Issue Information

Systematic Entomology (2017), 42, 240–266 DOI: 10.1111/syen.12209

Molecular phylogeny of Sericostomatoidea (Trichoptera) with the establishment of three new families

KJELL ARNE JOHANSON1, TOBIAS MALM1 andMARIANNE ESPELAND2

1Department of Zoology, Swedish Museum of Natural History, Stockholm, Sweden and 2Arthropoda Department, Zoological Research Museum Alexander Koenig, Bonn, Germany

Abstract. We inferred the phylogenetic relationships among 58 genera of Sericostom- atoidea, representing all previously accepted families as well as genera that were not placed in established families. The analyses were based on five fragments of the protein coding genes carbamoylphosphate synthetase (CPSase of CAD), isocitrate dehydrogenase (IDH), Elongation factor 1a (EF-1a), RNA polymerase II (POL II) and cytochrome oxidase I (COI). The data set was analysed using Bayesian methods with a mixed model, raxml, and parsimony. The various methods generated slightly different results regarding relationships among families, but the shared results comprise support for: (i) a monophyletic Sericostomatoidea; (ii) a paraphyletic Parasericostoma due to inclusion of Myotrichia murina, leading to synonymization of Myotrichia with Parasericostoma; (iii) a polyphyletic Sericostomatidae, which is divided into two families, Sericostom- atidae sensu stricto and Parasericostomatidae fam.n.; (iv) a polyphyletic Helicophidae which is divided into Helicophidae sensu stricto and Heloccabucidae fam.n.; (v) hypothesized phylogenetic placement of the former incerta sedis genera Ngoya, Seselpsyche and Karomana; (vi) a paraphyletic Costora (Conoesucidae) that should be divided into several genera after more careful examination of morphological data; (vii) reinstatement of Gyrocarisa as a valid genus within Petrothrincidae. A third family, Ceylanopsychi- dae fam.n., is established based on morphological characters alone. A hypothesis of the relationship among 14 of the 15 families in the superfamily is presented. A key to the families is presented based on adults (males). Taxonomic history, diagnosis, habitat preference and distribution data for all sericostomatoid families are presented.

This published work has been registered in ZooBank, http://zoobank.org/urn:lsid: zoobank.org:pub:CF6A6B9F-6A72-4265-BD09-3A710DFCD7B1.

Introduction just above 600 described extant species in 12 established families (Morse, 2016). The number of species is unevenly The first described members of the superfamily Sericostoma- distributed among the 68 recognized genera, and the largest toidea, Beraeodes minutus (Linnaeus) and Notidobia ciliaris genus, Helicopsyche von Siebold, comprises 273 species (45% (Linnaeus), were described by Linnaeus (1761), both originally of the species in the superfamily), and 50% of the genera in the classified together with all other Trichoptera species in the genus superfamily have one or two species only, indicating variable Phryganea (Fig. 1). Presently, the Sericostomatoidea contain evolutionary success in diversification or a tendency to use Helicopsyche as a kind of waste basket. The superfamily has a cosmopolitan distribution, but individual families have restricted Correspondence: Kjell Arne Johanson, Department of Zoology, distributions. Five genera – Ceylanopsyche Fischer, Karomana Swedish Museum of Natural History, Box 50007, SE-10405 Stockholm, Schmid, Mpuga Schmid, Ngoya Schmid and Seselpsyche Sweden. E-mail: [email protected] 240 © 2016 The Authors. Systematic Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. Phylogeny of Sericostomatoidea 241

Fig. 1. Picture of species in Sericostomatoidea. (A) Sericostoma personatum (Spence) male, Norway, representing the type genus Sericostoma Latreille of the family Sericostomatidae. (B) Beraea pullata (Curtis) female, Sweden, representing the type genus Beraea Stephens of the family Beraeidae.

Malicky – are classified as sericostomatoids but with uncertain among families based on analysis of morphological data using family affinities (Morse, 2016). Several attempts have been parsimony was that by Weaver (1983), who also was the first to made to outline the relationship among the sericostomatoid group eight of the families of Ross (1967) ‘leptocerid branch’ families and genera, starting with Ulmer more than 100 years into the superfamily Sericostomatoidea. He listed two synapo- ago (Ulmer, 1912), who hypothesized that the three families, morphies for the superfamily: loss of the abdominal tergite IX Sericostomatidae, Beraeidae and Helicopsychidae, presently in the larvae, and loss of the mid-leg preapical spurs in adults. classified as sericostomatoids, were not believed to be most He stated (pp. 51 and 244) that the Anomalopsychidae forms the closely related to each other (Fig. 2A), but no arguments were sister group to the rest of the families in the superfamily based given for that interpretation. Ross (1956) offered a first furcated on the presence of ocelli in the adults, which were lost in the phylogenetic hypothesis of Trichoptera families, included the sister group comprising the other seven families (Fig. 2E). The same three sericostomatoid taxa as Ulmer, and retained them as family Antipodoeciidae was included in the ‘leptocerid branch’ polyphyletic (Fig. 2B). In a similar analysis a decade later, Ross as a distinct family by Ross (1967) but was synonymized with (1967) included seven sericostomatoid families and grouped Beraeidae by Ross (1978), and not included in the analysis by them in the ‘leptocerid branch’ (Fig. 2C). The Sericostomatidae Weaver (1983) as a distinct family. As a first effort to classify was revised by Ross (1978), who reduced the number of fami- the Hydrosalpingidae, Petrothrincidae and Barbarochthonidae lies in Sericostomatoidea to five, but the superfamily remained in relation to the nine other families in the superfamily, deMoor polyphyletic (Fig. 2D). The first hypothesis of the relationship (1993) performed a parsimony analysis of 59 morphological

Fig. 2. Hypotheses of evolutionary relationships among families in Sericostomatoidea, after: (A) Ulmer (1912); (B) Ross (1956); (C) Ross (1967); (D) Ross (1978); (E) Weaver (1983); (F) Johanson (1998) derived from deMoor (1993); (G) Frania & Wiggins (1997); (H) Kjer et al. (2001); (I) Neboiss (2002); (J) Holzenthal et al. (2007a); (K) Malm et al. (2013). In Fig. 2A–D taxon names in bold belong to the Sericostomatoidea; taxa in plain are classified outside the Sericostomatidea.

© 2016 The Authors. Systematic Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. 42, 240–266 Phylogeny of Sericostomatoidea 243 characters, and included all 12 families. In his two most par- Material and methods simonious trees, three monophyletic groups were detected, Petrothrincidae + Barbarochthonidae + Hydrosalpingidae, Taxon sampling Calocidae + Chathamiidae, and Conoesucidae + Helicophidae, but a reanalysis of the data matrix (Johanson, 1998) forced most The data comprise representatives from all sericostomatoid of the branches into collapsed polytomies (Fig. 2F). Frania families and the majority of genera recognized in the group. & Wiggins (1997) performed a comprehensive analysis of When possible, two or more species from each genus were the relationship among Trichoptera families, and included six included and for some genera two individuals of the same sericostomatoids. They found (Fig. 2G) reproduced Sericos- species were represented. We extracted and sequenced repre- tomatoidea to be monophyletic and the family Sericostomatidae sentatives of 58 of the 70 Sericostomatoidea genera described was the sister group to remaining five families, of which the at present (Table 1). Twelve genera (Notoernodes Andersen previously assumed most basal taxon, Anomalopsychidae, & Kjærandsen, Alloecentrellodes Flint, Microthremma Schmid, formed the sister group to Helicopsychidae. Molecular data Pseudosericostoma Schmid, Aclosma Morse, Asahaya Schmid, Aselas Barnard, Mpuga, Ceylanopsyche, Latarima Shackleton, was first analysed in the context of Trichoptera evolution Webb, Lawler & Suter and Cerasma McLachlan, Chiloecia by Kjer et al. (2001), who applied a combination of mor- Navás) were excluded from our analyses due to difficulties phological data and DNA sequences from both coding and of obtaining high-quality DNA. Outgroup taxa were selected noncoding genes. Their support for monophyly of Sericos- across the suborder Integripalpia based on the evolutionary tomatoidea was obtained as very low, and almost absent for hypothesis presented by Malm et al. (2013). The outgroup the internal relationships among the eight families included comprises the genera Phryganopsyche Wiggins (Phryganopsy- of the analysis, in practice resulting in collapse of branches chidae), Phryganea Linnaeus (Phryganeidae), Taskiropsyche within the superfamily (Fig. 2H). Attempting to correctly Neboiss and Kokiria McFarlane (Kokiriidae), Anisocentropus place the genus Heloccabus Neboiss in the sericostomatoid McLachlan and Phylloicus Müller (Calamoceratidae), Molanna tree, Neboiss (2002) included representatives of 11 families Curtis (Molannidae), Condocerus Neboiss, Nectopsyche Müller in a morphologically based parsimony analysis together with and Gracilipsodes Sykora (Leptoceridae), Barynema Banks Heloccabus, and found the genus to form a sister group to Heli- (Odontoceridae), Aphilorheithrus Mosely (Philorheithridae), cophidae + Calocidae + Hydrosalpingidae + Sericostomatidae, Limnocentropus Ulmer (Limnocentropidae), and Trichovespula and decided to place the genus within the Helicophidae (Fig. 2I). Schmid, Tasiagma Neboiss and Tasimia Mosely (Tasimiidae). Updated analyses presented by Holzenthal et al. (2007a) for the The 149 voucher specimens are listed in Table 1 and are Trichoptera based on similar data as in their 2001 work strongly deposited in alcohol at the Swedish Museum of Natural His- supported the monophyly of Sericostomatoidea, but had low or tory (NHRS), in the Karl Kjer Laboratory at the University of no support for relationships among the 11 families included in California, or at the National Museum of Natural History, Smith- the analysis (Fig. 2J). Based on protein coding DNA sequences sonian Institution, Washington, DC. alone, i.e. removing the problems of alignment ambiguities of nonprotein coding gene sequences, Malm et al. (2013) published a revised hypothesis on the relationship among Tri- DNA extraction and sequencing choptera families and dated the nodes based on fossil data. One or more representatives of all the 12 families within the Seri- In order to test previous hypotheses on the evolutionary history costomatoidea were included and obtained strong to moderately of Sericostomatoidea, without potentially introducing alignment strong support for monophyly of all internal nodes as well as errors, we used fragments of four nuclear protein-coding genes: for the superfamily. All families were retained as monophyletic, 850 bp of carbamoylphosphate synthetase (CPSase of CAD), except Helicophidae, which was polyphyletic, i.e. divided by 720 bp of isocitrate dehydrogenase (IDH), 1099 bp of Elonga- the Hydrosalpingidae and Barbarochthonidae (Fig. 2K). Several tion factor 1a (EF-1a) and 772 bp of RNA polymerase II (POL efforts have been made to resolve internal relationships among II); and 658 bp of the protein coding mitochondrial cytochrome genera in several sericostomatoid families, e.g. Helicopsychi- oxidase I (COI). These genes have, in different combinations, dae (Johanson, 1998), Helicophidae (Johanson & Keijsner, been used for inferring phylogenies for genus and family level 2008), Conoesucidae (Johanson et al., 2009) and Calocidae or above within Trichoptera, Lepidoptera, Hymenoptera and (Johanson & Malm, 2010), but no results from these analyses Diptera, as well as among insect orders (Moulton & Wiegmann, challenged the monophyly of the families analysed, or the tax- 2004; Danforth et al., 2006; Wiegmann et al., 2009; Johanson onomic status of doubtfully classified genera. This work aims & Espeland, 2010; McKenna & Farrell, 2010; Mutanen et al., to hypothesize a stable classification of the Sericostomatoidea 2010; Winterton et al., 2010; Espeland & Johanson, 2010a,b; families and genera, testing the hypothesis of polyphyletic Malm & Johanson, 2011; Johanson et al., 2012; Malm & Helicophidae (see Neboiss, 2002; Malm et al., 2013), indi- Nyman, 2015). The extraction of the DNA followed the stan- cations of a polyphyletic Sericostomatidae (see Holzenthal dard methods: DNA was extracted from the abdomen in adult et al., 2007a), as well as present a hypothesis of more infor- specimens or the right hind leg in larvae, using the DNeasy mative classification of some of the previously incertae sedis Tissue Extraction Kit (Qiagen Inc., Valencia, CA, USA). Gene genera. regions were amplified using polymerase chain reaction (PCR)

Table 1. List of taxa included in the analyses, including gender (if adult) and instar (if juvenile), vouchers at the Swedish Museum of Natural History (NHRS), sequence length and GenBank accession number for each of the genes CAD, COI, IDH, EF-1a and POL-II.

NHRS Gene Gene Gene Gene Gene Gender/ voucher fragment fragment fragment fragment fragment Family Species instar code CAD COI IDH EF-1a POL-II

