-Zeiss trinocular head adapter attached to a Zeiss compound microscope. Images were transferred from the camera to the PC using DIYPhotoBits.com Camera Control 4.1 (Lowe, 2009), and images combined using CombineZ5.3 (Hadley, 2006).
2.2.11 Morphological Dataset & Total Evidence Parsimony Analyses
The morphological matrix was analyzed using TNT ver. 1.1 (Goloboff et al.,
2003). A heuristic search was performed (10,000 replications, random seed = 1, TBR branch searching) on the dataset, using both equal character weightings and using implied weightings (K=3.0) (Goloboff, 1993). Bootstrap resampling using 1000 replications of heuristic searching was used to test branch support in both analyses, and Bremer scores were acquired using the BREMER.run file accompanying TNT.
The morphological data matrix with equal character weighting was concatenated with the concatenated molecular dataset, and a new technologies search based on 1000
Wagner trees (random seed=l) was used to find the most parsimonious phylogenetic trees. Bootstrap, Jackknife and Bremer scores were again calculated using the search criteria described above.
2.3 Results
2.3.1 Sequencing Success and phylogenetic utility- white, EF-1ct and 28S
The white gene has proven useful for the study of phylogenetics of Diptera previously, and within the apparently closely related Diopsoidea (Baker et al., 2001;
Marshall et al., 2009), however the primers used by these authors failed to amplify
Micropezidae genomic template under the same PCR conditions. Subsequently, the gene white was dropped from this study.
15 EF-la and 28S rRNA also proved difficult to amplify, but after experimentation with PCR thennocycler protocols, both gene protocols were optimized and sufficient material was collected for sequencing. Pairwise distances between sequences for both genes (all within Taeniaptera) were then compared for variability and phylogenetic utility. It was found that the pairwise distances were a maximum of 2.5% between any two species for both genes, and the cost to benefit ratio of working with these genes further was deemed to be inefficient, so these genes were also dropped from the analysis.
2.3.2 12S rRNA
Sequence data was successfully acquired for 39 taxa. After alignment, there were a total of 580 bp analyzed, of which 208 (35.9%) were phylogenetically informative.
Parsimony analysis returned 6 most parsimonious trees (798 steps, CI = 0.503, RI =
0.672) of which the preferred tree is provided (Fig. 4).
2.3.3 COI
COI sequences were obtained for both regions of the COI gene, HEB and Pat and
Jerry (PJ). Because of insufficient overlap, these gene segments were first analyzed separately, and then analyzed as a concatenated dataset.
COI HEB sequences were obtained for 36 of 40 species in the analysis, with a total of 696 bp analyzed, of which 244 (35.1%) were informative. The parsimony analysis resulted in 4 equally parsimonious trees of a length of 1492 (CI = 0.286, RI =
0.478, preferred tree provided in Fig. 5).
Sequence data for the PJ portion of the COI gene were obtained for 37 taxa and comprised a larger dataset of 878 bp, 301 (34.3%) of which were found to be infonnative.
16 A single tree was returned after analysis (length = 1737 steps, CI = 0.341, RI = 0.518,
Figure 6).
When both COI sections were concatenated and analysed, 10 equally parsimonious trees were discovered of 3304 steps (CI = 0.308, RI = 0.483, preferred tree provided in Figure 7).
2.3.4 wingless
Obtaining sequence data for the wingless gene proved more difficult than anticipated, with multiple PCR attempts and optimizations for the primers given by Baker et al.(2001) and Marshall et al. (2009) failing to amplify micropezid genomic template.
Ultimately primers designed for use in Lepidoptera (Brower et al., 1998) and Vespoidea
(Pilgrim et al., 2008) were successfully optimized to amplify the micropezid DNA for a few taxa, and novel interior forward and reverse primers were designed from conserved regions of DNA found in the sequences of these few species. Sequence data was obtained for 31 taxa using at least one set of primers, and primer success rates were low for all combinations tried. Further issues were encountered when aligning sequences. Alignment software (ClustalX2) failed to provide usable alignments, thus it was necessary to hand align each sequence by adding them one at a time to the dataset and matching nucleotides by eye for the entire ~900bp sequence. The alignment was then double-checked using amino acid codons and gaps were added to correct the reading frame to remove stop codons.
An unalignable 128 bp intron was removed from all sequences that covered that region of the gene, resulting in 628 characters being analyzed, of which 146 (23.2%) were found to be phylogenetically informative. Parsimony analysis resulted in 4 most
17 parsimonious trees of a length of 498 steps (CI = 0.574, RI = 0.643, preferred tree provided in Figure 8).
The Micropezinae were not returned at the root of the tree, probably because of a duplication of the wingless gene (Sidow, 1992). With multiple gene homologs, there is no guarantee that the same homolog will be sequenced for each taxon, especially if primer sites are similar between homologs. Homology between micropezine and taeniapterine sequences can therefore not be ascertained. However, when the Micropeza and
Ciyogonus species are ignored, the data appears to follow closely with that of the other gene analyses.
In an attempt to reestablish homology and salvage this data, Micropeza and
Ciyogonus species were excluded and the remaining taxa reanalyzed with Globopeza as the putative outgroup. Eighteen most parsimonious trees were found, each of a length of
430 (CI = 0.593, RI = 0.667, preferred tree provided in Figure 9).
2.3.5 CAD
CAD data from the 3rd, 4th, and 5th segments of the carbamoylphosphate synthetase region (CPS) was acquired for 37 taxa, with a total of 2160 bps analyzed, of which 729 (33.8%) were phylogenetically informative. Parsimony analysis returned 10 most parsimonious trees of a length of 350 (CI = 0.462, RI = 0.536, preferred tree given in Figure 10).
2.3.6 Concatenated Molecular Dataset Parsimony Analysis
All data were concatenated for a total of 45 taxa with a total dataset of 4942 characters, 1628 (32.9%) of which were phylogenetically infonnative. Maximum
18 parsimony analysis returned 4 most parsimonious trees of a length of 8046 (CI = 0.399,
RI = 0.516) and the preferred tree is provided with relative branch lengths in Fig. 11, and with support statistics in Figs. 12 & 13.
2.3.7 Molecular Dataset Bayesian Analyses
The MCMC chains reached stationarity (split frequencies <0.05) by 5.2 million generations (final standard deviation of split frequencies 0.0186, all parameter estimates asymptotic). A total of 18,750 samples were used to create a majority-rule consensus tree with branch length estimates posterior probabilities for each node mapped (Fig. 14).
When the analysis was run with the 3rd codon positions of the nuclear coding genes
(wingless & CAD) removed, the MCMC chains reached stationarity in less than 500,000 generations (final standard deviation of split frequencies 0.00435, all parameter estimates asymptotic). The same methodology as the total evidence analysis was used (final standard deviation of split frequencies was 0.00435). A total of 18,750 samples were used to create a majority-rule consensus tree with branch length estimates posterior probabilities for each node mapped (Fig. 15).
2.3.8 Molecular Data Congruency
Results of the ILD tests are provided in Table 9. With the exception of 12S and the PJ region of COI or wingless, all other gene combinations were recovered as incongruent (P < 0.05), including different regions of the same gene (COI HEB vs COI
PJ,P = 0.001).
Results of the CTI are provided in Fig. 16. Only two datasets included in this analysis
(COI HEB and COI PJ) were found to share less than 14 the topological similarity of the total evidence analysis individually, but when they were concatenated into a single
19 dataset their congruency increased to nearly 60%. The CTI scores for the remaining genes appear to be similar to those recovered by Gibson et al. (12S, COI, and CAD)
(2010), and Almeida et al. (wingless) (2009). These CTI scores refute the ILD congruency tests, and provide evidence that the genes included in this study can be considered congruent, but appear to contribute nearly equally to the total evidence analysis.
Finally, when the complete molecular dataset tree is examined qualitatively, all clades are thought to be reliable. While there are certainly relationships which had not been previously hypothesized (eg. Taeniaptera albitarsis as sister to Ptilosphen +
Plocoscelus) there are no relationships which may bring the congruency of the datasets into question.
2.3.9 Morphological Dataset Parsimony Analyses
Parsimony analysis of the unweighted morphological dataset resulted in 2 most parsimonious trees (length = 584, CI = 0.357, RI = 0.452, Fig. 17). When implied weighting was implemented, a single tree was returned (length = 50.55, CI = 0.352, RI =
0.442, Fig. 18).
2.3.10 Total Evidence Parsimony Analysis
When the morphological dataset was concatenated with the molecular dataset, parsimony analysis returned three most parsimonious trees (length = 8686, CI = 0.393, RI
= 0.442, preferred tree Fig. 19). Morphological synapomorphies recovered from the total evidence analysis were mapped on the preferred tree in Figs. 20-23.
20 2.4 Discussion of Relationships
2.4.1 Total Evidence Parsimony Analysis
The Micropezinae species included in this analysis were recovered at the root of the tree, and both the genus Micropeza and the subfamily Micropezinae appear paraphyletic with respect to the Taeniapterinae. Although limited taxa were included in the analysis (4 morphospecies; 2 Micropeza (Micropeza) sp., 1 Micropeza
(Neriocephalus) sp., Ciyogonus formicarius (Rondani)) and a further outgroup was not included, this result is surprising considering the very strong morphological evidence supporting the subfamily. TNT ver 1.1 does not allow for a constrained monophyletic outgroup, which might explain the apparent paraphyly of the micropezines on Fig. 19.
Previous authors have hypothesized a number of different higher level relationships between the subfamilies (Fig. 24), with multiple authors suggesting that Micropezinae and Taeniapterinae are sufficiently distinct to warrant individual family status (Aczel,
1951; Hennig, 1958). The wingless sequences obtained in this study may lend credibility to this hypothesis, as the copy sequenced for the Taeniapterinae was different than those sequenced for the Micropezinae (Figs. 8 & 9), although there is a chance that this is a completely random occurrence. More meaningful results are expected when the other micropezid subfamilies found in the New World (Eurybatinae and Calobatinae) are included.
Regardless of its relationship to the Taeniapterinae, Micropeza was found to have a deep divergence between the 2 subgenera sequenced, with Micropeza (Micropeza) and
Micropeza (Neriocephalus) being recovered as genetically distinct. The divergence between these species is greater than the divergences observed between a number of
21 taeniapterine genera but the Micropezinae are poorly known and it is unknown whether this divergence is reflected in morphological characters, nor whether it will hold up to broader taxon sampling. The small, highly autapomorphic, southern South American micropezine genus Ciyogonus was also found to be quite distinct from its putative sister genus Micropeza based upon the genes sampled in this analysis. Proper assessment of the higher classification of the Micropezinae will require broader outgroup sampling including other nerioid families and other micropezid subfamilies (Eurybatinae,
Calobatinae), as well as increased taxon sampling within the Micropezinae.
Within the Taeniapterinae, Globopeza was recovered as sister to the remainder of the subfamily. Marshall (2004) noted the superficial similarities between Globopeza and
Micropeza, due to the contiguous antennae and size and general body shape, but also noted that Globopeza shared some unambiguous synapomorphies with other
Taeniapterinae, and ultimately placed it as sister to the genus Metasphen Frey (not included in this analysis), a group of small, ant-like micropezids that also has narrowly separated antennae and similar wing venation. Although he tentatively placed Globopeza within the Grallipezini (sensu Aczel = Rainieriini sensu Cresson), Marshall (2004) noted that he felt that a broader analysis of the subfamily may result in a different placement of the genus. The hypothesis reported here indicates that Globopeza is the sister to the remainder of the Taeniapterinae. With an apparent plesiomorphic similarity to the
Micropezinae and genetic data that places it at the root of the Taeniapterinae, Globopeza may prove important in deciphering generic relationships of the Micropezidae. Further work with increased taxon sampling will be required to continue with the task of sorting out subfamilial relationships.
22 With the exception of the basal lineage including only Globopeza, all
Taeniapterinae considered in this analysis are clustered into two monophyletic subgroups.
One, hereafter referred to as the "Taeniaptera clade", includes the majority of
Taeniaptera species recovered in 3 species groups (Taeniaptera annulata species group,
Taeniaptera tarsata species group, and Taeniaptera trivittata species group) as well as
Poecilotylus (Hemichaeta) scutellatus. The other monophyletic subgroup, hereafter referred to as the "Poecilotylus clade" includes the remaining taeniapterine genera included in the analysis.
The tribal classification of Taeniapterinae provides a convenient tool for identifying and dividing the subfamily using a readily apparent morphological character
(short anal cell on the wing), yet Fig. 19 shows Globopeza as the basal lineage of the subfamily and Grallipeza, Calosphen, Scipopus (Phaeopterina), and Scipopus (Scipopus)
(all Grallipezini sensu Aczel = Rainieriiini sensu Cresson) nestled deep within the
"Taeniapterini". Division of the Taeniapterinae into the tribes Grallipezini (= Rainieriini) and Taeniapterini is thus not reflected in the phylogeny and should be abandoned. The length of the anal cell was found to be quite plastic in taeniapterine micropezids, with multiple clades reverting back to the ancestral, shortened state. Why a seemingly innocuous character such as this would display multiple instances of convergent evolution presents an interesting area for future study.
Although a revised tribal classification may be possible dividing the "Taeniaptera clade" and the "Poecilotylus clade", conserved morphological synapomorphies for both clades have yet to be identified.
23 Grallipeza is found to be paraphyletic relative to Calosphen as anticipated by
Marshall (2010). Sequence data indicate that species currently placed in Grallipeza include at least 2 distinct clades, of which one is closer to putative Calosphen species than to the other "Grallipeza" clade. The relationships between Grallipeza, Calosphen and Scipopus were found to vary from dataset to dataset, with only the CAD dataset returning these genera as a single clade (Fig. 10). The relationships of the "Grallipezini" are outside the focus of this project, and further taxon sampling will be required to test the relationships among the diverse and morphologically variable Grallipeza and allies.
The remaining species and genera found within the "Poecilotylus clade" exhibit instances of both rapid radiation and genetically isolated species with extremely long branches (Fig. 11). Once again, many of the intergeneric relationships were found to be
quite volatile depending on the dataset analyzed. The relationships of Hoplocheiloma remain unknown, likely because only 12S data was obtained for the specimen included in this analysis. This paucity of molecular data resulted in each analysis returning it as a poorly supported sister to different taxa (Fig. 4, 12 & 19). Hoplocheiloma was just revised by Marshall (2011) so perhaps with more taxa and morphological character data the generic relationships of this genus can be further tested. Ptilosphen was also recovered in multiple locations throughout the analyses, including sister to the majority of the Taeniapterinae (Fig. 10). Both the concatenated molecular analysis and the total
evidence analysis returned Ptilosphen as closely related to the genus Plocoscelus (Fig. 12
& 19). Ptilosphen is also currently under revision (Marshall, unpublished) so additional
data regarding this placement may be forthcoming.
24 Although the remaining species in the "Poecilotylus clade" are recorded as
Taeniaptera and Poecilotylus by Steyskal (1968), most were recognized by Marshall
(2010) as belonging in the genus Poecilotylus. Taeniaptera gratula, Taeniaptera ichneumonea, and Taeniaptera balzapambana have all been curated and catalogued in the University of Guelph collection as members of Poecilotylus, and all evidence obtained in this study confinns that they do not belong in the genus Taeniaptera. The placement of Taeniaptera balzapambana as a distinct lineage sister to the genus Scipopus
(or other short anal-celled genera) in multiple analyses is surprising considering the morphological similarity between Taeniaptera balzapambana and Poecilotylus and relative dissimilarity with the "Grallipezini". Taeniaptera balzapambana is not the only species confounding qualitative morphology-based hypotheses of relationship with apparent convergence, as Taeniaptera albitarsis has never been considered to be strongly allied with species outside of the "Taeniaptera clade". Although superficially like the
"Taeniaptera clade" these species appear in our analyses as more closely related to species in the "Poecilotylus clade", with which they share several characters (maxillary palpus ovular and with apical white margin, frontal vitta and posterior mesotrons densely tomentose, vein A1+Q1A2 greater than half length of vein dm-cu). Despite minimal molecular data being obtained for Taeniaptera "aliacea", it was also found to be morphologically aligned to the "Poecilotylus clade" by most of the same characters
(maxillary palpus ovular, frontal vitta and posterior mesofrons densely tomentose, vein
A]+CuA2 greater than half length of vein dm-cu).
Within the "Taeniaptera clade", there is a deep, well-supported division between a clade made up of Poecilotylus (Hemichaeta) + Taeniaptera tarsata (Grallomyia sensu
25 Marshall 2010) + Taeniaptera sensu stricto (including T. trivittata and T. lasciva) and a clade including only the Taeniaptera annulata group. Poecilotylus (Hemichaeta) scutellatus was recovered nestled within the "Taeniaptera clade", and quite genetically distinct from the remaining species in the clade. Poecilotylus (Hemichaeta) scutellatus, the type species for the subgenus Poecilotylus (Hemichaeta), is a morphologically distinct species which Marshall considered to be a distinct genus (pers. coram.).
Taeniaptera tarsata is recovered as the sister to Taeniaptera sensu stricto. Taeniaptera tarsata, has undergone a series of taxonomic changes in the past 80 years, with some authors considering it a separate genus (Grallomyia Rondani) (Enderlein, 1922; Marshall,
2010) and others arguing it is a valid Taeniaptera species (Hennig, 1934; Aczel, 1949;
Aczel, 1951; Albuquerque, 1980b; Albuquerque, 1986). Taeniaptera sensu stricto has been recognized by several authors as a natural group (Hennig, 1934; Aczel, 1951), and as a possible subgenus (Albuquerque, 1986), due to the closed wing cell R5. Recovering these species as a monophyletic group is not surprising, but the placement away from the remainder of Taeniaptera is. The relationships between these three groups (Poecilotylus
(Hemichaeta), Taeniaptera tarsata, and Taeniaptera s.s.) are well supported in the total evidence analysis as well as the concatenated molecular analysis, in large part due to the
CAD dataset. Taeniaptera tarsata and Taeniaptera s.s. were returned as sister groups by every dataset with the exception of COI PJ (which placed Taeniaptera tarsata as sister to the majority of the "Poecilotylus clade", Fig. 6), and CAD (which returned Poecilotylus
(Hemichaeta) scutellatus as the sister to Taeniaptera tarsata and which together formed the sister clade to Taeniaptera s.s., Fig. 10).
26 The Taeniaptera annulata group fonns an extremely well supported sister clade to the genera discussed above. Within this clade there are several well supported species pairs, including Taeniaptera vulgata and T. annulata, two species that are very difficult to identify morphologically.
2.4.2 Bayesian Analysis of Concatenated Molecular Dataset
The Bayesian analysis returned a majority rule consensus tree (Fig. 15) that is very similar to the preferred tree of the total evidence parsimony analysis (Fig. 19). The
Micropezinae is recovered as paraphyletic and a very large genetic separation is observed between subfamilies. Most tenninal clades recovered in the parsimony analysis were also found in the Bayesian analysis, however there are significant differences in the way some of these clades were found to be related to one another. Most notably, Taeniaptera
"aliacea" and the Taeniaptera ichneumonea clade were found to be more closely allied to the "Taeniaptera clade" than to the remainder of the "Poecilotylus clade", and the
Taeniaptera balzapambana group was returned as sister to Poecilotylus paraguayensis +
Poecilotylus trifasciatus. Posterior probabilities were relatively high for most clades recovered.
When third codon positions were removed (Fig. 16), Taeniaptera sensu stricto +
Taeniaptera tarsata was recovered as the sister to the remaining Taeniapterinae, with
Poecilotylus (Hemichaeta) scutellatus branching off immediately. Globopeza was recovered as sister to a Grallipeza clade (with an extremely long branch length).
Although Globopeza shares a short anal cell with Grallipeza, this is the only analysis
(other than the wingless analysis with Micropeza included) which doesn't return
Globopeza as sister to the remaining Taeniapterinae. Poecilotylus (Hemichaeta)
27 scutellatus is not recovered as sister to Taeniaptera s.s., but rather as sister to the remaining Taeniapterinae. The only other major difference regarding higher relationships is the placement of Scipopus+Phaeopterina as sister to the Poecilotylus paraguayensis clade.
2.4.3 Gene sampling and utility
Besides testing the relationships of the Taeniapterinae, this study was also testing the practicality and utility of several genes for phylogeny reconstruction in the
Micropezidae. As can be seen in Figure 13, the partitioned Bremer supports help to explain the role that each gene played in the final concatenated molecular dataset parsimony analysis. In this study, wingless proved to be an extremely difficult gene from which to attain useable data. It appeared to possess multiple gene copies that were not homologous, and ultimately provided very little support to the final tree. Throughout the entire tree values ranged from 1 to 5, which is exceedingly low considering the diverse species included in this analysis. Future molecular studies involving Micropezidae would be best advised to avoid using the wingless gene as a data source, as there are more cost- effective and data-rich alternatives.
The "DNA Barcoding Gene" COI was found to be of differing utility, with the
"barcode" region (Former region = HEB) generally contributing moderately strong support to the final tree, while the second region (COI PJ) contributed little to the analysis for most clades. In fact, COI PJ perfonned more poorly than wingless for most clades recovered in the analysis, and COI PJ performed particularly poorly within the
Taeniapterinae. When the adjusted CTI scores (Fig. 14) are compared to other the other genes used, the sections of COI scored less than 50% on their own, but increased to
28 nearly 60% when concatenated. Both sections were relatively easy to obtain data from, especially the Folmer region, which has the benefit of many millions of dollars of research behind the development of degenerate primers that work across a broad spectrum of taxa. Neither region presented any difficulties when it came to alignment, making both sections worthwhile for including in future analyses, most informatively as a single dataset.
The gene with the best benefit to cost ratio is the mitochondrial 12S rRNA. The support for the final tree was very strong at all levels of the tree with this gene, from subfamily classification to interspecies relationships, and sequencing success rates were highest for this gene. Additionally, sequences and contigs required very little time to clean up and align, further supporting 12S rRNA as a favoured gene for future analyses.
Although more difficult to sequence and requiring the stitching together of multiple fragments (and thus more costly in time and resources), CAD had the greatest volume of data and was therefore the most influential data in the final analysis. Like 12S,
CAD also shows consistently strong support at all levels of the tree, making it a preferred candidate for future research. The alignment of this dataset was more time-consuming than the other genes with the exception of wingless, but the value provided by the data sufficiently offsets this hurdle.
Based upon this project, genes recommended for inclusion in future molecular studies of Micropezidae would be 12S, COI, and CAD. The first 2 genes were easily amplified, sequenced, and aligned for all taxa in this study, and both provided valuable information in this study. Although CAD is a little more difficult to amplify, sequence,
29 and align, the data was found to be extremely infonnative in deciphering generic relationships.
2.5 Taxonomic Recommendations Based on Total Evidence Analysis
Although not all Taeniapterine genera were sampled in this study, and the overall number of species sampled per genus is relatively low, several relationships appear strongly enough supported with this dataset to make taxonomic recommendations.
Perhaps one of the more surprising preliminary results from this study is the apparent paraphyly of the Micropezinae. Although not the focus of this study, and included here solely as the outgroup for the Taeniapterinae, the Micropezinae has long been considered to be a monophyletic group based on several strong morphological synapomorphies. Further research will be needed to examine the higher relationships of
Micropezidae and include outgroups from the broader Neriioidea. If the findings of this study are confirmed through proper in- and outgroup selection, expect a major taxonomic reorganization of the Micropezidae.
The tribal classifications of Cresson (1938) and Aczel (1951) (Taeniapterini and
Rainieriini [= Grallipezini]) do not reflect the phylogenetic relationships recovered in the current analyses. Although the length of the anal cell is suitable for partitioning the genera of the Taeniapterinae into 2 readily distinguishable groups, they are not monophyletic groups, with the shortened anal cell indicative of the "Rainieriini" being found in both the basal Globopeza as well as several genera clustered deep within the tree. The tribal classification of the Taeniapterinae should be abandoned.
30 The suggestion that Grallipeza is paraphyletic with respect to Calosphen
(Marshall (2010) appears to have been correct, although there is no statistical support for the placement of Calosphen presented here. As was the case for Taeniaptera, further molecular and morphological data and increased taxon sampling will be required to understand the complex relationships within these genera.
The focus of this study was to examine the relationships between Taeniaptera and
Poecilotylus, and as expected, these genera were tightly intertwined, requiring significant taxonomic changes. The species here treated as the "Poecilotylus clade" present an interesting taxonomic problem. Because these species are not the focus of this study, and there was insufficient data to assign clades to independent genera confidently, it is proposed that the broad definition of Poecilotylus used by Marshall (2010) be used, with the acknowledgement that this is likely a paraphyletic assemblage of species. This approach will allow for these problematic species groups to be properly revised individually and increase taxonomic stability in the long tenn. This genus will contain 26 species (Table 10) but all species placements should be considered tentative pending formal revision of this genus.
The taxonomic status of the "Taeniaptera clade" presents a number of taxonomic options. One option is to incorporate Poecilotylus (Hemichaeta) into a very broad definition of Taeniaptera, although the morphological analysis indicated Poecilotylus
(Hemichaeta) was well removed from Taeniaptera (with implied weighting) (Fig. 18).
