Molecular & Biochemical Parasitology

Molecular & Biochemical Parasitology 190 (2013) 38–43

Contents lists available at SciVerse ScienceDirect

Sequencing of the ␤-tubulin genes in the ascarid nematodes Parascaris equorum

ଝ and Ascaridia galli

∗

E. Tydén , A. Engström, D.A. Morrison, J. Höglund

Department of Biomedical Sciences and Veterinary Public Health, Section for Parasitology, Swedish University of Agricultural Sciences, S-750 07 Uppsala, Sweden

a r t i c l e i n f o a b s t r a c t

Article history: Benzimidazoles (BZ) are used to control infections of the equine roundworm Parascaris equorum and

Received 14 March 2013

the poultry roundworm Ascaridia galli. There are still no reports of anthelmintic resistance (AR) to BZ in

Received in revised form 7 May 2013

these two nematodes, although AR to BZ is widespread in several other veterinary parasites. Several single

Accepted 9 May 2013

nucleotide polymorphisms (SNP) in the ␤-tubulin genes have been associated with BZ-resistance. In the

Available online 16 May 2013

present study we have sequenced ␤-tubulin genes: isotype 1 and isotype 2 of P. equorum and isotype 1 of A.

galli. Phylogenetic analysis of all currently known isotypes showed that the Nematoda has more diversity

Keywords:

among the ␤-tubulin genes than the Vertebrata. In addition, this diversity is arranged in a more complex

Parascaris equorum

pattern of isotypes. Phylogenetically, the A. galli sequence and one of the P. equorum sequences clustered

Ascaridia galli

␤-Tubulin with the known Ascaridoidea isotype 1 sequences, while the other P. equorum sequence did not cluster

␤

Anthelmintic resistance with any other -tubulin sequences. We therefore conclude that this is a previously unreported isotype

PCR 2. The ␤-tubulin gene sequences were used to develop a PCR for genotyping SNP in codons 167, 198 and

200. No SNP was observed despite sequencing 95 and 100 individual adult worms of P. equorum and A.

galli, respectively. Given the diversity of isotype patterns among nematodes, it is likely that associations

of genetic data with BZ-resistance cannot be generalised from one taxonomic group to another.

1. Introduction been controlled by the strategic use of ML [4]. However, today ML-

resistance is recognised as a worldwide problem in P. equorum [4].

Anthelmintic resistance (AR) has become a major problem in On the other hand, the BZ fenbendazole (FBZ), is still effective, and

veterinary medicine, and constitutes a threat to animal welfare therefore the anthelmintic currently recommended for treatment.

and productivity [1]. Recently, AR has also been reported as an The poultry roundworm Ascaridia galli is another ascarid, which has

emerging problem in soil transmitted human parasites [2]. Per def- increased substantially in laying hens during the last decade due to

inition, AR is an inherited phenomenon resulting from changes the ban on traditional battery cages [5]. Although there are still no

in the genomes of the parasites that subsequently lead to phe- reports of AR in this nematode, the BZ ﬂubendazole (FLU), is the only

notypes with a reduced response to anthelmintic treatment [3]. anthelmintic substance currently available for treatment against

Both macrocyclic lactones (ML) and benzimidazoles (BZ) are com- this parasite. Unlike most other anthelmintics, FLU is administered

mon broad-spectrum anthelmintics that have been used for several to the birds for several days in their drinking water. As drug admin-

decades to control animal parasitic diseases. Unfortunately, the istration is based on voluntary oral intake, underdosing is likely to

extensive use of ML and BZ over many years has led to the devel- occur, which is one potential factor that has been identiﬁed as being

opment of high levels of AR, particularly in different nematodes of important for the rapid development of AR [6].

horses and ruminants [for review see 1]. Although the underlying mechanisms of AR development in

Parascaris equorum is one of the most pathogenic parasites in nematodes essentially remain unknown, it is understood that AR

foals and yearlings. For many years this ascarid roundworm has can arise in different ways. However, for BZs a change in the molec-

ular target causing failure at the binding site is believed to be the

major mechanism [6]. The mode of action of BZ is disruption of

microtubule equilibrium, which is essential for maintenance of

ଝ

␤

This is an open-access article distributed under the terms of the Creative cellular homeostasis. BZ binds to -tubulin, preventing the poly-

Commons Attribution-NonCommercial-ShareAlike License, which permits non-

merisation of the ␣-and ␤ subunits to form heterodimers [7]. Most

commercial use, distribution, and reproduction in any medium, provided the

eukaryotic cells express multiple variants or isoforms of closely

original author and source are credited.