Ingroup Anomalopsychidae Anomalopsyche Male CL2 850 658 720 1099 772 minuta Anomalopsyche Male GB6 850 - KC559480 658 - KC559545 720 - KC559610 484 772 - KC559703 minuta Contulma sp. Female HX5 850 658 599 – 772 Contulma talamanca Male GB7 850 - KC559481 418 - KC559546 565 - KC559611 484 772 - KC559704 Antipodoeciidae Antipodoecia sp. Male EJ1 826 - KC559482 658 - KC559547 717 - KC559612 1099 772 - KC559705 Antipodoecia turneri Male CP8 850 - KC559483 658 - KC559548 717 - KC559613 1099 772 - KC559706 Barbarochtonidae Barbarochton Male GB8 850 - KC559485 658 - KC559551 717 - KC559616 1099 772 - KC559709 brunneum Beraeidae Beraea pullata Male K 850 658 - FJ263223 – 1099 - FJ263248 – Beraea walteri Male FT7 850 - KC559486 658 - KC559552 720 - KC559617 1099 772 - KC559710 Beraeamyia Male I 850 - FN257672 658 - FN257700 720 - KC559619 1099 - FN257705 772 - FN257711 squamosa Beraeodes minutus Male L 850 - KC559487 658 - EF395016 635 1099 772 - KC559711 Beraeodina palpalis Male G 525 658 – 484 – Ernodes articularis Male FU6 850 – – 484 – Ernodes saltans Male FT6 850 - KC559488 658 - KC559553 720 - KC559620 1099 772 - KC559712 Nippoberaea Male H – 652 – – – palpalis Calocidae Caenota plicata Male CR9 850 - FN257690 658 - EF395068 720 - FN601147 1099 - EF395132 802 - FN257729 Caloca ascita Male CT2 850 - FN257692 658 - FJ588701 720 - KC559622 1099 - FJ263262 772 - FN257731 Caloca saneva Male EO3 850 - FN257699 658 - FN257704 693 1099 - FN257709 772 - FN257738 Calocoides mynottae Female CR1 845 - FN257689 658 - EF395065 720 1099 772 - FN257728 Pliocaloca fidesria Male CQ3 850 - FN257687 658 - EF395064 720 - KC559623 1099 772 - FN257726 Pycnocentrella Male BR4 850 - FN257679 658 - EF395050 720 1099 772 - FN257718 eruensis Pycnocentrella Male BY9 850 - FN257682 658 - FN257701 720 - KC559624 1099 - FN257706 772 - FN257721 eruensis Tamasia variegata Male EN8 850 - FN257698 658 - FN257703 693 1099 - FN257708 761 - FN257737 Chathamiidae Chathamia Male DP2 850 - FN257694 658 - FJ263238 693 - KC559625 1065 - FJ263265 772 - FN257733 integripennis Philanisus plebeius Male BY4 825 - FN257681 658 - FJ263231 607 - KC559626 1099 - FJ263256 772 - FN257720 Philanisus plebejus Male EC7 850 658 – 1099 772 Conoesucidae Beraeoptera roria Male BN4 850 658 - EF395046 – 1099 772 Beraeoptera roria Male BQ2 850 658 - FJ263228 – 1099 - FJ263253 772 Beraeoptera roria Male BR1 850 - FN257678 658 - FJ263229 720 - KC559627 1099 - FJ263254 772 - FN257717 Coenoria boera Male CQ8 850 - FN257688 658 - FJ263234 720 - FN601146 1099 - FJ263259 802 - FN600839 Coenoria sp. Male EC5 850 658 - FJ263240 703 1099 - FJ263267 730 Confluens olingoides Male BQ6 850 658 - EF395114 720 1144 - EF395114 772 Conoesucus cf. Male CT3 850 - FN257693 658 - FJ263236 720 - KC559628 1099 - FJ263263 772 - FN257732 norelus Conoesucus Male CT7 850 658 - FJ263237 – 1099 - FJ263264 772 nepotulus Conoesucus sp. Male EN3 850 658 - FJ263241 720 1099 - FJ263268 772 Conoesucus sp. Male EN4 850 658 - FJ263242 720 1099 - FJ263269 773 Costora delora Male CS3 850 658 - EF395069 716 1099 772 Costora seposita Male EN5 850 - FN257697 651 - FJ263243 693 1099 - FJ263270 772 - FN257736 Costora seposita Male EN9 850 658 - FJ263244 693 1099 - FJ263271 772 Hampa patona Male CS4 850 658 - EF395005 720 1099 772 Lingora aurata Male CR6 850 658 - EF395066 720 1099 - FJ263260 – Matasia satana Male DP3 169 658 – 484 – Matasia sp. Male EO4 850 658 - FJ263245 693 1099 - FJ263272 772 Olinga jeanae Male BP1 850 658 - FJ263228 720 1099 - FJ263252 772 Olinga feredayi Male BM5 850 - FN257675 658 - EF395045 720 1099 772 Periwinkla childi Female BZ3 850 - FN257683 658 - FJ263232 720 1099 - FJ263257 772 - FN257722 Pycnocentria evecta Male BM9 850 658 - FJ263225 720 1099 - FJ263250 772 Pycnocentria Male BN2 850 658 - FJ263226 720 1099 - FJ263251 772 sylvestris Pycnocentrodes Male BM3 850 658 - FJ263224 720 1099 - FJ263249 772 aureolus Pycnocentrodes sp. Male BR9 850 658 - FJ263230 720 1099 - FJ263255 772

Table 1. Continued

NHRS Gene Gene Gene Gene Gene Gender/ voucher fragment fragment fragment fragment fragment Family Species instar code CAD COI IDH EF-1a POL-II

Helicophidae Alloecella grisea Female CS6 850 658 - EF395071 720 1200 772 Alloecella longispina Male CR7 850 658 - EF395067 583 1200 772 Alloecella pilosa Female CT4 831 658 720 1094 772 Alloecentrella sp. Male BP8 850 - FN257677 658 - EF395048 720 - KC559632 1099 772 - FN257716 Austrocentrus Male CL1 850 658 - EF395056 720 484 772 griseus Eosericostoma Larva BZ9 832 658 720 1099 772 aequispina Eosericostoma Male CK9 850 - FN257685 658 - EF395057 720 - KC559633 1099 772 - FN257724 inaequispinum Helicopha acuta Male BY3 850 658 - EF395052 717 1086 772 Helicopha Male K3 850 658 - EF395009 700 1200 – amieuensis Helicopha Female AU2 850 658 - EF395042 700 484 – aoupiniensis Helicopha astia Male EN2 850 658 714 1099 772 Helicopha bifurcata Male M2 850 658 - EF395027 717 1200 – Helicopha caota Male K4 169 658 - EF395010 700 1200 – Helicopha Male K6 850 658 - EF395012 700 1200 772 dognyensis Helicopha Male K5 – 658 - EF395011 – 484 - EF395076 744 dognyensis Helicopha einap Male N3 423 658 - EF395036 700 1200 – Helicopha einap Male M5 395 658 - EF395029 – 1200 – Helicopha einap Male N1 394 658 - EF395034 – 1200 – Helicopha Female K8 832 658 - EF395014 717 484 772 hienghenensis Helicopha koghi Male K1 850 658 717 484 754 Helicopha koghi Female L5 850 658 - EF395021 717 484 - EF395086 – Helicopha koghi Male K2 850 658 - EF395008 463 484 – Helicopha koghi Male N7 528 658 – 484 – Helicopha Male AY3 850 658 - EF395044 697 1099 772 mouirangensis Helicopha Female M8 806 658 - EF395032 – 1200 – neocaledonia Helicopha ninguana Female L1 – 658 - EF395017 463 484 – Helicopha pouebo Male L3 831 - FN257673 658 - EF395019 717 - KC559634 1092 772 - FN257712 Helicopha Male CQ2 850 658 - EF395063 714 484 772 queenslandensis Helicopha stellata Male M3 850 658 - EF395028 717 1200 – Heloccabus EX2 850 658 680 939 772 buccinatus Heloccabus Larva EQ1 850 658 – 484 – buccinatus Zelolessica cheira Male BP4 850 - FN257676 658 - EF395047 717 - KC559635 1099 772 - FN257715 Helicopsychidae Helicopsyche Male BF7 850 658 697 1099 – (Cochliopsyche) opalescens Helicopsyche Female ED9 850 658 714 716 772 (Cochliopsyche) vazquezae Helicopsyche Male CE6 846 658 - EF395053 720 484 - EF395117 – (Feropsyche) borealis Helicopsyche Female EE1 850 658 717 715 772 (Feropsyche) guianensis Helicopsyche Male DF1 850 - KC559493 658 - KC559558 720 - KC559637 1099 772 - KC559717 (Helicopsyche) angusta Helicopsyche Male CA3 812 658 720 – 772 (Helicopsyche) angusta

Table 1. Continued

NHRS Gene Gene Gene Gene Gene Gender/ voucher fragment fragment fragment fragment fragment Family Species instar code CAD COI IDH EF-1a POL-II

Helicopsyche Male DE9 855 658 – 1099 – (Helicopsyche) bacescui Helicopsyche Male DE7 796 658 – 484 – (Helicopsyche) sperata Helicopsyche Larva DF3 771 658 – 442 – (Petrotrichia) kantilali Helicopsyche Male DP4 850 658 703 462 – (Petrotrichia) palpalis Helicopsyche Male BR5 823-FN257680 658 - EF395051 720 1144 772 - FN257719 (Saetotricha) albescens Helicopsyche Male AA1 850 658 – 1062 – (Saetotricha) apicolobata Helicopsyche Male CP5 849 658 - EF395061 720 1200 772 (Saetotricha) cochleaetesta Helicopsyche Male CP6 – 658 - EF395062 721 484 – (Saetotricha) murrumba Helicopsyche Male AD1 850 658 - EF395007 – 563 - EF395072 – (Saetotricha) neocaledonia Helicopsyche Male BN3 810 658 715 – – (Saetotricha) poutini Helicopsyche Male CP4 – 658 550 484 – (Saetotricha) ptychopteryx Rakiura vernale pupa N9 850 - FN257674 658 - EF395041 720 - KC559636 1099 772 - FN257713 Hydrosalpingidae Hydrosalpinx sericea Male GB9 842 - KC559494 658 - KC559559 712 - KC559639 1099 772 - KC559718 Petrothrincidae Petrothrincus acuta AT5 850 - KC559504 658 - KC559569 568 - KC559649 1099 772 - KC559728 Petrothrincus Male GC2 850 - KC559505 658 - KC559570 – 1144 772 - KC559729 circularis Petrothrincus Male GC1 850 - KC559507 658 - KC559572 720 - KC559651 1144 772 - KC559731 triangularis Petrothrincus sp. AT7 850 - KC559506 658 - KC559571 641 - KC559650 1099 772 - KC559730 Sericostomatidae Agarodes distinctus Male GC3 169 658 – 484 – Cheimacheramus Male EZ1 850 418 – 484 – ranomafanensis Fattigia pele Male GC4 – – – 1200 – Grumicha grumicha Male GC5 – 658 – 484 – Gumaga amudita Male FA7 169 658 – 484 – Gumaga orientalis Male DP5 850 - KC559511 658 - KC559577 568 - KC559655 1099 772 - KC559736 Myotrichia murina Male HX8 850 658 719 716 772 Notidobia ciliaris Male FC8 – 658 – 484 – Notidobiella Male CL5 850 - FN257686 658 - EF395058 620 - FN601143 1099 - EF395122 802 - FN257725 chacayana Notidobiella sp. Male CL3 – 658 – 484 725 Notidobiella sp. Male CM4 – 658 – 1099 772 Oecismus monedula Male FV1 169 658 – – – Parasericostoma Male CM1 850 658 720 1099 772 acutum Parasericostoma Male CM7 850 658 720 484 - EF395124 772 drepanigerum Parasericostoma Male CM6 850 658 - EF395059 703 1099 772 ovale Petroplax caricis Male GC6 – 658 693 1099 738

Table 1. Continued

NHRS Gene Gene Gene Gene Gene Gender/ voucher fragment fragment fragment fragment fragment Family Species instar code CAD COI IDH EF-1a POL-II

Petroplax curvicosta Male GC7 – 443 693 1099 738 Rhoizema saxiferum Male GC8 169 658 – 1099 772 Schizopelex festiva Male FC7 – 658 – 484 – Schizopelex furcifera Male DP6 – 658 – 1200 – Sericostoma Male FA5 169 435 – – 772 baeticum Sericostoma Male CC4 850 - FN257684 658 - FJ263233 720 - KC559656 1099 - FJ263258 802 - FN257723 clypeatum Sericostoma Male A1 – 658 720 1086 772 personatum Incertae sedis in Sericostomatoidea Karomana didinki Male FD3 – 658 – – – Ngoya elwe Male FD9 169 658 – – – Seselpsyche matyoti Male FU9 412 658 – 484 – Outgroup Tasimiidae Tasiagma ciliata Male CS1 850 - KC559512 658 - KC559578 720 - KC559657 1099 772 - KC559737 Tasimia palpata Male CS2 850 - FN601041 658 - FN600943 720 - FN601148 1099 - FN600743 802 - FN600840 Trichovespula Male CL7 850 - FN601039 658 - FN600941 720 - FN601144 1099 - FN600741 802 - FN600838 macrocera Philorheithridae Aphilorheithrus Male DE3 850 - FN601043 658 - FN600945 717 - FN601151 1099 - FN600745 802 - FN600842 decoratus Austhreithrus Male EX1 850 - FN601044 658 - FJ263246 – 1099 - FN600746 772 - FN600843 glymma Philorheithrus agilis Male BP7 850 - FN601037 658 - FN600939 720 - FN601141 1144 - FN600739 802 - FN600836 Phryganeidae Phryganea grandis Male CF2 850 - FN601038 658 - FN600940 720 - FN601142 1099 - FN600740 772 - FN600837 Phryganopsychidae Phryganopsyche Male GG3 850 - KC559508 658 - KC559573 568 - KC559652 1099 772 - KC559732 latipennis Kokiriidae Kokiria miharo Male BP6 845 - FN601036 658 - FN600938 720 - FN601140 1099 - FN600738 768 - FN600835 Taskiropsyche Male CS5 850 - FN257691 658 - FJ263235 616 - FN601149 1099 - FJ263261 802 - FN257730 lacustris Leptoceridae Hudsonema Larva BH7 850 - FN257696 658 - FJ263239 720 - FN601166 1087 - FJ263266 802 - FN257735 paludosus Gracilipsodes aureus Male AG9 850 - FN601047 658 - EF428534 717 - FN601155 1099 - EF428510 802 - FN600846 Nectopsyche Male CF1 850 - FN601065 658 - FN600963 717 - FN601175 1099 - FN600763 802 - FN600864 punctata Limnocentropodidae Limnocentropus Male FU8 850 - FN601131 658 - FN601028 717 - FN601241 1099 - FN600828 772 - FN600931 himalayanus Molannidae Molanna angustata Male A6 850 - FN257671 658 - FJ263247 720 - FN601139 1099 - FJ263247 802 - FN257710 Odontoceridae Barynema sp. Male CQ7 850 - FN601040 658 - FN600942 720 - FN601145 1099 - FN600742 802 - FN600839 Calamoceratidae Anisocentropus Male FC3 850 - FN601122 658 - FN601019 717 - FN601232 1099 - FN600819 772 - FN600922 thinlin Phylloicus lituratus Male GE5 850 - FN601133 658 - FN601030 714 - FN601243 1099 - FN600830 772 - FN600933

CAD, carbamoylphosphate synthetase; COI, cytochrome oxidase I; IDH, isocitrate dehydrogenase; EF-1a, Elongation factor 1a; POL-II, RNA polymerase II. with Ready-To-Go PCR Beads (Pharmacia Biotech, Uppsala, run at 96∘C (1 min) followed by 25 cycles of 96∘C(30s), Sweden). Each 25 μL PCR reaction contained 2 μLofDNA, 50∘C(15s)and60∘C (4 min). Finally, the sequencing reac-

1 μL of each primer (10 μm) and 22 μLofdH2O. PCRs were per- tions were purified using the DyeEx 96 Kit (Qiagen Nordic, formed under the following conditions: 95∘C for 5 min, followed Solna, Sweden). Raw sequence data and contigs were viewed by 40 cycles of 95∘C for 30 s, annealing temperature for 30 s and and assembled using the Pregap4 and Gap4 modules of the 72∘C for 40–50 s, followed by a final extension of 8 min at 72∘C. staden software package (Staden et al., 2000). Each sequence See Table 2 for a list of primers used. PCR products were puri- region was sequenced using both forward and reverse primers, fied using EXOSAP (GE Healthcare Life Sciences, Pittsburgh, and EF-1a was always amplified in two overlapping regions. Pennsylvania). The same primers were used for both sequenc- Primer sequences were removed from the beginning of each ing and PCR. Sequencing reactions were prepared using the sequence, and matching forward and reverse sequences for each BigDye Terminator 3.1 Cycle Sequencing Kit (Applied Biosys- gene region ensured the accuracy of sequence data. Heterozy- tems, Inc., Foster City, CA, USA) and cycle-sequencing was run gous sites were replaced with N and treated as missing data. In on an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, a few cases, full-length sequences were not possible to obtain in Inc.). Each 20 μL sequencing reaction mixture included 1 μL one run, and internal primers were used to produce shorter frag- of BigDye, 1 μLof1.6μm primer, 2–4μLofDNAtemplate ments. Correct reading was difficult at the beginning or at the end and diluted with dH2O to a total volume of 25 μL, and was of a small number of sequences, resulting in shorter sequences

Table 2. List of primers used in PCR reactions and sequencing.