When morphological synapomorphies are included on the total evidence tree built using molecular and morphological data (Fig. 20-23), most nodes are supported by symplesiomorphies, and very few synapomorphies are present. When the broad concept
31 of Taeniaptera is considered, it is supported by 2 synapomorphies (maxillary palpus shape (asymmetrically triangular) and patterning (with ventral white band)) and 2 symplesiomorphies (setal patterning of the white bands of the mid and hind femur (black setae present on white bands) and relative length of the apical distiphallus (shorter than basal portion)). Further, each of these symplesiomorphies has been modified/reversed in at least one of Poecilotylus (Hemichaeta), Taeniaptera tarsata, and/or Taeniaptera s.s.:
Hemichaeta has a maxillary palpus which is symmetrical and which is white apically, not ventrally (representing reversals to the ancestral states); Taeniaptera tarsata +
Taeniaptera s.s. have femoral bands mostly bare of black setae (when white bands are present); and Taeniaptera s.s. has the apical portion of the distiphallus longer than the basal portion. Likewise, the anal cell is setulose in the Taeniaptera annulata group and
Taeniaptera tarsata + Taeniaptera s.s. yet bare in Poecilotylus (Hemichaeta), and the wing cell r4+5 is closed before the wing margin in Poecilotylus (Hemichaeta) and
Taeniaptera s.s. and open in the Taeniaptera annulata group and Taeniaptera tarsata.
Alternatively, the "Taeniaptera clade" can be divided into four monophyletic groups, each of which includes the type species of a previously recognized genus or subgenus. Recognizing each of these groups at the generic level requires no new names and will make generic identification relatively easy.
Poecilotylus (Hemichaeta) scutellatus is the type for the subgenus Hemichaeta, here treated at the generic level. Hemichaeta is currently differentiated from Poecilotylus sensu stricto by a single frontal bristle (Hemichaeta possesses 1, Poecilotylus has 2). This character had already been noted as varying wildly within Poecilotylus (Marshall, 2010), but the type species of Hemichaeta had also been noted as being morphologically distinct
32 from other Poecilotylus (Marshall, pers. coram.). Newly collected material of the type species from coastal habitat near Dominical, Costa Rica allowed the inclusion of this atypical species in the molecular analysis and confirmed that it is widely separate from the other Poecilotylus included in this analysis. As noted, taxon sampling in Poecilotylus is inadequate to assess the monophyly of Poecilotylus s.s., but the placement of H. scutellata within the "Taeniaptera clade" supports the treatment of Hemichaeta as a separate genus. Hennig (1934) included 4 species in his original designation of
Hemichaeta based on the number frontal bristles, but as mentioned, this character is unlikely to prove diagnostic for the genus. Until a fonnal revision can be done, these 4 species will continue to be considered Hemichaeta (Table 10).
Taeniaptera tarsata is the type species for Grallomyia Rondani (recently considered a separate genus by Marshall (2010)) , here recognized at the generic level.
Although currently monotypic (Table 10), there are at least 2 species recognized as new and awaiting description in the University of Guelph Insect Collection.
Taeniaptera annulata is the type species for Grallomyia (Paragrallomyia)
Hendel, here restituted and elevated to the genus Paragrallomyia Hendel nov. stat. This genus as defined here includes 28 of the species previously treated as Taeniaptera (Table
10) which share the character traits of an axe-shaped maxillary palpus, bare arista, and open wing cell r4+5. This genus is need of a complete revision as there are undoubtedly additional species awaiting description.
Taeniaptera trivittata is the type species for Taeniaptera Macquart. The definition of Taeniaptera has been restricted to include only those species with a closed wing cell
T4+5 and an asymmetrical axe-shaped maxillary palpus, and the genus is revised. The
33 genus is comprised of 4 previously described species and 3 new species, described in
Chapter 3.
34 3. Redefinition of the genus Taeniaptera Macquart 1835 and revision of the Taeniaptera s.s.
The New World genus Taeniaptera is redefined and revised with full descriptions of all previously described species and 3 new species. A key to species for Taeniaptera is included. Each species is illustrated with character photos, full habitus, male and female genitalia (where available), wing photos, and wing intereferrence patterns
(WIP)(Shevtsova et al., 2011). Morphological terminology of the head follows Cresson
(1930) and Marshall (2011) (Fig. 25); male genitalia tenninology follows McAlpine
(1998) (Fig. 27).
Genus Taeniaptera Macquart, 1835
Taeniaptera Macquart, 1835: 491. Type species: Taeniaptera trivittata Macquart, 1835, original designation - Macquart, 1835: pg. 491 [diagnosis, illustr.]; Cresson, 1930: 349 [diagnosis, revision];
Hennig 1934: 73 [diagnosis, revision, key, phylogenetic notes]; Cresson, 1938: 359 [diagnosis, review, illustr.]; Aczel 1949: 312 [catalogue]; Aczel 1951: 517 [phylogenetic notes, biogeography, diagnosis, revision, key, illustr.]; Stone et al. 1965: 636 [catalogue]; Steyskal 1968: 48.16 [catalogue]; Cole 1969: 339
[diagnosis, record]; Merritt & James 1973: 2 [larval biology]; Merritt & Peterson 1976: 1502 [diagnosis];
Albuquerque 1980a: 663 [phylogenetic notes, diagnosis, revision, biogeography, illustr.]; Steyskal
1987(Steyskal, 1987): 762 [range, catalogue, illustr.]; Marshall 2010: 813 [diagnosis, illustr.].
Grallopoda Rondani 1850: 178, 180. Type species: Calobata albimana Macquart 1843 [= trivittata
Macquart 1835], original designation. -Rondani 1850: 180 [diagnosis]; Enderlein 1922: 212 [revision];
Cresson 1930: 349 [synonymy].
Generic Description
35 Included species: Taeniaptera trivittata Macquart, Taeniaptera lasciva Fabricius, Taeniaptera vulpes Cresson, Taeniaptera nigriceps Hennig, Taeniaptera knutsonii sp. nov., Taeniaptera longapilis sp. nov., Taeniaptera mater sp. nov.
Medium to large flies (6 -15mm) mostly brown or black. Antennae widely separated; distal 3 flagellomeres fonning arista, bare. Face usually with short black bristles arising between antennae and dark ventral margin. Clypeus bare. Maxillary palpus flat, shaped like the head of an axe (rounded ventrally, flat dorsally), usually with white ventral or apical margin. Paraface often with dark spot at apex. Parafrontal often rugose anteriorly, subshining on lateral anterior margins. Mesofrons flat, at most slightly depressed laterally of frontal; usually narrow at ptilinal shelf, less than Vi width of frontal at ptilinal shelf; shining, sometimes with small black bristles near anterior margin; usually with dark spot anterior to ocellar triangle. Ocellar triangle not dramatically raised above profile of mesofrons. Two pairs of lower frontal bristles and one pair of upper frontal bristles usually present. Postocellar bristles absent or present, vertex without lateral humps. Inner and outer vertical bristles present. Dorsocentral bristles in 1-4 pairs, some species with presutural dorsocentral setae present near margin of scutum. Scutellum generally with 2 long scutellar bristles, some species with very short, fine setae along dorsal and lateral surfaces. Wing with long cell cup (vein CuA2 much longer than
A1+Q1A2); wing cell r4+5 closed prior to reaching wing margin, sometimes petiolate.
Wing usually with 3 cross-bands, discal band (centre band) rounded. Fore basitarsus white, brown, or a combination thereof. Mid and hind femora usually with white rings, either at the base or near the apex. Hind femora sometimes with knot-like swelling distally, but most often of consistent diameter from coxa to tibia. Hind tibia ranging from cylindrical to flattened and expanded. First abdominal segment with fine white setae
36 basally, fringe of longer light or dark setae at apical margin; no longitudinal sulcus.
Second abdominal tergite with basolateral sulcus extending 2/3 length of tergite.
Abdominal tergites 1 and 2 fused, differentiated by silvery microtomentose band.
Abdominal tergites 1, 2, 5 and 6 usually bluish black, 3rd and 4th abdominal tergites usually paler or brown. Abdominal pleuron without pleural sacs, pleuron with black and white areas. Male copulatory fork present, with or without basal appendages.
Generic Diagnosis
Taeniaptera can be recognized by the axe-shaped maxillary palpus with white ventral margin (Fig. 25A), mesofrons anterior to the ocellar triangle not raised (Fig.
25A); wing with "bulls-eye" patterning, and with cell Y4+5 closed before reaching wing margin (Fig. 25C).
Similar Genera
Taeniaptera is most similar to the genus Paragrallomyia Hendel, which has the wing cell r4+5 open to the wing margin. Grallomyia Rondani is also similar, but can be distinguished most easily by the discal wing patterning, forming an apically opening chevron pattern in Grallomyia compared to the circular pattern seen in Taeniaptera, a lack of dorsocentral bristles, and a scutellum with many, dense long hairs in addition to the scutellar bristles. Hemichaeta has a closed wing cell r4+5 but can be distinguished from Taeniaptera by its parallel-sided maxillary palpus Poecilotylus s.s. also has the maxillary palpus either parallel sided or ovular.
Key to species of Taeniaptera
37 1. Scutum with 1 pair of dorsocentral bristles (Fig. 29A) 2
1'. Scutum with 2 pairs (Fig. 42B) or 4 pairs (Fig. 32A) of dorsocentral bristles 3
2. Front 5th tarsomere white (Fig. 26A); male genital fork with basal appendages (Fig.
26B); Taeniaptera trivittata Macquart
(Eastern Nearctic)
2'. Front 5th tarsomere brown to black (Fig. 29B); male genital fork without basal
appendages (Fig. 29C);
Taeniaptera lasciva (Fabricius)
(USA, Carribbean, Central & South America, most records near the Gulf of Mexico)
3. Scutum with 4 pairs of dorsocentral bristles (Fig. 32 A) . Taeniaptera nigriceps Hennig
(Brazil)
3'. Scutum with 2 pairs of dorsocentral bristles (Fig. 42B) 4
4. Head yellowish brown, lacking mesofrontal spot (Fig. 35); mid femur with basal white
band (Fig. 36)
Taeniaptera vulpes Cresson
(Colombia, Panama)
4'. Head colour yellow or dark brown, mesofrontal spot always present (Fig. 38C); mid
femur usually without basal white band (Fig. 39) 5
5. Head yellow (Fig. 38C); distal band of wing pattern with dark basal border (Fig. 38A) .
Taeniaptera knutsonii sp. nov.
38 (Brazil)
5'. Head dark brown (Fig. 42B); distal band of wing pattern uniform, without darker basal
border (Fig. 41A) 6
6. Fore tarsomeres 2-5 entirely white (Fig. 42B); hind femur with distinct knot-like
swelling on apical half (Fig. 41C) Taeniaptera longapilis sp. nov.
(Guatemala)
6'. Fore tarsomeres 2-4 light brown, fifth fore tarsomere black; hind femur uniform
diameter throughout (Fig. 43C) Taeniaptera promiscua sp. nov.
(Brazil)
Taeniaptera trivittata Macquart, 1835
(Figs. 25-27)
Taeniaptera trivittata Macquart 1835.Distr. Nearctic: Canada, USA
Taeniaptera trivittata Macquart, 1835: 491, pi. 20, fig. 9 [unknown]. Type locality: "North
America". HT not observed, location unknown. - Osten Sacken 1878: 256 [taxonomic notes];
Hennig 1934: 86 [redescription, illustr.]; Cresson 1938: 361 [taxonomic notes, diagnosis,
distribution]; Stone et al. 1965: 636 [catalogue]; Merritt & Peterson 1976: 1502 [diagnosis,
distribution]; Steyskal 1987: 762 [male illustr.]; Marshall 2006: 509 [biology, illustr.]; Marshall
2010: 806 [biology].
Calobata albimana Macquart, 1843: 245 Tab. 33 fig. 3, [male] Type locality: Java, Cuba,
Philadelphia. HT male, location unknown. - Osten Sacken 1878: 179, 256 [synonymy]; Hennig
1934: 86 [synonymy]; Cresson 1938: 362 [taxonomic notes]; McAlpine 1998: 59 [biogeography,
taxonomic notes].
39 Calobata valida Walker, 1856: 390 [male] Type locality: "United States". HT unknown, location
unknown. - Osten Sacken 1878: 179 [synonymy]; Hennig 1934: 86 [synonymy]; Cresson 1938:
362 [taxonomic notes].
Calobata lasciva Fabricius (in part), 1798. - Osten Sacken (in part) 1878: 179 [distribution];
Johnson 1890: 397 [list]; Johnson 1895: 336 [list]; Johnson 1900: 692 [list]; Johnson 1910: 803
[list]; Kilpatrick 1956: 796 [biology].
Taeniaptera divaricata Cresson, 1914: 459 [male] Type locality: USA, Georgia, Billy's Island,
Okefenokee Swamp, June 1912. [CU1C]. -Britton 1920: 204 [list]; Johnson 1925: 265 [list];
Leonard 1928: 853 [list]; Hennig 1934: 86 [synonymy]; Cresson 1938: 362 [taxonomic notes].
Grallopoda divaricatus Enderlein 1922: 212 [generic combination] (=divaricata in Cresson 1938:
361).
Redescription
Male and Female: Body length 8-13mm (wing length 7-9mm), body colour dark brown to black with blue sheen. Head with well developed postocellar, outer and inner vertical bristles; 2 lower and 1 upper fronto-orbital bristles. First flagellomere dark dorsally, lighter brown on basal ventral surface; arista 2.5 times length of first flagellomere, mostly black but white basally; ventral apical bristle of pedicel less than half as long as first flagellomere. Face light brown with dark ventral margin, many small setae present between antennal bases. Parafrontal with shining silver tomentum ventrally and dark spot where it meets the frontal at the supra-antennal shelf. Paraface rugose, brown anteriorly, poorly differentiated from mesofrons; mesofrons reddish-brown with white tomentum, broad where it meets the face. Mesofrons with dark shining triangle anterior to the ocellar triangle, subshining tomentose posterior to ocellar triangle; ocellar triangle dark with golden ocelli. Epi- and paracephala shining bluish brown; small setae
40 clumped around inner vertical bristle. Maxillary palpus axe-shaped, widest at about lA length, black with white anteroventral border a brown basal area and stout black bristles that are longer near ventral margin;. Thorax with 1 dorsocentral bristle, 2 notopleural bristles, 1 supra-alar bristle and 1 postalar bristle; suprahumeral bristles short. Anterior thoracic spiracle fringed by white hairs; katepisternal fan black. Scutellum with golden tomentum on anterior surface, small cluster of short, fine black hairs between scutellar bristles and along posterodorsal ridge. Legs mottled with yellow and brown areas.
Foreleg with femur darkest dorsally,tibia evenly dark and slightly compressed laterally, basitarsus entirely black with long black bristle comb on ventral surface and sparse white setae distally, remaining tarsi white. Mid and hind femora darkest at middle, with weak basal and sub-apical bands sometimes discernable (colours darkerin more northerly specimens). Mid tibia dark basally, slightly lighter at distal margin and with anterior sulcus, two apical dorsoventral bristles present. Hind tibia dark except for slightly lighter distal margin, sulcus on anterior and posterior surfaces running entire length of tibia. All mid and hind tarsomeres brown. Wing with cell r4+5; R4+5+M extending to wing margin; vein R] with 4 small black dorsal hairs near h, and 2 small black hairs where Ri meets the costa. Wing pattern with straight proximal band, circular discal band and proximally concave distal band reaching wing margin; membrane around vein r-m clear; vein dm-cu covered by discal band. Abdominal pleuron mostly black, small white patch at the posterior corner of syntergite 1+2; pleuron below tergite 6 nebulously white; small black setae present throughout pleuron posterior to tergite 5. Tergite 1 with dense white tomentum on apical half, fine, long white hairs bristling from basal half; circumtergal row of longer, stouter bristles at basal margin of silver tomentum section all white;
41 posterior half of quadrate section bare. Tergite 2 with brown tomentum basally; many short, stout black bristles present across dorsal surface, longer along posterior margin of tergite; thin white line on dorsal apex of posterior margin. Tergites 3 and 4 brown with white posterior margin; small stout black bristles covering dorsal surface, slightly longer along posterior margin. Tergites 5 and 6 consistently bluish-black and covered with short, stout black bristles. Sternites 1 and 2 blue-black with brown border, fine yellowish setae arising from surface; sternites 3 and 4 greatly reduced, black, with small black setae along lateral edges.
Male abdomen: Genital fork brown with basal and apical arms, both laterally compressed and curved, forming a mitt-like appearance; lateral edges of arms with long, black setae; inner surface of both anns with sharp nail-like "setae"; basal appendages separated medially by a deep evagination. Ejaculatory apodeme large, "fan" with dark spot Aedeagal apodeme laterally compressed, axe-shaped, nearly as large as cerci.
Hypandrial apodeme spoon-like, expanded dorsally. Basal and distal sections of distiphallus equal in length, divided by large, well developed bulb; distal section of distiphallus hook-shaped, curving back and opening posteriorly, wrapped in hyaline sheath. Cercus triangular, posterior angle less than 45°. Epandrium less than 1.5x as high as long; posteroventral corner with a cluster of long, posteriorly-directed stout bristles; anteroventral epandrial process very short, less than lA length of epandrium.
Female abdomen: Oviscape black with white tomentum present on basal 2/3 of dorsal surface; dorsal surface with sparse, short, fine setae; ventral surface bare; oviscape slightly more than Vi length of remaining abdomen. Three spermathecae, single spennatheca tubular, narrow, no wider than duct leading from vagina; individual ducts of
42 paired spermathecae coiled for 2/3 length, distal 1/3 globular with circular indents at apex; apical half of shared duct strongly constricted, basal half broad, heavily reticulated.
Discussion
Described from "l'Amerique septentrionale" (North America) by Macquart
(1835), this species displays a great deal of geographical variation in colouring and leg patterning. Further sampling across the range of this species may reveal local populations worthy of distinct species status. Taeniaptera trivittata, the only Taeniaptera species found north of the Gulf of Mexico, can be distinguished from T. lasciva by the basal appendages of the male copulatory fork and the fifth fore tarsomere being entirely white.
Kilpatrick et al.'s (1956) record of Taeniaptera lasciva in outhouses in Savannah,
Georgia probably refers to Taeniaptera trivittata because T. lasciva is not known from the Atlantic coast of Georgia. Marshall (2006) recorded Taeniaptera trivittata females depositing eggs in the roots of rotting Typha L. (cattails) in South Carolina.
Material Examined
Canada. Ontario: Essex Co. River Canard, nr. Front Rd N overpass 13-Sep-05 S.M. Paiero (1 S,
DEBU). Essex Co. Windsor 42°18'00"N 083°01'00"W 10-Jul-84 malaise M.T. Kasserra (1 <$, DEBU).
Essex Co. Windsor, Ojibway Prairie 42°15'51"N 083°04'30"W 22-Sep-01 sweeps S.A. Marshall (1 2,
DEBU). Essex Co. Windsor, Ojibway Prairie 42°15'51"N 083°04'30"W 8-9 Jul 2002 S.A. Marshall (1 S,
DEBU). Kent Co. St. Clair N.W.R. 9-Jul-02 S.A. Marshall (4 <$S, 4 2$, DEBU). USA. Alabama: Baldwin
Co. Byrnes Lk. 30°47'24"N 087°54'36"W J.W. McCreadie 18-Jul-00 (2 SS, 2 22, DEBU), 20-Nov-00 (1
S, DEBU). Baldwin Co. Little Briar Creek 30°50'24"N 087°56'24"W J.W. McCreadie 8-Aug-00 (1 3,
DEBU), 24-Aug-00 (1 $, DEBU), 31-Aug-OO (1 <$, DEBU). Baldwin Co. Raft River 30°46'12"N
087°57'00"W J.W. McCreadie 8-Aug-00 (1 3, DEBU), 13-Sep-00 (1 ?, DEBU). Florida: Dade Co.
Homestead 4-Jun-78 G.J. Umphrey (2 2 2, DEBU). Highlands Co. Archbold Biol. Stn. 27°11'00"N
43 081°21'05"W 14-17 Apr 1989 malaise S.A. Marshall near cabin (1 2, DEBU). Highlands Co. Archibold
Biol. Stn., Lake Placid 15-Apr-89 malaise trap W.W. Wirth (1 8, USNM). Highlands Co. Archbold Biol.
Stn. 27°11'00"N 081°21'05"W 16-Apr-89 K.N. Barber main grounds (1 $, DEBU). Alachua Co.
Gainesville S.W. Gross 20-Jun-82 (1 2, USNM), 28-Sep-82 (1 8, USNM), 12-May-84 (1 8, USNM), 21-
May-84 (1 2, USNM), 21-Jun-84 (1 8, USNM). Highlands Co. Highland Hammock St. Pk. 27°28'00"N
081°32'00"W 13-17 Apr 1989 malaise trap K.N. Barber wet palm/palmetto (2 22, DEBU), Highlands Co.
Highland Hammock St. Pk. 27°28'00"N 081°32'00"W 17-Apr-89, S.A. Marshall (1 8, DEBU). St. Johns
Co. Crescent Beach 23-Jul-83 S.W. Gross (1 2, USNM). Lake Placid 27-Dec-80 B.V. Brown (1 8,
DEBU). Withlacoochee St. Forest, Croom Reserve 12-Apr-89 K.N. Barber (1 8, DEBU). North Carolina:
Clayton 12-Oct-63 B.S. Heming (2 88, 1 ?, DEBU). Brunswick Co. Green Swamp, Shoestring Savanna
34°05'35"N 078°17'56"W 14-18 May 2001 sweep S.M. Paiero water's edge (1 2, DEBU). Columbus Co.
Waccamaw Dam 34°15'40"N 078°31'26"W 14-May-01 on plant w/ 5 others J. Knopp (1 8, DEBU).
Columbus Co. Waccamaw Dam 34°15'40"N 078°31'26"W 14-18 May 2001 S.A. Marshall (2 88, DEBU).
South Carolina: Charleston Co. Santee Coastal Natl. Wildlife Refuge 8-Oct-06 0. Lonsdale (1 8, 1 2,
DEBU). Georgetown Co. Hobcaw Barony 25 Apr-8 May 2004 J. Klymko (1 8, 3 22, DEBU).
Georgetown Co. Hobcaw Barony, Belle Baruch Marine Field Lab, Crabhaul Rd. nr. Picnic Rd. 33°21'22"N
079°12'45"W 26 Apr-8 May 2004 S.A. Marshall cypress swamp (1 2, DEBU). Georgetown Co.
Hobcaw Barony, Belle Baruch Marine Field Lab, Crabhaul Rd. nr. Picnic Rd. 33°21'22"N 079°12'45"W 26
Apr-8 May 2004 S.A. Marshall (41 88,48 22, 1 ?> DEBU). Georgetown Co. Hobcaw Barony, Belle
Baruch Marine Field Lab, Crabhaul Rd. nr. Picnic Rd. 33°21'22"N 079°12'45"W 27-Apr-04 D.K.B.
Cheung (1 8, 1 2, DEBU). Georgetown Co. Hobcaw Barony 28-Apr-04 Y. Reid roadside (1 2, DEBU).
Georgetown Co. Hobcaw Barony, Belle Baruch Marine Field Lab 33°20'00"N 079°13'00"W 29-Apr-04 on leaf, moving front arms R. Dell Kings Hwy (12, DEBU). Georgetown Co. Hobcaw Barony, Belle Baruch
Marine Field Lab 33°20'00"N 079°13'00"W 30-Apr-04 21A dried leaf E.M. Dell (1 ?, DEBU).
Georgetown Co. Hobcaw Barony, Belle Baruch Marine Field Lab 33°20'00"N 079°13'00"W l-May-04 on dung J. Klymko (1 8, DEBU). Georgetown Co. Hobcaw Barony, Belle Baruch Marine Field Lab, 1000
Acre Rd., 5 km S Kings Rd. 33°19'25"N 079°13'05"W 4-May-04 S.M. Paiero (1 8, DEBU). Georgetown
Co. Hobcaw Barony, ~5 km E Georgetown 33°19'25"N 079°13'05"W 28 Apr-5 May 2006 malaise S.M.
44 Paiero (1 8, DEBU). Georgetown Co. Hobcaw Barony, ~5 km E Georgetown 33°19'25"N 079°13'05"W
12-Sep-07 M.D. Bergeron (1 8, DEBU). Georgetown Co. Hobcaw Barony, ~5 km E Georgetown
33°19'25"N 079°13'05"W 12-16 Sep 2007 malaise Paiero & Bergeron (1 8, DEBU). Georgetown Co.
Hobcaw Barony, ~5 km E Georgetown 33°19'25"N 079°13'05"W 15-17 Sep 2007 WPT & YPT Paiero &
Bergeron open field (1 2, DEBU). Georgetown Co. Hobcaw Barony, ~5 km E Georgetown 33°19'25"N
079°13'05"W 15-17 Sep 2007 yellow pans Paiero & Bergeron deciduous forest (1 8, DEBU). Texas:
Jefferson Co. Sea Rim State Park, 10 mi. W of Sabine Pass 10-11 May 1993 white light J. Skevington dunes on Gulf of Mexico (1 8, DEBU).
Taeniaptera lasciva (Fabricius), 1798
(Figs. 28-31)
Taeniaptera lasciva (Fabricius), 1798. Distr. Nearctic: USA. Neotropical: Argentina (Hennig), Barbados,
Bolivia, Brazil, Chile (Hennig), Colombia, Costa Rica, Cuba (Hennig), Dominica, Dominican Republic,
Ecuador (Cresson), France - French Guiana, Guyana (Hennig), Honduras (Hennig), Jamaica (Hennig),
Mexico (Hennig), Montserrat, Netherlands - St. Martin, Panama, Paraguay (Hennig), Peru, Puerto Rico
(Hennig), Suriname (Hennig). Trinidad & Tobago, Venezuela.