∗ related ␤-tubulins that are the products of distinct genes [8]. ␤-

Corresponding author. Tel.: +46 18 671208; fax: +46 18 673334.

E-mail address: [email protected] (E. Tydén). Tubulin sequences are highly conserved in metazoans, including

E. Tydén et al. / Molecular & Biochemical Parasitology 190 (2013) 38–43 39

Table 1

Primers used for isolation of ␤-tubulin genes in A. galli and P. equorum.

Species Primer Oligonucleotide sequence (5 –3 )

A. galli/P. equorum F degenerate CAAGTGGAGCKGGHCACAACTGGC

A. galli/P. equorum R degenerate CGBAGATCHGCATTCAGCTGHCCAGG

A. galli/P. equorum F degenerate nested CTYGGTGGAGGYACMGGWTC

A. galli RACE gene-speciﬁc primers GGGTCGCATTGTACGGCTCCAGGACGA

P. equorum RACE gene-speciﬁc primers GGAGACGGGACGACCGAGAACGAGCT

Designed according to [18].

nematodes, but there are also differences that are most pronounced reagents were from Applied Biosystems, apart from BSA that was

in the carboxy-terminal parts of the genes [8]. For many years, supplied from New England Biolabs. The cycling parameters for

◦

BZ resistance has been believed to be associated with a structural the ampliﬁcation consisted of an initial denaturation at 95 C for

◦

change in the ␤-tubulin molecule that causes reduced binding of 5 min, followed by 40 cycles of 95 C for 45 s, primer annealing at

◦ ◦

BZ and thus absence of the anthelmintic effect [9]. This structural 50–65 C for 45 s, and extension at 72 C for 1 min, with a prolonga-

change in the ␤-tubulin molecule is thought to be associated with tion of the ﬁnal extension of 3 min (Bio-Rad, My Cycler thermal

SNP in the ␤-tubulin isotype 1 gene. In sheep nematodes such as cycler). The PCR product from the ﬁrst PCR at an annealing tem-

◦

Haemoncus contortus and Trichostrongylus spp., mainly three dif- perature of 52.9 C was then used as a template for the subsequent

ferent SNPs have been reported to be responsible for BZ resistance: ampliﬁcation using the nested primer (Table 1), together with the

substitution of phenylalanine (TTC) by a tyrosine (TAC) at codon outer antisense primer used in the ﬁrst PCR. Nested PCR was per-

200 [10–13], or at codon 167 also leading to a shift from (TTC) by formed under the same conditions as the ﬁrst PCR. Prior to cloning, a

␮

a tyrosine (TAC) at codon 200 [14], and/or a change of glutamate 5 L aliquot of PCR product from the nested reaction was examined

(GAA) to alanine (GCA) at codon 198 [16]. Homozygous resistance on a 1% agarose electrophoresis gel buffered with Tris-Borat-EDTA

mutations in more than one locus are never found, which suggests (TBE) to conﬁrm the size of the product. The ampliﬁed PCR products

that ␤-tubulin can tolerate one mutation, but that two mutations were cloned into pGEM -T Easy Vector Systems (pGMT, Promega),

make the protein dysfunctional and thus are lethal for the parasite according to the manufacturer’s instructions. Ampliﬁcation of the

[17]. 3 and 5 ends of each cDNA from P. equorum and A. galli was then

As noted above, there are currently no studies reporting BZ resis- performed using rapid ampliﬁcation cDNA ends (RACE) from Invit-

tance in either P. equorum or A. galli. However, BZ resistance is likely rogen. Based on the sequenced fragment, gene-speciﬁc primers

to occur in the near future, as overreliance on one drug class and were designed individually for the 5 and 3 ends of the of ␤-tubulin

underdosing are potential risk factors for the development of AR in gene of P. equorum and A. galli (Table 1). PCR product of 3 and 5

both species [4]. The overall aim of the present study was to provide were ﬁnally cloned using a TOPO TA vector sequencing kit (Invit-

sequences of ␤-tubulin gene isotype 1 and isotype 2 of P. equorum rogen), according to the manual.

and A. galli, and to compare these sequences with those of other

nematodes in a phylogenetic context. Moreover, we developed a

2.3. Sequencing

PCR for detection of SNPs in codons 167, 198 and 200.