Gene Direction Primer name Primer sequence (5′ –3′) References

COI Forward LCO1490 GGTCAACAAATCATAAAGATATTGG Folmer et al. (1994) Reverse HCO2198 TAAACTTCAGGGTGACCAAAAAATCA Folmer et al. (1994) Forward COImidF GAGCACCWGATATAGCHTTYCCYCG Johanson et al. (2012) Reverse COImidR GAACHGGATGAACWGTNTAHCCNCC Johanson et al. (2012) CAD Forward CAD743nF GGNGTNACNACNGCNTGYTTYGARCC Wahlberg & Wheat (2008) Reverse CAD1028R TTRTTNGGNARYTGNCCNCCCAT Wahlberg & Wheat (2008) Forward CAD743nF-ino GGIGTIACIACIGCITGYTTYGARCC Johanson & Malm (2010) Reverse CAD1028R-ino TTRTTIGGIARYTGICCICCCAT Johanson & Malm (2010) IDH Forward IDHdeg27F-ino GGWGAYGARATGACIAGRATHATHTGG Malm & Johanson (2011) Reverse IDHdegR-ino TTYTTRCAIGCCCAIACRAAICCICC Malm & Johanson (2011) POL Forward POLFOR2 TGGGAYGSYAAAATGCCKCAACC Modified from Danforth et al. (2006) Reverse POLREV2 TYYACAGCAGTATCRATRAGACCTTC Modified from Danforth et al. (2006) Forward LeptoF-ino TRAARCCIAARCCIYTITGGAC Johanson & Malm (2010) EF-1a Forward Lepto-IF TTCGTNCCNATCTCAGGNTGGC Johanson & Malm (2010) Reverse aIntR CCAYCCCTTGAACCANGGCAT Malm & Johanson (2008) Forward aF ATCGAGAAGTTCGAGAARGARGC Kjer et al. (2001) Reverse aR GGGAAYTCCTGGAARGAYTC Kjer et al. (2001) Forward M46.1 GAGGAAATYAARAAGGAG Whiting (2002)

CAD, carbamoylphosphate synthetase; COI, cytochrome oxidase I; IDH, isocitrate dehydrogenase; EF-1a, Elongation factor 1a; POL-II, RNA polymerase II. for some specimens. All shorter sequences were aligned with together with bootstrap support values for internal branches the full-length sequences using the MUSCLE alignment option were calculated using the raxml-hpc v.8 (Stamatakis, 2014) in geneious6, with Anchor optimization and ClustalW as on the Cipres Science Gateway server (http://www.phylo.org) sequence weighting scheme (Thompson et al., 1994). (Miller et al., 2010). The analyses encompassed 1000 replicate bootstrap iterations in total, with the same partitions as for the Bayesian analysis and using the GTRCAT model. The majority Phylogenetic analyses consensus tree from the trees generated in the Bayesian analyses was produced in geneious 6.1.6 (Biomatters Ltd.). Most parsi- Each of the individual genes was treated as a separate parti- monious trees were inferred in paup*4.0 (Swofford, 2002) by tion in the analyses, resulting in a data set comprising 4099 bp in applying the heuristic search option, tree bisection reconnection five partitions. The number of parsimony informative characters (TBR), and stepwise additions in 1000 iterations with random was calculated in paup*4.0 (Swofford, 2002). The partitioned starting points and saving 200 shortest trees in each replicate. data set was analysed by Bayesian methods using the Markov chain Monte Carlo in mrbayes 3.2 (Ronquist & Huelsenbeck, 2003). The data were analysed applying the mixed rate sub- Results stitution model (nst = mixed, rates = gamma). The models were incorporated in the analysis for the purpose of data exploration, In the resulting trees from the Bayesian analyses (Figs 3, and the presentation of corroborated nodes on the combined 4) clades with posterior probability (PP) support ≥95% are analysis tree. All partitions were unlinked, allowing each par- considered strongly supported and indicated by thick lines, tition to have its own set of parameters, and each partition and those below 95% PP support are considered moderately was allowed to evolve at different rates under a flat Dirichlet strong to weakly supported and indicated by thin lines. Posterior prior. The analyses were performed on Cipres Science Gate- probability support values are indicated only for clades with less way (http://www.phylo.org) (Miller et al., 2010) with random than 100% PP support. starting trees without constraints. In each of the analyses, the temperature was set to 0.11, number of chains to four, paral- lel runs to two, and the analysis was run for 10 00 000 gener- Data set with 90 taxa ations with a sampling frequency of 5000. The average standard deviation of split frequencies was used to determine when A data set including only taxa with all five genes represented convergence was reached (<0.01), and all trees generated after comprises 90 evolutionary units, and of the 4099 characters convergence were summarized in a majority rule consensus tree 1781 were parsimony-informative. The standard deviation of in geneious 6.1.6 (Biomatters Ltd, Auckland, New Zealand). split frequency threshold of 0.01 was reached after 80 000 Split frequencies lower than 0.01 were used as a burn-in thresh- generations. old. All analyses were repeated twice to ensure that final trees Based on the tree generated from the majority rule con- converged on the same topology. Maximum likelihood trees sensus of 19 984 trees using the mixed model (Fig. 3), the

Fig. 3. Hypothesis of the evolutionary relationships among Sericostomatoidea taxa derived from a Bayesian analysis of 90 taxa with DNA sequences for all five genes included in the analysis. The position of Sericostomatoidea is indicated by an arrow. Letters in circles refer to parts ofthetreediscussed in the text. Thick lines indicate groups supported by posterior probabilities of ≥95% and only posterior probabilities <100% are provided. Taxon names in red are traditionally classified in the Helicophidae. Taxon names in blue are traditionally classified in the Sericostomatidae. The lehorizontal sca bar indicates the average number of substitutions per site.

Fig. 4. Legend on next page.

Sericostomatoidea (node A) and all except two previously recog- rescaled consistency index of each character, the third posi- nized families are found to be monophyletic with PPs of 100%. tions for all genes were generally moderately to strongly The Anomalopsychidae was previously argued to represent the down-weighted compared with the first and second positions sister group to all other families in the superfamily (Weaver, and one shortest tree was retained (L = 27 130, CI = 0.1754, 1983), but in our analyses (node B) the Anomalopsychidae RI = 0.4658, RC = 0.0817) (Figure S3). The resulting tree is, forms the sister group to Chathamiidae + Helicopsychidae, and to a large degree, similar to that from the Bayesian analysis, these three families form the sister group to the rest of the with only a few inconsistencies as described later. The first families in the superfamily (node C). The nodes B and C branching event within Sericostomatoidea separates the sister have PP support of 99 and 96.2, respectively, indicating the groups Antipodoeciidae + Beraeidae and Helicopsychidae + presence of weak conflict in the data set. Within node D, Chathamiidae + Anomalopsychidae from the remaining seri- the Antipodoeciidae was assembled as a sister group to the costomatoids. The Anomalopsychidae are paraphyletic, with Beraeidae with high PP support (99.5%), a classification diver- Contulma Flint forming the sister group to Chathamiidae, and gent from previous hypotheses (Fig. 2F, I–K) where Antipo- Contulma + Chathamiidae in turn forming the sister group of doeciidae grouped as a sister group to the Anomalopsychidae Helicopsychidae. The remaining tree topology is identical to or appeared with uncertain placement. The Sericostomatidae that from the Bayesian analysis. (excluding the genera Parasericostoma Schmid and Myotrichia Schmid) and Petrothrincidae form a monophyletic clade (PP = 97.2%), being the sister group to a monophyletic group Data set, 149 taxa holding the remaining families (node E) with PP support of 99.7%. With a 100% PP support, the Barbarochthonidae and A data set including all taxa represented comprises 149 Helicophidae (minus Heloccabus) are sister groups (node F), evolutionary units and 1826 parsimony-informative characters. a hypothesis not offered earlier. Clade G (Fig. 3) is strongly In mrbayes, the standard deviation of split frequency of 0.01 supported as monophyletic and is divided into a weakly sup- was reached after 35 00 000 generations and all preceding trees ported clade H (pp 85.1%), comprising Calocidae as sister were discarded as burn-in. The majority consensus tree was Heloccabus group to Hydrosalpingidae + , and a strongly sup- derived from 12 820 trees and is given in Fig. 4. ported clade I (pp 99.9%). Clade I contains a cluster of the The Sericostomatoidea was recovered as monophyletic (node two sericostomatid genera, Parasericostoma and Myotrichia,as A) but with low support (pp 88.2%), and monophyly of most well as the Conoesucidae. The genus Heloccabus was found of the deeper nodes in the superfamily, including several fami- by Neboiss (2002) to constitute the sister group to the Seri- lies, received low support or was unsupported. Three families costomatidae + Hydrosalpingidae, which is fairly similar to our appeared as polyphyletic: Beraeidae, Helicophidae and Seri- findings, where Heloccabus forms the sister group to Hydros- costomatidae. The Beraeidae is divided into two groups, one alpingidae. comprising Nippoberaea Botosaneanu, Nozaki & Kagaya, appearing early in clade B as sister group to Chathamiidae, raxml and one comprising the rest of the Beraeidae which is sister The results of the analysis using the raxml (Figure S1) are to to the remaining taxa in clade E. Nippoberaea + Chathamiidae a large extent similar to that from the Bayesian analysis. The form the sister group to a monophyletic Helicopsychidae. This main differences are that in Bayesian analysis Antipodoeciidae clade (node B) forms the sister group to all remaining sericos- and Beraeidae are sister groups, while in the raxml tree tomatoids (clade C). The monophyly of both Helicopsychidae Beraeidae and Antipodoeciidae are recovered in sequence but and Chathamiidae is strongly supported (PP = 99.8 and 100%, with low support. In addition, the Bayesian analysis grouped respectively). Within the Beraeidae, excluding Nippoberaea, Calocidae together with (Heloccabus + Hydrosalpingidae) in a the monotypic Beraeodina Mosely forms the sister group to monophyletic group, while in the raxml analysis this group is the rest of the genera, which are fully resolved by 100% PP. recovered in sequence. With strong support, Anomalopsychidae are monophyletic (pp 98.7%) and form the sister group to Antopodoeciidae + Ngoya Parsimony (PP = 99.8%) (node D). At node F, Seselpsyche, which together The analysis generated two shortest trees [length (L) = 27 099, with the majority of Sericostomatidae genera form a mono- consistency index (CI) = 0.1756, retention index (RI) = 0.4665, phyletic clade (PP = 100%), are separated from the remaining rescaled consistency index (RC) = 0.0819], recovered in 10% groups (defined by node G, PP = 79.3%). At node G Petrothrin- of the iterations. After successive reweighting based on the cidae form the sister group to remaining clades (node H).

Fig. 4. Hypothesis of the evolutionary relationships among Sericostomatoidea taxa derived from a Bayesian analysis of 149 taxa with DNA sequences for between one and five genes included in the analysis. The position of Sericostomatoidea is indicated by an arrow. Letters in circles refertoparts of the tree discussed in the text. Thick lines indicate groups supported by posterior probabilities of ≥95% and only posterior probabilities <100% are provided. Taxon names in red are traditionally classified in the Helicophidae. Taxon names in blue are traditionally classified in the Sericostomatidae. Taxon names in green are previously classified as incertae sedis outside any established family. The horizontal scale bar indicates average number of substitutions per site.

As in the results from the analysis of the smaller data instead of immediately after. Third, the Calocidae + set, Hydrosalpingidae form the sister group to Heloccabus (Karomana + Barbarochthonidae + Helicophidae excluding with the inclusion of Grumicha as a sister group to Heloc- Heloccabus) form a paraphyletic rather than a mono- cabus (PP = 99.7%). These three taxa form a sister group to phyletic group as Calocidae appear in a polytomy with (Parasericostoma + Myotrichia)(PP= 100%) + Conoesucidae Hydrosalpingidae + (Grumicha + Heloccabus)andParaseri- (PP = 100%) as in the analysis above based on fewer taxa. In a costoma + Myotrichia + Conoesucidae. Configurations among weakly supported node I (PP = 57.7%) Calocidae (PP = 100%) the other clades are identical, and the configurations within is the sister group to a weakly supported group containing Karo- separate clades are the same between the two analyses. mana + Barbarochthonidae (PP = 70.9%) and Helicophidae (PP = 89.8%) (node J). Parsimony The Helicophidae (indicated in red in Fig. 4) is polyphyletic The analysis generated 18 shortest trees (L = 32 697, and divided into a monotypic Heloccabus as the sister group to CI = 0.1627, RI = 0.5340, RC = 0.0869), recovered in 4% the sericostomatid Grumicha Müller, and a weakly supported of the iterations. After successive reweighting based on the (PP = 89.8%) monophyletic group comprising the remaining rescaled consistency index of each character, the third positions genera in the family. for all genes were generally strongly down-weighted compared The Sericostomatidae (indicated in blue in Fig. 4) is poly- with first and second position positions and three shortest phyletic and divided into three distantly related branches. trees were retained (L = 32 738, CI = 0.1538, RI = 0.5333, One branch includes Grumicha as the sister group to Heloc- RC = 0.0867) (Figure S4). The resulting tree is, to a large cabus (PP = 100%), and Grumicha + Heloccabus, constituting degree, similar to that from the Bayesian analysis, but with a a well-supported sister group to Hydrosalpingidae (PP sup- few important inconsistencies, particularly near the root of the port = 99.7%). A second group of the Sericostomatidae superfamily. The Sericostomatoidea appears as monophyletic, comprises a monophyletic Parasericostoma + Myotrichia with an early clade comprising Helicopsychidae as sister group (PP = 100%). In this clade the genus Parasericostoma is to Nippoberaea. This clade is the sister group to the remaining paraphyletic due to inclusion of Myotrichia. The third group representatives in the superfamily, where smaller groups branch comprises the majority of sericostomatid genera, the type genus off successively, starting with Chathamiidae + Contulma; of the family, as well as the previously classified incertae sedis Antipodoeciidae + Ngoya + Anomalopsychidae; and the genus Seselpsyche (indicated in green in Fig. 4). This group remaining families in Sericostomatoidea. The branching is strongly supported as monophyletic (PP = 100%). In this sequence in the remaining tree, starting with the Beraei- clade, the Madagascan endemic Cheimacheramus Barnard dae, is almost identical to that from the Bayesian analysis, and Seychellean endemic Seselpsyche form a monophyletic except that Hydrosalpingidae + Grumicha + Heloccabus sister group to the other genera in the clade. The next clade form the sister group to Calocidae instead of to Paraseri- branching off within this clade is Rhoizema Barnard + Petroplax costoma + Myotrichia + Conoesucidae. Barnard, which form the sister group to a clade containing two subclades, one comprising the Notidobiella Schmid and the Gumaga Tsuda, the other comprising Oecismus McLachlan, Discussion Notidobia Stephens, Fattigia Ross & Wallace, Agarodes Banks, Schizopelex McLachlan and Sericostoma Latreille. However, Data support the monophyly of some of the internal groups is only weakly supported. In our results the majority rule consensus tree generated from One of the incertae sedis taxa within Sericostomatoidea (indi- the analysis of 149 taxa versus 90 taxa was generally more cated in green in Fig. 4) is the monotypic genus Ngoya that weakly supported at many nodes, particularly older nodes were forms a strongly supported monophyletic clade together with poorly supported. A reason for this might be that in the larger Antipodoecidae (PP = 99.8%) (node D). Another incertae sedis data set, data are more incomplete for some taxa. This may taxon within Sericostomatoidea is Karomana, which together also contribute to these taxa more readily changing positions with the Barbarochthonidae form a weakly supported mono- throughout the analyses. Some genes are better at resolving phyletic clade (PP = 70.9%) as sister group to the larger group deeper nodes in the tree, particularly CAD (Malm et al., 2013; of Helicophidae (PP = 80.3%). Bukontaite et al., 2014), and some taxa in the larger data set include sequences from COI only, or COI in combination with shorter fragments of other genes. raxml Considering morphological signal, Weaver (1983) listed The results of the analysis using the raxml (Figure S2) the following two synapomorphies for the Sericostomatoidea: were different from those based on Bayesian methods in a reduced tergite IX in the larva, and reduced number of three important aspects. First, in the raxml results the mid-leg preapical spurs in the adults. Frania & Wiggins (1997) Helicopsychidae is the sister group to all other taxa in gave the additional potential synapomorphy for the Sericos- Sericostomatoidea. Secondly, the Beraeidae (excluding tomatoidea: larvae with posterior third of pronotum lightly Beraeodina) branches off immediately before the group tanned. There are only a few examples in literature where comprising Ngoya + Antipodoeciidae + Anomalopsychidae, synapomorphies for individual families have been presented