Musca lasciva Fabricius 1798: 564 [unknown?] Type locality: French Guiana. HT unknown,
location unknown.
Calobata lasciva - Fabricius 1805: 262 [generic combination, diagnosis]; Johnson 1894: 336
[list]; Coquillet 1900: 257 [record]; Cresson 1908: 10 [diagnosis].
Calobata ruficeps Guerin, 1829: 553, pi. 103 [unknown] Type locality: Cuba. HT unkown,
location unknown. - Johnson 1894: 336 [synonymy].
Calobata aloa Walker, 1849: 1053 [male] Type locality: Jamaica. HT unknown, location - "Mr.
Gosse's collection" or [BMNH]. - Johnson 1894: 336 [synonymy].
Calobata lunulata van der Wulp 1897: 372 [both sexes, illustr.] Type locality: Mexico, Presidio
de Mazatlan (Forrer), Medellin near Vera Cruz, Frontera and Teapa in Tabasco (H. H. Smith),
North Yucatan (Gaumer). HT unknown, location unknown. - Coquillet 1900: 257 [synonymy]
Grallopoda lasciva Enderlein 1922: 212 [generic combination]
45 Taeniaptera lasciva - Cresson 1930: 350 [generic combination, taxonomic notes]; Fischer
1932(Fischer, 1932): 21 [larval biology]; Hennig 1934: 86 [diagnosis, distribution, illustr.]; Aczel
1949: 316 [catalogue]; Aczel 1951: 517, 523 [diagnosis, distribution, illustr.]; Steyskal 1968:
48.18 [catalogue]; Merritt & James 1973: 2 [larval biology]; Albuquerque 1980: 663 [diagnosis,
distribution, illustr.]; Bennett & Alam 1985: 34 [biology, list]; Steyskal 1987: 767 [larval illustr.];
Marshall 2010: 806 [biology].
Taeniaptera lasciva var. obliterata Cresson, 1930: 351 [both sexes] Type locality: Ecuador,
(Parrish; 1914). HT male [USNM no. 43148]. - Hennig 1934: 88 [record]; Cresson 1938: 360
[synonymy].
Redescription
Male and Female: Body length 8mm to 15mm (wing length 5mm-8mm), body colour brown to bluish black. Head with well developed postocellar, inner and outer vertical bristles; 2 lower and 1 upper frontal bristles. First flagellomere dark brown along dorsal ridge and anterior margin, peachy orange on remaining surface; arista about 2 times length of first flagellomere, mostly black but white basally; apicoventral pedicel bristle about 1/3 length of first flagellomere. Maxillary palpus black with white anteroventral border; covered in small black setae, longer along ventral margin; axe- shaped, maximum height about Vi length. Face brown and covered with small black bristles between antennal bases, cream-coloured and bare below antennal bases
(sometimes darker in specimens collected further inland); cream colour reaching clypeus at median, dark band present laterally. Paraface light brown ventrally, shining, dark spot present lateral to antenna. Parafrontal rugose, brown or at least darker than mesofrons at anterior margin, poorly differentiated from frontal or mesofrons. Frontal honey brown, tomentose, with small black bristles present over most of anterior surface; narrow at
46 anterior margin, less than width of one parafrontal. Mesofrons long and narrow between frontals, reaching supra-antennal shelf; heart-shaped spot anterior to ocellar triangle reaching more than Vi way to anterior margin of mesofrons; posterior to ocellar triangle shining reddish-brown. Ocellar triangle dark brown to black. Epicephala largely dark brown, subshining, but anterior projections often light brown, light area sometimes reaching upper frontal bristle; wrinkled where it meets the posterior mesofrons.
Paracephala dark brown anteriorly fading to light brown posteriorly. Thorax with one dorsocentral bristle, 2 notopleural bristles (posterior bristle arising from pronounced knob), 1 supra-alar bristle, and 1 postalar bristle; suprahumeral bristles reduced. Scutum largely black, humerus and posterior notopleural knob light to reddish brown.
Notopleural bristles surrounded by small black setae. Humerus with small black setae along anterior face. Anterior thoracic spiracle fringed with white hairs; katepisternal fan entirely black. Scutellum black with slight gold tomentum near middle; 2 posterior scutellar bristles, and short, fine black setae present along lateral margins. Legs mostly dark. Front femur and tibia equally dark brown; fore basitarsus mostly dark brown, slight lightening at dorsal distal margin; tarsomeres 2-4 white, 5th tarsomere brown. Mid femur largely dark brown, light brown distad of subapical white band; white subapical band bare, rest of femur covered in dark setae. Hind femur dark brown between basal and subapical white bands, lighter brown distad of subapical band; basal and subapical bands largely bare (may be some black bristles present ventrally). Mid and hind tibia dark brown, fully sulcated along anterior face. Mid and hind tarsomeres equally brown. Wing with wing cell r$ closed by veins R4+5 and M joined before reaching wing margin, fonning short vein ILt+5+M; vein R] with ~6 small black setae present near vein h, no
47 black setae near joining of Costa. Wing pattern "bullseye" with straight proximal band, circular discal band and distal band concavely curved on basal margin; proximal and discal bands joined in cell dm below vein r-m; vein dm-cu entirely covered by discal band, vein r-m not covered by dark wing patterning. Abdominal pleuron variable, varying in degree of white and black patterning. Tergite 1 with band of dense white tomentum on apical half, long white hairs bristling from basal half; basal half shining blue; fine,; circumtergal row of longer, stouter bristles at anterior margin of tomentum band all white. Tergite 2 largely brown, shinging blue on posterior lateral corners; with short, stout black bristles, longer along posterior margin of tergite; thin white line on dorsal apex of posterior margin. Tergites 3 and 4 dull brown with lateral margins shining blue, white posterior margin; stout black bristles present over entire surface, longest along posterior margin. Tergites 5 shining blue with stout black bristles present over entire surface; white posterior margin. Tergite 6 shining blue with white bristles over entire surface. Sternites 1 and 2 blue-black with brown border, fine yellowish setae arising from surface; sternites 3 and 4 greatly reduced, black, with small black setae along lateral edges.
Male Abdomen: Tergite 7 largely brown, some bluish highlights; white setae present over entire surface. Genital fork without basal arms; light brown with dark cone- shaped bristles on inner surfaces, long brown setae on ventral and lateral surfaces; arms quite angular, diamond shaped; apical portion of arms slightly longer than basal portion of arms. Ejaculatory apodeme large, larger than epandrium; dark ring on "fan" near base of "stalk". Aedeagal apodeme laterally compressed, dorsoventrally expanded, ovular, smaller than cercus. Hypandrial apodeme spoon-like, greatly expanded. Distiphallus
48 extremely long, divided by well developed bulb; distal section laterally compressed with hyaline sheath, coiled and 2x as long as basal section. Cercus triangular, posterior angle less than 45°. Epandrium rectangular, height approximately equal to length; anteroventral epandrial process short, less than 1/3 length of epandrium
Female Abdomen: Oviscape dark brown, sometimes lightening towards tip; basal half covered with dense white tomentum, apical half bare; short, fine, erect white setae present over both dorsal and ventral surfaces; oviscape tip variable, sometimes elongated with narrow opening, sometimes wide opening; length ~l/2 length of remaining abdomen. Three spermathecae, basal spennatheca tubular, narrow, no wider than duct leading from vagina, surface irregular; apical spermathecae paired; individual ducts loosely coiled for 2/3 length, distal 1/3 ovoid without apical indentation. Apical Vi of shared duct for paired spermathecae heavily constricted, basal lA of duct broad, heavily reticulated.
Discussion
Taeniaptera lasciva is the only Taeniaptera species found in the Caribbean, and is found in the countries bordering the Caribbean Sea and much of South America. One of the more ubiquitous Taeniaptera species in the neotropics, T. lasciva larvae have been recorded from rotting sugar cane cuttings (Cresson, 1938) and beneath the bark of fig roots (Steyskal, 1964).
Material Examined
Bolivia. Dpto. Beni: Puerto Cavinas, Beni River, Jan-21 W.M. Mann (1 c?,USNM). Dpto. La Paz:
Caranavi 15°49'00"S 067°33'00"W 12-Mar-Ol A. Freidberg (1 8, USNM), Guanay, 9 km NW 15°29'30"N
067°53'48"W 840m 13-Mar-01 A. Freidberg (1 8, USNM). Brazil. Brazil 18-Apr-93 (1 ?, DEBU),
EMBRAPA 17-Jun-85 Nivia (1 8, INPA), Novo Ariquana, Reserva Soka 05°15'53"S 060°07'08"W 28
49 Apr-5 May 1999 malaise - mata R.L. Ferriera, R.A. Rocha, J. Vidal & R.S. Lelle (1 2, INPA), Recrio dos
Branderantes Guan. 20-Sep-61 Krauss (1 8, USNM). Amazonas: Tefe, Alvarez 50m 25-Feb-81 Ekis &
Young (1 2, CMNH), Est Amo 10 kms, 1 Ceplac ??? 18-Aug-77 L.P. Albuquerque (1 8, INPA), Manaus
Petropolis 12-Apr-88 S.S. Lerte (1 2, INPA), Manaos, Amazon 03°06'23"S 060°01'15"W (2 88, MZHF).
Bahia: Salvador Bahia Oct-61 Krauss (1 8, USNM). Goias: L de Pedra, W.R. Cana Brava, 160km NE
Brasilia 23-30 Oct 1974 L. Knutson (1 2, USNM). Mato Grosso: Diamantino Fascienda, Sao Joao 450m
Ekis & Young 6-Feb-81 (1 8, CMNH), 7-Feb-81 (2 88, 6 22, CMNH), Tiradentes 15-17 Feb 1990 pan traps S.A. Marshall along creek (1 2, DEBU). Para: Tucurui lg do Pitinga 4-Oct-81 (1 8, INPA).
Rondonia: Rondoala Vilhera 27-Jul-83 N. Penny (1 8, 2 22, INPA). Sao Paulo: Itan, Sao Paulo 25-Oct-61
Krauss (1 8, USNM). Colombia. Dpto. Amazonas: Amazonas PNN, Amacayacu San Martin 03°46'00"S
070°18'00"W 150m 26 Feb-12 Mar 2001 malaise D. Chota (1 2, DEBU). Dpto. Magdalena: TayronaNatl.
Pk., Zaino 11°16'00"N 074°13'00"W 50 m 28 Apr-13 May 2000 malaise trap R. Henriquez (1 8, 1 2,
DEBU). Com. Vichada: El Tuparro Natl. Pk., Centra Admin. 140 m malaise trap W. Villalba 19-29 Jun
2000 (13 88, 17 22, DEBU), 29 Jun-15 Jul 2000 (11 88,19 2?, UNCB), Vichada PNN, El Tuparro Pie
Cerro Tomas 05°21'00"N 067°51'00"W 250m 1-12 May 2001 malaise I. Gil (3 88, 8 22, DEBU),
Vichada PNN, El Tuparro Cerro Tomas 05°21'00"N 067°51'36"W 140m malaise W. Villalba 15-19 Jul
2000 (6 88, 8 22, DEBU), 19-29 Jul 2000 (13 88, 17 22, UNCB), 29 Jul-8 Aug 2000 (13 88, 12 22,
1 ?, DEBU), 8-28 Aug 2000 (7 88, 10 22, DEBU), 18-28 Aug 2000 (2 88, 5 2?, DEBU). Costa Rica.
Prov. Alajuela: Volcan Tenorio, Bijagua Biol. Stn. 700 m 20-Jun-00 M. Buck (1 8, DEBU). Prov. Heredia:
Estac. Biol, la Selva 2-Mar-93 (1 8, DEBU). Prov. Limon: Cahuita Natl. Pk. 23-25 Dec 1988 A.S. Menke
(3 22, USNM). Dominica. St. George Parish: Trafalgar Village 259 m 29-Dec-78 M.M. Ivie & L.L. Ivie
(2 88, MTEC). St. Joseph Parish: Wet Area Exp. Stn. 800 ft 31-Dec-78 M.A. Ivie & L.L. Ivie (1 8,
MTEC). Dominican Republic. Azua Province: 2 km S of Bohechio Rio del Medio 18°46'00"N
070°59'00"W 9-Aug-90 taken on flowers of Crotalaria sp. J.E. Rawlins (1 2, CMNH). Dajabon Province:
Mariano Cestero 650m 14-Aug-80 A. Norrbom (2 88, 2 22, CMNH). Elias Pifia Province: La Estrelleta
Rio Limpio 650m 15-Aug-80 A. Norrbom (1 2, CMNH). La Vega Province: Par. Nac. Armando Bermudez
La Cienaga-Los Tablones 1187m 29-Jul-93 beating veg. D.S. Sikes (1 8, MTEC). Ocoa Province: RD-209
19 kms NE Ocoa on road to Rancho Arriba 18°39'00"N 070°27'51"W 720 m 3-Apr-04 D. Perez & B.
50 Hierro (2 88, DEBU). Peravia Province: Arroyo Canas 650m l-Aug-80 A. Norrbom (1 8, CMNH).
France - French Guiana. Arrondissement of Cayenne Mana River May-17 (1 8, 2 22, CMNH). Mexico.
Chiapas: Yaxoquintela 16°58'00"N 091°47'00"W 6-Nov-78 J.E. Rawlins (1 2, CMNH). Veracruz: Cota
28-Nov-61 Krauss (1 8, USNM). Montserrat. West Indies, Montserrat 22-27 Jul 1981 R.S. Miller (2 88,
2 22, MTEC). Netherlands - St. Martin. St. Martin, Paradise Park (1 8, DEBU). Panama. San Curitiba
Apr-40 Claret (3 88, USNM). Code Province: Penonome 31-Mar-26 C.T. Greene (4 88, 3 22, USNM).
Panama Province: Ancon Canal Zone (C.Z.) 22-Mar-26 C.T. Greene (2 88, 1 ?, USNM). Peru. Dpto.
Ucayali: Pucallpa Schunke 7-Dec-50 (1 8, USNM), 22-Dec-50 (3 88, 2 22, USNM), 3-Jan-51 (1 2,
USNM), 20-Feb-51 (1 8, 1 2, USNM), 25-Feb-51 (1 8, USNM), 28-Feb-51 (1 ?, USNM). Trinidad and
Tobago. Trinidad and Tobago 18-Aug-24 S. Crawford (1 8, CMNH). Caroni: Tabaquite H.D. Chipman
22-Nov-02 (1 8, CMNH), 7-Jan-03 (1 8, 1 2, CMNH), 10-Jan-03 (1 8, CMNH), 15-Nov-03 (1 2,
CMNH). Saint George Co.: Curepe 10°38'00"N 061°24'00"W malaise trap F.D. Bennett 1978 (2 22,
DEBU), 20-Jan-78 (1 2, DEBU), Aug-78 (1 2, DEBU), 29-Nov-78 (2 88,2 2?, DEBU), Dec-78 (3 22,
DEBU), 17-Dec-78 (1 8, DEBU). USA. Alabama: Baldwin Co. Bon Secour 30°18'00"N 088°44'24"W 19-
Oct-04 malaise E. Benton site 4 (1 2, DEBU), Mobile Co. Wilmer 30°47'24"N 088°23'24"W 25-Oct-04 malaise E. Benton site 15 (1 2, DEBU). Texas: Hidalgo Co. Bentsen, Rio Grande Valley St. Park 30 Nov-2
Dec 1978 E.E. Grissell & S. Menke (12, USNM). Venezuela. Estado Aragua: PN H. Pittier, Rancho
Grande, Portachuelo: 1143m: Malaise 10°20' 51"N, 67°41'16"W 13-14.ix.2008: E. Fisher, J. Skevington,
M. Jackson (1 2, DEBU), Overgrown yard near river 10°28'31"N 67°36'19"W 205m; ix-12/2008 M.D.
Jackson (2 88, 2 2?, DEBU).
Taeniaptera nigriceps Hennig
(Figs. 32-34)
Taeniaptera nigriceps Hennig 1934. Distr. Neotropical: Brazil
Taeniaptera nigriceps Hennig, 1934: 89 [both sexes, illustr.]. Type locality: "Brazil". Type-series
4 males, 2 females [NHMW] -Aczel 1949: 318 [catalogue]; Steyskal, 1968: 48.18 [catalogue].
51 Redescription (from photographic slides of female specimen from type series
[label: "Typus; Beske 848 Brasilien; Alta Sammlung; ?lasciva"] by S.A. Marshall)
Female: Head largely dark; postocellar, inner and outer vertical bristles well developed; 2 lower frontal and 1 upper frontal bristle; strong genal fan present.
Flagellomeres and arista missing from specimen. Face, mesofrons, frontal and parafrontal similarly coloured, dark brown; parafrontal and mesofrons shining; paraface with dark spot at dorsal margin with parafrontal, even with antennal insertion; ocellar triangle dark; epi- and paracephala subshining, same colour as frontal. Maxillary palpus rounded ventrally, dorsal surface obscured but presumed to be flattened; ventral edge with slight white border, possibly expanded white marking near apical tip. Thorax largely brown, slight lightening at humerus and posterior notopleural knob. 4 strong dorsocentral bristles present, not extending beyond transverse suture; 2 notopleural, 1 supra-alar bristle visible, 1 post-alar bristle likely present but obscured. Katepisternal fan appears entirely dark. Scutellum with 2 long posterior scutellar bristles, no auxiliary setae visible. Legs largely brown. Fore and mid femur and tibia evenly brown, no banding. Fore basitarsus dark basally, light yellow (possibly white in newer specimens) dorsally on apical 1/3, ventrally on less than apical 1/3; remaining fore tarsomeres light yellow (white). Mid and hind tarsomeres evenly brown. Hind femur with basal and subapical white rings, basal white ring more than twice length of subapical ring. Mid and hind tibia sulcated, degree unknown. Wing with wing cell r$ closed by veins R4+5 and M joined before reaching wing margin, forming short vein R4+5+M. Wing pattern "bullseye" with slightly curved proximal band, circular discal band and distal band concavely curved on basal margin; discal band with slight lightened patch where crossvein dm-cu meets vein M, otherwise
52 crossvein dm-cu entirely covered by discal band; crossvein r-m entirely in hyaline area.
Abdominal tergite 1 and 2 blue basally, brown with blue margins apically. Tergite 1 with fine, long white hairs bristling from basal half; circumtergal row of longer, stouter bristles at midpoint all white; posterior half bare. Tergite 2 section with short, stout black bristles, longer along posterior margin of tergite. Tergites 3 and 4 brown with very long black bristles along posterior margins. Tergites 5 and 6 appear bluish brown, bristles on posterior margin shorter than those on tergites 3 and 4. Very long bristles present on sternite 2. Male genital fork withut basal arms (from Hennig 1934). Oviscape dark brown, less than Vi length of remaining abdomen; tip somewhat elongated and narrowed.
Discussion
This species is known only from the type series. I have only seen the photographs of one of syntype [female, labels: "Tvpus; Beske 848 Brasilien; Alta Sammlung;
?lasciva"1 made by S.A. Marshall, which I am designating as the lectotype for
Taeniaptera nigriceps, assigning the remainder of Hennig's type series as paralectotypes.
The curator of NMNH will be asked to label the specimen photographed as the lectotype and the remainder as paralectotypes. The lectotype is in poor shape and covered with debris, although the characters important for identification are clearly visible. This species is unique in Taeniaptera for its 4 dorsocentral bristles posterior to the transverse suture, a character that will readily identify this species.
Taeniaptera vulpes Cresson
(Figs. 35-37)
Taeniaptera vulpes Cresson, 1926. Distr. Neotropical: Colombia, Panama
53 Taeniaptera vulpes Cresson, 1926: 273 [male]. Type locality: Panama, Trinidad Rio, March 18,
1912, (A. Busck), [U.S.N.M. No. 27081]. HT male [USNM]. - Cresson 1930: 353 [diagnosis];
Hennig 1934: 85 [catalogue]; Aczel 1949: 322 [catalogue]; Steyskal 1968: 48.19 [catalogue]
Redescription (from photographic slides of type by S.A. Marshall)
Male: Head light brown; postocellar, inner and outer vertical bristles present, inner vertical bristles much longer than either postocellar or outer verticals; 2 lower frontal and 1 upper frontal bristles very strong, as long as postocellar bristles. First flagellomere brown, arista black. Clypeus, face, mesofrons, frontal and paraface light brown; mesofrons without dark spot anterior to ocellar triangle; ocellar triangle light brown, not differentiated from remaining head plates; paraface with reduced dark spot near dorsal margin; epi- and paracephala light brown; epicephala slightly inflated compared to paracephala. Maxillary palpus axe-shaped, light brown, with light yellow or white band along ventral margin. Thorax dark brown dorsally, pleuron darker with metallic blue shine. 2 dorsocentral bristles present, 2 notopleural bristles, 1 supra-alar bristle, as well as 4 strong superhumeral bristles; post-alar bristles not visible, likely present. Posterior notopleural knob very well defined, triangular margin and greatly inflated. Katepisternal fan likely entirely black, obscured and shadowed however.
Scutellum partially obscured but 2 posterior scutellar bristles present. Legs light brown.
Fore femur light brown, fore tibia dark brown; fore basitarsus largely white, slight darkening basally; remaining fore tarsomeres white. Mid and hind femora with white basal and subapical white bands bare, remainder of femora with small black bristles; hind femora basal white band ~3x length of subapical band. Mid and hind tibia sulcated on at
54 least basal half; strong row of posterior bristles present. Mid and hind tarsomeres evenly light brown. Wings with wing cell rs closed by veins R4+5 and M joined before reaching wing margin, forming short vein R4+5+M. Wing pattern "bullseye" with thick proximal band, circular discal band and distal band straight on basal margin; discal band with slight basal projection towards proximal band, not crossing vein r-m, large hyaline spot anterior to where crossvein dm-cu meets vein M, otherwise crossvein dm-cu entirely covered by discal band; crossvein r-m entirely in hyaline area. Abdominal tergites 1 and
2 shining blue anteriorly, brown with blue lateral highlights posteriorly. Tergite 1 with fine, long white hairs bristling on basal half; circumtergal row of longer, stouter bristles at midpoint all white, basal half with band of silvery tomentum. Tergites 3 and 4 obscured in photos. Tergites 5 and 6 metallic blue; long bristles extending over the posterior margin of tergite 5. Genital fork without basal anns, long bristles on lateral and ventral surfaces.
Discussion
T. vulpes is known from 16 specimens recorded from Panama (Cresson, 1926;
Cresson, 1930) and Colombia (Hennig, 1934). I have only seen photographs of the type made by S.A. Marshall. Closely allied to Taeniaptera knutsonii, T. vulpes can be differentiated by the lack of a dark spot on the frontal vitta and the presence of a basal white band on the mid femur.
Taeniaptera knutsonii sp. nov.
(Figs. 38-40)
Description
55 Male & Female: Body Length 11-13 mm (wing length 8-9 mm). Thorax brown with bluish tint; humerus brown, posterior pronotum, anterior anepimeron, lateral edges of supra-alar area reddish brown. Abdominal tergites 1 & 2 brown anteriorly and blue metallic posteriorly, tergites 3 & 4 brown with anterolateral corners metallic blue, tergites
5 & 6 brown centrally and metallic blue laterally. Head golden brown; paracephala dark brown and densely polinose; patch of small, erect, black setae between postvertical and innervertical bristles. Mesofrons narrow, tapered at anterior margin; dark brown spot in centre anterior to ocellar triangle. Parafrons wide anteriorly, almost meeting in centre, rugose. Posterior margin of frontal brown. Face light yellow with brown ventral border, golden brown between antennae; small dark setae present from antennae to dorsal margin; Paraface with dense, white tomentum ventrally and dark spot at dorsal border with parafrontal. Scape and pedicel dark brown, scape less than V2 length of pedicel; pedical with ventral apical bristle less than half as long as first flagellomere; first flagellomere 2.5 times longer than wide, golden brown basally, brown apically, covered with silver tomentum; arista bare, more than 3.5 times length of first flagellomere, white on basal 1/7, rest black. Postgena with white tomentum along eye margin; 4 long black bristles behind tomentose area; prementum with 4 longer bristles (one dorsal, one lateral, one ventrolateral, one ventral). Thorax with at least one very strong intra-alar bristle on anterior margin of scutum; two dorsocentral bristles, the anterior bristle 1/3 length of the posterior bristle, anterior bristle arising about 1/3 of the distance from the transverse suture to the scutellum. Fine bristles present on anterior face of humerus; proepimeral setae as long or longer than anterior spiracle, black. Scutellum dark with golden tomentum; line of short stout black bristles leading along lateral edge to scutellar bristles;
56 two scutellar bristles, standing dorsally erect, longer than posterior dorsocentral bristle by 1/2. Legs dark brown, mid femur with apical white band, hind femur with basal and apical white bands; basal white band 2.5 times width of apical band. Black setae present across all legs, including white bands of mid and hind femora. All tibia sulcate, none greatly expanded. Fore basitarsus same colour as tibia basally, white apically; remaining fore tarsi white; tarsal claws black. Mid and hind tarsi all same colour as tibia. Wings with sinuate vein M; wing cell rs closed by veins R4-1-5 and M joined before reaching wing margin, sometimes forming short vein R4+5+M. Distal wing band with dark border basally, edge rounded; median wing band rounded on basal and apical edges, appearing round; proximal wing band straight. Abdominal Tergite 1 with long, white setae covering basal half; mid point with row of long bristles white dorsally, thick and black laterally; apical half of tergite 1 bare. Tergite 2 with band of silver tomentum basally, brown tomentum medially, and shining blue apically; short black setae present over dorsal surface, longer along apical margin; apical margin white on medial 2/3s. Tergite 3 and 4 brown with posterior lateral corners blue; dorsal surface covered in small black setae, longer on apical margin; apical margin with white margin. Tergite 5 and 6 blue with white apical margin; black setae covering dorsal surface, longer along apex.