Altogether 20 clones from 3 RACE and 20 clones from 5 RACE of

2. Materials and methods each nematode were sequenced. Aliquots of colony PCR products

were analysed by electrophoresis on Tris-Borate electrophoresis

2.1. Parasitic material for RNA extraction and cDNA synthesis buffer (TBE) 1.5% agarose gels. Prior to sequencing, the remaining

PCR products were puriﬁed using 10 U Fermentas Exonuclease I

Adult P. equorum were expelled from naturally infected horses (ExoI, Thermo Scientiﬁc), according to the manufacturer’s descrip-

® ®

with fenbendazole (Axilur vet. 19% oral paste, Intervet), and tion. The amplicons were sequenced using the Big Dye Terminator

washed immediately with DEPC-treated water and stored at v3.1 Cycle Sequencing Kit Protocol (Applied Biosystems), accord-

◦

−80 C. One adult A. galli was collected at necropsy from naturally ing to the manufacturer. The sequences were determined with a

infected hens, and washed with DEPC-treated water and stored Genetic Analyser (ABI PRISM 3100). The sequences were edited

◦

at −80 C. For initial isolation of ␤-tubulin sequences, RNA was and analysed with CLC Main Workbench version 5.6.1.

extracted from each nematode species using TRIzol (Invitrogen, Life

Technologies) according to the manufacturer’s recommendation.

2.4. Phylogenetic analysis

The integrity of the RNA was veriﬁed on a 1% agarose gel contain-

ing 18% formaldehyde at 60 V. About 1 ␮g RNA was used for cDNA

The P. equorum and A. galli sequences were used in BLAST

synthesis using ABI high capacity RNA-to-cDNA (ABI). All RNA and

◦ searches of (i) the nematodes in the GenBank non-redundant

cDNA were stored at −80 C.

database; (ii) the genome databases of available nematodes, includ-

ing Caenorhabditis elegans, C. briggsae and C. remanei, Loa loa and

2.2. Isolation of ˇ-tubulin Brugia malayi; and (iii) the horse, chicken, human, green anole,

western clawed frog, zebraﬁsh and purple sea urchin genome

For the initial isolation of the P. equorum and A. galli ␤-tubulin databases. This yielded a total of 87 ␤-tubulin sequences for phy-

genes, cDNA was ampliﬁed with degenerate primers based on the logenetic analysis, as listed in the Supplementary online material.

conserved regions of ␤-tubulin of six related nematodes accord- The DNA sequences were translated to amino acids, and the

ing to [18]. In the ﬁrst PCR, the cDNA was ampliﬁed with the outer amino acid sequences were edited and aligned using MacClade

sense primer (Table 1) and the outer antisense primer (Table 1) version 4.08 [19]. For regions with variable lengths, hypotheses

using gradient PCR under the following conditions: 25 ␮L reaction of alignment were evaluated using Promals3D [20], which aligns

volumes containing 10 mM Tris–HCl pH 8.3, 4 ␮g Bovine Serum the sequences based on the secondary structure of the protein. The

Albumin (BSA), 50 mM KCl, 2 mM MgCl2, 0.4 ␮M of each primer, ﬁnal alignment consisted of 442 aligned codon positions. The phy-

0.24 mM dNTP, and 1.5 U AmpliTaq GOLD DNA polymerase. All logenetic relationships among the aligned amino acid sequences

40 E. Tydén et al. / Molecular & Biochemical Parasitology 190 (2013) 38–43

Table 2

ABI, Thermal Cycler 2720. Aliquots of PCR products were obtained

Primers used for analysis of SNPs in codons 167, 198 and 200 in the ␤-tubulin genes

and analysed as described above.

of A. galli and P. equorum.