Fig. 5. Accepted hypothesis of the evolutionary relationship among families in the Sericostomatoidea, based on the analysis including 90 taxa and complete genetic sequence data and strong overall posterior probability support at all major nodes. The new families Heloccabucidae fam.n. and Parasericostomatidae fam.n. are included. The maps to the right of the taxon names indicate roughly the biogeographical affinity of the respective taxa. The right column lists the number of maxillary palp segments in the males of the respective family, showing great variation among sericostomatoid families.

(e.g. Neboiss, 2002), and the hypothesis of monophyly of the Heloccabucidae + Hydrosalpingidae, and Paraseriocostom- families is most often based on a combination of diagnostic atidae + Conoesucidae. Several adult characters that are characters. Within the superfamily, many clades receive no traditionally considered stable at higher taxonomic levels support from morphological data in adults, but larval characters and frequently applied in the classification of Trichoptera do were applied by Neboiss (2002) to support internal clades. not appear as useful for the Sericostomatoidea, e.g. when map- When comparing available morphological data of adults, no ping the number of maxillary palp segments (Fig. 5). In most synapomorphies are found for the family pairs Helicopsychi- cases, both the forewing and hindwing venation are different dae + Chathamiidae, Antipodoeciidae + Beraeidae, Sericostom- between family pairs as well, such as wing coupling mechanism, atidae + Petrothrincidae, Helicophidae + Barbarochthonidae, and position of termination of both Cu2 and A in the forewing.

Among-family relationships The present data set is more comprehensive compared with that in Malm et al. (2013), particularly regarding the number Most of the preceding phylogenetic analyses of the relation- of included sericostomatoid genera, as well as the inclusion of ships among sericostomatoid families by various authors (Fig. 2) one more gene (EF-1a). There are uncertainties in the results excluded many families or resulted in branch collapses, and for comprising 149 taxa, particularly regarding the phylogenetic these our results are incomparable. Of the available resolved position of Karomana and Nippoberaea. Therefore, we urge trees our hypothesis is to a large extent similar to that of Malm caution about the placement of these taxa. et al. (2013) (Fig. 2K). Our findings that Barbarochthonidae and Helicophidae are sister groups (Fig. 3) or closely related (Fig. 4) contradicts Within-family relationships Neboiss (2002), who argued that these two families are distantly related, while Malm et al. (2013) grouped Barbarochthonidae Previous efforts to formulate a well-supported phylogenetic as a sister group to one part of an otherwise polyphyletic Heli- hypothesis of families in Sericostomatoidea were generally cophidae. There are no morphological characters in the adults unsuccessful, possibly caused by weak taxonomic coverage that indicate a close relationship, except that males of species in at the family level, or analyses resulting in a high degree the Australian helicophid genera and males in Barbarochthon of branch collapse (Fig. 2) due to choice of characters with Barnard have reduced venation medially in the hindwings. or without conflicting phylogenetic signal. However, within In the analysis of 90 taxa (Fig. 3), Sericostomatidae and the few comprehensive analyses published previously, generic Petrothrincidae form sister groups. This configuration was also relationships within families correspond, to a large degree, with found by Malm et al. (2013) but a competing hypothesis was the result obtained herein. presented by Neboiss (2002), who separated these families When comparing our results with that from the parsimony within two different major clades. In the analysis including 149 analyses of morphological characters on Helicopsychidae taxa (Fig. 4), the two families form a paraphyletic group where (Johanson, 1998) we see a highly congruent pattern. The differ- Sericostomatidae represents the sister group to other taxa in the ence is primarily that in our analysis the Helicopsyche subgenus clade at node F, of which Petrothrincidae is the first family to Cochliopsyche Müller forms a sister group to the subgenus Fer- branch off. Morphological characters in the adults do not support opsyche Johanson, while Johanson (1998) placed the subgenus either of these hypotheses. Cochliopsyche as a sister group to the Helicopsyche subgenus The hypothesis of Beraeidae as the closest relative to the Galeopsyche Johanson. Antipodoeciidae as found in the analysis based on 90 taxa (node Johanson & Keijsner (2008) performed a parsimony-based D in Fig. 3) is novel. Beraeidae was previously found to be analysis of DNA sequence data of Helicophidae and our results related to the Calocidae (Frania & Wiggins, 1997), the Conoesu- confirm their results, except that in the present work wefound cidae (Neboiss, 2002), or as a sister group to a clade containing that the genus Alloecella Banks forms the sister group to Eoseri- seven other families (Malm et al., 2013). In the analysis includ- costoma Schmid instead of Alloecentrella Wise + Austrocentrus ing 149 taxa (node E in Fig. 4) Beraeidae forms a paraphyletic Schmid. However, the latter configuration was only weakly sup- group with Antipodoeciidae + Anomalopsychidae + Ngoya, ported in the previous analysis. corroborating the idea that the two families are closely related. In parsimony and Bayesian phylogenetic analyses of the The Calocidae were previously assumed to be closely Conoesucidae, based on molecular data (Johanson et al. 2009), related to the Beraeidae and the Sericostomatidae (Ross, this family was divided into two major groups: one clade com- 1967, 1978); the Beraeidae and Helicophidae (Frania prising Costora, Coenoria Mosely, Matasia Mosely, Lingora & Wiggins, 1997); or as a sister group to Conoesuci- Mosely and Hampa Mosely, which was the sister group to the dae + Hydrosalpingidae + Helicophidae + Barbarochthonidae other clade, which comprised the remaining genera (Olinga (Malm et al., 2013). In the analysis of 90 taxa (Fig. 3, node McLachlan, Conoesucus Mosely, Pycnocentria McLachlan, H) this family forms the sister group to Hydrosalpingi- Pycnocentrodes Tillyard, Periwinkla McFarlane, Confluens dae + Heloccabusidae fam.n., while in the tree based on Wise and Beraeoptera Mosely). We retained monophyly of the 149 taxa (node I in Fig. 4) the Calocidae is the sister group to same two groups but with some differences within each. In Karomana + Barbarochthonidae + Helicophidae (node J). No particular, we found that Confluens forms the sister group to morphological characters in the adults support either alternative. Periwinkla instead of Beraeoptera; the latter alternative was not Malm et al. (2013) included all 12 families of Sericos- strongly supported by Johanson et al. (2009). tomatoidea in their analysis of the evolution of the order Our result for the internal configuration in Calocidae was fully Trichoptera, and retained a polyphyletic Helicophidae, the congruent with that found by Johanson & Malm (2010) based on monophyly interrupted by inclusion of Barbarochthonidae and molecular data. Hydrosalpingidae. In addition, both they and Neboiss (2002) found Antipodoeciidae and Anomalopsychidae to be sister groups, a configuration not retained in our analysis of the 90-taxa Taxonomic implications data set. In the hypothesis based on the 149-taxa dataset, these two families were retained as sister groups only when removing As shown earlier, the previously established taxonomy of taxa Ngoya elwe Schmid. in the Sericostomatoidea is insufficient to correctly reflect the

© 2016 The Authors. Systematic Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. 42, 240–266 Phylogeny of Sericostomatoidea 255 evolution of the group, particularly because the present taxon- Anomalopsychidae Flint omy includes several polyphyletic families. In all our results, the monotypic genus Myotrichia, represented by M. murina Type genus. Anomalopsyche Flint, 1967: 66. Schmid, leaves a paraphyletic Parasericostoma, represented Taxonomic history. The representatives of the family were by P. acutum Flint, P. drepanigerum Flint, P. ov a l e Schmid originally classified in Sericostomatidae. When erecting the and an unidentified Parasericostoma sp. Instead of dividing family Anomalopsychidae Flint (1981) implied that it is related Parasericostoma into two genera, Myotrichia is synonymized to Beraeidae, Helicophidae and Antipodoeciidae, from which with Parasericostoma. males of Anomalopsychidae are separated by having ocelli, a In all our trees, the Sericostomatidae are divided into three more complete wing venation and a reduction of number of separate monophyletic groups. As a consequence we estab- maxillary palp segments. Within the Sericostomatoidea, it was lish a new family, Parasericostomatidae fam.n.,forParaseri- classified as the sister group to the rest of the families dueto costoma + Myotrichia, which is monophyletic and well sup- the presence of ocelli which was presumed primitive, a consid- ported by our data. Sericostomatidae is retained for the seri- eration adopted by deMoor (1993). Frania & Wiggins (1997), costomatid clade, including the type genus Sericostoma.The however, grouped Anomalopsychidae as sister group to the Heli- position of the third sericostomatid branch, comprising a sin- copsychidae, and Neboiss (2002) found that Anomalopsychidae gle monotypic genus (Grumicha), is based on sequences from and Antipodoe/iciidae were sister families, which was also sup- COI and the first half of EF-1a only, and is therefore not ported by Malm et al. (2013). The majority of the 27 described considered fully reliable. The Helicophidae is, regardless of species in the family were described by Flint (1991), Holzenthal analysis method, separated into two monophyletic clades, one & Flint (1995) and Holzenthal & Robertson (2006), who also comprising the monotypic genus Heloccabus, represented by indicated that the adults are very rarely collected (Holzenthal & Heloccabus buccinatus Neboiss, and the second comprising the Robertson, 2006). other genera. Helicophidae is therefore divided into Helicophi- dae sensu stricto and Heloccabucidae fam.n. Taxonomic place- Description. According to Flint (1981) the Anomalopsychi- ments of the former incertae sedis genera Ngoya, Seselpsyche dae are characterized by having three ocelli, males with four- and Karomana are hypothesized, although based on incomplete or five-segmented maxillary palps oriented anteriorly, segments data. In addition to incomplete DNA sequence data, we lack 1–3 equally long and longer than segment 4(–5). Antennae are information on juvenile morphology and therefore no nomen- shorter than forewings; scape shorter than length of head; two clatorial changes are suggested for the following taxa: Ngoya oval and oblique cephalic warts almost touching inner edge of forms the sister group to Antipodoeciidae but is retained as eyes. Thorax has pronotum with one or two pairs of setal warts; incertae sedis instead of forming a new family; and Karomana if two pairs, the lateral pair being smaller than the median pair; forms the sister group to Barbarochthonidae but is retained as mesonotum with variable setal warts on mesoscutum; mesos- incertae sedis instead of forming a new family. Seselpsyche is cutellum with pair of large setal warts fused mesally forming transferred from incertae sedis to the Sericostomatidae. Cos- a single large wart. Forewings broader than hindwings, elon- tora Mosely (Conoesucidae) appears as a paraphyletic group gate, with slightly pointed apices. Forewings have a discoidal in all analyses with respect to a number of conoesucid genera cell, nygma and a small jugal lobe; forks 1, 2, 3 and 5 present; and is in need of taxonomic revision, including morphological Cu2 ends in wing margin before reaching Cu1b; anal vein ends features before taxonomic changes are made. The Petrothrinci- at wing margin. Hindwings without discoidal cell; forks 2 and 5 dae was divided into the two genera, Petrothrincus Barnard and present; apex slightly pointed. No apparent wing coupling struc- Gyrocarisa Weaver, based on the shape of the cephalic warts tures present. Legs with spur formula 2, 2, 4. (Weaver, 1997), and being endemic to South Africa and Mada- Larval cases are tapering and slightly curved, made from sand gascar, respectively. These were synonymized by Johanson & grains. Larvae bear large anterolateral projection derived from Oláh (2006) because this character overlapped between the two pronotum. The larvae of Anomalopsyche are found on moss geographically defined groups, and also showed a large degree on the upper surface of stones in cold, fast-flowing brooks of interspecific variation. In our results, the Madagascan and (Flint, 1981), while the larvae of Contulma are found in small South African species are deeply divergent, and we propose waterfalls, seeps and smaller forest streams in forested areas, that the family is to be divided into two genera as proposed by and also at high altitudes above the treeline (Holzenthal & Weaver. Robertson, 2006; Holzenthal et al., 2007b).

Included genera. Anomalopsyche Flint (1 species) and Con- tulma (26 species). Classiﬁcation of the Sericostomatoidea Phylogenetic placement. Sister group to Helicopsychi- Diagnoses of the families within Sericostomatoidea, taxo- dae + Chathamidae. nomic history, distribution information, phylogenetic placement and larval habitat, are given below (in alphabethical Antipodoeciidae Ross order). These are based on literature data and new character observations. Type genus. Antipodoecia Mosely, 1934: 178.