Male Abdomen: pleura largely velvety black, white band located apical margin of tergite 3. Genital fork (sternite 5) very broad where connected to abdomen; posterior processes present; processes greatly reduced, shorter than distance between tips; bristles on base as long as bristles at tips of processes. Ejaculatory apodeme small, "fan" the same size as the "pump". Aedeagal apodeme laterally expanded, slightly curved ventrally; significant scleritization of core. Hypandrial apodeme reduced, spoon-shaped;
57 lateral margins of hypandrium dorsoventrally expanded, taller than adeagal apodeme.
Distiphallus of medium length, divided by complicated bulb; basal section longer than distal section; distal section very slightly curved, opening dorsolaterally, without visible hyaline sheath. Cercus ovular, posterior angle more than 45°. Epandrium subquadrate, dorsal length -2/3 ventral length, height almost equal to ventral length; anteroventral process -1/2 length of epandrium (ventral).
Female Abdomen: pleura largely dark, small white area near apical margin of tergite 3. Ovipositor completely black, as long as posterior 4 tergites combined. At least 2 spermathecae present (see discussion), paired, basal 2/3 of individual ducts heavily coiled, distal 1/3 spherical, no apical indentations visible. A third spermathecae arising basally to the shared spennathecal duct is expected.
Holotype (S, USNM) "BRAZIL S. Paulo Rio Claro 14 Jan. 1977 L.Knutson".
Paratvpes (16*, 2 $ $, USNM): "BRAZIL Sao Paulo Maua V - 1961 NLH
Krauss" (16*); "BRASIL Brasilia National Park 23 IV 1972 L. Knutson" (1$); "Goias,
R.Preto, 20kmNE Brasilia, S. Formosa 21.X-7.XI.1974 L. Knutson" (1$).
Etymology: The name is in recognition of Lloyd Knutson, who collected 3 of the
4 known specimens, each on a different collecting expedition.
Discussion
Known from 4 specimens collected in Brazil during the 1970s, this new species is differentiated from Taeniaptera vulpes by the dark spot on the mesofrons and the basal white band on the mid femur and from Taeniaptera longapilis and Taeniaptera
58 promiscua by the yellowish head, basal dark border of the distal wing band.
Unfortunately the female genitalic dissection failed, with the spermathecae remaining clumped with soft tissue, obscuring morphological details. This is a fairly common occurrence in Micropezidae, especially with older specimens, so the other female in the series was left complete so as not to risk destruction. Nothing is known of the biology of this species.
Taeniaptera longapilis sp. nov.
(Fig. 41-42)
Description
Female: Body Length 12mm (wing length 9mm), body largely black. Head brown; paracephala black, shining between orbital bristle and inner vertical bristle, otherwise pollinose. Postvertical bristles absent. Mesofrons pollinose except for dark chevron-shaped brown spot anterior to ocellar triangle; nanow at supra-antennal shelf, less than half width of frontal. Ocellar triangle dark brown and shining. Frontals brown, white tomentum present; very wide at anterior margin. Parafrontals shining, small blonde bristles present on anterior region; rugose. Paraface with subtle spot on dorsal margin, tomentose ventrally. Face sparsely covered with short black setae between antennal bases; dorsally brown, centrally pale, and with prominent dark band on ventral margin.
First flagellomere entirely dark brown, covered with white tomentum; apicoventral pedicel bristle about half as long as first flagellomere; arista mostly black, basally white.
Postgena with dense silver tomentum below eye. Maxillary palpus axe-shaped, brown with white ventral margin; long black setae present along ventral margin; small white
59 setae present over remainder of surface. Thorax mostly black with reddish areas on humerus and lateral edge of supra-alar region. Two equally long dorsocentral bristles present, each about 4/5 length of scutellar bristle. Acrostichal, dorsocentral, and intra-alar rows of fine, short setae present. Humerus with very fine, black setae present on anterior surface; proepimeral setae dark brown, uneven in length, some as long as anterior spiracle, some much shorter. Scutellum with dense tomentum, few, short, fine, black bristles near lateral margins. Legs dark brown, hind femur with basal and apical white rings; basal ring 2.5 times width of apical band. Black setae covering femora and tibiae, including apical white ring of hind femur. Fore basitarsus brown on basal half, remaining white; remaining fore tarsi white. Hind femur with knot-like swelling basal to apical white ring; hind tibia widely sulcate; hind tarsi a lighter brown than tibia and femur.
Middle legs missing on only known specimen. Wings with vein M largely straight, only curved near apical V* to close posterior cell; wing cell r5 closed by veins PM+5 and M at wing margin, vein R4+5+M not present. Distal wing band uniformly coloured, basal margin concave; medial band convex on distal margin, straighter on basal margin but still giving the band an overall circular appearance, darkest on anterobasal corner; basal band straight, not entering anal cell. Abdominal Tergite 1 with long, white setae covering basal half; row of long bristles at midpoint white dorsally and laterally; basally bluish black, with brown section near posterior lateral edge; apical half with dense band of silver tomentum. Tergite 2 with basal band of silver tomentum, medial band of blackish- brown tomentum, and apical half shining blue; apex with wide white section; small black setae present on dorsal surface of apical half. Tergite 3 brown narrowly on basal margin, remainder black except for white stripe at apex; black setae present on dorsal surface,
60 longer along apex. Tergite 4 brown; small black setae present across dorsal surface, longer at apex.. Tergites 5 and 6 entirely bluish black; black setae covering dorsal surface of both tergites. Pleura almost entirely black, small white marking near posterior comer of tergite 4.
Ovipositor bluish black basally, transitioning to brown then black, with tip light brown; longer than posterior 4 tergites combined.
Male unknown.
Holotype ($, USNM) "GUATEMALA, S. Antonio Such. VII - 6 - 1965 Paul J.
Spangler".
Etymology: The specific name is a combination of the Latin for "long hairs" in reference to the extremely long thoracic bristles found on this species.
Discussion
Known from a single specimen collected in Guatemala, this species can be differentiated from other Taeniaptera species with a closed wing cell and 2 dorsocentral thoracic bristles by the following characters: a mostly dark head with a spot on the mesofrons; the lack of a dark basal border on the distal wing band; deep sulcation on front tibia; light brown hind tarsomeres, and knot-like swelling of the hind femur.
Nothing is known of the biology of this species.
Taeniaptera promiscua sp. nov.
(Figs. 43-44)
61 Description
Male: Body Length 9mm (wing length 7mm). Body colour brown to bluish black. Head with well developed postocellar, inner and outer vertical bristles; 2 lower and 1 upper frontal bristles. First flagellomere dark brown along dorsal ridge and anterior margin, peachy orange on remaining surface; arista about 2 times length of first flagellomere, mostly black but white basally; apicoventral pedicel bristle about 1/3 length of first flagellomere. Maxillary palpus black with white anteroventral border; covered in small black setae, longer along ventral margin; axe-shaped, maximum height about 1/3 length. Face brown and covered with small black bristles between antennal bases, cream- coloured and bare below antennal bases; cream colour reaching clypeus at median, dark band present laterally. Paraface light brown ventrally, shining, dark spot present lateral to antenna where paraface meets parafrontal. Parafrontal rugose, brown or at least darker than frontal at anterior margin, poorly differentiated from frontal. Frontal brown with small black bristles present over most of anterior surface; at anterior margin, equal width of one parafrontal. Dense white tomentum present over most of mesofrons. Mesofrons long and narrow towards anterior margin; less than % width of frontal at supra-antennal shelf; heart-shaped dark brown shining spot anterior to ocellar triangle reaching more than Vi way to anterior margin of mesofrons; ocellar triangle dark brown to black; posterior to ocellar triangle shining reddish-brown, extending to postocellar bristles.
Epicephala dark brown, subshining; wrinkled where it meets the frontal vitta.
Paracephala dark brown. Thorax with two dorsocentral bristles, 2 notopleural bristles
(posterior bristle arising from subtle knob), 1 supra-alar bristle, and 1 postalar bristle.
Scutum largely black, humerus reddish brown. Notopleural bristles sunounded by small
62 black setae. Humerus with small black setae along anterior face. Anterior thoracic spiracle fringed with white hairs; katepistemal fan entirely black. Scutellum black with slight gold tomentum near middle; 2 scutellar bristles, and small black setae present along lateral margins. Legs mostly dark. Front femur and tibia black; fore basitarsus black; tarsomeres 2-4 brown, 5th tarsomere black. Mid femur dark brown with slight reddening at base; nanow white subapical band bare except for dorsal surface, rest of femur covered in dark setae. Mid tibia dark brown, lightly sulcated on basal XA; 2 very strong apical ventral spurs. Hind femur dark brown between basal and subapical white bands, lighter brown distad of subapical band; basal and subapical bands largely bare, subapical band with black bristles present on dorsal surface. Hind tibia dark brown, fully sulcated along anterior face. Mid and hind tarsomeres equally dark brown. Wing with wing cell rs closed by veins R4+5 and M joined before reaching wing margin, forming short vein
R4+5+M; vein R] with ~4 small black setae present near vein h, 2-3 small black setae near joining of Costa. Wing pattern "bullseye" with straight proximal band, semi-circular discal band and distal band concavely curved on basal margin; discal band inegularly curved along basal margin; proximal and discal bands joined in cell dm below vein r-m; vein dm-cu entirely covered by discal band, vein r-m margin of discal band; hyaline band between discal and distal wing bands very narrow. Abdominal pleuron mostly retracted in available specimen, appears to be largely dark. Tergite 1 with shining blue basally with covering of long, fine white bristles; circumtergal row of long bristles white dorsally and laterally; apical half of tergite 1 with dense white tomentum. Tergite 2 largely brown, shining blue on posterior lateral comers; fine; short, stout black bristles present over dorsal surface, longer blonde bristles along posterior margin of tergite; thin white line on
63 dorsal apex of posterior margin. Tergites 3 and 4 dull brown with lateral margins shining blue, tergite 3 with white apical margin; stout black bristles present over entire surface, longer brown bristles along posterior margin. Tergite 5 shining blue with stout black bristles present over entire surface, longer brown bristles along posterior margin; white tomentum densely covering surface. Tergite 6 shining blue with white bristles over entire surface; white tomentum densely covering entire surface. Sternites 1 and 2 blue-black with brown border, fine yellowish setae arising from surface; sternites 3 and 4 concealed in available specimen. Genital fork without basal arms; brown with dark cone-shaped bristles on inner surfaces, long brown setae on ventral and lateral surfaces; arms quite angular, diamond shaped; apical portion of arms slightly longer than basal portion of arms.
Genitalia: Distiphallus exposed on available specimen; very long, divided by well developed bulb; distal section more than 2x as long as basal section, coiled twice, laterally compressed with hyaline sheath present. Cercus with many, very long bristles posteriorly; posterior angle less than 30°. Remainder of genitalia concealed, specimen not dissected.
Holotype (S, USNM): "Belle Horizonte MGs. Braz. 4, 35 DMCochran".
Etymology: The specific name is a direct Latin translation of "promiscuous", and is a reference to the extreme similarity between this species and Taeniaptera lasciva.
Discussion
64 Known from a single Brazilian specimen, Taeniaptera promiscua is extremely similar to Taeniaptera lasciva, but has 2 dorsocentral bristles, compared to the single pair present in T. lasciva. Other significant differences include the colouration of the fore tarsomeres and the tomentosity of the abdominal tergites. Taeniaptera promiscua can be differentiated from Taeniaptera vulpes and Taeniaptera knutsonii by the dark head, and from Taeniaptera longapilis by the dark fore tarsomeres. Nothing is known of the biology of this species.
65 4. Conclusions & Future Work
This study examined the generic relationships of the Taeniapterinae and redefined the genus Taeniaptera Hennig. A phylogenetic analysis of the subfamily was performed using a dataset composed of DNA molecular characters and morphological characters.
The resulting phylogeny was used as support for the elevation of 2 monophyletic subgenera to the generic level (Hemichaeta Hennig and Paragrallomyia Hendel, the confinnation that Grallomyia Rondani should remain at the generic level, and the redefinition of Taeniaptera as a restricted, but monophyletic and easily recognizable genus. Taeniaptera was then revised, and 3 new species were described.
The phylogenetic hypotheses generated by this study have reinforced that all genera of Taeniapterinae other than the newly redefined Taeniaptera and the recently revised Hoplocheiloma are in desperate need of revision. The University of Guelph Insect
Collection houses several undescribed species across the Taeniatperinae which will be vital for future revisionary work.
Although this study included a relatively broad sampling of taeniapterine genera, the exploration of the higher relationships of Micropezidae will require a much broader taxon sampling, including species from each of the micropezid subfamilies and preferably from every genus, and on a global scale. Increased outgroup sampling including species of each of the remaining neriioid familes is also critical, since the relationships between the subfamilies, and indeed the monophyly of the family itself, are currently in question. Broader taxonomic sampling is essential, but future phylogenetic analyses should also include new datasets generated by careful comparative morphology
66 as well as further molecular datasets. Alternative gene regions should be explored for phylogenetic utility at the higher taxonomic levels.
With a diverse, worldwide fauna and demonstrated taxonomic challenges,
Micropezidae systematics represents an opportunity to unite traditional methodologies with next-generational concepts and techniques to become the model for integrative taxonomy.
67 5. Figures & Tables
j Cephalosphen Hennig (OW)
-Hoplocheiloma Cresson
-Tenthes Cresson • Taeniaptera s. su. -
-Choetotylus Hendel
I Glyphodera Enderlein (OW) -—i Grammkomyia Bigot (OW)
-Taeniaptera- -Grallipeza Rondani
-Poecilotylus Hennig —Ptilosphen Enderlein
Oiobata Enderlein Mesocortius Enderlein
-Amtobata Frey •T. Grallomyia - —Calosphen Hennig
Rainieria Rondani Plocoscelus Enderlein
- Cardiacephala Macquart
l——Parasphen Enderlein
I I! i Pseudeurybata Hennig i , . _ , . . ( Scipopuss.str, — Scipopus Enderlein—i ' S. Phaeopterina
' Mimegralla Rondani (OW)
Figure 1: Graphical representation of Hennig's generic relationships of the
Taeniapterinae (Hennig, 1934; 1935a; 1935b; 1936).
68 • Tenthes • Plocoscelus
• Cardiacephala • Parasphen
• Ptilosphen • Poecilotylus
• Hemichaeta
• Hoplocheiloma
• Taeniaptera (Taeniaptera)
• Taeniaptera (Syntaeniaptera) • Taeniaptera (Parataeniaptera) • Taeniaptera (Pseudotaeniaptera)
• Zelatractodes
• Mesoconius
• Calosphen
• Grallipeza (Amazogtaitipeza) • Grallipeza (Paragrallipeza)
• Grallipeza (Grallipeza) • Scipopus
• Phaeopterina • Gobata • Pseudeurybata • Metasphen
• Choetotylus
• Ramteria (Globomyia)
• ftainieria (Ramieria)
• Ramieria (Ramieriella)
Figure 2: Phylogeny of the Taeniapterinae from Albuquerque 1986.
69 Taeniaptera (Taeniaptera) Macquart T (Syntaeniaptera) vittipennis (Coquillett, 1902)
T (Taeniaptera) trivittata Macquart, 1835 ** T (Syntaeniaptera) similhma (Hendel, 1922)
T (Taeniaptera) lasciva (Fabr , 1798) T (Syntaeniaptera) ichneumonea (Brauer, 1885)
T (Taeniaptera) vulpes Cresson, 1926 T (Syntaemaptera) diversicolor (Macquart, 1855)
T (Taeniaptera) nigriceps Hennig, 1934 T (Syntaeniaptera) postannulus (Enderlein, 1922)
T (Syntaeniaptera) parens Cresson 1926
Taeniaptera (Syntaeniaptera) T (Syntaeniaptera) plamtibia (Enderlein, 1922)
T (Syntaeniaptera) annulata (Fabr , 1787) **
T (Syntaeniaptera) albibasis (Enderlein, 1922) Taeniaptera (Parataeniaptera)
T (Syntaeniaptera) albitarsis (Enderlein, 1922) T (Parataeniaptera) tibialis (Macquart, 1843) **
T (Syntaeniaptera) angulata (Loew, 1922) T (Parataeniaptera) munda (Wulp, 1897)
T (Syntaeniaptera) inornata Hennig, 1934 T (Parataeniaptera) medwfuscaHemng 1934
T (Syntaeniaptera) inpai Albuquerque 1980 T (Parataeniaptera) aliceae Albuquerque 1980
T (Syntaeniaptera) teresacristinae Albuquerque 1981 T (Parataeniaptera) dilutimacula (Enderlein, 1922)
T (Syntaeniaptera) vulgata Hennig 1934 T (Parataeniaptera) continentalis Hennig 1934
T (Syntaeniaptera) thiemei (Enderlein, 1922)
T (Syntaeniaptera) lauta (Cresson, 1930) Taeniaptera (Pseudotaemaptera)
T (Syntaeniaptera) gratula Steyskal, 1967 T (Pseudotaemaptera) tarsata (Wiedemann, 1830) **
T (Syntaeniaptera) grata (Wulp, 1897) T (Pseudotaemaptera) hneata (Enderlein, 1922)
T (Syntaeniaptera) wulpi Steyskal, 1967 T (Pseudotaemaptera) balzapambana (Enderlein, 1922)
T (Syntaeniaptera) gorgonae Hennig 1934 T (Pseudotaemaptera) seiuncta (Czemy, 1931)
T (Syntaeniaptera) platycnema (Loew, 1866) T (Pseudotaemaptera) aeripenms (Enderlem, 1922)
T (Syntaeniaptera) volens Cresson, 1926 T (Pseudotaemaptera) strigata (Enderlein, 1922)
T (Syntaeniaptera) nigntarsis (Macquart, 1848)
Figure 3: The subgenera of Taeniaptera ai included species according to Albuquerque
(1986). ** - type species for the subgenus.
70 Micropeza (Micropeza) sp. 099 mm~ Micropeza (Micropeza) sp. 100 Micropeza (Neriocephalus) sp. 085 Micropeza (Neriocephalus) sp. 086 Ciyogonus formicarius 087 Globopeza venezuelensis 092 Globopeza venezuelensis 096 Taeniaptera tarsata 078 Taeniaptera tarsata 079 TiwyiHlpWW BlrtWfcl OPS rMriqriwfc»ta$I§r Scipopus (Phaeopterina) sp 095 WM«^^I«""'«" Scipopus sp. 11 1 3a99,r| Sripopus sp. 112 Poecilotylus paraguayensis 046 Poecilotylus trifasciatus 106 Poecitiotylus "2 FO no hd" 050 Plocoscelus nr. harenosus 065 acMs/i^^^^^-"™ Plocoscelus harenosus 057 MSQknw Plocoscelus nr. harenosus 069 Taeniaptera balzapambana grp 052 arazo^^j""^- Taeniaptera balzapambana grp 053 woowioi Taewipfwa'wteopwn&wwgrprjSI Taeniaptera khneumonea 043 Ptilosphen cyaneiventris 084 Calosphen auristrigosus 091 Grallipeza sp. 089 Grallipeza vicina 088 Hoplocheiloma totliana 104 Grallipeza sp. 090 ism/I d Grallipeza sp. BC 103 Taeniaptera albitarsis 017 Taeniaptera gratula 093 Taeniaptera gorgonae 007 Taeniaptera th'iemei 010 Taeniaptera albibasis 009 Taeniaptera angutata 001 27rai^^^™»™ Taeniaptera annulata 003 loowak— roenwp«ravu/gofo002 Taeniaptera "aliacea"020
Figure 4: Preferred tree for 12S parsimony analysis (tree length = 798, CI = 0.503, RI =
0.672). Numbers below nodes represent; bootstrap support/jackknife support/Total
Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Blue
- Paragrallomyia, Grey - Poecilotylus.
71 Micropeza (Micropeza) sp. 099 ^^ Micropeza (Micropeza) sp, 100 22/28/3 ^^^ Cryogonus formicarius 087 ^"^^^^^™" Micropeza (Neriocephalus) sp. 085 ioo/ioo/i6lni^ Micropeza (Neriocephalus) sp. 086 Poecilotylus (Hemichaeta) scutellatus 101 ioo/ioo/24f^» Taeniaptera tarsata 078 100/100/0 66/82/s | ^"™ Taeniaptera tarsata 079
80/88/1 s^_^^^™ Scipopus (Phaeopterina) sp. 095 99/100/12T " •™ Taeniaptera balzapambana grp 08\ 100/100/19 Taeniaptera balzapambana grp 109 Taeniaptera balzapambana grp 052 Grallipeza sp.BC 103 1/6/1 |__^^™ Grallipeza sp. 089 Grallipeza vicina 088 Calosphen auristrigosus 091 Scipopus sp. 111 Scipopus sp. 112 53/88/9 Grallipeza sp. 090 Ptilosphen cyaneiventris 084 Plocoscelus nr harenosus 1065 95/98/6 Plocoscelus nrharenosus2 069 Poecilotylus 2 FO no hd 050 Taeniaptera gratula 093 Poecilotylus paraguayensis 046 99/100/34 hMB Poecilotylus trifasciatus 106 Taeniaptera albitarsis 017 Taeniaptera khneumonea 043 Taeniaptera gorgonae 007 4/18/1 31 /4S/7 r"™ Taeniaptera thiemei 010 Taeniaptera albibasis 009 Taeniaptera angulata 001 Taeniaptera annulata 003 Taeniaptera vulgata 002
Figure 5: Preferred tree for COI HEB parsimony analysis (tree length = 1492, CI =
0.286, RI = 0.478). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera,
Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus.