Species/gene Codon Primer Oligonucleotide sequence (5 –3 )

3. Results

A. galli F AGATCCGCGAAGAATATCCC

167

Isotype 2 R CTTCGGCGATGGAACAACC

3.1. Sequencing of the ˇ-tubulin gene

A. galli F CCCTTTCAGTGCATCAACTC

198/200

Isotype 2 R TAAGATCGCCATAGGTCGG

P. equorum F AGATTCGTGAAGAATATCCC RACE of P. equorum resulted in ampliﬁcation of two variants of

167

Isotype 1 R CTTTGGAGACGGGACGACC

amplicons from the 3 end and two variants of amplicons from the 5

P. equorum F TGGAGCCTTACAACGCAAC

198/200 end. For P. equorum, 20 clones each from 3 RACE PCR-products and

Isotype 1 R TGGGATTTGTAAGCTTCAGAG

5 RACE PCR-products were sequenced. The sequencing of RACE

P. equorum F AGATTCGTGAGGAGTATCCA

167

␤

Isotype 2 R CTTTGGAGACGGGACGACC PCR-products resulted in two full length cDNA variants of the -

P. equorum F TGGAGCCTTACAATGCAAC

198/200 tubulin gene of P. equorum with an overall length of 1350 bp. A

Isotype 2 R CTGGATTAGACAACTTCAGCG

BLAST search demonstrated high similarity for one of the two cDNA

variants (GenBank accession number KC713797) with ascaridoid ␤-

tubulin isotype 1 sequences, but the other novel variant (GenBank

were analysed using SplitsTree version 4.11.3 [21], based on the

accession number KC713798) was unmatched. The RACE of A. galli

JTT + G + I model (G = 0.71, I = 0.51), as determined by ProtTest ver-

resulted in ampliﬁcation of one amplicon sequence of the 3 ends

sion 2.4 [22]. A neighbour-net network was used to display the

and the 5 ends. For A. galli 20 clones from 3 RACE PCR-products

relationships, rather than a phylogenetic tree, because it is impor-

and 20 clones 5 RACE PCR-products were sequenced. The sequenc-

tant to emphasise the conﬂicts between sequences as well as their

ing of RACE PCR-products resulted in one full length cDNA of the

similarities [see 23]. ␤

-tubulin gene of A. galli with an overall length of 1350 bp. A BLAST

search of the A. galli ␤-tubulin cDNA (GenBank accession number

2.5. Parasitic material and DNA extraction for SNP analysis

KC713796) demonstrated high similarity with the ␤-tubulin iso-

type 1 sequences of other ascaridoid nematodes (Fig. 1). To search

Adult P. equorum were expelled from naturally infected horses

for the ␤-tubulin isotype 2 in A. galli, an additional 20 clones from

with FBZ (Axilur vet. 19% oral paste, Intervet) at the recommended

3 - and 5 RACE PCR-products were sequence, but no other variants

dose rate, collected by the horse manager, and immediately sent

were found.

by surface mail to the laboratory of the Section for Parasitology

at the Swedish University of Agricultural Sciences (SLU) in Upp-

3.2. Phylogenetic analysis

sala (Table 3). Adult A. galli from broiler breeder and laying hens

were collected from the small intestines of infected birds, either at

The neighbour-net phylogenetic network (Fig. 1) had many

a slaughterhouse or from birds submitted to the National Veteri-

reticulations, indicating complex relationships among the animal

nary Institute (SVA) in Uppsala for routine diagnostic necropsies ␤

-tubulin genes. However, there was still a strong tree-like pattern,

as described earlier [24]. From most farms, 10 A. galli were col-

which allows a straightforward interpretation of several genetic

lected from an individual hen (Table 4). For both species, DNA

patterns.

was extracted from individual worms using nucleospin tissue

First, the nematodes showed greater diversity among the

(Macherey-Nagel) according to the manufacturer’s recommenda- ␤

◦ -tubulin genes than did the vertebrates, which included two

tion. The puriﬁed DNA was stored at -20 C until use.

mammals, a bird, a reptile, an amphibian and a ﬁsh. The echino-

derm (Strongylocentrotus purpuratus) genes were also much more

2.6. Analysis of SNPs in codons 167, 198 and 200 of the ˇ-tubulin

similar to those of the vertebrates than were the nematode

isotype 1 and 2 ones.