Taxonomic history. This family holds a single described about as long as length of head. Thorax has pronotum with species, Antipodoecia turneri Mosely, originally described in single transverse setal wart covering entire dorsal face of the family Sericostomatidae but elevated to family level by Ross segment; mesonotum without setal warts but with pair of (1967), and classified together with the families Odontoceridae delimited areas of setae, and lacking fissure on mesoscutum; and Molannidae. The family was not included in some of the mesoscutellum with pair of setal warts fused medially into subsequent phylogenetic analyses. deMoor (1993) found it to be single large setal wart. Forewings broader than hindwings, each related to the Beraeidae, and Neboiss (2002) grouped the family with slightly pointed apex. The discoidal cell of forewings as a sister group to the Anomalopsychidae based on the presence present; nygma present, jugal lobe large; forks 1, 2, 3 and 5 of a modified character in the pupal mandibles, as did Malm et al. present in both males and females; Cu2 ends in Cu1b without (2013) based on molecular data. touching the wing margin; anal veins end at wing margin in well developed anastomosis. Hindwings without discoidal cell; venation reduced in central parts of wing; forks 1 and Description. According to Neboiss (1986) the Antipodoeci- 2 present in males and females. Wing coupling by modified idae are of small size with dark-coloured forewings. Two oval setae/macrotrichia. Legs have spur formula 2, 2, 4. and oblique cephalic warts touching inner edge of eyes. Head The larvae produce very long tuboid, curved cases tapering lacks ocelli. Male maxillary palps three-segmented with minute posteriorly and made from silk, with rows of sand grains near apical segment, typically curving dorsally along its length. posterior end. The larvae are found in low- to high-altitude Antennae about as long as forewings, each with scape shorter waterfalls and among stream vegetation of the grass genus than length of head. Thorax has pronotum with pair of long, Scirpus sp. (Scott, 1993). transverse setal warts; mesonotum with poorly defined setal warts on mesoscutum; mesoscutellum with pair of large, almost Distribution. South Africa. circular setal warts fused mesally. Forewings and hindwings narrow, about equally wide, elongate, each with slightly pointed apex. Forewings lack discoidal cell and have minute jugal lobe; Phylogenetic placement. Sister group to the Helicophidae. nygma present, forks 1, and 3 present; Cu2 ends in Cu1b + M3+4 without contact with wing margin; anal veins indistinct, ends Included genus. Barbarochthon (1 species). at Cu1/Cu2. Hindwings without discoidal cell, forks 2 and 5 present. No apparent wing coupling structures. Legs have spur Beraeidae Wallengren formula 2, 2, 4. Larval cases are tapering and slightly curved, made from sand Type genus. Beraea Stephens, 1833: 118. grains. Larvae have large anterolateral projection derived from pronotum. They are found in fast-flowing forest streams (Dean Taxonomic history. The family was originally established et al., 2004). to include the genera Beraea Stephens, Beraeodes Eaton and Ernodes Wallengren by Wallengren (1891), which were earlier Included genus. Antipodoecia Mosely (1 species). classified in the Rhyacophilidae. Subsequently described genera belonging to the Beraeidae were assigned directly to this family.

Distribution. Endemic to the Australian region (Australia). Description. The Beraeidae are small in size and brownish to blackish. Two large oval cephalic warts present, anteriorly Phylogenetic placement. Sister group to Beraeidae. situated close to inner edge of eyes. Head lacks ocelli, male maxillary palps five-segmented and usually unmodified. Anten- Barbarochthonidae Scott nae as long as or slightly shorter than forewings. Scape slightly shorter than length of head. Thorax has pronotum with one pair Type genus. Barbarochthon Barnard, 1934: 319. of oval setal warts; mesonotum without fissure, with one or two pairs of oval setal warts, or warts dissolved to scattered setae on mesoscutum; mesoscutellum usually with pair of setal warts Taxonomic history. The genus Barbarochthon was originally almost fused medially into single wart-like structure. Forewings placed in the family Sericostomatidae and placed in a distinct broader than hindwings, each with rounded or pointed apex. monotypic family described by Scott in 1993, but the family Forewings lack discoidal cell; jugal lobe absent; venation of name was introduced by Scott already in 1985. males strongly modified and number of wing forks differ among

genera; R4 forming false fork together with R3,andR5 form- Description. The Barbarochthonidae are of small size and ing false fork together with M1+2; forewing nygma of fork 2 with brown wings. One pair of large bean-shaped cephalic prominent; Cu2 ends in wing margin and is not connected to warts present, anterior edge situated near inner edge of eyes. Cu1b by a crossvein; anal vein ends at wing margin. Hindwings Head lacks ocelli, male maxillary palps three-segmented, curved without discoidal cell, number of forks differ among genera. dorsally and covering frontal part of head. Antennae about Wing coupling by modified setae/macrotrichia. Legs have spur as long as forewings, each with scape slightly shorter or formula2,2,4.

The larval cases are typically made from small sand grains cell, nygma, and jugal lobe; forks 1, 2, 3 and 5 present; Cu2 and and are curved with tapering posterior part. The larvae are anal vein end at Cu1b without touching wing margin. Hindwings characteristic in that the anal prolegs each has reduced lateral without discoidal cell; forks 1, 2 and 5 present. Wing coupling sclerite and bears long, thick, dark seta (similar to that in the by modified setae/macrotrichia. Legs have spur formula 2, 2, 4. Chathamiidae). The larvae are found mainly in small streams The larval cases are typically made from small sand grains, and springs. curved and with tapering posterior part. The larvae of Caenota plicata Mosely produce cases made from leaves or bark (Jack- Distribution. Restricted to western parts of the Palaearctic, son, 1998), and Shackleton & Webb (2014) described a larval Nearctic region and the eastern part of the Afrotropical region. case of Calocoides produced entirely from silk. The habitat is running water, most often small to larger streams, but one species is also found terrestrially among leaf litter in forests Phylogenetic placement. The Beraeidae forms the sister (Caloca saneva Mosely). group to the Antipodoeciidae. Included genera. Caenota (five species), Caloca (12 species), Included genera. Beraea (24 species), Beraeamyia Mosely Calocoides (three species), Latarima (two species), Pliocaloca (11 species), Beraeodes (one species), Beraeodina Mosely (one (five species), Pycnocentrella Mosely (one species), Tamasia species), Ernodes (17 species), Nippoberaea (one species) and (two species). Notoernodes Andersen & Kjærandsen (two species). Distribution. Endemic to the Australian region, each included Calocidae Ross genus endemic to Australia, except Pycnocentrella,whichis endemic to New Zealand. Type genus. Caloca Mosely, 1953 in Mosely & Kimmins, 1953: 153. Phylogenetic placement. Sister group to the Heloccabuci- dae + Hydrosalpingidae. Taxonomic history. Calocidae was first used as a taxonomic name by Ross (1967), but without stating what genera were to Ceylanopsychidae fam.n. be included, except referring to the paper by Mosely & Kim- http://zoobank.org/urn:lsid:zoobank.org:act:56CC33C8-60BD- mins (1953) and it can be assumed that the name is derived from 4E28-AE76-6FA1B7A91523 the genus Caloca Mosely, which was originally described in the family Odontoceridae. Mosely & Kimmins (1953) described the genus Pycnocentrella placed in the Beraeidae, a classi- Type genus. Ceylanopsyche Fischer, 1970: 243. fication subsequently questioned by McFarlane (1966). Ross (1967) moved Pycnocentrella to a new family, Pycnocentrelli- Taxonomic history. The genus Ceylanopsyche was originally dae, which was later synonymized with Calocidae by Neboiss described as Noleca (preoccupied) in the Sericostomatidae. It (1977). Two genera, Tamasia Mosely and Caenota Mosely, was listed as incertae sedis by Morse (2016) and is not included were originally described in the Sericostomatidae but transferred in our phylogenetic analyses due to an absence of molecular to the Calocidae by Neboiss (1977). The genera Calocoides data. However, morphological data from larval, pupal and adult Neboiss, Pliocaloca Neboiss and Latarima Shackleton, Webb, stages of representatives of this genus are available and a number Lawler & Suter were originally placed in the family. Recent tax- of the character states are considered unique within Trichoptera. onomic work by Shackleton (2010, 2013), Shackleton & Webb Following the descriptions of the adults, larvae, and pupae, we (2014) and Shackleton et al. (2014) increased the number of classify Ceylanopsyche in a distinct family, Ceylanopsychidae known species in the family by 50% (11 species). fam.n.

Description. According to Neboiss (1986), the Calocidae Diagnosis. The adults of Ceylanopsychidae are unique in sev- are of medium size and are dark. One pair of medium-sized eral aspects, particularly in characters of the head and wings. oval and oblique cephalic warts present, situated distantly from They have a head with a strongly dorsally produced vertex. inner edge of eyes. Head lacks ocelli, male maxillary palps The antennae have a slightly rounded scape, about half as long 3–5 segmented, often modified. Antennae are as long as, or as eye diameter, and with a small dark spot located mesally slightly shorter than, forewings, each with scape about as near the base. The frons has a large, rounded, triangular or long as, or slightly shorter than, length of head, often with diamond-shaped plate narrowing ventrally. The short male max- strongly expanded lateral lobes. Thorax has pronotum with illary palps are one-segmented, in sericostomatoids, and also two pairs of oval setal warts (except one pair in Caenota), found in some Sericostomatidae. The forewings lack discoidal median pair smaller than lateral pair; mesonotum without fissure cell, as is the case in other sericostomatoid families, i.e. the or setal warts on mesoscutum; mesoscutellum with pair of Beraeidae, Antipodoecidae and part of the Helicopsychidae and large longitudinal setal warts. Forewings slightly broader than Helicophidae. The males of the family are characteristic in hav- hindwings, all with rounded apices. Forewings have discoidal ing a false fork in the forewings produced by radial veins R3 and

R4, the absence of R5, a media that constitutes only a single vein, Included genus. Ceylanopsyche (seven species). and absence of Cu2. The larval cases of Ceylanopsyche resemble those made by Distribution. Endemic to Sri Lanka. larvae of Petrothrincidae, from which they are separated by being less dorsoventrally flattened and lacking lateral plates Phylogenetic placement in Sericostomatoidea. Unknown. covering the anterior part. Description, based on Chantaramongkol & Malicky (1986), Chathamiidae Tillyard Malicky (1973), Mosely (1939), and Schmid (1958). Type genus. Chathamia Tillyard, 1925: 279.

Adult. Head vertex strongly produced dorsally. Antennae Taxonomic history. The genus Chathamia was described in with each scape slightly rounded, about half as long as eye diam- the subfamily Chathamiinae under Rhyacophilidae, and trans- eter, with a small dark spot located mesally near the base of each ferred to Philanisidae by Wise (1965), a family established for scape. Frons with large, rounded, triangular or diamond-shaped the genus Philanisus Walker. Philanisus was originally estab- plate narrowing ventrally. Head lacks ocelli, maxillary palps lished as a genus within the Hydropsychidae, and transferred to are one-segmented in males; one- or five-segmented in females, Sericostomatidae by Ulmer (1907). Philanisidae and Chathami- short. Forewings and hindwings lack discoidal cells; in male dae were synonymized by Riek (1976). forewings, R3 forms false fork together with R4;R3 ending in wing margin near wing apex; R5 absent; nygma present posterior to R ; M simple, with crossvein R–M opposite to bifurcation of Description. According to Neboiss (1986) the Chathami- 4 idae are of medium size caddisflies lacking ocelli. Males Rs; Cu1 with well developed fork 5; Cu2 absent; the anal vein bifurcated with one long apical and one short basal vein, both have five-segmented maxillary palps of which segment 2is longer than each of the other segments; segment 3 originates ending in wing margin. In male hindwings, Sc and R1 well developed; Rs divided into R and R shortly after mid-length of sub-apically on segment 2. Scape shorter than length of head. 2+3+4 5 Two pairs of oval cephalic warts present, each well separated wing; R undivided, basally fused with R and separated from 2+3 4 from inner edge of eyes. Thorax has pronotum with one pair R near wing apex; R straight, ending at wing margin well pos- 4 5 of transverse setal warts; mesonotum with setal bases scattered terior of wing apex; nygma present basally in fork 2; M simple, in two longitudinal rows on mesoscutum; mesoscutellum with connected to R by well developed crossvein at about mid-length 5 pair of small, indistinct and mesally fused setal warts forming of wing, and to Cu by crossvein basally of mid-length of wing; small single rounded wart. Forewings about as broad as hind- anal vein with long apical and short basal veins ending at wing wings, elongate, with slightly pointed apices. Forewings have margin. Wing coupling mechanism unknown. Legs have spur discoidal cell, nygma, and minute jugal lobe; forks 1, 2, 3 and formula 2, 2, 2. 5 present; both Cu2 and A ends at Cu1b without meeting wing margin. Hindwings lack discoidal cell; forks 1, 2 and 5 present. Larva. Cases long, slender, conical and slightly flattened Wing coupling facilitated by modified setae/macrotrichia. Legs dorsoventrally; made from small sand grains; posterior end with have spur formula 2, 2, 4. dorsal collar; posterior opening covered by dorsally located The larval cases are slightly curved and covered by calcareous bean-shaped opening. Anterior enclosure of pupal case with hor- algae (Ulmer, in Mosely & Kimmins (1953). Hudson (1904) first izontal slit, posterior enclosure with vertical slit. Head capsule described the larvae of Philanisus as marine, living in intertidal about as long as wide in dorsal and ventral views. Frontoclypeus pools, and Riek (1976) reported them as widespread along open almost triangular, about 1.5 times longer than the width of ante- oceanic coasts. The larvae feed on various species of red algae rior margin. Pro- and mesothorax with single sclerite covering in the Rhodophyceae and Corallinoideae (Riek, 1976). dorsal surface; metathorax with long transverse, bar-shaped posterior sclerite and pair of triangular, lateral anterior sclerites. Included genera. Chathamia (two species), Philanisus (three Legs short and stout; protrochantin large, anterior part curving species). dorsally. Abdominal segment 1 with pair of small ventrolat- eral humps; abdominal gills absent; abdominal segment 9 with Distribution. Australian region (Australia and New Zealand). pair of small rectangular sclerites each with long seta. Anal prolegs merged basally, each with dorsal group of irregularly shaped fine setae, two fine lateral setae, and single strong pos- Phylogenetic placement. Sister group to Helicopsychidae. teriorly oriented seta located above the anal claw; anal claw simple, thorn-shaped and directed ventrally. Ceylanopsyche lar- Conoesucidae Ross vae are distinguished by the absence of strong lateral indenta- tions on head frontoclypeus; presence of sclerites on metanotum, Type genus. Conoesucus Mosely, 1936: 399. absence of dorsal hump on the first abdominal segment, absence of abdominal gills, basally merged anal prolegs, and anal claws Taxonomic history. The first taxon described of those now without teeth. classified in the family is Pycnocentria, which was originally