72 f1""""" MicropezaMicroi (Micropeza) sp. 099 Micropeza (Micropeza) sp. 100 •••• Ciyogonus formicarius 087 100/100/01 00/100/20 •— Micropeza (Neriocephalus) sp. 085 Micropeza (Neriocephalus) sp. 086 100/100/20 24/38/31 ' Grallipeza sp. 090 • r Figure 6: Single most parsimonious tree for COI PJ parsimony analysis (tree length = 1737, CI = 0.341, RI = 0.518). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - 73 Micropeza (Micropeza) sp. 099 •••" Micropeza (Micropeza) sp. 100 irjo/100/40 •—a Micropeza (Neriocephalus) sp. 085 Micropeza (Neriocephalus) sp. 086 -Q Cryogonus formicarius 087 100/100/0 Scipopus (Phaeopterina) sp. 095 Taeniaptera tarsata 078 100/100/49 Taeniaptera tarsata 079 097 55/97/18 ramKgtfencrfaisefw Ig 098 0/3/2 Poecilotylus (Hemichaeta) scutellatus 101 Grallipeza sp. 089 13/S5/14I>MB Grallipeza vicina088 Taeniaptera gratula 093 70/100/46 Calosphen auristrigosus 091 9i/ioo/44p—•• poecilotylus paraguayensis 046 Poecilotylus trifasciatus 106 Scipopus sp. 111 65/99/261 Scipopus sp. 112 Grallipeza sp. 090 Grallipeza sp. BC103 Ptilosphen cyaneiventris 084 Plocoscelus nr. harenosus 065 Plocoscelus harenosus 057 0/24/5 Plocoscelus nr. harenosus 069 Taeniaptera batazapambana grp 109 Taeniaptera gorgonae 007 Taeniaptera thiemeiOW Taeniaptera albibasis 009 Taeniaptera angulata 001 Taeniaptera annulata 003 ioo/ioo/33»-BB»i Taeniaptera vulgata 002 Poecilotylus 2 FO no hd 050 Taeniaptera khneumonea 043 Taeniaptera albitarsis 017 Taeniaptera balzapambana grp 052 Taeniaptera balzapambana grp 053 9i /78/oBHMi Taeniaptera balzapambana grp 081 Figure 7: Preferred most parsimonious tree for total COI dataset parsimony analysis (tree length = 3304, CI = 0.308, RI = 0.483). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 74 1 Micropeza (Micropeza) sp. 099 91/95/5^—— Poecilotylus paraguayensis 046 > Poecilotylus trifasciatus 106 1 Taeniaptera khneumonea 043 37/49/2 ••••••• Taeniaptera tarsata 078 i Taeniaptera gorgonae 007 30/38/Qf—— Micropeza (Micropeza) sp. 100 i Taeniaptera th'iemei 010 ' Taeniaptera albibasis 009 so/ss/ilBBBMaa Taeniaptera angulata 00\ < Taeniaptera annulata 003 72/76/2 LBMI Taeniaptera vulgata 002 ' Grallipeza sp. 089 | Ptilosphen cyaneiventris 084 1 Plocoscelus nr. harenosus 065 1 Plocoscelus harenosus 05 7 62/60/1 !•••••• Plocoscelus nr. harenosus 069 '5c/poptM sp. 112 85/89/6 L-— Sc/pOpUS Sp. 111 1 Taeniaptera albitarsis 0\7 0/0/11 I ' C"o'osp/jen auristrigosus 091 T^TTOTTI f—— Grallipeza sp. 090 26/4i/2| Grallipeza sp. 8C 103 1 Globopeza venezuelensis 092 ioo/ioo/iolanBBBB Globopeza venezuelensis 096 ••••••• Cryogonus formicarius 087 ^5o7T| f^""— Taeniaptera balzapambana grp 052 5j^^5| P""""" Taeniaptera balzapambana grp 109 32/2o7fl IP—— Taeniaptera balzapambana grp 053 ai/80/3 laaaaaai jaeniaptera balzapambanagrp 081 Figure 8: Preferred most parsimonious tree for total wingless parsimony analysis (tree length = 498, CI = 0.574, RI = 0.643). Numbers above or below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Blue - Paragrallomyia, Grey - Poecilotylus. 75 1 Globopeza venezuelensis 092 | Globopeza venezuelensis 096 | Taeniaptera albitarsis 017 1 Calosphen auristrigosus 091 11/22/11 | " Grallipeza sp. 090 "/3sq| Grallipeza sp. BC 103 | Grallipeza sp. 089 1 Ptilosphen cyaneiventris 084 1 Plocoscelus nr. harenosus 065 1 Plocoscelus harenosus 057 Plocoscelus nr. harenosus 069 Taeniaptera tarsata 078 Taeniaptera gorgonae 007 Taeniaptera thiemei 0X0 Taeniaptera albibasis 009 49/58/1 laaHBBBB Taeniaptera angulata 001 Taeniaptera annulata 003 71/77/3 LMIB Taeniaptera vulgata 002 Taeniaptera balzapambana grp 052 Taeniaptera balzapambana grp 109 21/27701 |^"""™ Taeniaptera balzapambana grp 053 74/76/2laHHMB Taeniaptera balzapambana grp 081 Taeniaptera khneumonea 043 1726//2I f^— Poecilotylus paraguayensis 046 ^^•••••••B Poecilotylus trifasciatus 106 Scipopus sp. 112 Scipopus sp. 111 Figure 9: Preferred most parsimonious tree for wingless parsimony analysis with Micropeza and Cryogonus species removed (tree length = 430, CI = 0.593, RI = 0.667). Numbers above and below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Blue - Paragrallomyia, Grey - Poecilotylus. 76 ^—m* Micropeza (h(Micropeza) sp. 099 BH^J p"^" MicrofMicropeza (Micropeza) sp. 100 Cryogonus formicarius 087 ioo7ioo/ol 100/1 Globopeza venezuelensis 092 Globopeza venezuelensis 096 100/1100/5 Ptilosphen cyaneiventris 084 "•••• Poecilotylus paraguayensis 046 100/96/30 36/41/41—' Poecilotylus "2 FO no hd* 050 Taeniaptera khneumonea 043 75/80/7 •••••• Taeniaptera gratula 093 72/72/18 Poecilotylus (Hemichaeta) scutellatus 101 Taeniaptera tarsata 078 loo/loom""""— Poe-Taen sp. "Steve" 107 ramftpamimllrafeiOOS 0/28/4 afiMSrei. •****> fa«iqp8Bn»kKft«i094 mSSSna^B-J"'*" fiwiflqpi«fa Jtasdiw kg 098 ffffifllnHM ftKnidptefd teovo sm 097 Taeniaptera thiemei 010 Taeniaptera annulata 003 97/98/61 f^^™ Taeniaptera albibasis 009 47/5377^^^^™"™ Taeniaptera gorgonae 007 Taeniaptera angulata 001 Taeniaptera albitarsis 017 Plocoscelus nr. harenosus 065 Plocoscelus harenosus 057 Plocoscelus nr. harenosus 069 Taeniaptera balzapambana grp 052 100/99/221 f— Taeniaptera balzapambana grp 109 B4/9o71s,^__Jl,,,••"• Taeniaptera balzapambana grp 053 «W4—• Taeniaptera balzapambana grp 081 99/99/22fi«™» Grallipeza sp.089 52/44/9J IBM Grallipeza vicina 088 Grallipeza sp. 090 100/100/231— Grallipezasp. BC 103 Scipopus (Phaeopterina) sp. 095 ioo/ioo/i9i11-1J^— Scipopus sp. 111 97/99/11 ft—— Scipopus Sp. 112 Figure 10: Preferred most parsimonious tree for CAD parsimony analysis (tree length = 350, CI = 0.462, RI = 0.536). Numbers above and below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poec/Yo/j/ws'. 77 Micropeza (Micropeza) sp. 099 ^ Micropeza (Micropeza) sp. 100 Micropeza (Neriocephalus) sp. 085 Micropeza (Neriocephalus) sp. 086 Cryogonus formacarius 087 Globopeza venezuelensis 092 Globopeza venezuelensis 096 Taeniaptera thiemei 010 Taeniaptera angulata 001 Taeniaptera albibasis 009 Taeniaptera gorgonae 007 Taeniaptera vulgata 002 Taeniaptera annulata 003 Poecilotylus (Hemichaeta) scutellatus 101 Taeniaptera tarsata 078 Taeniaptera tarsata 079 PoeTaensp.'Steve* 107 racntyMeratrMriDniOOS TotntoptetatosdmOM Taeniaptera kadva sm 097 Toentopteru fcutmi Ig 098 Poecilotylus nn 2 FO no hd 050 Taeniaptera khneumonea 043 "•" Taeniaptera gratula 093 Taeniaptera albitarsisOl 7 Taeniaptera "aliacea" 020 Plocoscelus nr. harenosus 065 Plocoscelus harenosus 057 Plocoscelus nr harenosus 069 Ptilosphen cyaneiventris 084 Hoplocheiloma totliana 104 Poecilotylus paraguayensls 046 Poecilotylus trifasciatus 106 J"""""••••••••••••• Taeniaptera balzapambana g\p 052 Taeniaptera balzapambana 109 Taeniaptera balzapambana grp 053 Taeniaptera balzapambana grp 081 J^• Grallipeza vicina 088 ^—"•"•"i""™^^^^^"™"" Grallipeza sp. 089 Calosphen sp. 091 ' Grallipeza sp. 090 1 Grallipeza sp, BC103 ' Scipopus (Phaeopterina) sp. 095 1 Scipopus sp. 111 1 Scipopus sp. 112 I I III I I I Ml II I II I ll II I I I I ! I I l! II I I I III ll I I I I I I I lllll Mil I I I I I I I I! I : I I 6000 5000 4000 300 0 200 0 1000 00 Figure 11: Phylogram of preferred most parsimonious tree with branches proportional to lengths. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 78 1 Micropeza (Micropeza) sp. 099 1 Micropeza (Micropeza) sp. 100 1 Micropeza (Neriocephalus) sp 085 1 Micropeza (Neriocephalus) sp 086 1 Cryogonus formicarius OS7 Globopeza venezuelensis 092 Globopeza venezuelensis 096 Taeniaptera thiemei 010 100/100/4 JI too/ioo/47^— Taeniaptera anguhta 001 Taeniaptera albibasis 009 70/80/38 I^^J~,,,I^ Taeniaptera gorgonoe 007 33/27/35 ^^SsefctMB^^^^^^""""" Taeniaptera vulgata 002 ,oo7i(w48l™^« Taeniaptera annulata 003 Poedlotylus (Hemichaeta) scutellatus 101 ioo/w/4ol^^— roerwaptera farjafa 078 72/70/361 I"""1™T—.Jr™^"™ Taeniaptera tarsata 079 Poe Taen sp. "Steve" 107 JO/16/34 F S2/80/40 Poedtofy/us"nn2FOnohd"050 Taeniaptera khneumonea 043 12/21/33 • Taeniaptera gratula 093 Taeniaptera albitarsis 017 Taeniaptera "aliacea" 020 Plocoscelus nr. harenosus 065 Plocoscelus harenosus 057 10o/loo/53•ll,lll,,,ll•,• Plocoscelus nr. harenosus 069 Ptilosphen cyaneiventns 084 Hoplocheiloma totliana 104 Poecilotylus paraguayensis 046 Poecilotylus trifasdatus 106 Taeniaptera balzapambana grp 052 Taeniaptera bahzapambana 109 Taeniaptera balzapambana grp 053 100/100/39 • Taeniaptera balzapambana grp 081 Grallipeza vicina 088 Grallipeza sp. 089 Catospftensp.091 Grallipeza sp. 090 B9/82/M^™^» Grallipeza sp. BC 103 Scipopus (Phaeopterina) sp. 095 100/97/39^^^ SopOpUJ sp. 111 100/100/46™^^"" Scipopus sp. 112 Figure 12: Preferred most parsimonious tree for combined data set including all genes examined (tree length = 8046, CI = 0.399, RI = 0.516). Numbers above and below nodes represent; bootstrap support/jackknife support/Total Bremer support. Numbers after species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 79 Figure 13: Preferred most parsimonious tree for combined data set including all genes examined (tree length = 8046, CI = 0.399, RI = 0.516). Values below branches are partitioned Bremer supports in the following order; 12S/COI HEB/COI PJ/WING/CAD. Numbers following species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 80 1.00 0.90 12S COI HEB COI PJ COI Total Wing CAD Data Partitions Figure 14: Congruent Topology Information (CTI) of data partitions (using strict consensus tree) when compared to total evidence strict consensus tree and adjusted for number of species represented compared to total evidence analysis. 81 Figure 15: Majority Rule Consensus tree from Bayesian analysis of complete dataset. Numbers at nodes are posterior probabilities. Numbers following species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 82 Figure 16: Majority Rule Consensus tree from Bayesian analysis of complete dataset with 3rd codon positions of nuclear coding genes removed. Numbers at nodes are posterior probabilities. Numbers following species names are unique specimen identifiers. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 83 Micropeza (Micropeza) sp. Globopeza venezuelensis Calosphen auristrigosus 100 Grallipeza vicina Plocoscelus harenosus Scipopus (Phaeopterina) sexguttatus 83 Taeniaptera aliacea Taeniaptera albitarsis Taeniaptera thiemei 81 Taeniaptera angulata 10 10 Taeniaptera annulata 16 Taeniaptera albibasis Taeniaptera gorgonae 67 Poecilotylus trlfasciatus Poecilotylus paraguayensis 18 Taeniaptera khneumonea Ptilosphen cyaneiventris Poecilotylus (Hemichaeta) scutellatus Hoplocheiloma totliana Taeniaptera balzapambana Scipopus limbativertex Taeniaptera tarsata Tacntapttra lasciva TtmtaptewtrMttaiaAi. Taerttapt&a trMttata SC Figure 17: Unweighted morphological parsimony analysis strict consensus tree (2 most parsimonious trees, length = 584, CI = 0.357, RI = 0.452). Numbers above nodes are bootstrap supports, numbers below nodes are Bremer supports. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 84 Micropeza (Micropeza) sp. Globopeza venezuelensis Scipopus (Phaeopterina) sexguttatus Hoplocheiloma fabricii Poealotyius (Hemichaeta) scutellatus Taeniaptera balzapambana Scipopus limbauvertex Plocoscelus harenosus Taeniaptera khneumonea Ptilosphen cyaneiventris Calosphen auristrigosus Poecilotylus Wasciatus Poecilotylus paraguayensis Taeniaptera aliacea Grallipeza vkina Taeniaptera albitarsis Taeniaptera tarsata ToBniaptBokBOifa 93 i TatntytoMtiMttoktNL TaenkjUMMsataSC Taeniaptera gorgonae Taeniaptera internet Taeniaptera albibasis Taeniaptera annulata Taeniaptera angubta Figure 18: Implied weighting morphological parsimony analysis tree (length = 50.55, CI = 0.352, RI = 0.442). Numbers above nodes are bootstrap supports, numbers below nodes are Bremer supports. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 85 Micropeza (Micropeza) sp. 099 Micropeza (Micropeza) sp 100 Micropeza (Neriocephalus) sp. 086 Micropeza (Neriocephalus) sp. 085 Cryogonus formicarius 087 Globopeza venezuelensis 096 dobopeza venezuelensis 092 — raen«qpterat/ifeme/010 Taeniaptera albibasis 009 Taeniaptera angulata 001 Taeniaptera gorgonae 007 Taeniaptera annulata 003 Taeniaptera vulgata 002 Poeetiotylus (Hemichaeta) scutellatus 101 WiM[ Taeniaptera tarsata 079 """"I I Poe-Taen sp. "Steve" 107 Taeniaptera tarsata 078 ficnfe|Neral9Kha«n097 Taeniaptera gratuh 093 Taeniaptera ichneumonea 043 ftjedtoryfcs "nn 2 FO no hd" 050 Poeafor>^fnfasddrus106 ft)ector>*KparpguiyerisK046 Taeniaptera "atacea" 020 Taeniaptera albitarsus 017 Ptilosphen cyaneiventris 084 Plocoscelus nr. harenosus 065 Plocoscelus nr. harenosus 069 Plocoscelus harenosus 057 &affipezasp.BC103 GraWtpezasa. 090 Cafospfiensp. 091 Gra///pezosp.089 Grallipeza vkina 088 Hoplocheiloma totliana 104 Scipopus (Phaeopterina) sp. 095 Scipopus sp. 112 Scpqpus sp. 111 Taeniaptera balzapambana grp 052 Taeniaptera batzabambana 109 Taeniaptera balzapambana grp 081 Taeniaptera balzapambana grp 053 Figure 19: Combined total evidence parsimony analysis including molecular and morphological character data. Preferred tree of 3 most parsimonious trees (length = 8686, CI = 0.393, RI = 0.507). Numbers above nodes represent bootstrap supports/jackknife supports, numbers below nodes represent Bremer supports. Coloured boxes represent new generic combinations: Red - Taeniaptera, Green - Grallomyia, Yellow - Hemichaeta, Blue - Paragrallomyia, Grey - Poecilotylus. 86 Stapes fstaspKiiifi'8 HIH * *tl»*«»»M<» Stoapss$™ef>WiJiss! 0 OfagstwktmmiW t"«o1iR fJsiam $prt taoloftefffenitliMrtiaafeM 161 «F .•I. tmeptmmtklgl Pw*l)fe «f JK>wW*» * AtaK4SiSf*eWiBS«5 — — &«%»$ & MS »*•" C«fep*Rs»s091 «uf ™i &#efimo»86! #y */ !(.»(!»If. Hi <«»«, iSfCfMip.lli >i*|ft< f«wpw Wjpisiiiiw jip»f Figure 20: Combined total evidence parsimony analysis including molecular and morphological character data. Preferred tree of 3 most parsimonious trees (length = 8686, CI = 0.393, RI = 0.507). Boxes represent morphological characters (character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species. 87 Micropeza (Micropeza) sp.®9 Micropeza (Micropeza) sp. 100 I 2 3 4 111318222745 49 M 62 67 717475 8087 899197 •••••LIOOIIIIIIIflllBII 0203O2012004232000OOI0 JWcropezfl (Neriocephalus) sp. 086 -- - Micropeza (Neriocephalus) sp.WS Cryogonus fotmicotius 087 187174 808791 Globopeza venezuelensis 0% •DDOOOd 2 1 4 1 3 }! — Globopeza venezuelensis 092 16 45 no 2 1 1113 27 71 MCHS— 1110 136067 75 Mil OS21 4960 -#rn 1 2 •J 3II 226I2 0 10 0 Figure 21: Expanded view of Figure 20. Boxes represent morphological characters (character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species. 88 taiopfera (tow? 010 "-flfloooSB-- IL0 — • fowpteraflngafotflOQl Tamkpteiagoiqome 007 t"32>?) r - foen/apfera omufofo 003 ••UK ' • Ffleniapfefa viz/gate 002 rffl| Poetifoiyte (Hmichseta) scufeftrtus 101 *¥ ?4 H V? •ORO OOOO ( i 1 3 Poe-Taert sp. 'Steve* 107 heniapteiatamtodli •on Taeniaptera friV/totoAL ToenwpreratfiVirtfltoOOS i 2 Fom»pteralo5dwi094 7 ISO ~WM»- Taeri/apferG lascw Ig 098 feiMpferfltecffosniOW 'era iflffflo Taetiiaptm khneumonea 043 t—— Poecktyius "ret 2 FO no hd" 050 nam I? Poetik^tifaaatmM •iffih-i 2 13 | 112? 74*1 Faenioptera "daces'020 , OOOO-- TamptetotMcmW UfiflfjpffiJ1 t I S HflospknqomimtrisIM § 2 !M M 1 1 3 r%ostttenr.toraMji«065 f J imiS22J?8J83 3 1 «!11 J 32 r - »%osceli7snr.fe«/)osuj069 • /tacete itonosus 057 Figure 22: Expanded view of Figure 20. Boxes represent morphological characters (character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species. 89 Taeniaptera gratulaWl 60 7113 80 87 91 T . . . , „., 27 45 75 97 "QDOO oo a D a D Taeniaptera Khneumonea 043 1110 Poec;7ory/u13 s "nn 2 FO no hd" 050 116789 r-O- DC-O Poecilotylus trifasciatus 106 2 1 3 Poecilotylus paraguayensis 046 4,345606771 'WW ^to'ofiKBa'020 2 2" °' ac-aa - Taeniaptera albitarsis 017 : I 3 I 4 1127 7174 75108789 p_WDDnna_> Ptilosphen cyaneiventris 084 12 0 111113 — Plocoscelus nr, harenosus 065 ! 2II131822276CS9 •UMUUUUQ' ] I 112 12 3 2 - P/occscetenr. itonosus 069 Plocoscelus harenosus %7 Grallipeza sp. KM Grallipeza sp. 090 ! 4 188087 •OBOBO Ca/osp/ien sp. 091 0 0 2 2 2 Grfpezflsp.089 4 1327608991 ...... „ 62 r HkV- n 1874 75 8991 kjuaooo Grallipeza vianaM -DODGD- 13 12 2 Hoplocheiloma18 97 fot/iana 104 i Qd 2 22 27 71 2 0 HJDOO— 4 2745 Scipopus (Pnoeopfer™) sp. 095 1111 HK}Q 2 2 1 2 ll!!606?>48> •100000 Scipopus sp. 112 1167 808991 0 110 4 2 DDODO- 2 113 3 — -- Scipopus sp. 111 131860627487 Taeniaptera balzapambana grp 052 £H30»DO 2 2 2 0 11 Taeniaptera balzapambana 109 Taeniaptera balzapambana grp 081 Taeniaptera balzapambana grp 053 Figure 23: Expanded view of Figure 20. Boxes represent morphological characters (character number above box, state number below box); solid box - unique synapomorphy. clear box - symplesiomorphy, X box - symplesiomorphous with autapomorphy for at least 1 species. 90 Nothyboidea -Tanypezidae Tanypezidae Cypselosomatidae • Neriidae Taeniapteridae —Taeniapteridae Taeniapterinae — Micropezidae Trepidariidae — Micropezinae — Micropezidae -Nerriidae -Calobatinae - Nerildae Aczel 1950 Aczel 1951 Hennig 1958 Pseudopomyzidae Nothybidae - Neriidae Cypselosomatidae Megamerinidae Calycopteryginae - Nerriidae — Diopsidae Cypseiostomatidae Calobatinae Megamerinidae Micropezidae —Taeniapterinae {including Neriinae) - Micropezinae - Micropezinae — Psilidae *£-— Eurybatinae {including Tanypezinae & '"*• Metopochetus -Caiobatinae Strongylophthalmyiinae) -Taeniapterinae D.K.McAlpine1966 Rohdendorf 1964/1974 D.K. McAipine 1974 • Neriidae Diopsoidea Heleomyzidae Calycopteryginae M icropezidae ....— Megamerinidae? Calobatinae — Neriidae -Cypselosomatidae Micropezinae — Neriidae Taeniapterinae —Eurybatini - Cypselosomatidae Pseudopomyzidae Micropezidae —-Metopochetini J.F. McAipine 1989 D.K. McAipine 1996 O.K. McAipine 1998 Figure 24: Higher classification of Micropezidae through the years. 91 Figure 25: Taeniaptera trivittata -A: head (lateral) displaying maxillary palpus. -B: head (anterior). -C: wing. -D: wing WIP. Abbreviations: Ar = arista; CI = clypeus; Ep = epicephala; FF = first antennal flagellomere; Fr = frontal; Mf = mesofrons; MP = maxillary palpus; OT = ocellar tnangle; Pc = paracephala; Pfc = paraface; Pfr = parafrontal. 92 Figure 26: Taeniaptera trivittata ($) -A: fore tarsomeres. -B: male genital fork. -C: general habitus. 93 Figure 27: Taeniaptera trivittata -A: male genitalia. -B: female genitalia. Abbreviations: AA = adeagal apodeme; ADi = apical distiphallus; Ba = basiphallus; BDi = basal distiphallus; Bu = bulb; Ce = cercus; Ej A = Ejaculatory apodeme; Ep = epandrium; HA = hypandnal apodeme; Hp = hypandrium; PD = pair spennathecal duct; PSp = paired spermatheca; SD = single spennathecal duct; SSp = single spennatheca; Va = vagina. 94 •••?f^*%'£?%;(}ff**<- .^^pf^,;^ T*^'- Figure 28: Taeniaptera lasciva -A: wing. -B: wing WIP. 95 Figure 29: Taeniaptera lasciva -A: head and thorax chaetotaxy. -B: head and fore tarsomeres. -C: male genital fork. 96 B Figure 30: Taeniaptera lasciva -A: general habitus (S). -B: live specimen ($), staged, Henri Pittier National Park, Venezuela. 97 - IV» •'•..'si. Figure 31: Taeniaptera lasciva -A: male genitalia. -B: female genitalia. 98 Figure 32: Taeniaptera nigriceps lectotype ($) -A: head, wing and thorax, displaying 4 dorsocentral bristles (photo by S. A. Marshall). -B: lateral habitus (photo by S. A. Marshall). 99 Figure 33: Taeniaptera nigriceps lectotype (§), left lateral habitus (photo by S.A. Marshall). 100 J Figure 34: Taeniaptera nigriceps lectotype (9), right lateral habitus (photo by S. A. Marshall). 101 ''•'•^^y^-.w .-v?*.* -v> r-i-^i .1$ ''•,< --\va ,ij> #^r Figure 35: Taeniaptera vulpes holotype, male (photo by S. A. Marshall). 102 4 "s-Sf*8 *%» Figure 36: Taeniaptera vulpes holotype, male (photo by S. A. Marshall). 103 *i IT f .ft- t * m > *-# •of"-* * * r m^ ^•^F 3Rr _. Figure 37: Taeniaptera vulpes holotype, male (photo by S. A. Marshall) 104 Figure 38: Taeniaptera knutsonii sp. nov. -A: wing. -B: wing WIP. -C: head displayinj mesofrontal spot and yellow frons (holotype, <$). 105 Figure 39: Taeniaptera knutsonii sp. nov. general habitus ($). 106 «HWP Figure 40: Taeniaptera knutsonii sp. nov. -A: male genitalia. -B: male ejaculatory apodeme. -C: female genitalia. 107 mk Figure 41: Taeniaptera longapilis sp. nov. -A: wing. -B: wing WIP. -C: hind femur illustrating knot-like swelling. 108 Figure 42: Taeniaptera longapilis sp. nov. holotype ($) -A: general habitus. -B: head and thorax displaying fore tarsomeres, mesofrontal spot and brown frons, and 2 dorsocentral bristles. 