Second, the vertebrates showed a pattern of distinct ␤-tubulin

Primers for ampliﬁcation of one PCR product covering codon

gene isotypes that were shared between species, currently named

167 (Table 2) and one PCR product covering codons 198 and 200

isotypes 1, 2, 3, 4 and 6. The nematodes did not have this pattern,

(Table 2) were designed based on the sequences isolated above.

except for the isotype 4 gene in the Rhabditoidea and Filari-

PCR was conducted under the conditions described in Section 2.2.

oidea, which was more similar to the vertebrate isotypes than

The cycling parameters for the ampliﬁcation consisted of an ini-

◦ ◦ most of the other nematode isotypes (Fig. 1). Furthermore, in

tial denaturation at 95 C for 5 min, followed by 40 cycles of 95 C,

◦ ◦ the two examined species of the Trichocephalida only one iso-

primer annealing at 55 C for 45 s, and extension at 72 C for 30 s,

◦ type has yet been detected, which clustered with the vertebrate

with a prolongation of the ﬁnal extension of 3 min at 72 C using an isotypes.

Third, our A. galli sequence and the novel P. equorum ␤-tubulin

sequence clustered with the Ascaridoidea isotype 1 sequences,

Table 3

The geographical origin of P. equorum isolate, number of worms collected and the from which we conclude that these two are isotype 1 (Fig. 1). The

breed of horses. All worms were collected after being expelled by fenbendazole.

other P. equorum sequence did not cluster with any other ␤-tubulin

sequence, and we therefore conclude that this is of a previously

Geographical origin in Sweden Number of worms Breed of horses

unreported isotype 2 of the Ascaridoidea.

Boden 9 Standardbred

Fourth, there were some interesting patterns of gene relation-

Borlänge 9 Standardbred

Heby 9 Standardbred ship among the nematodes, including:

Bro 10 Standardbred

Ekerö 10 Standardbred

(i) the ␤-tubulin isotypes 1 and 2 of the Rhabditoidea and Strongyl-

Tystberga 9 Standardbred

ida were similar to each other, but were distinct from isotypes

Västervik 9 Standardbred

Landskrona 10 Standardbred 1 and 2 of the Ascaridoidea and Filarioidea;

Svenljunga 8 Standardbred

(ii) for the Rhabditoidea and Strongylida, isotypes 1 and 2 formed

Sjöbo 9 Standardbred

4 closely related groups for each taxonomic group, whereas

E. Tydén et al. / Molecular & Biochemical Parasitology 190 (2013) 38–43 41

Table 4

The geographical origin of A. galli isolate, number of worms collected and housing system. All worms were collected during necropsy.

Geographical origin in Sweden Chicken category Housing system Number of worms

Jönköping Laying hens Aviary-indoor 10

Kalmar Laying hens Aviary-indoor 10

Skåne Broiler breeders Litter indoor 10

Halland Laying hens Aviary-indoor 10

Östergötland Laying hens Aviary-indoor 10

Stockholm Laying hens Litter indoor 10

Kalmar Laying hens Litter indoor 10

Denmark Laying hens Organic 10

Blekinge Laying hens Free-range 10

Östergötland Laying hens Organic 10

for the Ascaridoidea and Filarioidea isotype 1 was similar 3.3. SNP analyses

between the taxonomic groups while isotype 2 was differ-

ent between the groups, as well as being very different from All individual worms of P. equorum and A. galli were homozygous

isotype 1; at codons 167, 198 and 200. Analysis of the sequenced PCR-

(iii) for the Panagrolaimoidea, sequences were available from products revealed no occurrence of SNP in any of the codons at

Strongyloides papillosus and Steinernema carpocapsae, but these positions 167, 198 or 200 (Table 5). Thus, the ␤-tubulin isotype 1

showed large phylogenetic difference suggests that they were of P. equorum and A. galli had TTC at codon 167, GAG at codon 198

␤

also of different -tubulin isotypes, with the Steinernema and TTC at codon 200, whereas the ␤-tubulin isotype 2 genes in all

sequence presumably being isotype 1 and the Strongyloides P. equorum were homozygous for TTT at codon 167, GAG at codon

sequence being isotype 2; 198, and TAC at codon 200.