© 2016 The Authors. Systematic Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. 42, 240–266 Phylogeny of Sericostomatoidea 259 placed in the Sericostomatidae, as were all the subsequently by Banks (1939), but transferred to Beraeidae by Mosely & described genera. Ross (1967) grouped all Australasian species Kimmins (1953), and to Helicophidae by Neboiss (1977). with reduced setal warts on mesoscutum into a separate sericos- Wise (1958) described the genus Alloecentrella in the Beraei- tomatid subfamily, the Conoesucinae. The subfamily received dae, which was subsequently moved to the Helicophidae by family status by Neboiss (1977). Henderson & Ward (2007). Microthremma was placed in the Thremmidae by Schmid (1955), but moved to Sericostom- Description. According to Neboiss (1986) the Conoesucidae atidae (Schmid, 1957), and finally to Helicophidae by Flint are of medium size and black to blackish-brown. Two very (1979). Both Alloecentrellodes and Zelolessica McFarlane were large oval and oblique cephalic warts present against inner originally placed in the Helicophidae. edge of eyes. Head lacks ocelli, male maxillary palps one- to three-segmented, partly or completely membranous, typically Description. Adults are of small to medium-sized and dark oriented dorsad in front of head, apical segment small to minute. greyish. Two large, sickle-shaped and oblique cephalic warts Antennae are as long as or slightly shorter than forewings, present, anteriorly situated close to inner edge of eyes. Head each with scape about as long as length of head. Thorax has lacks ocelli, male maxillary palps five-segmented, unmodified. pronotum with pair of long, transverse setal warts; mesonotum The antennae as long as, or slightly shorter than, forewings, with anteromesal fissure and without warts on mesoscutum; each with scape about as long as, or slightly shorter than length mesoscutellum with pair of large longitudinal setal warts. of head. Thorax has pronotum with one pair of oval setal Forewings and hindwings about of equal width, elongate and warts; mesonotum without fissure or setal warts on mesoscutum; slightly ovoid. Forewings have discoidal cell, nygma, and mesoscutellum with pair of setal warts of various shape almost fused medially. Forewings broader than hindwings, each with well-developed jugal lobe; forks 1, 2, 3 and 5 present; Cu2 ends rounded apex; discoidal cell present or absent, nygma present, in Cu1b; anal vein ends at wing margin. Hindwings with or without discoidal cell; forks 1, 2 and 5 present. Wing coupling and jugal lobe small or absent; venation often modified; forks by modified setae/macrotrichia. Legs have spur formula 2, 2, 2, 1, 2, 3 and 5 or 2, 3 and 5 present; vein Cu2 ends in Cu1b or 2, 2, 4. without contact with wing margin; anal vein ends at wing The larvae produce a tuboid, usually curved case tapering margin or in Cu2. Hindwings with vein-free area in the middle posteriorly and made from silk, sand grains, pieces of plant, or a in Australian species, more complete in Neotropical species; mixture of material. The larvae are mainly found in streams and without discoidal cell; forks 2 and 5 present. Wing coupling by some species occur in cool lakes (Jackson, 1998). hamuli. Legs have spur formula 2, 2, 4. The larvae are found in small brooks, springs and streams, often with moss and often shaded by forest. Cases are Included genera. Beraeoptera (one species), Coenoria (one tube-shaped, slightly curved and tapering posteriorly, con- species), Confluens (two species), Conoesucus (eight species), structed of sand grains with some organic fragments. Costora (eight species), Hampa (one species), Lingora (four Eosericostoma cases are broad and flattened. species), Matasia (one species), Olinga (four species), Periwin- kla (one species), Pycnocentria (eight species) and Pycnocen- Distribution. Recorded from the Australian and Neotropical trodes (one species). region.

Distribution. Endemic to the Australian region, with each Phylogenetic placement. Sister group to the Bar- included genus endemic to either Australia or New Zealand. barochthonidae.

Phylogenetic placement. Sister group to the Parasericostom- Included genera. Alloecella (three species), Alloecentrella atidae. Wise (four species), Alloecentrellodes Flint (two species), Aus- trocentrus (three species), Eosericostoma (two species), Heli- Helicophidae Mosely copha (22 species, of which 19 are endemic to New Caledonia), Microthremma (eight species), Pseudosericostoma (one species) Type genus. Helicopha Mosely, 1953, in Mosely & Kimmins, and Zelolessica (two species). 1953: 148. Helicopsychidae Ulmer Taxonomic history. The Helicophidae was described to include the Australian genus Helicopha. The family comprises Type genus. Helicopsyche von Siebold, 1856: 38. genera included earlier in various other families (Sericostom- atidae, Beraeidae, Calocidae and Thremmidae). The South Taxonomic history. The first Helicopsychidae taxa were clas- American Austrocentrus, Pseudosericostoma and Eosericos- sified into the Phryganeidae in the subfamily Sericostomatinae toma were all originally placed in Sericostomatidae but later by Hagen (1864). The family group was erected as a subfamily transferred to Helicophidae by Flint (1979, 1983, 1992), respec- within Sericostomatidae by Ulmer (1906) and received family tively. Alloecella was originally classified in the Molannidae status by Ross (1944).

Description. According to Johanson (1998) representatives morphological cladistic analysis, despite the fact that the genus of the Helicopsychidae are of small to medium size, and did not group together with other Helicophidae in the analysis brownish to blackish, some species with pale metallic spots. (Neboiss, 2002). Two small to large oval, pyriform or sickle-shaped cephalic warts present, anteriorly situated distantly to eyes, or close Diagnosis. The adults of Heloccabucidae are unique in Seri- to but not touching eyes. Head lacks ocelli, male maxillary costomatoidea in having one pair of cephalic warts situated palps two- to four-segmented, usually unmodified, three- or more posteriorly on the head compared with those of other four-segmented maxillary palps are found in certain species families. Neboiss (2002) also stated that the shape of the male from the Oriental region. Antennae as long as or slightly shorter head tentorium for the genus is unique in Trichoptera. The than forewings, except in subgenus Cochliopsyche characterized males of Heloccabucidae fam.n. have three-segmented maxil- by having long, leptocerid-like antennae; scape longer to shorter lary palps, resembling the palps of other sericostomatoids, i.e. than head length. Thorax has pronotum with one pair of oval Barbarochthonidae, Antipodoecidae and Conoesucidae, as well setal warts, some species have additional pair of small lateral as some Helicopsychidae, Calocidae and Sericostomatidae. In setal warts; mesonotum without fissure, with one pair of oval addition, the thorax has a mesonotum that lacks setal warts, setal warts on mesoscutum that may be reduced to scattered setal as in the Barbarochthonidae, Hydrosalpingidae, Helicophidae, bases; mesoscutellum usually with pair of small rounded setal Conoesucidae, Parasericostomatidae fam.n. and Calocidae, and warts almost fused medially, fused into single wart-like structure part of the Anomalopsychidae and Helicopsychidae. The hind- in some species. Forewings broader than hindwings, each with wings have a well-developed discoidal cell, in sericostoma- rounded apex. Discoidal cell of forewings present; jugal lobe toids otherwise only present in Parasericostomatidae fam.n. absent; nygma absent, venation often modified; forks 1, 2, 3 and and part of the sericostomatid families Helicopsychidae and 5 usually present; Cu2 ends in wing margin and connected to Conoesucidae. Cu1b by a crossvein, anal vein ends at wing margin. Hindwings with or without discoidal cell; forks 1, 3 and 5 present in most species; fork 1 and 5 lacking in some species. Adults are unique Description derived from Neboiss (2002). The adults are in the superfamily by the presence of a reticulate pattern on of small size and with brownish wings. One pair of small anterior abdominal sternites in most species; and forewings and oblong, oblique cephalic warts, anterior part well separated from hindwings without nygma. Wing coupling by hamuli. Legs have inner edge of eyes. Head lacks ocelli, male maxillary palps spur formula 2, 2, 4. three-segmented, curved dorsally and covering frontal part of The larvae are unique in the superfamily in building dextrally head. Antennae about as long as forewings, each with scape coiled cases, which are made from sand grains, and most species much shorter than length of head. Thorax has pronotum with inhabit cold, running water in forested habitats. pair of lateral transverse setal warts almost touching mesally; mesonotum without setal warts on mesoscutum; mesoscutellum with one pair of setal warts. Forewings are slightly broader Distribution. Recorded from all biogeographical regions. than hindwings, each with slightly rounded apex. Discoidal cell present in both forewings and hindwings; forewings with Phylogenetic placement. Sister group to the Chathamiidae. nygma, forks 1, 2, 3 and 5 present; in hindwings forks 1, 2 and

5 present; forewings with Cu2 connected to Cu1a by crossvein, Included genera. Rakiura McFarlane (one species) and Heli- ends at margin; anal vein ends at wing margin without touching copsyche (226 species in five subgenera). Five extinct species Cu2. Wing coupling by modified setae/macrotrichia. Legs have described from five fossil genera are believed to represent the spur formula 2, 2, 4. family: Amechanites Haupt (one species, Eocene), Archotaulius Handlirsch (one species, Jurassic), Electrohelicopsyche Ulmer Larva. Cases long, slender, conical; made entirely from silk; (one species, Eocene), Mesotaulius Handlirsch (one species, anterior end with produced collar; posterior end without dorsal Jurassic), and Palaeohelicopsyche Ulmer (one species, Eocene). collar; posterior opening with silken enclosure with dorsally located bean-shaped opening. Pupal case with anterior enclosure Heloccabucidae fam.n. with horizontal slit. Larva with head capsule about as long http://zoobank.org/urn:lsid:zoobank.org:act:FBE98FC6-138F- as wide in dorsal and ventral views. Frontoclypeus almost 4E25-BBBC-E6C0F75635DA triangular, total length 1.5 times that of width of anterior margin. Prothorax with single sclerite covering dorsal surface; with stout spines along anterior margin; transverse row of setae Type genus. Heloccabus Neboiss, 2002: 196. present at about anterior one-third to half of pronotum. Meso- and metathorax without sclerites. Abdominal gills present on Taxonomic history. The genus Heloccabus was first men- segments 1 and 2. Lateral humps of abdominal segment 1 with tioned in the literature by Jackson (1998), who, based on two black, elongate sclerites in addition to a spiny patch; dorsal larval material, left it unclassified but probably belonging to hump absent. Anal claws with two accessory hooks. The larvae Calocidae/Helicophidae. Together with the formal description were collected in fast-flowing, clear water streams (Neboiss, of the taxon, it was classified into the Helicophidae based ona 2002).

Included genera. Heloccabus (one species). Taxonomic history. The genus Parasericostoma was first described in Sericostomatidae as Chrysostoma Schmid, a name preoccupied by Swainson (1840) for a mollusc genus. The Distribution. The family includes one described species, name was changed to Parasericostoma by Schmid (1957). being endemic to southern and eastern parts of Australia Myotrichia was described in the Sericostomatidae by Schmid (Queensland, New South Wales, Victoria). (1955). The genus Chiloecia Navás was originally placed in the Limnephilidae but transferred to the Sericostomatidae by Flint Phylogenetic position. Sister group to the Hydrosalpingidae. et al. (1999). The only known species in Chiloecia, C. lacustris Navás, has not been recorded since the original description, and the type material is presumed lost. Based on characters in the Hydrosalpingidae Scott wings, Flint et al. (1999) considered the genus being related to Type genus. Hydrosalpinx Barnard, 1934: 321. Parasericostoma and Myotrichia, and it is herein included in the family Parasericostomatidae fam.n.

Taxonomic history. Hydrosalpinx was described together with Petrothrincus in the Aequipalpia but without connection Diagnosis. The adults of the family have a unique combi- to any specific families. The family was formally described by nation of characters, like presence of a minute apical segment Scott in 1993 but the family name had already been introduced of the maxillary palps (also present in some Sericostomatidae by Scott in 1985. and Calocidae); a thorax with two pairs of pronotal setal warts (also present in Petrothrincidae and some Anomalopsychidae, Helicopsychidae and Calocidae); the forewings with anal vein Description. The Hydrosalpingidae are of medium size and ending in Cu1 (also Antipodoeciidae and Calocidae); and each with golden brownish wings. One pair of large, almost triangular hindwing has a discoidal cell, as is also present in Heloccabu- cephalic warts, laterally situated near inner edge of eyes. Head cidae fam.n. and some representatives of the Helicopsychidae lacks ocelli, very long, five-segmented male maxillary palps and Conoesucidae. are laterally flattened and oriented anteriorly. Male labial palps very long. Antennae longer than forewings, each with scape Description. Partly derived from the diagnosis of Paraseri- slightly shorter than length of head. Thorax has pronotum with costoma (Schmid, 1955, 1957; Valverde & Miserendino, 1997; one pair of oval setal warts; mesonotum without setal warts and Valverde & Albariño, 1999) and Myotrichia (Schmid, 1955). fissure on mesoscutum; mesoscutellum with pair of warts fused medially into single large, longitudinally oriented setal wart. Forewings slightly broader than hindwings, each with slightly Adults. Parasericostomatidae are of small size and with dark, pointed apex. The discoidal cell of the forewings present, nygma grey-brownish forewings. One pair of large pyriform cephalic present, jugal lobe small; forks 1, 2 and 3 present in males; Cu2 warts, anteriorly touching inner edge of eyes. Head lacks ends in Cu1 without contact with wing margin; anal vein ends at ocelli, male maxillary palps are five-segmented, curved dorsally, wing margin without contact with Cu2. Hindwings with reduced covering frontal part of head; apical segment minute. Antennae venation, without discoidal cell; fork 2 present. Wing coupling about as long as forewings, each with scape slightly shorter than by modified setae/macrotrichia. Legs have spur formula 2, 2,4. length of head. Ocelli absent. Thorax has pronotum with two The larvae produce a tuboid, curved case tapering posteriorly, pairs of transverse setal warts, median pair larger than lateral made from silk, and, except for very young larvae, eventually pair; mesonotum without anteromesal fissure or warts, except incorporating a few sand grains. The larvae are found in few individual setal bases in Parasericostoma; mesoscutellum high-altitude waterfalls and stony streams, and are associated with pair of large longitudinal setal warts almost fused mesally with acidic water (Scott, 1993). and covering surface of mesoscutellum. Forewings about as broad as hindwings, each parabolic at apex. Forewings and hindwings with discoidal cell and small jugal lobe; forewing Distribution. South Africa. nygma and forks 1, 2, 3 and 5 present; Cu2 ends in Cu1b without contact with wing margin; anal vein distally fused

Phylogenetic placement. Sister group to the Heloccabucidae. with Cu1. Hindwings with discoidal cell; forks 1, 2 and 5 present. Wing coupling without modified setae. Legs have spur formula 2, 2, 4. Included genus. Hydrosalpinx Barnard (one species).