109 ,**. VI >. Figure 43: Taeniaptera promiscua sp. nov. holotype ($) -A: wing. -B: wing WIP. -C: hind femur displaying cylindrical apex. 110 Figure 44: Taeniaptera promiscua sp. nov. holotype (S) -A: general habitus. -B: fore tarsomeres. Ill Table 1: Taxonomy of species included in analyses. Subfamily Genus Species Micropezinae Cryogonus Cresson Cryogonus formicarius (Rondani) Micropeza (Micropeza) Meigen Micropeza sp. Micropeza (Neriocephalus) Micropeza sp. Enderlein Taeniapterinae Calosphen Hennig Calosphen auristrigatus Hennig Calosphen sp. Globopeza Marshall Globopeza venezuelensis Marshall Grallipeza Rondani Grallipeza vicina Hennig Grallipeza sp. Hoplocheiloma Cresson Hoplocheiloma totliana Gmelin Plocoscelus Enderlein Plocoscelus harenosus Cresson Plocoscelus sp. Poecilotylus (Hemichaeta) Poecilotylus (Hemichaeta) scutellata (Cresson) Hennig Poecilotylus (Poecilotylus) Poecilotylus (Poecilotylus) paraguayensis Hennig (Enderlein) Poecilotylus (Poecilotylus) trifasciatus (Wiedemann) Poecilotylus (Poecilotylus) sp. Ptilosphen Enderlein Ptilosphen cyaneiventris (Macquart) Scipopus (Phaeopterina) Frey Scipopus (Phaeopterina) sexguttatus Enderlein Scipopus (Phaeopterina) sp. Scipopus (Scipopus) Enderlein Scipopus (Scipopus) limbativertex Enderlein Scipopus (Scipopus) sp. Taeniaptera Macquart Taeniaptera albibasis (Enderlein) Taeniaptera albitarsis (Enderlein) Taeniaptera aliacea Albuquerque Taeniaptera angulata (Loew) Taeniaptera annulata (Fabricius) Taeniaptera balzapambana (Enderlein) Taeniaptera gorgonae Hennig Taeniaptera gratula Steyskal Taeniaptera ichneumonea Brauer Taeniaptera lasciva (Fabricius) Taeniaptera tarsata (Wiedemann) Taeniaptera thiemei (Enderlein) Taeniaptera trivittata Macquart Taeniaptera vulgata Hennig 112 Table 2: List of specimens examined for molecular study. Species Unique Verbatim Label Data ID Calosphen VEN, Estado Carabobo: Rancho Grande Trails 10o20'59"N, TAE091 auristrigosus 67o4l'04"W 1070m; ix-14/2008 E. Fisher Cryogonus CHILE: V Region, Olmue On dead branch w. leaves 22 Nov. 2006. TAE087 formicarius S.A. Marshall Globopeza VEN, Estado Carabobo: Portachuelo 10o20'51"N, 67o41'16"W TAE092 venezuelensis 1143m: ix-13-15/2008 M.D. Jackson Globopeza VEN, Estado Carabobo: Rancho Grande Trails 10o20'59"N, TAE096 venezuelensis 67o41'04"W 1070m; ix-14/2008 E. Fisher CR: San Jose, Tarrazu, San Carlos, Reserva Riosparaiso, Albergue Grallipeza sp. TAE089 Pecari, 405 m, 9o33'53'N 84o07'32"W, lo forest 22-26 Feb 2006, S.A. Marshall CR: Horquetas 12KNW Ran. Aves 700m 22-27-ii-05 S.A. Marshall Grallipeza sp. TAE090 Collected into 95% EtOH Grallipeza sp. Big & VENEZUELA: Estado Lara; Trail into Yacambu N.P. 9 41'59"N, 69 TAE103 Colourful (EC) 38'52"W 1904m, ix-05/2008 M.D. Jackson CR: Puntoscenas Peninsula Osa, Agua Buena 11/8/01 dung pitfalls, Grallipeza vicina TAE088 primary forest S.A. Marshall Peru: Madre de Dios: Los Amigos Biol. Stn 2-14 June 2006 Klymko Grallomyia tarsata TAE078 & Paiero Grallomyia tarsata TAE079 BOL: Heath River Wildlife Centre 25 Apr-11 May 2007 S.M. Paiero Hoplocheiloma TAE104 totliana CUBA: Santiago Botanical Garden 27 Nov 2005 S.A. Marshall Micropeza TAE085 VEN, Estado Lara: Creek near Sabana Grande 9o44'02"N, (Neriocephalus) sp. 69o40'06"W 1282m; ix-04/2008 M.D. Jackson Micropeza TAE086 VEN, Estado Lara: Sanare Gravel Pit; near river valley 9o49' 16"N, (Neriocephalus) sp. 69o37'33"W 964m; ix-08-2008 M.D. Jackson Micropeza Argentina: Jujuy: Calilegua National Park, Ranger Headquarters: TAE099 (Micropeza) sp. 12.xi.2008 23o42'00"S 64o52'00"W 1081m: J. Skevington Micropeza Argentina: Tucuman: Parque Sierra de SanJavier, RioMuerto trail; TAE100 (Micropeza) sp. sweeps; 666m 4.xi.2008: JF Gibson 26o47'16"S 65ol9'53"W Scipopus VEN, Estado Carabobo: Portachuelo 10o20'51"N, 67o41'16"W TAE095 (Phaeopterina) sp. 1143m: ix-13-15/2008 M.D. Jackson CR: San Jose, Tarrazu, San Carlos, La Virgen, 821 m, 9o34'50"N Plocoscelus harenosus TAE057 84o07'51"W, 2o forest, 25 Feb 2006, S.A. Marshall Plocoscelus nr. TAE065 CR: Osa San Pedrillo 13 Aug 2001 S.A. Marshall harenosus Plocoscelus nr. TAE069 CR: Puntarenas OSA, Agua Buena 11.8.01 Dung Pans M. Buck harenosus Poecilotylus (Hemichaeta) TAE101 CR: Dominical Hacienda Baru 22 Feb 08 S.A. Marshall scutellatus Poecilotylus „. ,.,,„ ECU: Prov. Pichincha, Bellavista Cloud Forest Res. 0 1'13"S 78 TAE10T 9 balzababambana 40'30"W, 2200m, 9-13 May 2009 S.A. Marshall Poecilotylus Peru: Madre de Dios: Los Amigos Biol Stn, 2-14 vi 2006 S. Paiero & TAE052 balzapambana grp J. Klymko Poecilotylus CR: Horquetas 12KNW Rara Aves 700m 22-27-H-05 S.A. Marshall TAE053 balzapambana grp Collected into 95% EtOH Poecilotylus TAF081 CR: Honluetas !2K NW Rara Aves 700m 22-27-ii-05 S.A. Marshall balzapambana grp Collected into 95% EtOH 113 Table 3: Specimens examined list for molecular study. Species Unique Verbatim Label Data ID Poecilotylus CR: Puntarenas, Ecolodge, San Luis de Monteverde, 1-24 Mar 2007, TAE043 ichneumonea sendero espajito, malaise, P.D. Careless Poecilotylus- " 2 FO BOL: Depto. La Paz, Heath River Wildlife Centre, 12o40'S, TAE050 no hd" 68o42'W. 28 Apr-11 May 2007. S.A. Marshall Poecilotylus BOL: Depto. La Paz, Heath River Wildlife Centre, 12o40'S, TAE046 paraguayensis 68o42'W. 28 Apr-11 May 2007. S.A. Marshall Poecilotylus TAEl 06 trifasciatus CR: Dominical Hacienda Baru 22 Feb 08 S.A. Marshall Poe-Taen sp. "Steve" TAEl 07 CR: Dominical Hacienda Baru 22 Feb 08 S.A. Marshall Ptilosphen TAE084 VEN, Carabobo; Henri Pittier National Park, Portachuelo Pass cyaneiventris 13.ix.2008:10o20'51"N, 67o41'16"W J. Skevington 1143m ARGENTINA: JUJUY: Calilegua National Park, Ranger Scipopus sp. TAEl 11 Headquarters; 12-xi-2008 23 42'00"S 64 52'00"W 1081m J. Skevington CR: San Jose, Tarrazu, San Carlos, Reserva Riosparaiso, Albergue Scipopus sp. TAEl 12 Pecari, 405m, 9 33'53"N 84 07'32"W, primary, 22-26 Feb 2006, S.A. Marshall Taeniaptera "aliacea" BOL: Depto. La Paz, Heath River Wildlife Centre, 12o40'S, TAE020 group 68o42'W. 28 Apr-11 May 2007. S.M. Paiero BOL: Dipto. La Paz, Heath River Wildlife Centre, 12o40'S, 68o42'W. Taeniaptera albibasis TAE009 28 Apr-11 May 2007. S.A. Marshall Peru: Madre de Dios: Los Amigos Biol Stn, 2-14 vi 2006 S. Paiero & Taeniaptera albitarsis TAE017 J. Klymko Peru: Madre de Dios: Los Amigos Biol Stn, 2-14 June 2006 Klymko Taeniaptera angulata TAE001 & Paiero CR: Corcovado NP San Pedrillo Stn. 12-14/8/01 M. Buck Compost Taeniaptera annulata TAE003 Pans Taeniaptera gorgonae TAE007 CR: 1000m on road to Rios Paraisos 15 Apr 06 S.A. Marshall Taeniaptera gratula TAE093 PERU: Manu National Park x. 2006 J. Skevington Venezuela: Aragua: PN H. Pittier, RanchoGrande, Portachuelo: Taeniaptera lasciva TAE094 1143m: Malaise 10o20' 51"N, 67o41'16"W 13-14.ix.2008: E. Fisher, J. Skevington, M. Jackson Taeniaptera lasciva VENEZUELA, Estado Aragua: Overgrown yard near river TAE098 (large) 10o28'31"N 67o36'19"W 205m; ix-12/2008 M.D. Jackson Taeniaptera lasciva VENEZUELA, Estado Aragua: Overgrown yard near river TAE097 (small) 10o28'31"N 67o36'19"W 205m; ix-12/2008 M.D. Jackson Taeniaptera thiemei TAE010 CR: Rios Paraiso 12-15 Apr 06 S.A. Marshall USA: SC: Georgetown Co. Hobcaw Barony, Belle Baruch Marine Taeniaptera trivittata TAE005 Field Lab, S.A. Marshall Taeniaptera vulgata TAE002 NO LABEL DATA 114 Table 4: Oligonucleotide primers used for PCR amplication with original references and type of polymerase used for each. (S) - sense, (A) - antisense Gene Primer 3' Genbank Referenc Polyme Sequence (5'-most) Locus Name Location Acc.# e rase 12S (Simon et rRNA 12Sh GACCAAATTGGTGCCAGCAGT 14776 NC_001322 1 al, 1994) Taq (Simon et Tag 12Sbi AAGAGCGACGGGCGATGTGT NC001322 1 al,1994) (Folmer et COI Tag COI HEB F GGTCAACAAATCATAAAGATAT 1514 NC001322 1 af, 1994) (Folmer et Tag COI HEB R TAAACTTCAGGGTGACCAAAAAATCA 2173 NC_001322 1 al, 1994) (Simon et Tag COI PAT TCCAATGCACTAATCTGCCATATTA 3014 NC001322 1 al, 1994) (Simon et Tag COI JERRY CAACATTTATTTTGATTTTTTGG 2183 NC_001322 1 al,1994) 11404-11426 (Baker et white ExTaq (S) TGYGCNTATGTNCARCARGAYGA 11278 X02974 2 al,2001) 11975-11997 (Baker et ExTaq (A) ACYTGNACRTAAAARTCNGCNGG 11852 X02974 2 al, 2001) (Brower et wingless ExTaq LEP Wgl (S) GARTGYAARTGYCAYGGYATGTCTGG 1136 M17230 1 al, 1998) POMP (Pilgrim et ExTaq Wg2R ACTGCGCAGCACCAGTGGAATGTGCA 1774 M17230 1 al, 2008) 1099-1118 (Baker et ExTaq (S) GAAATGCGNCARGARTGYAA 1118 M17230 1 al,2001) 1597-1617 (Baker et ExTaq (A) ATTYTTTTCRCAAAARCTTGG 1617 M17230 1 al,2001) 1147-1166 (Baker et ExTaq (S) GTTAGAACWTGYTGGATGCG 1166 M17230 1 al, 2001) 1756-1775 (Baker et ExTaq (A) ACYTCRCARCACCARTGRAA 1775 Ml 7230 1 al, 2001) Wing-Dipt- Novel ExTaq 7430R CGACACCGATCGATGTGTC 1703 Ml 7230 1 Wing-Dipt- Novel ExTaq 6803F GCGTTTGGCTAACTTCCG 1181 Ml 7230 1 Wing-Dipt- Novel ExTaq 1505R CCRTGACGTCCNCGTCC 1505 M17230 1 Wing-Dipt- Novel ExTaq 1505F GGACGNGGACGTCARGG 1505 M17230 1 Wing-Dipt- Novel ExTaq 1393R RGATGCCGATCGTATG 1393 Ml 7230 1 115 Table 5 cont'd: Oligonucleotide primers used for PCR amplication with original references and type of polymerase used for each. (S) - sense, (A) - antisense Gene Primer 3' Genbank Polym Locus Name Sequence (5'-most) Location Acc.# Reference erase 28S (Bertone et rRNA rc28AB ACTACCCCCTGAATTTAAGCA 3334 M21017 1 al, 2008) Tag (Bertone et 28C GCTATCCTGAGGGAAACTTCGG 4431 M21017 1 al, 2008) Tag (Bertone et rc28B CCCGTCTTGAAACACGGACC 4067 M21017 1 al, 2008) Tag (Wiegmann 28P GGCTTACGCCAAACACTTCTAGGC 4913 M21017 1 et al, 2000) Tag (Wiegmann 28E CCTTATCCCGAAGTTACG 5513 M21017 1 et al, 2000) Tag (Wiegmann rc28D CCGCAGCTGGTCTCCAAG 5438 M21017 1 et al, 2000) Taq (Gibson et 281 GGGTCTTCTTTCCCCGCT 6047 M21017 1 al) Tag (Gibson et rc28F GTGATTTCTGCCCAGTGCTCTG 5846 M21017 1 al) Tag (Collins et 28Q AACTCCCTACCTGGCAAT 6406 M21017 1 al, 2002) Tag (Wiegmann rc28Q GGACATTGCCAGGTAGGGAGTT 6406 M21017 1 et al, 2000) Taq (Bertone et 28ZC TGGATCGCAGTATGGCAGCT 7202 M21017 1 al, 2008) Taq (Cho et al, EF-la M46 GAGGAAATYAARAAGGAAG 2582 X06869 1 1995) ExTaq (Cho et al, rcM4 ACAGCVACKGTYTGYCTCATRTC 3366 X06869 1 1995) ExTaq (Cho et al, M44-1 GCTGAGCGYGARCGTGGTATCAC 2277 X06869 1 1995) ExTaq 2284-2302 (Baker et al, (S) TATYGCTTTRTGGAAATTCG 2303 X06869 1 2001) ExTaq 2934-2954 (Baker et al, (A) CTTCGTGATGCATTTCAACGG 2954 X06869 1 2001) ExTaq 2477-2495 (Baker et al, (S) CTTGCTTTCACHTTGGGTG 2495 X06869 1 2001) ExTaq GGWGGWCAAACWGCWYTMAAYTGYG (Moulton et CAD 581F2 G 1507 X04813 1 al, 2004) ExTaq (Moulton et 843R GCYTTYTGRAANGCYTCYTCRAA 2393 X04813 1 al, 2004) ExTaq (Moulton et 806F GTNGTNAARATGCCNMGNTGGGA 2287 X04813 1 al, 2004) ExTaq (Moulton et 1124R CATNCGNGARAAYTTRAARCGATTYTC 3227 X04813 1 al, 2004) ExTaq (Moulton et 1057F GTNTCNACNGAYTAYGAYATGTG 3020 X04813 1 al, 2004) ExTaq (Moulton et 1278R TCRTTNTTYTTWGCRATYAAYTGCAT 3694 X04813 1 al, 2004) ExTaq 116 o Gene Primer Pair Initialization Denaturing Annealing Extension # of Cycles Final Extension Holding H o 94C - 3min 94C-• 3 min 54C -1 min 72C-• 2 min 35 72C - 5 min 10C 2 12S 12Shxl2SBi re 94C - 3min 94C-• 50sec 58C-50sec 72C-- lmin 39 72C - 5 min 10C er\ COI HEB HebFxHebR o £3 H 94C - 3min 94C-• lmin 50C - lmin 72C-• 2min 39 72C - 5 min 10C COI P J PatxJerry a- 3 • 1.5min 35 white 11404x11975 94C - 3min 94C-• lmin 47C - lmin 72C- 72C - 5 min 10C o P 28S rc28ABx28C 95C - lmin 95C-• lmin 64C-1.5min 72C-• 2min 35 72C - 5 min 10C o rc28Bx28E 95C - lmin 95C-• lmin 54C-1.5min 72C-- 2min 35 72C - 5 min 10C cr B P a rc28Px28E 95C - lmin 95C-• lmin 54C-1.5min 72C-- 2min 35 72C - 5 min 10C o o rc28Dx28I 95C - lmin 95C-• lmin 54C-1.5min 72C-• 2min 35 72C - 5 min 10C o rc28Fx28Q 95C - lmin 95C-• lmin 54C-1.5min 72C-• 2min 35 72C - 5 min 10C rc28Qx28ZC 95C - lmin 95C-• lmin 54C-1.5min 72C-• 2min 35 72C - 5 min 10C CD EF-la M46xrcM4 94C - 2min 94C-• lmin 54C - 1.5min 72C-• 2min 35 72C - 5 min 10C P M44xrcM4 94C - 3min 94C-• lmin 52C-1.5min 72C-• 2min 35 72C - 5 min 10C O 2284x2934 95C - 2min 95C-• lmin 54C-1.5min 72C-• 2min 35 72C - 5 min 10C 2477x2934 94C - 3min 94C-• lmin 52C-1.5min 72C-• 2min 35 72C - 5 min 10C i' wingless 1099x1597 94C - 3min 94C-• lmin 54C - lmin 72C-• 1.5min 35 72C - 5 min 10C 94C - 3min 94C-• lmin 54C - lmin 72C-• 1.5min 35 72C - 5 min 10C P_ 1147x1597 SI' 1147x1756 94C - 3min 94C-• lmin 54C - lmin 72C-• 1.5min 35 72C - 5 min 10C LepWglFxPompWg2R 94C - 3min 94C-• lmin 61C-lmin 72C-• 1.5min 35 72C - 5 min 10C CD 6803x7430 94C - 3min 94C-• lmin 61C-lmin 72C-• 1.5min 35 72C - 5 min 10C o 6803x7122R 94C - 3min 94C-• lmin 61C-lmin 72C-• 1.5min 35 72C - 5 min 10C > 6992x7122F 94C - 3min 94C-• lmin 55C - lmin 72C-• 1.5min 35 72C - 5 min 10C D 61C-lmin • 1.5min 35 7122Fx7430 94C - 3min 94C-• lmin 72C- 72C - 5 min 10C O CAD 581F2x843 94C - 4min 94C-• 0.5min 52C-0.5min 72C-• 2min 5 94C-• 0.5min 51C-lmin 72C-• 2min 5 3' 94C-• 0.5min 45C-0.5min 72C-• 2.5min 40 72C - 3min 10C o 806x1124 94C - 4min 94C-• 0.5min 52C-0.5min 72C-• 2min 5 a5 * 94C- 0.5min 51C - lmin 72C-• 2min 5 94C-• 0.5min 45C-0.5min 72C-• 2.5min 40 72C - 3min 10C 1057x1278 94C - 4min 94C-• 0.5min 52C-0.5min 72C-• 2min 5 3 94C-• 0.5min 51C-lmin 72C-- 2min 5 » 94C-• 0.5min 45C-0.5min 72C-• 2.5min 40 72C - 3min 10C 3' CTQ Table 7: Akaike Information Criterion models selected for Bayesian analysis. Negative log-liklihood (Ant), number of estimated (free) parameters (K), and Akaike Information Criterion (AICC) are provided. Gene Selected , „ ,_ . T„ T i»» J i -Int K AICC Locus Model 12S GTR+I+G 4101.54 10 8223.09 S91 HKY+I+G 6620.73 6 13253.49 tihiii COIPJ GTR+I+G 7603.54 10 15227.08 wingless K80+I+G 3125.49 3 6256.98 CAD GTR+I+G 16504.53 10 33029.06 118 Table 8: Specimens examined for morphological phylogenetic analyses Species Primary Male Alternate Male Primary Female Alternate Female Taeniaptera COLOMBIA COLOMBIA lasciva Vichada PNN El Vichada PNN El Tuparro Pie Cerro Tuparro Pie Tomas 5o21'N Cerro Tomas 67o51'W250m 5o21'N67o5rW Malaise 15/1/01 250m Malaise 5/12/01 I. Gil Leg. 15/1/01 5/12/01 I. M. 1793 Gil Leg. M. 1793 debud 048682 debuO1048682 Taeniaptera AL: Baldwin Co., AL: Baldwin Co., trivittata AL Byrnes Lk., Byrnes Lk., 30o47'24"N, 30o47'24"N, 87o54'36"W, 18 Jul 87o54,36"W, 18 2000, J.W. Jul 2000, J.W. McCreadie, McCreadie, debu00242167 debu00242166 Taeniaptera SC: Georgetown SC: SC: Georgetown trivittata SC Co., Hobcaw Georgetown Co., Hobcaw Barony, Belle Co., Hobcaw Barony, Belle Baruch Marine Barony, Belle Baruch Marine Field Lab, Crabhaul Baruch Marine Field Lab, Rd. nr. Picnic Rd., Field Lab, Crabhaul Rd. nr. 26 Apr-8 May 2004, Crabhaul Rd. Picnic Rd., 27 Marshall et al. nr. Picnic Rd., Apr 2004, D.K.B. 26 Apr-8 May Cheung, 2004, Marshall debu00232784 etal. Taeniaptera Peru: Madre de Peru: Madre de tarsata Dios, Los Amigos Dios, Los Amigos Biol. Stn., palm Biol. Stn., palm swamp, yellow swamp, yellow pans, 6-10 Jun pans, 6-10 Jun 2006, Paiero & 2006, Paiero & Klymko, Klymko, debu00279632 debu00279628 Taeniaptera ECU: Napo, Jatun ECU: Napo, angulata Sacha Res., 6 km Jatun Sacha E Misahualli, 450 Res., 6 km E m, 1o4'S, 77o37'W, Misahualli, 450 varzea, dung pans, m, 1o4'S, 2-7 May 2002, M. 77o37'W, varzea, Buck, dung pans, 2-7 debuOO187283 May 2002, M. Buck, debu00177951 119 Table 9 cont'd: Specimens examined for morphological phylogenetic analyses Taeniaptera COL: Cacua PNN COL: Cacua PNN annulata Gorgona, El Gorgona, El Saman, 2o58'N, Saman, 2o58'N, 78o11'W, 5m, 9-27 78o11'W, 5m, 9- Aug 2001, malaise, 27 Aug 2001, H.Torres, M.2120 malaise, H. Torres, M.2120 Taeniaptera COL: Cacua PNN COL: Cacua PNN gorgonae Gorgona, El Gorgona, El Saman, 2o58'N, Saman, 2o58'N, 78o11'W, 5m, 9-27 78o11'W,60m, 6- Aug 2001, malaise, 23 Oct 2000, H.Torres, M.2120 malaise, R. Duque, M.899 Taeniaptera BOL: La Paz, BOL: La Paz, albibasis Heath River Wildlife Heath River Centre, -21 km Wildlife Centre, SSW Puerto Heath, -21 km SSW 12o40'S68o42'W, Puerto Heath, 29 Apr-11 May 12o40'S 2007, M.D. 68o42'W, 29 Apr- Jackson, 11 May 2007, debu00289597 M.D. Jackson, debu00289595 Taeniaptera CR: San Jose, San CR: San Jose, thiemei Carlos, Riosparaiso San Carlos, Res., upper trail to Riosparaiso Res., Rio Negro, 1o Pecari Stn., 16km forest, 26 Feb NNE Quepos, 2006, S.M. Paiero, 9o33'35"N, debu00256639 84o7'32"W, 400m 12-15 Apr 2006, S.A. Marshall, debu00258115 Taeniaptera Peru: Madre de Peru: Madre de albitarsis Dios, Los Amigos Dios, Los Amigos Biol. Stn., palm Biol. Stn., palm swamp, yellow swamp, yellow pans, 6-10 Jun pans, 6-10 Jun 2006, Paiero & 2006, Paiero & Klymko, Klymko, debu00279645 debu00279629 120 Table 10 cont'd: Specimens examined for morphological phylogenetic analyses Taeniaptera BOL: La Paz, BOL: La Paz, aliacea Heath River Wildlife Heath River Centre, -21 km Wildlife Centre, SSW Puerto Heath, -21km SSW 12o40'S68o42'W, Puerto Heath, 29 Apr-12 May 12o40'S 2007, S.A. 68o42'W, 29 Apr- Marshall, 12 May 2007, debu00282047 S.A. Marshall, debu00282186 Micropeza Argentina: Jujuy: Argentina: Jujuy: (Micropeza) sp. Calilegua National Calilegua Park, Ranger National Park, Headquarters: Ranger 12.xi.2008 Headquarters: 23o42'00"S 12.xi.2008 64o52'00"W 23o42'00"S 1081m: J. 64o52'00"W Skevington 1081m: J. Skevington Grallipeza COSTA RICA: COSTA RICA: vicina Heredia: Estac. Heredia: Estac. Biol. La Selva 1 Biol. La Selva 15 Nov. 1993 ALAS October 1993 mal. Trap: ALAS mal. Trap: M/01/248 M/05/240 Calosphen VEN: Estado Venezuela: auristrigosus Carabaibo: Rancho Aragua Rancho Grande Trails Grande Biol.Stn, 10o20'59"N H.PittierN.Pk. 67o41'04"W 1070m 1400m, ix-14/08 E. Fisher LaCucumbre, 8.iii.1995, S.Marshall Globopeza VENEZUELA, VENEZUELA, venezuelensis Estado Carabaibo: Estado Portachuelo Carabaibo: 10o20'51"N, Portachuelo 67o41'16"W 1143m 10o20,51"N, ix-13-15/2008 M.D. 67o41'16"W Jackson 1143m ix-13- 15/2008 M.D. Jackson 121 Table 11 cont'd: Specimens examined for morphological phylogenetic analyses Scipopus VENEZUELA: (Phaeopterina) Aragua: Henri sexguttatus Pittier Nat. Park: Pico Periquito: 1680m, Malaise- trap, 15- 30.xi.1997T. Pape leg. Scipopus CR: Heredia, Santo CR: Heredia, (Scipopus) Domingo, INBio Santo Domingo, limbativertex Pk., 19-21 Aug INBio Pk., 19-21 2001, S.A. Aug 2001, S.A. Marshall, Marshall, debuOOl68311 debuOOl68297 Plocoscelus COSTA RICA: COSTA RICA: COSTA RICA: harenosus Puntarenas San Estrella Valley, Estrella Valley, Gerardo, 1200m Pandora Pandora sweep in banana 16.iii.1984, FIT 16.iii.1984, FIT grove 15.xii.1994 GVManley & GVManley & D.C. Caloren HFHowden HFHowden Ptilosphen BarroCololsl CZ PAN. Panama, cyaneiventris v.23.26 CTGreene Barro Colorado I. Collector 16-23 Oct 1996, J. Pickering, debu00256900 Hoplocheiloma Cuba: Gran Piedra, CUBA: Santiago totliana pans behind de Cuba station, 23 Nov Biological Garden 2005, S.A. xi.2005, coll. SA Marshall, Marshall debu00262916 Taeniaptera CR: Puntarenas, CR: Puntarenas, ichneumonea Monteverde, San Monteverde, San Luis Ecolodge, 1-7 Luis, 1000- Apr 2005, P.D. 1350m, malaise Careless, trap, Jan 1993, Z. debu00256776 Fuentes, debuOOl38156 122 Table 12 cont'd: Specimens examined for morphological phylogenetic analyses Poecilotylus BOL: La Paz, BOL: La Paz, paraguayensis Heath River Wildlife Heath River Centre, -21 km Wildlife Centre, SSW Puerto Heath, -21 km SSW 12o40'S68o42'W, Puerto Heath, 29 Apr-12 May 12o40'S 2007, S.M. Paiero, 68o42"W, 29 Apr- debu00281716 12 May 2007, S.A. Marshall, debu00282131 Poecilotylus CR: Prov. CR: Prov. (Hemichaeta) Puntarenas, Puntarenas, scutellatus Hacienda Baru de Hacienda Baru Dominical Reserve, de Dominical 2 km N, 22-25 Feb Reserve, 2 km N, 2008, S.A. 22-25 Feb 2008, Marshall, S.A. Marshall, debu00294622 debu00294673 Poecilotylus CR: Prov. CR: Prov. trifasciatus Puntarenas, Puntarenas, Hacienda Baru de Hacienda Baru Dominical Reserve, de Dominical 2 km N, 22-25 Feb Reserve, 2 km N, 2008, S.A. 22-25 Feb 2008, Marshall, S.A. Marshall, debu00294610 debu00294591 Taeniaptera ECU: Prov. ECU: Prov. balzapambana Pichincha, Pichincha, Bellavista Cloud Bellavista Cloud Forest Res., Forest Res., 0o1'13"S 0o1'13"S 78o40'30"W, 78o40"30"W, 2200m, 9-13 May 2200m, 9-13 May 2009 S.A. Marshall 2009 S.A. Marshall 123 Table 13: Morphological Character list for the Taeniapterinae CHARACTER DESCRIPTION Char. 1 = ARISTA 0 = bare 1 = pubescent 2 = plumose 3 = pectinate Char. 2 = CLYPEUS 0 = long, swollen 1 = narrow and abbreviated 2 = almost absent Char. 3 = FACE 0 = bare 1 = hairy Char. 4 = FRONTAL 0 = bare 1 = sparsely setulose on lateral edges 2 = densely setulose 3 = sparsely setulose over entire surface Char. 5 = MESOFRONS 0 = unicolourous 1 = anterior region darkened 2 = posterior region darkened 3 = area around ocellar triangle lighter Char. 6 = MESOFRONS 0 = bare 1 = densely tomentose 2 = posterior region tomentose 3 = FV laterally tomentose, posterior densely tomentose Char. 7 = MESOFRONS SPOT 0 = triangular 1 = oval 2 = teardrop 3 = diamond 4 = arrowhead 5 = elongated (pencil-like) 6 = reduced Char. 8 = HEAD SHAPE 0 = as long as high 1 = longer than high 2 = higher than long Char. 9 = LOWER ORBITALS 0 = two 1 = one 124 Table 14 cont'd: Morphological Character list for the Taeniapterinae Char. 10 = LUNULE 0 = broad, antennae clearly separated 1 = narrow, antennae separated by less than 0.5 scape Char. 11 = MAXILLARY PALPUS MARGIN 0 = uniform 1 = with ventral white band 2 = with apical white band/area Char. 12 = MAXILLARY PALPUS DEPTH 0 = flattened 