(iv) ␤-tubulin isotype 4 has so far been detected only in the Rhab-

ditoidea and Filarioidea; and 4. Discussion

(v) Loa loa (Filarioidea) had an extra fourth ␤-tubulin isotype

(accession number XM 003139955), which has not yet been In this study we have for the ﬁrst time sequenced ␤-tubulin

detected in any other nematode. gene isotype 2 in P. equorum and ␤-tubulin isotype 1 in A. galli.

Fig. 1. Neighbour-net phylogenetic network of the 87 ␤-tubulin sequences. Most of the individual sequences are unlabelled. The taxonomic groups are named according to

the GenBank Taxonomy, and the ␤-tubulin isotypes are (mostly) named according to the database sequence annotations. The colours represent the monophyletic groups of

[27], with Clade I = blue, Clade III = red, Clade IV = green, and Clade V = cyan.

42 E. Tydén et al. / Molecular & Biochemical Parasitology 190 (2013) 38–43

Table 5

Genotypes of ␤-tubulin isotype 1 and isotype 2 of P. equorum and ␤-tubulin isotype 1 of A. galli in individual worms. The allele frequencies for SNPs determined by PCR and

sequencing.

␤ ␤

Species -Tubulin isotype 1 gene -Tubulin isotype 2 gene

Codon 167 Codon 198 Codon 200 Codon 167 Codon 198 Codon 200

A. galli TTT GAG TTC

n = 100 100% 100% 100%

P. equorum TTC GAG TTC TTC GAG TTT

n = 95 100% 100% 100% 100% 100% 100%

Furthermore, we conﬁrmed the existence of P. equorum ␤-tubulin either isotype 1, 2 or 4, and thus presumably represents a fourth

gene, which was identiﬁed as isotype 1. Subsequently, allele- ␤-tubulin isotype. Furthermore, only one ␤-tubulin isotype was

speciﬁc PCRs were developed and applied for investigation of identiﬁed in the Trichocephalida.

BZ-resistance associated codons 167, 198 and 200 in the ␤-tubulin Since the isotypes 1 of both Filarioidea and Ascaridoidea clus-

gene, which have been linked to AR in other nematodes of vet- tered, and appear to be separated from the isotype 2 sequences,

erinary interest. We observed no variation in these genes despite this implies that the original gene duplication occurred before the

sequencing 95 and 100 individual adult worms of P. equorum and divergence of the two superfamilies. On the other hand, since the

A. galli, respectively. This either conﬁrms the susceptible status of Rhabditoidea isotypes 1 and 2 were similar to each other, as were

these worms, which so far have not shown any clinical indications the Strongylida isotypes 1 and 2, then this implies either that these

of AR to benzimidazole [25,26], even tough these compounds have gene duplications occurred after the divergence of the superfami-

been widely used for several years to control these infections, or it lies or that there has been recent concerted evolution of the gene

may equally indicate that these AR mechanisms are not involved paralogs.

in these parasites. This diversity of gene relationships among the nematodes has

In P. equorum, two ␤-tubulin isotypes were sequenced using the important consequences for the possibly that AR is related to differ-

degenerate primer approach according to the method described by ences between isotypes. Based on the results from this phylogenetic

[18]. Using the same approach, only one ␤-tubulin gene, isotype study, it is likely that associations of genetic data with BZ-resistance

1, was identiﬁed and sequenced in A. galli. We could not identify cannot be generalised from one taxonomic group to another, which

isotype 2 in A. galli even though optimisation of the PCR-protocol means that the observed patterns in the Strongylida may not be

were performed, up to 10 degenerate primers supposed to be more applicable to the Ascaridoidea, or indeed to any other group of

speciﬁc to isotype 2 were designed, and 60 clones were sequenced. nematodes.