Larva. Cases long, slender, conical; made entirely from silk Parasericostomatidae fam.n. or with inclusion of sand grains up to 10% of total surface http://zoobank.org/urn:lsid:zoobank.org:act:BB17D6B7- area; anterior end with silken collar; posterior opening with C6C2-4F27-9005-3130FD4A5CFF silken enclosure with transverse opening. Anterior enclosure of pupal case with small oval horizontal slit, posterior opening Type genus. Parasericostoma Schmid, 1957: 393. transverse. Larvae with head capsule slightly longer than wide

© 2016 The Authors. Systematic Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. 42, 240–266 262 K. A. Johanson et al. in dorsal and ventral view. Frontoclypeus unknown. Prothorax all with rounded apex. Discoidal cell and nygma of forewings with pair of large sclerites covering dorsal surface and separated present; jugal lobe present; venation includes forks 1, 2 and 3 in medially; with stout spines along anterior margins (Parasericos- male; Cu2 ends in wing margin without contact with Cu1;anal toma ovale) or with normal setae (other Parasericostoma and vein ends at wing margin. Hindwings without discoidal cell; fork Myotrichia); a pair of longitudinal sclerites situated immedi- 2 present. Wing coupling by modified setae/macrotrichia. Legs ately below and partly fused with ventral margin of each dorsal have spur formula 2, 2, 4. sclerite. No row of setae on pronotum. Mesonotum with sin- The larvae produce a straight case made from sand grains, gle anteriorly triangular transverse sclerite with anteromarginal dorsally and laterally strongly expanded to form a roof above setae. Metathorax without sclerites (Parasericostoma) or with anterior opening of the case. The larvae are found in streams, narrow long transverse sclerite accompanying pair of minute lat- predominantly at higher altitudes (Scott, 1993). eral sclerites (Myotrichia). Abdominal gills absent. Abdominal segment 1 with one dorsal and two lateral humps. Each anal Distribution. South Africa and Madagascar. claw with single accessory hook. Larvae of Parasericostomati- dae fam.n. can be distinguished from those of Conoesucidae by the ventral surface of the head capsule having genae close Phylogenetic placement. Sister group to the Sericostomati- together, while in Conoesucidae the genae are widely separate. dae. Larvae were collected from running, clear water streams without pollution (Valverde & Miserendino, 1997; Albariño & Valverde, Included genera. Petrothrincus (three species) and Gyro- 1998). carisa (11 species).

Included genera. Parasericostoma (10 species), Myotrichia Sericostomatidae Stephens (one species), Chiloecia (one species). Type genus. Sericostoma Latreille, 1825: 439. Distribution. Chile and Argentina. Taxonomic history. According to Holzenthal et al. (2007b: 686) the Sericostomatidae ‘has been used as a “dumping Phylogenetic position. Sistergroup to Conoesucidae. ground” for genera unable to be placed with confidence in other families’, which is also reflected in the taxonomic his- Petrothrincidae Scott tory, involving many genera entered into and removed from the family. In total, about 25 genera previously classified in the Seri- Type genus. Petrothrincus Barnard, 1934: 323. costomatidae have been transferred to other families in the Seri- costomatoidea. This leaves 18 genera as representatives of the Taxonomic history. Due to the resemblance between larval family. cases of petrothrincid and Molanna species (Molannidae), the first species described in the family, Petrothrincus triangularis Description. The Sericostomatidae are small to medium- (Hagen), based on larval material only, was placed in the genus sized and greyish-brown. Head with one pair of large, oval Molanna. The genus Petrothrincus was described together with and oblique cephalic warts, anteriorly situated near inner edge Hydrosalpinx into the Aequipalpia but without connection to of eyes. Head lacks ocelli, male maxillary palps one- to specific families. The family was formally described by Scott three-segmented, curved dorsally and covering frontal part of in 1993, but the family name had already been introduced by head. Antennae slightly shorter than forewings, each with scape Scott in 1985. The genus Gyrocarisa was added to the family, about as long as or slightly shorter than length of head. Tho- to hold species from Madagascar, but was synonymized with rax has pronotum with one pair of oval setal warts; mesonotum Petrothrincus by Johanson & Oláh (2006). The Gyrocarisa is with one pair of setal warts and lacking fissure on mesoscutum; reinstated as a valid genus. mesoscutellum with one pair of small rounded setal warts fused medially into single large wart. Forewings slightly broader than Description. The Petrothrincidae are small greyish-brown, hindwings, each with rounded apex; discoidal cell and nygma often with pale patches on the forewings. One pair of oval and present; jugal lobe small; venation often modified and number oblique cephalic warts, anterior edge situated near inner edge of of forks varies among genera; Cu2 ends in Cu1 without contact eyes. Head lacks ocelli; male maxillary palps five-segmented, with wing margin, or ends in wing margin with connection to oriented anterad. Antennae slightly longer than forewings, Cu1 by crossvein; vein A meets wing margin. Hindwings with each with scape about as long as length of head. Thorax has or without discoidal cell; forks 1, 2 and 5 present. Wing coupling pronotum with two pairs of setal warts, lateral pair being small, by modified setae/macrotrichia. Legs have spur formula 2, 2, 4 rounded, median pair large, oval; mesonotum with pair of setal (except Notidobiella with spur formula 2, 2, 2). warts meeting mesally on mesoscutum and lacking fissure; The larval cases are typically made from small sand grains, mesoscutellum anteriorly with pair of rounded setal warts curved and with tapering posterior part. Representatives of the separated medially. Forewings slightly broader than hindwings, genus Grumicha build cases from silk alone. The larvae of the

© 2016 The Authors. Systematic Entomology published by John Wiley & Sons Ltd on behalf of Royal Entomological Society. 42, 240–266 Phylogeny of Sericostomatoidea 263 family are mostly found in running water, most often small to 11.Mesoscutumwithpairofsetalwarts...... larger streams, but some species are also found in lakes...... Sericostomatidae – Mesoscutum without setal warts ...... 12 Distribution. Recorded from all biogeographical regions, 12. Head cephalic setal warts situated close to eyes ...... except the Australian region...... Conoesucidae Head cephalic setal warts well separated from eyes ...... Heloccabucidae Phylogenetic placement. Sister group to the Petrothrincidae. 13. Head with two pairs of cephalic setal warts; forewing A ends

in Cu2 ...... Chathamiidae Included genera. Agarodes (12 species in two subgenera), – Head with one pair of cephalic setal warts; forewing A ends Cheimacheramus (two species), Fattigia (one species), Gru- in Cu1 ...... 14 micha (one species), Gumaga (six species), Notidobia (10 14. Hindwing discoidal cell present; wing coupling not species), Notidobiella (six species), Oecismus (four species), involving macrotrichia ...... Parasericostomatidae Petroplax (four species), Rhoizema (five species), Schizopelex – Hindwing discoidal cell absent; wing coupling by (12 species), and Sericostoma (30 species). macrotrichia...... Calocidae The five genera Aclosma (two species), Asahaya (one species), Aselas (one species), Cerasma (two species) and Chiloecia (one species) were also previously classified under Sericostomati- Supporting Information dae but were excluded from this analysis due to the absence of available material. Of these, Chiloecia is moved to Parasericos- Additional Supporting Information may be found in the online tomatidae fam.n. due to morphological similarities (Flint et al., version of this article under the DOI reference: 1999). The other four genera are retained in the family awaiting 10.1111/syen.12209 further analyses. Figure S1. raxml bootstrap analysis of the data set of 90 taxa with DNA sequences for all five genes included in the Fossil genera. Stenoptilomyia Ulmer (two species, Baltic analysis. Figures are frequencies of retained groups in 1000 Amber), Aulacomyia Ulmer (two species, Baltic Amber), Pseu- bootstrap replicates. The horizontal scale bar indicates the doberaeodes Ulmer (one species, Baltic Amber), Sphaleropal- mean number of nucleotide substitutions per site. pus Ulmer (one species, Baltic Amber). Figure S2. Single most parsimonious tree after successive reweighting based on rescaled consistency index of each Key to the extant families of Sericostomatoidea character. The horizontal scale bar indicate five character (males) changes.

1.Ocellipresent...... Anomalopsychidae Figure S3. raxml bootstrap analysis of the data set of 149 – Ocelliabsent...... 2 taxa with DNA sequences for between one and five genes 2. Nygma absent in forewings; most species have abdominal included in the analysis. Figures are frequencies of retained sternum 2 with reticulate pattern ...... Helicopsychidae groups in 1000 bootstrap replicates. The horizontal scale bar – Nygma present in forewings; abdominal sternum 2 without indicates the mean number of nucleotide substitutions per reticulatepattern...... 3 site. 3. Head vertex strongly produced dorsally ...... Figure S4. Strict consensus of three shortest trees after ...... Ceylanopsychidae successive reweighting based on rescaled consistency index – Headvertexweaklyproduceddorsally...... 4 of each character. The horizontal scale bar indicates 100 4. Forewing Cu endsinwingmargin...... 5 2 character changes. – Forewing Cu2 ends in Cu1 ...... 6 5. Pronotum with one pair of setal warts ...... Beraeidae – Pronotum with two pairs of setal warts . . . . Petrothrincidae References 6.Hindwingfork5absent...... 7 – Hindwingfork5present...... 8 Albariño, R.J. & Valverde, A.C. (1998) Hábito alimentario del estado 7. Maxillary palps with three segments ...... larval de Parasericostoma cristatum (Trichoptera: Sericostomatidae)...... Barbarochthonidae Revista de la Sociedad Entomológica Argentina, 57, 131–135. – Maxillary palps with five segments . . . . . Hydrosalpingidae Banks, N. (1939) New genera and species of Neuropteroid insects. 8.Hindwingfork1absent...... 9 Bulletin of the Museum of Comparative Zoology, 85, 439–504. Barnard, K.H. (1934) South African caddis-flies (Trichoptera). Transac- – Hindwingfork1present...... 10 tions of the Royal Society of South Africa, 21, 291–394. 9. Maxillary palps with three segments . . . . . Antipodoeciidae Bukontaite, R., Miller, K.B. & Bergsten, J. (2014) The utility of CAD in – Maxillary palps with five segments ...... Helicophidae recovering Gondwanan vicariance events and the evolutionary history 10.ForewingAendsinwingmargin...... 11 of Aciliini (Coleoptera: Dytiscidae). BMC Evolutionary Biology, 14, – ForewingAendsinCu...... 13 1. DOI: 10.1186/1471-2148-14-5.

Chantaramongkol, P. & Malicky, H. (1986) Beschreibung von neuen Holzenthal, R.W. & Robertson, D.R. (2006) Four new species of Köcherfliegen (Trichoptera, Insecta) aus Sri Lanka. Annalen des Contulma from South America (Trichoptera: Anomalopsychidae). Naturhistorischen Museums in Wien. Serie B, Botanik und Zoologie, Zootaxa, 1355, 49–59. 88, 511–534. Holzenthal, R.W., Blahnik, R.J., Kjer, K.M. & Prather, A.P. (2007a) Danforth, B.N., Fang, J. & Sipes, S. (2006) Analysis of family-level An update on the phylogeny of caddisflies (Trichoptera). Proceedings relationships in bees (Hymenoptera: Apiformes) using 28S and two of the 12th International Symposium on Trichoptera (ed. by L. previously unexplored nuclear genes: CAD and RNA polymerase II. Bueno-Soria, R. Barba-Alvarez and B. Armitage), pp. 143–153. The Molecular Phylogenetics and Evolution, 39, 358–372. Caddis Press, Columbus, Ohio. Dean, J.C., St. Clair, R.M. & Cartwright, D.I. (2004) Identification keys Holzenthal, R.W., Blahnik, R.J., Prather, A.L. & Kjer, K.M. (2007b) to Australian families and genera of caddis-fly larvae (Trichoptera). Order Trichoptera Kirby, 1813 (Insecta), caddisflies. Zootaxa, 1668, Cooperative Research Centre for Freshwater Ecology Identification 639–698. Guide, 50, 1–131. Hudson, G.V. (1904) New Zealand Neuroptera. A Popular Introduction Espeland, M. & Johanson, K.A. (2010a) The effect of environmen- to the Life and Habits of May-flies, Dragon-flies, Caddis-flies and tal diversification on species diversification in New Caledonian Allied Insects Inhabiting New Zealand, Including Notes on their Orthopsyche and Caledopsyche caddisflies (Insecta: Trichoptera: Relation to Angling. West, Newman and Co., London. Hydropsychidae). Journal of Biogeography, 37, 879–890. DOI: Jackson, J.E. (1998) Preliminary guide to the identification of late 10.1111/j.1365-2699.2009.02263.x. instar larvae of Australian Calocidae, Helicophidae and Conoesucidae Espeland, M. & Johanson, K.A. (2010b) The diversity and radiation (Insecta: Trichoptera). Cooperative Research Centre for Freshwater of the largest monophyletic animal group on New Caledonia (Tri- Ecology Identification Guide, 16, 1–81. choptera: Ecnomidae: Agmina). Journal of Evolutionary Biology, 23, Johanson, K.A. (1998) Phylogenetic and biogeographic analysis of 2112–2122. DOI: 10.1111/j.1420-9101.2010.02072.x. the family Helicopsychidae (Insecta: Trichoptera). Entomologica Fischer, F.C.J. (1970) Änderung einiger präokkupierten Namen in der Scandinavica, Supplement, 53, 1–172. Ordnung Trichoptera. Entomologische Berichten, 30, 242–243. Johanson, K.A. & Espeland, M. (2010) Phylogeny of the Ecno- Flint, O.S. Jr. (1967) Studies of Neotropical caddiflies II, Trichoptera midae (Insecta: Trichoptera). Cladistics, 26, 36–48. DOI: collected by Prof. J. Illies in the Chilean subregion. Beiträge zur 10.1111/j.1096-0031.2009.00276.x. Johanson, K.A. & Keijsner, M. (2008) Phylogeny of the Heli- Neotropischen Fauna, 5, 45–68. cophidae (Trichoptera), with emphasis on the New Caledonian Flint, O.S. Jr. (1979) Studies of Neotropical caddisflies, XXIII: new species of Helicopha. Systematic Entomology, 33, 451–483. DOI: genera from the Chilean Region. Proceedings of the Biological 10.1111/j.1365-3113.2008.00423.x. Society of Washington, 92, 640–649. Johanson, K.A. & Malm, T. (2010) Testing the monophyly of Caloci- Flint, O.S. Jr. (1981) Studies of Neotropical caddisflies, XXVII: Anoma- dae (Insecta: Trichoptera) based on multiple molecular data. lopsychidae, a new family of Trichoptera. Proceedings of the 3rd Molecular Phylogenetics and Evolution, 54, 535–541. DOI: International Symposium on Trichoptera (ed. by G.P. Moretti), pp. 10.1016/j.ympev.2009.09.025. 75–85. Dr. W. Junk Publishers, The Hague. Johanson, K.A. & Oláh, J. (2006) Eleven species of Sericostomatoidea Flint, O.S. Jr. (1983) Studies of Neotropical caddisflies, XXXIII: from Madagascar (Trichoptera: Helicopsychidae, Petrothrincidae, new species from austral South America (Trichoptera). Smithsonian Sericostomatidae). Zootaxa, 1205, 1–30. Contributions to Zoology, 377, 1–100. Johanson, K.A., Kjer, K. & Malm, T. (2009) Testing the monophyly Flint, O.S. Jr. (1991) Studies of Neotropical caddisflies, XLV: the of the New Zealand and Australian endemic family Conoesucidae taxonomy, phenology, and faunistics of the Trichoptera of Antioquia, Ross based on combined molecular and morphological data (Insecta: Colombia. Smithsonian Contributions to Zoology, 520, 1–113. Trichoptera: Sericostomatoidea). Zoologica Scripta, 38, 563–573. Flint, O.S. Jr. (1992) Studies of Neotropical caddisflies, XLIX: the tax- DOI: 10.1111/j.1463-6409.2009.00391.x. onomy and relationships of the genus Eosericostoma, with descrip- Johanson, K.A., Malm, T., Espeland, M. & Weingartner, E. (2012) tions of the immature stages (Trichoptera: Helicophidae). Proceed- Phylogeny of the Polycentropodidae (Insecta: Trichoptera) ings of the Biological Society of Washington, 105, 494–511. based on protein-coding genes reveal non-monophyletic gen- Flint, O.S. Jr., Holzenthal, R.W. & Harris, S.C. (1999) Nomenclatural era. Molecular Phylogenetics and Evolution, 65, 126–135. DOI: and systematic changes in the Neotropical caddisflies. Insecta Mundi, 10.1016/j.ympev.2012.05.029. 13, 73–84. Kjer, K.M., Blahnik, R.J. & Holzenthal, R.W. (2001) Phylogeny of Folmer, O., Black, M., Hoeh, W., Lutz, R. & Vrijenhoek, R. (1994) DNA Trichoptera (caddisflies): characterization of signal and noise within primers for amplification of mitochondrial cytochrome c oxidase multiple datasets. Systematic Biology, 50, 781–816. subunit I from diverse metazoan invertebrates. Molecular Marine Latreille, P.A. (1825) Familles naturelles du règne animal, exposées Biology and Biotechnology, 3, 294–299. succinctement et dans un ordre analytique, avec l’indication de leurs Frania, H.E. & Wiggins, G.B. (1997) Analysis of morphological and genres. J.B. Baillière, Paris. behavioral evidence for the phylogeny and higher classification of Linnaeus, C. (1761) Fauna svecica, sistens animalia sveciae regni: Trichoptera (Insecta). Life Sciences Contributions, Royal Ontario mammalia, aves, amphibia, pisces, insecta, vermes, distributa per Museum, 160, 1–67. classes & ordines, genera & species. Cum differentiis specierum, syn- Hagen, H.A. (1864) Ueber Phryganiden-Gehause. Stettiner Entomolo- onymis auctorum, nominibus incolarum, locis natalium, description- gische Zeitung, 25, 113–144, 221–262. ibus insectorum, Editio altera auctior edn. Sumtu & Literis Direct, Henderson, I.M. & Ward, J.B. (2007) Three new species in the endemic Laurentii Salvii, Stockholmiae. New Zealand genus Alloecentrella (Trichoptera), and a re-evaluation Malicky, H. (1973) The Ceylonese Trichoptera. Results of the of its family placement. Aquatic Insects, 29, 79–96. Austrian-Ceylonese hydrobiological mission 1970 of the 1st Zoologi- Holzenthal, R.W. & Flint, O.S. Jr. (1995) Studies of Neotropical cal Institute of the University of Vienna (Austria) and the Department caddisflies, LI: systematics of the Neotropical caddisfly genus of Zoology of the University of Ceylon Vidyalankara Campus, Contulma (Trichoptera: Anomalopsychidae). Smithsonian Contribu- Kelaniya (Sri Lanka). Bulletin of the Fishery Research Station, Sri tions to Zoology, 575, 1–59. Lanka (Ceylon), 24, 153–177.