1 = cylindrical 2 = reduced Char. 13 = MAXILLARY PALPUS SHAPE 0 = parallel-sided 1 = triangular 2 = ovular (not parallel-sided, not triangular) Char. 14 = MESOFRONS to 0 = >1 PARAFRONTAL WIDTH at anterior margin 1 = 1 Char. 15 = OCELLAR PLATE 0 = raised and protruding above frons 1 = flush with frons Char. 16 = OCELLAR TRIANGLE 0 = unicolourous with mesofrons spot 1 = darker than mesofrons spot Char. 17 = POSTVERTICAL BRISTLES 0 = present 1 = absent Char. 18 = SCAPE APICOVENTRAL 0 = present BRISTLE 1 = absent 2 = more than one present Char. 19 = SCAPE APICOVENTRAL 0 = absent BRISTLE 1 = shorter than first flagellomere 2 = as long or longer than first flagellomere Char. 20 = EPICEPHALA 0 = subopaque 125 1 = shining Table 15: Morphological Character list for the Taeniapterinae Char. 21 = FORE BASITARSOMERE 0 = white 1 = white distally, dark basally 2 = other Char. 22 = FORE TARSOMERES 2-4 0 = all white 1 = all dark Char. 23 = FORE TIBIA 0 = cylindrical 1 = sulcated on at least basal half 2 = weakly sulcated (only trace of sulcation, less than 1/2 sulcated) Char. 24= HIND FEMUR 0 = swollen at base 1 = only swollen distally 2 = N/A Char. 25 = HIND TIBIA 0 = cylindrical 1 = flattened and sulcate on at least basal 1/2 2 = strongly expanded Char. 26 = HIND TIBIAL BRISTLES 0 = paired 1 = widely separated 2 = single 3 = most paired, some single 4 = absent 5 = basal half singles, apical half paired 6 = most single, some paired Char. 27 = MID AND HIND FEMUR 0 = white rings bare 1 = white rings with black setae present in them 2 = white rings absent Char. 28 = MID AND HIND FEMUR 0 = subcylindrical 1 = swollen 2 = mid subcylindrical, hind swollen 126 Table 16: Morphological Character list for the Taeniapterinae Char. 29 = MID COXA 0 = with only stout black ventral bristles 1 = with ventral bristles and long fine yellow bristles along most of anterior surface 2 = with ventral bristles and long fine black bristles on anterior surface 3 = all fine yellow Char. 30 = MID TIBIA 0 = distal fringe of bristles short, at most one or two longer bristles 1 = distal fringe bristles all extremely long and thick Char. 31 = VENTRAL 0 = 0 KATEPISTERNAL BRISTLES 1 =1 2 = 2 3 = more Char. 32 = ACROSTRICHAL BRISTLES 0 = absent 1 = short 2 = medial length Char. 33 = ANEPISTERNUM 0 = almost bare 1 = with posterior and ventral bristles 2 = bristles present in anterior third Char. 34 = ANTERIOR HUMERAL 0 = absent BRISTLES 1 = multiple fine longer bristles 2 = short bristles Char. 35 = CERVICAL SCLERITES 0 = normal 1 = conspicuously inflated Char. 36 = DORSOCENTRAL SETAE 0 = absent 1 = short 2 = medium Char. 37 = KATEPISTERNAL BRISTLE 0 = all black ROW 1 = anterior row short and golden 2 = ventral bristles golden and long 3 = all yellow 4 = reduced to single bristle 127 Table 17 cont'd: Morphological Character list for the Taeniapterinae Char. 38 = POSTERIOR CALLUS 0 = bare other than postalar bristles 1 = with fine setae around the postalar bristle 2 = with fine setae and black, short well developed bristles Char. 39 = POSTERIOR HUMERAL 0 = absent BRISTLES 1 = present Char. 40 = POSTERIOR SPIRACLE 0 = fringed with white setae 1 = fringed with black setae 2 = absent? Char. 41 = POSTPRONOTAL BRISTLE 0 = absent 1 = well developed 2 = weakly developed Char. 42 = POSTPRONOTAL SETAE 0 = absent 1 = posterior 2 = anterior Char. 43 = PROEPISTERNUM 0 = with black anterior bristles 1 = bare 2 = with fine setae Char. 44 = SCUTELLUM 0 = bare other than scutellar bristles 1 = fine setae arising on outer third between scutellar bristles and along lateral edges 2 = setae present at middle of scutellum 3 = two arranged setae per side 4 = long (-1/2 length of scutellar bristles) setae covering most of dorsal surface 5 = 4 long (-1/2 length of scutellar setae) along lateral 1/3 line Char. 45 = ANAL CELL 0 = bare membrane 1 = entirely setulose Char. 46 = BM-CU 0 = even with anal cell 1 = before CuA2 2 = beyond CuA2 3 = absent 128 Table 18 cont'd: Morphological Character list for the Taeniapterinae Char. 47 = BM-CU 0 = thick only on posterior half 1 = evenly thickened 2 = absent Char. 48 = CALYPTERAL COMB 0 = setae all the same colour 1 = setae darker basally 2 = setae darker apically 3 = n/a Char. 49 = CELL r4+5 0 = open to wing margin 1 = closed, sometimes close to wing margin Char. 50 = COSTAGIAL BRISTLE 0 = none 1 = one long bristle 2 = 2 ventral bristles, 1 dorsal bristle 3 = 1 ventral bristle, 1 dorsal bristle 4 = 3 ventral bristles, 1 dorsal bristle Char. 51 = LAST SECTOR OF R4+5 0 = recurved 1 = straight Char. 52 = LIMIT OF FIRST COSTAL SECTOR 0 = before Ma 1 = equal with Ma Char. 53 = PTEROSTIGMA 0 = developed 1 = vestigial Char. 54 = R1 0 = bare 1 = with long setae beyond divergence from R2+3 Char. 55 = R1 & Sc 0 = widely divergent, separated by 3X width of R 1 = close distally 2 = fused Char. 56 = R1 near joint with Costa 0 = bare 1 = with small black bristle Char. 57 = R2+3 0 = vestigial at meeting of R1 1 = strong to meeting of R1 129 Table 19 cont'd: Morphological ( list for the Taeniapterinae Char. 58 = R4+5 ventral 0 = bare 1 = with small black bristles near base 2 = with single fine seta? Char. 59 = STUMP VEIN CuP 0 = absent 1 = present (anal cell) Char. 60 = SUBALAR SCLERITE 0 = small, dorsoventrally compressed 1 = same shape as 0 but projecting laterally 2 = shape as 0 but projecting anteriorly 3 = dorsoventrally compressed, extending to a tip on anterior half 4 = conical Char. 61 = ULTIMATE SECTOR OF CUAn 0 = less than half as long as dm-cu 1 = equal to or greater than half as long as dm-cu 2 = as long or longer than dm-cu Char. 62 = VEIN A1+CUA2 0 = shorter than CuA2 1 = much longer (more than 3X) 2 = medial length (1X-3X) Char. 63 = VEIN H 0 = strong 1 = weak Char. 64 = WING MEMBRANE 0 = hyaline 1 = infuscated 2 = dark with hyaline spots 3 = hyaline with dark cross bands Char. 65 = WING VEINS 0 = black/dark brown 1 = light brown 2 = more than one colour Char. 66 = BASAL MASS OF 0 = all fine, yellowish hairs BRISTLES ON FIRST TERGITE 1 = yellowish hairs dorsally, strong black setae laterally 2 = fine yellowish hairs dorsally. socketed hairs laterality 3 = absent 130 Table 20 cont'd: Morphological Character list for the Taeniapterinae Char. 67 = POSTERIOR FRINGE OF 0 = all fine, yellowish hairs BRISTLES ON FIRST TERGITE 1 = most fine, yellowish hairs, long black stout bristles on lateral edges 2 = most fine yellowish hairs, long stout golden bristles laterally 3 = absent Char. 68 = TERGITES 3&4 0 = differently coloured than other tergites 1 = same colour as other tergites Char. 69 = BASIPHALLUS 0 = Expanded dorsoventrally 1 = Less than 2x width of basiphallus Char. 70 = DISTIPHALLUS 0 = with distal part 1 = ending with bulb 2 = other Char. 71 = DISTIPHALLUS 0 = with distal part shorter than basal part 1 = with distal part longer than basal part 2 = absent Char. 72 = DISTIPHALLUS 0 = bulb small, not broader than distiphallus 1 = bulb enlarged, broader than and at least 1.25 length of phallus 2 = absent Char. 73 = DISTIPHALLUS 0 = distal part not flanked by hyaline sheath 1 = basally flanked by hyaline sheath 2 = distal part absent Char. 74 = APICAL DISTIPHALLUS 0 = Absent 1 = Straight (relatively) 2 = Curved - Hooklike aiming posteriorly 3 = Curved - s-shaped 4 = Coiled Char. 75 = DISTIPHALLUS BULB 0 = Absent 1 = simple - 2 loops 131 2 = complex - 3 or more loops Table 21 cont'd: Morphological Character list for the Taeniapterinae Char. 76 = EJACULATORY APODEME 0 = Fan smaller than hypandrium shelf 1 = Fan same size as hypandrium shelf 2 = Fan larger than hypandrial shelf Char. 77 = EPANDRIAL LENGTH 0 = more than 1.5X width 1 = less than 1.5X width 2 = less than width Char. 78 = EPANDRIUM 0 = with short anteroventral arms (same length as bulb) 1 = with long anteroventral arms (longer than bulb) Char. 79 = GENITAL FORK 0 = absent 1 = present 2 = vestigial Char. 80 = GENITAL FORK 0 = basal appendages absent 1 = with single pair of basal appendages 2 = with multiple pairs of basal appendages Char. 81 = GENITAL FORK 0 = absent 1 = as wide as long 2 = wider than long 3 = longer than wide Char. 82 = GENITAL FORK 0 = basal appendages absent 1 = basal appendages with only small setae 2 = basal appendages with minority of apical setae situated at tip of large knobs 3 = basal appendages with majority of apical setae situated at tip of large knobs 4 = knobs present but no setae emerging from them Char. 83 = GENITAL FORK 0 = delicate, finger like appendages 1 = cumbersome, blocky, clam-like 2 = appendages absent/vestigial 132 Table 22 cont'd: Morphological Character list for the Taeniapterinae Char. 84 = GENITAL FORK 0 = apical appendages cylindrical 1 = apical appendages anteroposteriorly compressed 2 = laterally compressed 3 = appendages vestigial Char. 85 = GENITAL FORK 0 = covered with long bristles on all surfaces 1 = bristles only present on anterior/dorsal surface 2 = bristles on anterior and lateral sides Char. 86 = GENITAL FORK 0 = basal appendages absent 1 = basal appendages vestigial 2 = basal appendages cylindrical 3 = basal appendages laterally compressed Char. 87 = HYPANDRIUM 0 = spoon-shaped 1 = loop or ribbon-like 2 = other Char. 88 = PLEURAL SWELLING 0 = absent 1 = present Char. 89 = PLEURON 0 = bare 1 = with small black hairs distad of segment 2 2 = with short, fine, yellowish hairs beyond 3 = densely tomentose (velvety) Char. 90 = PLEURON 0 = evenly black and white 1 = mostly black 2 = mostly white Char. 91 = STERNITES 0 = bare 1 = fringed with medium-long bristles 2 = abdominal sternites reduced/absent 3 = fringed with short bristles 133 Table 23 cont'd: Morphological Character list for the Taeniapterinae Char. 92 = TERGITE 3 0 = similar to t4 1 = overlapping t4 and with marginal bristles enlarged Char. 93 = OVISCAPE 0 = unicolourous 1 = bicoloured Char. 94 = OVISCAPE LENGTH 0 = less than half length of abdomen 1 = more than or equal to half length of abdomen Char. 95 = PLEURON 0 = evenly black and white 1 = mostly black 2 = mostly white Char. 96 = PAIRED SPERMATHECAE 0 = simple, spherical 1 = enlarged and elongate (sausage-like) 2 = multi-lobed Char. 97 = PAIRED SPERMATHECAE 0 = two 1 = one 2 = four Char. 98 = PAIRED SPERMATHECAE 0 = pair on common duct 1 = duct only common at base Char. 99 = PAIRED SPERMATHECAE 0 = straight 1 = curled Char. 100 = BASAL SINGLE 0 = present SPERMATHECA 1 = absent Char. 101 = BASAL SINGLE 0 = like a spermatheca SPERMATHECA 1 = tubular 2 = enlarged into shape different from spermathecae 3 = minimal, sac-like evagination 4 = cone-shaped 5 = absent 134 Table 24 cont'd: Morphological Character list for the Taeniapterinae Char. 102 = VENTRAL RECEPTACLE 0 = apical appendages cylindrical 1 = apical appendages anteroposteriorly flattened - spoon like 2 = apical appendages absent 3 = apical appendages globular 4 = absent Char. 103 = VENTRAL RECEPTICLE 0 = Duct shorter than spermathecal duct 1 = Duct as long or longer than spermethecal duct 2 = absent Char. 104 = VENTRAL RECEPTICLE 0 = Shorter than spermatheca (including individual duct) 1 = As long as spermatheca (including individual duct) 2 = absent 135 Table 25: Morphological character matrix for the Taeniapterinae Species Character & State 000000000111111111122222222223333333333 123456789012345678901234567890123456789 Taeniaptera angulata 001117320010111102110012111020321212011 Taeniaptera annulata 001310220010101102101012101020321212011 Taeniaptera trivittata SC 001312000010121002102022132010312001011 Taeniaptera gorgonae 001300220010111002101012231020321202011 Taeniaptera albibasis 001300120010111002100012111020311211011 Taeniaptera thiemei 001310220010121102101012131020321012011 Taeniaptera albitarsus 001201100020211000210011131220311001021 Taeniaptera "aliacea" 001201120010201100111012242020322002011 Taeniaptera lasciva 001312411010121000102012120010212002011 Grallomyia tarsata 001312021010121000110012030010211102211 Taeniaptera trivittata AL 001312010010121000102022132010212001211 Micropeza (Micropeza) sp. 020302611102271000202102162030100201400 Grallipeza vicina 201131100000210000210012062020321002021 Calosphen auristrigosus 001000021000021002270002032010201001110 Globopeza venezuelensis 020301101101011002202100062200101001000 Scipopus (Phaeopterina) sexguttatus 011200100021001112102112122000211002010 Scipopus (Scipopus) limbativertex 001200101000001101010112152021212201011 Plocoscelus harenosus 311303510010120102102111152100322102201 Ptilosphen cyaneiventris 201113321020020010110012020020321002111 Hoplocheiloma totliana 011301120001011111000102051010211201111 Taeniaptera ichneumoneus 001312000000020000200012031010321201211 Poecilotylus paraguayensis 001311000020020000110012031010311201211 Poecilotylus (Hemichaeta) scutellatus 011101121020221000112102001010211012311 Poecilotylus trifasciatus 001301020020220100110001061110321102221 Taeniaptera balzapambana 011301121020221002112112061011301001211 136 Table 26 cont'd: Morphological character matrix for the Taeniapterinae Species Character & State 4444444444555555555566666666667777777777 0123456789012345678901234567890123456789 Taeniaptera angulata 00101100002010001101000030011??????????1 Taeniaptera annulata 0010110100200000011100013001070010322211 Taeniaptera trivittata SC 1202110101201010111120013100000110221101 Taeniaptera gorgonae 0010110120201010110100003111070010322111 Taeniaptera albibasis 1010110100201010101100003011010010320101 Taeniaptera thiemei 1010110120201010001100003211110010322001 Taeniaptera albitarsus 1100111120201010010111003000000010322011 Taeniaptera "aliacea" 1110310100201010010111003000110010122111 Taeniaptera lasciva 0000110101200010010120003100000110222111 Grallomyia tarsata 0002410020301000010121003000070001?10111 Taeniaptera trivittata AL 0002110101201010111120013100000110221101 Micropeza (Micropeza) sp. 1001103230000112110042200033112222000202 Grallipeza vicina 0100300120200010110111103122101212022112 Calosphen auristrigosus 0002100020210000010101213002701212022011 Globopeza venezuelensis 2001001020200101000002213002100111420011 Scipopus (Phaeopterina) sexguttatus 0122211120200010010001102011111111111111 Scipopus (Scipopus) limbativertex 1000512010211010010111201000102110422011 Plocoscelus harenosus 0000102120200010010131003202111212022111 Ptilosphen cyaneiventris 0002102100400010002101003002100100112001 Hoplocheiloma totliana 1002101100200010010101203002100100312101 Taeniaptera ichneumoneus 0210312120200010011130003202100001210111 Poecilotylus paraguayensis 1002110100200010011100003011101212012111 Poecilotylus (Hemichaeta) scutellata 1002102101300010110121011102110000212111 Poecilotylus trifasciatus 1002110120201010011100003011101222011111 Taeniaptera balzapambana 1002102100200010010120001001100110127011 137 Table 27 cont'd: Morphological character matrix for the Taeniapterinae Species Character & State 0000000000000000000011111 8888888888999999999900000 0123456789012345678901234 Taeniaptera angulata 1310022701210001000701177 Taeniaptera annulata 1320002001210001001101000 Taeniaptera trivittata SC 1320203002130001000001011 Taeniaptera gorgonae 1320002001010101001104000 Taeniaptera albibasis 1320002001010001001104000 Taeniaptera thiemei 1320002007110001000101000 Taeniaptera albitarsus 0101200001010111111111111 Taeniaptera "aliacea" 0100000000120111101015422 Taeniaptera lasciva 0100200002130101000001100 Grallomyia tarsata 0300020000030102020003200 Taeniaptera trivittata AL 1330103002130001100101010 Micropeza (Micropeza) sp. 0301120200210112001000311 Grallipeza vicina 02023200112301020000????? Calosphen auristrigosus 2340012000710001001101001 Globopeza venezuelensis 1330203200120101200000300 Scipopus (Phaeopterina) sexguttatus ?????????????001120015422 Scipopus (Scipopus) limbativertex 1310012113030011000101000 Plocoscelus harenosus 0100010002110102001100300 Ptilosphen cyaneiventris 1330011003211110000100300 Hoplocheiloma totliana 0300020102220012000101000 Taeniaptera ichneumoneus 1330021000131110021100300 Poecilotylus paraguayensis 0300020003110011020115422 Poecilotylus (Hemichaeta) scutellata 0300010100030011001100301 Poecilotylus trifasciatus 0300020103110111120115422 Taeniaptera balzapambana 1310011103130010200001000 138 Table 28: Incongruence Length Difference (ILD) results. Gene Partitions 12S COI COIPJ wingless CAD COI HEB complete T2S 0.029 0.437 0.001 0.428 0.001 COIHEB 0.01 0.03 0.001 COIPJ 0.001 0.024 wingless 0.04 CAD All genes 0.001 0.001 0.001 0.001 0.001 0.001 except: Total evidence 0.001 139 Table 29: List of new combinations resulting from this study Sensu Steyskal Type New Taxonomy 1968 (or later publication) Examined Grallomyia Rondani, 1850 Grallomyia tarsata Wiedemann 1830 (type species) Taeniaptera tarsata Photo of (Wiedemann) suspected type Hemichaeta Hennig, 1934 Hemichaeta landrocki (Czerny) 1932 Poecilotylus Not (Hemichaeta) Examined landrocki (Czerny) Hemichaeta quinquemaculata (Czerny) 1932 Poecilotylus Not (Hemichaeta) Examined quinquemaculata (Czerny) Hemichaeta scutellata (Cresson) 1930 (type species) Poecilotylus Photo of type (Hemichaeta) scutellata (Cresson) Hemichaeta similis (Hennig) 1934 Poecilotylus Not (Hemichaeta) Examined similis Hennig Paragrallomyia Hendel, 1933 Paragrallomyia aeripennis (Enderlein) 1922 Taeniaptera Not aeripennis Examined (Enderlein) Paragrallomyia albibasis (Enderlein) 1922 Taeniaptera Photo of type albibasis (Enderlein) Paragrallomyia angulata (Loew) 1866 Taeniaptera Not angulata (Loew) Examined Paragrallomyia annulata (Fabricius) 1787 (type Taeniaptera Photo of type species) annulata (Fabricius) Paragrallomyia caerulescens (Macquart) 1846 Taeniaptera Not caerulescens Examined (Macquart) Paragrallomyia continentalis (Hennig) 1934 Taeniaptera Photo of type continentalis Hennig Paragrallomyia dilutimacula (Enderlein) 1922 Taeniaptera Photo of type dilutimacula (Enderlein) 140 Table 30 cont'd: List of new combinations resulting from this study Paragrallomyia diversicolor (Macquart) 1855 Taeniaptera Not diversicolor Examined (Macquart) Paragrallomyia feei (Steyskal) 1986 Taeniaptera feei Photo of type Steyskal Paragrallomyia gorgonae (Hennig) 1934 Taeniaptera Not gorgonae Hennig Examined Paragrallomyia grata (Wulp) 1897 Taeniaptera grata Not (Wulp) Examined Paragrallomyia inornata (Hennig) 1934 Taeniaptera Photo of inornata Hennig suspected type Paragrallomyia inpai (Albuquerque) 1980 Taeniaptera inpai Not Albuquerque Examined Paragrallomyia mediofusca (Hennig) 1934 Taeniaptera Not mediofusca Hennig Examined Paragrallomyia nigritarsis (Macquart) 1848 Taeniaptera Not nigritarsis Examined (Macquart) Paragrallomyia parens (Cresson) 1926 Taeniaptera parens Not Cresson Examined Paragrallomyia planitibia (Enderlein) 1922 Taeniaptera Photo of type n 1 /~iit ill r\i /~i ptuniiiuia (Enderlein) Paragrallomyia platyenema (Loew) 1866 Taeniaptera Not platycnema (Loew) Examined Paragrallomyia postannulus (Enderlein) 1922 Taeniaptera Photo of type pus tannut us (Enderlein) Paragrallomyia rufifacies (Macquart) 1851 Taeniaptera Not rufifacies Examined (Macquart) Paragrallomyia teresacristinae (Albuquerque) 1981 Taeniaptera Not teresacristinae Examined Albuquerque Paragrallomyia thiemei (Enderlein) 1922 Taeniaptera thiemei Photo of type (Enderlein) Paragrallomyia tibialis (Macquart) 1843 Taeniaptera tibialis Not (Macquart) Examined Paragrallomyia vittipennis (Coquillet) 1902 Taeniaptera Not vittipennis Examined (Coquillet) 141 Table 31 cont'd: List of new combinations resulting from this study Paragrallomyia volens (Cresson) 1926 Taeniaptera volens Photo of type Cresson Paragrallomyia vulgata (Hennig) 1934 Taeniaptera Not vulgata Hennig Examined Paragrallomyia wulpi (Steyskal) 1967 Taeniaptera wulpi Not Steyskal Examined Poecilotylus Hennig, 1934 Poecilotylus albitarsis (Enderlein) 1922 Taeniaptera Photo of type albitarsis (Enderlein) Poecilotylus aliacea (Albuquerque) 1980 Taeniaptera aliacea Not Albuquerque Examined Poecilotylus balzapambana (Enderlein) 1922 Taeniaptera Photo of type balzapambana (Enderlein) Poecilotylus bistrigatus (Enderlein) 1922 Poecilotylus Photo of type bistrigatus (Enderlein) Poecilotylus buscki (Cresson) 1930 Poecilotylus buscki Photo of type (Cresson) Poecilotylus egregius (Hennig) 1934 Poecilotylus Not egregius (Hennig) Examined Poecilotylus gratula (Steyskal) 1967 Taeniaptera gratula Not Steyskal Examined Poecilotylus ichneuomoneus (Brauer) 1885 Taeniaptera Not ichneumonea Examined Brauer Poecilotylus latifascia (Wulp) 1897 Taeniaptera Not latifascia (Wulp) Examined Poecilotylus lauta (Cresson) 1930 Taeniaptera lauta Photo of type (Cresson) Poecilotylus leucomelas (Walker) 1852 Poecilotylus Photo of type leucomelas (Walker) Poecilotylus lividisoccatus (Enderlein) 1922 Poecilotylus Photo of type lividosoccatus (Enderlein) Poecilotylus longifurca (Hendel) 1933 Taeniaptera Photo of longifurca (Hendel) suspected type 142 Table 32 cont'd: List of new combinations resulting from this study Poecilotylus luridilabris (Enderlein) 1922 Poecilotylus Photo of type luridilabris (Enderlein) Poecilotylus minor (Hennig) 1934 Poecilotylus minor Photo of type (Hennig) Poecilotylus munda (Wulp) 1897 Taeniaptera munda Not (Wulp) Examined Poecilotylus obliquus (Fabricius) 1805 Poecilotylus Not obliquus (Fabricius) Examined Poecilotylus paraguayensis (Enderlein) 1922 Poecilotylus Photo of paraguayensis lectotype (Enderlein) Poecilotylus pictus Hennig 1937 Poecilotylus pictus Photo of type Hennig Poecilotylus seiuncta (Czerny) 1931 Taeniaptera Not seiuncta (Czerny) Examined Poecilotylus simillima (Hendel) 1922 Taeniaptera Not simillima (Hendel) Examined Poecilotylus stellatus (Wulp) 1897 Poecilotylus Not stellatus (Wulp) Examined Poecilotylus strigata (Enderlein) 1922 Taeniaptera Photo of type strigata (Enderlein) Poecilotylus testaceus (Fabricius) 1805 Poecilotylus Not testaceus Examined (Fabricius) Poecilotylus tricolorus (Enderlein) 1922 Poecilotylus Photo of type tricolorus (Enderlein) Poecilotylus trifasciatus (Wiedemann) 1830 Poecilotylus Photo of type trifasciatus (Wiedemann) Poecilotylus varius (Wiedemann) 1830 (type species) Poecilotylus varius Photo of type (Wiedemann) 143 Table 33 cont'd: List of new combinations resulting from this study Taeniaptera Macquart, 1835 Taeniaptera knutsonii spec. nov. Holotype Taeniaptera lasciva (Fabricius) 1798 Taeniaptera lasciva Not (Fabricius) Examined Taeniaptera longapilis spec. nov. Holotype Taeniaptera mater spec. nov. Holotype Taeniaptera nigriceps Hennig 1934 Taeniaptera Photo of nigriceps Hennig lectotype Taeniaptera trivittata Macquart 1835 (type species) Taeniaptera Not trivittata Macquart Examined Taeniaptera vulpes Cresson 1926 Taeniaptera vulpes Photo of type Cresson 144 6. References Aczel, M. L. (1949). "Catalogo de la Familia de las "Tylidae" (Calobatidae + Micropezidae + Neriidae, Diptera) en la Region Neotropical." Acta Zoologica Lilloana 8: 309-389. Aczel, M. L. (1950a). "Notes on Tylidae I: The Palearctical Tylidae (Syn. Micropezidae, Dipt.) of the Hungarian National Museum (Nat. Hist.)