Malm, T. & Johanson, K.A. (2008) Revision of the New Caledo- Ross, H.H. (1967) The evolution and past dispersal of the Trichoptera. nian endemic genus Gracilipsodes (Trichoptera: Leptoceridae: Gru- Annual Review of Entomology, 12, 169–206. michellini). Zoological Journal of the Linnean Society, 153, 425–452. Ross, H.H. (1978) The present disposition of components of the Malm, T. & Johanson, K.A. (2011) A new classification of the Sericostomatidae sens. lat. (Trichoptera). Proceedings of the 2nd long-horned caddisflies (Trichoptera: Leptoceridae) based on International Symposium on Trichoptera (ed. by M.I. Crichton), pp. molecular data. BMC Evolutionary Biology, 11, 17 pp. DOI: 1–6. Dr. W. Junk, The Hague. 10.1186/1471-2148-11-10. Schmid, F. (1955) Contribution à la connaissance des Trichoptères Malm, T. & Nyman, T. (2015) Phylogeny of the symphytan grade of néotropicaux. Mémoires de la Société Vaudoise des Sciences Hymenoptera: new pieces into the old jigsaw(fly) puzzle. Cladistics, Naturelles, 11, 117–160. 31, 1–17. DOI: 10.1111/cla.12069. Schmid, F. (1957) Contribution à l’étude des Trichoptères néotropicaux Malm, T., Johanson, K.A. & Wahlberg, N. (2013) The evolutionary II. Beiträge zur Entomologie, 7, 379–398. history of Trichoptera (Insecta): a case of successful adaptation Schmid, F. (1958) Trichoptères de Ceylan. Archiv Für Hydrobiologie, to life in freshwater. Systematic Entomology, 38, 459–473. DOI: 54, 1–173. 10.1111/syen.12016. Scott, K.M.F. (1985) Order Trichoptera (caddis flies). Insects of South- McFarlane, A.G. (1966) New Zealand Trichoptera (Part 6). Records of ern Africa (ed. by C.H. Scholtz and E. Holm), pp. 327–340. Butter- the Canterbury Museum, 8, 137–161. worths, Durban. McKenna, D.D. & Farrell, B.D. (2010) 9-Genes reinforce the phy- Scott, K.M.F. (1993) Three recently erected Trichoptera families logeny of holometabola and yield alternate views on the phylogenetic from South Africa, the Hydrosalpingidae, Petrothrincidae and Bar- placement of strepsiptera. PLoS ONE, 5, e11887. DOI: 10.1371/jour- barochthonidae (Integripalpia: Sericostomatidae). Annals of the Cape nal.pone.0011887. Provincial Museums (Natural History), 18, 293–354. Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Shackleton, M. (2010) Two new species of Pliocaloca Neboiss (Tri- Science Gateway for inference of large phylogenetic trees. Proceed- choptera: Calocidae) from eastern Australia, with descriptions of ings of the Gateway Computing Environments Workshop (GCE),New the immature stages of one species. Zootaxa, 2476, 30–38. DOI: Orleans, 14 November 2010, pp. 1-8. 10.1111/aen.12091. deMoor, F.C. (1993) A cladistic analysis of character states in the twelve Shackleton, M.E. (2013) New species of Caloca Mosely (Trichoptera: families here considered as belonging to the Sericostomatoidea. Calocidae) from eastern Australia. Memoirs of Museum Victoria, 70, Annals of the Cape Provincial Museums (Natural History), 18, 1–10. 347–352. Shackleton, M.E. & Webb, J.M. (2014) Two new species of Calo- Morse, J.C. (ed.) (2016) Trichoptera World Checklist. [WWW doc- coides Neboiss 1984 (Trichoptera: Calocidae) from eastern Australia, ument]. URL http://entweb.clemson.edu/database/trichopt/index.htm with descriptions of the immature stages. Austral Entomology, 53, [accessed on 16 February 2016]. 444–457. DOI: 10.1111/aen.12091. Mosely, M.E. (1934) A new Australian caddis-fly (Trichoptera). Ento- Shackleton, M.E., Webb, J.M., Lawler, S.H. & Suter, P.J. (2014) A mologist, 67, 178–180. new genus and species of Calocidae (Trichoptera: Insecta) from south Mosely, M.E. (1939) The Indian caddisflies (Trichoptera), part VI. eastern Australia. Memoirs of Museum Victoria, 72, 25–30. Journal of the Bombay Natural History Society, 41, 39–47. Staden, R., Beal, K.F. & Bonfield, J.K. (2000) The Staden pack- Mosely, M.E. & Kimmins, D.E. (1953) The Trichoptera of Australia and age, 1998. Methods in Molecular Biology, 132, 115–130. DOI: New Zealand. British Museum (Natural History), London. 10.1385/1-59259-192-2:115. Moulton, J.K. & Wiegmann, B.M. (2004) Evolution and phyloge- Stamatakis, A. (2014) RAxML version 8: a tool for phylogenetic netic utility of CAD (rudimentary) among Mesozoic-aged Eremoneu- analysis and post-analysis of large phylogenies. Bioinformatics, 30, ran Diptera (Insecta). Molecular Phylogenetics and Evolution, 31, 1312–1313. 363–378. Stephens, J.F. (1833) The Nomenclature of British Insects; Together with Mutanen, M., Wahlberg, N. & Kaila, L. (2010) Comprehensive gene their Synonymes: Being a Compendious List of Such Species as are and taxon coverage elucidates radiation patterns in moths and butter- Contained in the Systematic Catalogue of British Insects, and of those flies. Proceedings of the Royal Society B: Biological Sciences, 277, Discovered Subsequently to its Publication; Forming a Guide to their 2839–2848. DOI: 10.1098/rspb.2010.0392. Classification, 2nd edn. Baldwin and Cradock, London. Neboiss, A. (1977) A taxonomic and zoogeographic study of Tasmanian Swainson, W. (1840) A treatise on malacology; or, shells and shell fish. caddis-flies (Insecta: Trichoptera). Memoirs of the National Museum Longman, Orme, Brown, Green & Longmans, London, U.K. of Victoria, 38, 1–212. Swofford, D.L. (2002) PAUP*. Phylogenetic Analysis Using Parsi- Neboiss, A. (1986) Atlas of Trichoptera of the SW Pacific-Australian mony (*and Other Methods). Sinauer Associates, Sunderland, Mas- Region, Series Entomologica 37. Dr W. Junk, Dordrecht. sachusetts. Neboiss, A. (2002) A family problem with placement of Heloccabus Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) CLUSTAL buccinatus gen. nov. & sp. nov., an Australian caddisfly (Insecta: W: improving the sensitivity of progressive multiple sequence Trichoptera). Proceedings of the 10th International Symposium on alignment through sequence weighting, position-specific gap Trichoptera, Nova Supplementa Entomologica 15 (ed. by W. Mey), penalties and weight matrix choice. Nucleic Acids Research, 22, pp. 195–204, Goecke & Evers, Keltern, Germany. 4673–4680. Riek, E.F. (1976) The marine caddisfly family Chathamiidae (Tri- Tillyard, R.J. (1925) Caddis-flies (order Trichoptera) from the Chatham choptera). Journal of the Australian Entomological Society, 15, Islands. Records of the Canterbury Museum, 2, 277–284. 405–419. Ulmer, G. (1906) Neuer beitrag zur kenntnis aussereuropäischer Tri- Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: bayesian phyloge- chopteren. Notes from the Leyden Museum, 28, 1–116. netic inference under mixed models. Bioinformatics, 19, 1572–1574. Ulmer, G. (1907) Trichoptera. Genera Insectorum,Vol.60 (ed. by P. Ross, H.H. (1944) The caddisflies or Trichoptera of Illinois. Bulletin of Wytsman), pp. 1–259, P. Wytsman, Brussels, Belgium. the Illinois Natural History Survey, 23, 1–326. Ulmer, G. (1912) Die trichopteren des baltischen Bernsteins, Ross, H.H. (1956) Evolution and Classification of the Mountain Cad- Beiträge zur Naturkunde Preussens,Vol.10. Schriften der disflies. University of Illinois Press, Urbana, Illinois. Physikalisch-Ökonomischen Gesellschaft zu Köningsberg, Leipzig.

Valverde, A.C. & Albariño, R.J. (1999) Descripción de los esta- Whiting, M.F. (2002) Mecoptera is paraphyletic: multiple genes and dos enmaturos de Myotrichia murina y Parasericostoma cristatum phylogeny of Mecoptera and Siphonaptera. Zoologica Scripta, 31, (Trichoptera: Sericostomatidae). Revista de la Sociedad Entomológ- 93–104. ica Argentina, 58, 11–16. Wiegmann, B.M., Trautwein, M.D., Kim, J.-W., Cassel, B.K., Bertone, Valverde, A.C. & Miserendino, M.L. (1997) Los estados inmaduros de M.A., Winterton, S.L. & Yeates, D.K. (2009) Single-copy nuclear Parasericostoma ovale (Trichoptera: Sericostomatidae). Revista de la genes resolve the phylogeny of the holometabolous insects. BMC Sociedad Entomológica Argentina, 56, 33–37. Biology, 7, 34. Wahlberg, N. & Wheat, C.W. (2008) Genomic outposts serve the Winterton, S.L., Hardy, N.B. & Wiegmann, B.M. (2010) On wings phylogenomic pioneers: designing novel nuclear markers for of lace: phylogeny and Bayesian divergence time estimates of Neu- genomic DNA extractions of Lepidoptera. Systematic Biology, 57, ropterida (Insecta) based on morphological and molecular data. Sys- 231–242. tematic Entomology, 35, 349–378. Wallengren, H.D.J. (1891) Skandinaviens Neuroptera. Andra afdel- Wise, K.A.J. (1958) Trichoptera of New Zealand I. A catalogue of ningen. Kongliga Svenska Vetenskaps-Akademiens Handlingar, 24, the Auckland Museum collection with descriptions of new genera 1–173. and new species. Records of the Auckland Institute and Museum, 5, Weaver, J.S. III. (1983) The evolution and classification of Trichoptera, 49–63. with a revision of the Lepidostomatidae and a North American Wise, K.A.J. (1965) An annotated list of aquatic and semi-aquatic synopsis of the family. Dissertation, Clemson University, Clemson, insects of New Zealand. Pacific Insects, 7, 191–216. South Carolina. Weaver, J.S. III (1997) A new genus of Petrothrincidae (Trichoptera) Accepted 17 August 2016 from Madagascar with specialized modifications in the female termi- First published online 30 September 2016 nalia for carrying the eggmass. Proceedings of the 8th International Symposium on Trichoptera (ed. by R.W. Holzenthal and O.S. Flint Jr.), pp. 467–474. Ohio Biological Survey, Columbus, Ohio.