." Zoologica Lilloana 8: 161-196. Aczel, M. L. (1951). "Morfologia Externa Y Division Sistematica de Las Tanypezidiformes: Con sinopsis de las especies Argentinas de Tylidae (Micropezidae) Y Neriidae (Dipt.)." Acta Zoologica 11: 483-589, pis. 1-4. Albuquerque, L. P. d. (1980a). "Estudos dos micropezideos da Bacia Amazonica: I - Contribuicao a Sistematica de Micropezidae e estudo do genero Taeniaptera Macquart, 1835 (diptera - acalyptratae)." Acta Amazonia 10(3): 659-670. Albuquerque, L. P. d. (1980b). "Estudo dos Micropezideos da Bacia Amazonica: II - Redescricao de tres aspecies e conhecimento de duas especies novas para a ciencia de Taeniaptera Macquart, 1835 (Diptera-Micropezidae)." Acta Amazonia 10(4): 863-881. Albuquerque, L. P. d. (1981). "Estudo dos Micropezideos da Bacia Amazonica: III - Conhecimento de uma nova especie e redescricao de tres especies de Taeniaptera Macquart, 1835 (Diptera - Micropezidae)." Acta Amazonia 11(4): 821-838. 145 Albuquerque, L. P. d. (1986). Sistematica Dos Taeniapterinae da Regiao Neotropical (Diptera - Micropezidae). Ciencias Biologicas. Curitiba, Universidade Federal do Parana. Doctor of Science. Almeida, E. A. B. and B. N. Danforth (2009). "Phylogeny of colletid bees (Hymenoptera: Colletidae) inferred from four nuclear genes." Molecular Phylogenetics and Evolution 50(2): 290-309. Baker, R. H., G. S. Wilkinson and R. DeSalle (2001). "Phylogenetic Utility of Different Types of Molecular Data Used to Infer Evolutionary Relationships among Stalk- Eyed Flies (Diopsidae)." Systematic Biology 50(1): 87-105. Bennett, F. D. and M. M. Alam (1985). An annotated check-list of the insects and allied terrestrial arthropods of Barbados. Bridgetown, Barbados, Caribbean Agricultural Research and Development Institute. Bertone, M. A., G. W. Courtney and B. M. Wiegmann (2008). "Phylogenetics and temporal diversification of the earliest true flies (Insecta: Diptera) based on multiple nuclear genes." Systematic Entomology 33: 668-687. Boyer, S. L., I. Karaman and G. Giribet (2005). "The genus Cyphophthalmus (Arachnida, Opiliones, Cyphophthalmi) in Europe: A phylogenetic approach to Balkan Peninsula biogeography." Molecular Phylogenetics and Evolution 36: 554-567. Brindle, A. (1965). "Taxonomic Notes on the Larvae of British Diptera: No. 19 - The Micropezidae (TvridaeV The Entomologist 98(1233): 83-86. Britton, W. E. (1920). Check-list of the insects of Connecticut / by Wilton Everett Britton. Hartford :, State Geological and Natural History Survey. 146 Brower, A. V. Z. and R. O. B. Desalle (1998). "Patterns of mitochondrial versus nuclear DNA sequence divergence among nymphalid butterflies: the utility of wingless as a source of characters for phylogenetic inference." Insect Molecular Biology 7: 73-82. Cho, S., A. Mitchell, J. C. Regier, C. Mitter, R. W. Poole, T. P. Friedlander and S. Zhao (1995). "A highly conserved nuclear gene for low-level phylogenetics: Elongation Factor-la recovers morphology-based tree for heliothine moths." Molecular Biology and Evolution 12(4): 650-656. Cole, F. R. (1969). Micropezidae. Flies of Western North America. Berkeley, University of California Press: 337-340. Collins, K. P. and B. M. Wiegmann (2002). "Phylogenetic relationships of the lower Cyclorrhapha (Diptera: Brachycera) based on 28S rDNA sequences." Insect Systematics & Evolution 33: 445-456. Coquillet, D. W. (1900). "Report on a Collection of Dipterous Insects from Puerto Rico." Proceedings of the United States National Museum 22: 249-270. Cresson, E. T. (1908). "Dipterological Notes I." Transactions of the American Entomological Society 34: 1-12, pi. I, II. Cresson, E. T. (1926). "Descriptions of new genera and species of Diptera (Ephydridae and Micropezidae)." Transactions of the American Entomological Society 52: 249-274, pi. 7-17. Cresson, E. T. (1930). "Notes on and Descriptions of Some Neotropical Neriidae and Micropezidae (Diptera)." Transactions of the American Entomological Society 56: 307-360. 147 Cresson, E. T. (1938). "The Neriidae and Micropezidae of America North of Mexico." Transactions of the American Entomological Society 64: 293-366, pl.XI-XIII. Eberhard (1999). "Mortal mimicry in the fly, Plocoscelus sp (Diptera, Micropezidae)." BIOTROPICA 31(3): 535. Enderlein, G. (1922). "Klassifikation der Micropeziden." Archiv Fur Naturgeschichte 88(5): 141-229. Farris, J. S., M. Kallersjo, A. G. Kluge and C. Bult (1994). "Testing Significance of Incongruence." Cladistics 10(3): 315-319. Farris, J. S., M. Kallersjo, A. G. Kluge and C. Bult (1995). "Constructing a Significance Test for Incongruence." Systematic Biology 44(4): 570-572. Ferrar, P. (1987). A Guide to the Breeding Habits and Immature Stages of Diptera Cyclorrhapha (Part 1: Text). Leiden, E.J. Brill/Scandinavian Science Press. Fischer, C. R. (1932). "Contribuicao para o conhecimento da metamorphose e posicao systemica da familia Tylidae (Micropezidae, Dipt.)." Revista de Entomologia 2(1): 15-24. Folmer, O., M. Black, W. Hoeh, R. Lutz and R. Vrijenhoek (1994). "DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates." Molecular Marine Biology and Biotechnology 3(5): 294- 299. Gibson, J. F., S. Kelso, M. D. Jackson, J. H. Kits, G. F. G. Miranda and J. H. Skevington (In Press). "Diptera-Specific PCR-Amplification Primers of Use in Molecular Phylogenetic Research." Annals of the Entomological Society of America. 148 Gibson, J. F., J. H. Skevington and S. Kelso "Placement of Conopidae (Diptera) within Schizophora based on mtDNA and nrDNA gene regions." Molecular Phylogenetics and Evolution In Press, Uncorrected Proof. Gibson, J. F., J. H. Skevington and S. Kelso (2010). "Placement of Conopidae (Diptera) within Schizophora based on mtDNA and nrDNA gene regions." Molecular Phylogenetics and Evolution 56(1): 91-103. Goloboff, P. A. (1993). "ESTIMATING CHARACTER WEIGHTS DURING TREE SEARCH." Cladistics 9(1): 83-91. Goloboff, P. A., J. S. Farris and K. C. Nixon (2003). TNT: Tree Analysis Using New Technology, Willi Hennig Society: Program and documentation, available from the authors, and at www.zmuc.dk/public/phylogeny. Hadley, A. (2006). CombineZ5.3, http://www.hadleyweb.pwp.blueyonder.co.uk. Hall, T. A. (1999). "BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT." Nucleic Acids Symposium Series 41: 95-98. Hennig, W. (1934). "Revision der Tyliden (Dipt., Acalypt.). I. Teil: Die Taeniapterinae Amerikas." Stettiner Entomologische Zeitung 95: 65-108, 294-330. Hennig, W. (1935a). "Revision der Tyliden (Dipt., Acalypt). I. Teil: Die Taeniapterinae Amerikas [concl.]." Stettiner Entomologische Zeitung 96: 27-67. Hennig, W. (1935b). "Revision der Tyliden (Dipt., Acalypt). II. Teil: Die auPeramerikanischen Taeniapterinae, die Trepidariinae und Tylinae. Allgemeines iiber die Tyliidaen." Konowia 14: 68-92, 192-216, 289-310. 149 Hennig, W. (1936). "Revision der Tyliden (Dipt., Acalypt.) II Teil: Die au(3eramerikanischen Taeniapterinae, die Trepidariinae und Tylinae. Allgemeines iiber die Tyliiden." Konowia 15: 129-144. Hennig, W. (1958). "Die Familien der Diptera Schizophora und ihre phylogenetische Verwandtschaftsbeziehungen." Beitrage zur Entomologie 8: 505-608. Huelsenbeck, J. P., J. J. Bull and C. W. Cunningham (1996). "Combining data in phylogenetic analysis." Trends in Ecology & Evolution 11(4): 152-158. Johnson, C. W. (1890). Insects of New Jersey; a list of the species occurring in New Jersey, with notes on those of economic importance, by John B. Smith. Trenton, N.J., MacCrellish & Quigley, state printers. Johnson, C. W. (1894). "List of the Dipter of Jamaica with descriptions of new species." Proceedings of the National Academy of Sciences Philadelphia 46: 271-281. Johnson, C. W. (1895). "Insects of Florida I. Diptera." Bulletin of the American Museum of Natural History 32: 37-90. Johnson, C. W. (1900). Insects of New Jersey; a list of the species occurring in New Jersey, with notes on those of economic importance, by John B. Smith. Trenton, N.J., MacCrellish & Quigley, state printers. Johnson, C. W. (1910). Insects of New Jersey; a list of the species occurring in New Jersey, with notes on those of economic importance, by John B. Smith. Trenton, N.J., MacCrellish & Quigley, state printers. Johnson, C. W. (1925). "Fauna of New England; List of the Diptera or two-winged flies." Occasional Papers of the Boston Society of Natural History 7(15): 1-326. 150 Kilpatrick, J. W. and H. F. Schoof (1956). "Fly Production in Treated and Untreated Privies." Public Health Reports 71(8): 787-796. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan, H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thompson, T. J. Gibson and D. G. Higgins (2007). "Clustal W and Clustal X version 2.0." Bioinformatics 23: 2947-2948. Leonard, M. D. (1928). "A list of the insects of New York, with a list of the spiders and certain other allied groups." Memoir (Cornell University Agricultural Experiment Station) 101: 1-1121. Lowe, R. (2009). DIYPhotoBits.com Camera Control 4.1, http://www.diyphotobits.com/2009/10/02/diyphotobits-com-camera-control-4-l- dog-food/. Macquart, P. J. M. (1835). "Histoire Naturelle des Insectes - Dipteres." 2: -700. Maddison, D. R. and W. P. Maddison (2000, 2003). MacClade. Sunderland, Massachusetts, U.S.A., Sinauer Associates, Inc. Maddison, W. P. and D. R. Maddison (2009). "Mesquite: a modular system for evolutionary analysis." Ver. 2.17 (build 514): http://mesquiteproject.org. Marshall, S. A. (2004). "Globopeza, a new genus of micropezid fly from Ecuador and Venezuela (Diptera, Taeniapterinae)." Studia dipterologica 11(2): 537-541. Marshall, S. A. (2006). Insects Their Natural History and Diversity. Richmond Hill, Firefly Books Ltd. Marshall, S. A. (2010). Micropezidae (stilt-legged flies). Manual of Central American Diptera. 2. 151 Marshall, S. A. (2011). "A review of the genus Hoplocheiloma Cresson (Diptera: Micropezidae)." Zootaxa 2806: 1-23. Marshall, S. A., M. Buck, J. H. Skevington and D. Grimaldi (2009). "A revision of the family Syringogastridae (Diptera: Diopsoidea)." Zootaxa 1996: 1-80. McAipine, D. (1966). "Description and biology of an Australian species of Cypselosomatidae (Diptera), with a discussion of family relationships." Australian Journal of Zoology 14: 673-685. McAipine, D. (1998). "Review of the Australian stilt flies (Diptera: Micropezidae) with a phylogenetic analysis of the family." Invertebrate taxonomy 12(1): 55. McAipine, D. K. (1974). "The subfamily classification of the Micropezidae and the genera Eurybatinae (Diptera: Schizophora)." Journal of Entomology (B) 43(2): 231-245. McAipine, D. K. (1987). "Studies in Upside-down Flies (Diptera: Neurochaetidae) Part II: Biology, Adaptations, and specific mating Mechanisms." Proceedings of the Linnean Society of New South Wales 110(1): 59-82. McAipine, D. K. (1996). "Relationships and Classification of the Pseudopomyzidae (Diptera: Nerioidea)." Proceedings of the Linnean Society of New South Wales 116: 223-232. McAipine, J. F. (1989). Phylogeny and Classification of the Muscomorpha. Manual of Nearctic Diptera. J. F. McAipine. Ottawa, Ont, Canada, Agriculture Canada. 3: 1397-1519. 152 Meier, R., K. Shiyang, G. Vaidya and P. Ng (2006). "DNA Barcoding and Taxonomy in Diptera: A Tale of High Intraspecific Variability and Low Identification Success." Systematic Biology 55: 715-728(14). Merritt, R. W. and M. T. James (1973). "The Micropezidae of California (Diptera)." Bulletin of the California Insect Survey 14: 28. Merritt, R. W. and B. V. Peterson (1976). "A synopsis of the Micropezidae (Diptera) of Canada and Alaska, with descriptions of four new species." Canadian Journal of Zoology 54: 1488-1506. Moulton, J. K. and B. M. Wiegmann (2004). "Evolution and phylogenetic utility of CAD (rudimentary) among Mesozoic-aged Eremoneuran Diptera (Insecta)." Molecular Phylogenetics and Evolution 31: 363-378. Miiller, H. (1957). "Leguminosenknollchen als Nahrunsquelle heimischer Micropezidae- (Tylidae-) Larven (Diptera): Zur Morphologie und Biologie der bisher Unbekannten Larvae von Micropeza corrigiolata L. (Tylos corrigiolata L.)." Beitrage zur Entomologie 7: 247-267. Nylander, J. A. A. (2004). MrModeltest v2. Evolutionary Biology Centre, Uppsala University, Program distributed by the author. Ortiz, P. (2001). Mimicry, Sleep and Sex: The natural history of a micropezid fly. Film presented to the Animal Behaviour Society Annual Meeting. Corvallis, Oregon. Osten-Sacken, C. R. (1878). Catalogue of the described Diptera of North America by CR. Osten Sacken. Washington :, Smithsonian Institution. Pefia, C. and N. Wahlberg (2008). "Prehistorical climate change increased diversification of a group of butterflies." Biology Letters 4(3): 274-278. 153 Pilgrim, E. M., C. D. v. Dohlen and J. Pitts (2008). "Molecular phylogenetics of Vespoidea indicate paraphyly of the superfamily and novel relationships of its component families and subfamilies." Zoologica Scripta 37(5): 539-560. Rohdendorf, B. (1964). Historical development of dipterous insects, Nauka. Rohdendorf, B. (1974). The Historical Development of Diptera. Edmonton, AB, CAN, University of Alberta Press. Rondani, C. (1850). "Osservazioni sopra alquante specie di Esapodi Ditteri del Museo Torinese di Camillo Rondani." Nuovi Annali delle Scienze Naturali 3(2): 165- 197. Ronquist, F. and J. P. Huelsenbeck (2003). "MRBAYES 3: Bayesian phylogenetic inference under mixed models." Bioinformatics 19: 1572-1574. Sabrosky, C. W. (1942). "An Unusual Rearing of Rainieria brunneipes (Cresson) (Diptera: Micropezidae)." Entomological News 53: 283-285. Shevtsova, E., C. Hansson, D. H. Janzen and J. Kjasrandsen (2011). "Stable structural color patterns displayed on transparent insect wings." Proceedings of the National Academy of Sciences 108(2): 668-673. Sidow, A. (1992). "Diversification of the Wnt gene family on the ancestral lineage of vertebrates." Proceedings of the National Academy of Sciences 89: 5098-5102. Simon, C, F. Frati, A. Beckenbach, B. Crespi, H. Liu and P. Flook (1994). "Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers." Annals of the Entomological Society of America 87: 651-701. 154 Steyskal, G. C. (1964). "Larvae of Micropezidae (Diptera), Including Two Species that Bore in Ginger Roots." Annals of the Entomological Society of America 57: 292- 296. Steyskal, G. C. (1967). "Notes on some older types of Neotropical Micropezidae with descriptions of new species." Papeis Avulsos De Zoologia 20(8): 70-84. Steyskal, G. C. (1968). Family Micropezidae. A Catalogue of the Diptera of the Araericas South of the United States. P. E. Vanzolini and N. Papavero. Sau Paulo, Departmento de Zoologia, Secretaria da Agricultura: 48.1-48.33. Steyskal, G. C. (1987). Micropezidae. Manual of Nearctic Diptera. J. F. McAipine. Ottawa, Research Branch, Agriculture Canada. 2: 761-767. Stone, A., C. W. Sabrosky, W. W. Wirth, R. H. Foote and J. R. Coulson (1965). A Catalog of the Diptera of America North of Mexico. Washington D.C., Agriculture Research Service, United States Department of Agriculture. Swofford, D. L. (2003). PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Sunderland, Massachusetts, Sinauer Associates. Walker, F. and B. Museum (1849). List of the specimens of dipterous insects in the collection of the British Museum. [By Francis Walker]. London, Printed by order of the Trustees. Wheeler, W. M. (1924). "Courtship of the Calobatas: The Kelep Ant and the Courtship of Its Mimic, Cardiacephala myrmex." Journal of Heredity 15(12): 485-495. Wiegmann, B. M., S.-C. Tsaur, D. W. Webb, D. K. Yeates and B. K. Cassel (2000). "Monophyly and relationships of the Tabanomorpha (Diptera: Brachycera) based 155 on 28S ribosomal gene sequences." Annals of the Entomological Society of America 93: 1031-1038. Wulp., F. M. v. d. (1888-1903). Biologia Centrali-Americana :zoology, botany and archaeology - Insecta. Diptera. v. 2 (1888-1903). [London :, Published for the editors by R. H. Porter]. 156 7. Appendices 7.1 List of Abbreviations AIC - Akaike Information Criterion BS - Bremer Supports CAD - carbamoylphosphate-synthetase-asparate-transcarbamylase-dihydroorotase (also known as rudimentary) CI - Consistency Index CMNH - Section of Insects and Spiders, Carnegie Museum of Natural History, Pittsburgh, PA CNCI - Canadian National Collection of Insects, Agriculture and Agri-Food Canada, Ottawa, ON COI - Cytochrome c oxidase I COI HEB - Folmer region of the cytochrome c oxidase I (positions 1514-2173 of the Drosophila melanogaster mitochondrial genome) COI PJ - The remainder of the cytochrome c oxidase I gene (positions 2183-3014 of the Drosophila melanogaster mitochondrial genome) CTI - Congruent Topological Information EF-la - Elongation factor la ILD - Incongruence Length Difference INPA - Colecao Sistematica da Entomologia, Instituto Nacional de Pesquisas da Amazonia, Manaus MCMC - Monte Carlo Markov Chain 157 MTEC - Montana State University Entomology Collection, Entomology Research Laboratory, Montana State University, Bozeman, MT PBS - Partitioned Bremer Supports PCR - Polymerase Chain Reaction RI - Retention Index s.l. - sensu lato s.s.-sensu stricto TNT - Tree Analysis Using New Technologies - program for phylogenetic parsimony analysis UNCB Museo de Historia Natural, Instituto de Ciencias Naturales, Universidad Nacional de Colombia, Sante Fe' de Bogota', Colombia USNM - United States National Museum, Smithsonian Institute, Washington DC 158 7.2 Illustration of Characters used in Morphological Analysis API - Taeniaptera trivittata frontal head - numbers refer to characters listed in Table 7. 159 -**^i h \V I*1 ** -• ."J»> AP2 - Taeniaptera trivittata lateral head - numbers refer to characters listed i n Table 7. 160 AP3 - Taeniaptera lasciva - 3A lateral head and thorax - numbers refer to characters listed in Table 7. 161 AP4 - Taeniaptera knutsonii n. sp. - 3A view of head and thorax - numbers refer to characters listed in Table 7. 162 AP5 - Taeniaptera trivittata dorsal thorax - numbers refer to characters listed in Table 7. 163 AP6 - Taeniaptera trivittata - lateral thorax - numbers refer to characters listed in Table 7. 164 AP7 - Taeniaptera lasciva - % lateral habitus - numbers refer to characters listed in Table 7. 165 59 AP8 - Taeniaptera trivittata - wing - numbers refer to characters listed in Table 7. AP9 - Taeniaptera trivittata - dorsal abdomen - numbers refer to characters listed in Table 7. 166 APIO - Taeniaptera trivittata - male genitalia - numbers refer to characters listed in Table 7. 167 API 1 - Taeniaptera knutsonii — lateral female abdomen - numbers refer to characters listed in Table 7. 168 API2 - Taeniaptera trivittata - lateral male abdomen - numbers refer to characters listed in Table 7. 169 API3 - Taeniaptera trivittata - female genitalia - numbers refer to characters listed in Table 7. 170