Similarly, only one ␤-tubulin gene has been identiﬁed in Trichuris In all of the specimens investigated (for P. equorum n = 95 and

trichiura using low stringency Southern Blot technique [27]. for A. galli n = 100), 100% susceptible alleles were found in all

The Nematoda is extremely large and diverse, and molecular codons. The ﬁeld isolates sequenced herein have no prior history of

phylogenetic analysis based on SSU rRNA has been used to produce reduced efﬁcacy of BZ [25,26], and the absence of SNP was there-

new views of the phylogeny [28]. Access to EST-data suggests the fore not surprising. Selection of SNP in the ␤-tubulin gene, which

existence of three major nematode classes, which can be further is linked to AR has been reported in several nematode parasites of

divided into ﬁve major clades [29]. Interestingly, the model nema- veterinary importance. Simultaneously, screening of SNP in other

tode genus Caenorhabditis is in the same clade as the strongylids, strongylids such as Trichostrongylus tenuis [30], Necator americanus,

including important parasitic nematode species infecting domestic Ancylostoma duodenale, and Ancylostoma caninum [31], as well as in

livestock, with genera such as Haemonchus where the existence of Ascaris lumbricoides [18] and Trichurus spp. [32] did not reveal any

AR has been linked to mutations in the ␤-tubulin isotypes 1 and 2 mutations in codons 167, 198 or 200 even though the investigated

[11,15]. It seems reasonable to assume that the biology of C. elegans worms were collected from animals frequently dewormed with BZ.

will have more relevance to these parasites than to more distant For P. equorum, it is worth mentioning that most of the farms

relatives, such as the clade with the ascarids including P. equorum included in this survey dewormed their foals regularly with FBZ

and A. galli, which in turn is different from the clade that contains (Axilur vet. 19% oral paste, Intervet). In addition, all adult P. equo-

T. trichiura. rum worms analysed for SNP were expelled using FBZ. Although

There were also two sequences of rhabditid within Panagro- these worms had been exposed to BZ and thereby under selection,

laimoidea available, which were very different from each other. no SNP that confer BZ-resistance were still detected. This ﬁnding

However, one species, S. carpocapsae is entomopathogenic nema- is similar to the results from recent studies where human Ancy-

tode, whereas S. papillosus has a heterogonic life cycle that may lostoma hookworms, did not show any signs of BZ selection despite

infect the small intestine of ruminants, which may indicate that worms were recovered from children treated with mebendazole

these species more unrelated than expected. However, it seems for 13 rounds [31,33]. Furthermore, several of the studs included

likely, that the S. carpocapsae sequence is an isotype 1 sequence, in the present study have a history of resistance in P. equorum to

while that from the S. papillosus, is of isotype 2. the ML substance ivermectin (IVM) [25,34]. In this case, the new

The neighbour-net phylogenetic network showed that there is ﬁnding that repeated administration of IVM may select for SNPs in

great diversity of ␤-tubulin genes in the Nematoda. In particular, codon 167, 198 and 200 of the ␤-tubulin gene in H. contortus and

there is not a single “isotype 1” or “isotype 2” sequence type, and Onchocerca volvulus [35,36] does not appear to relate to P. equorum.

where the Rhabditoidea and Strongylida showed similar patterns, This indicates the difﬁculty to extrapolate the mechanisms behind

as did the Ascaridoidea and Filarioidea. For both the Strongylida and AR between parasite species.

Rhabditoidea, the sequences of isotypes 1 and 2 clustered together, In the case of A. galli, less is known about the deworming history

with the isotype 4 sequences forming a separate group independent of the adults analysed in the present study. In contrast to P. equorum,

of the taxonomy. However, the isotypes 1 of both Filarioidea and A. galli is a parasite that has recently reappeared in laying hens in

Ascaridoidea clustered, while the isotype 2 sequences formed sepa- Sweden, as a consequence of the ban on traditional battery cages

rate groups that were very different from the isotype 1 sequences. [36]. Many farms occasionally deworm their ﬂocks with FLU in a

There was also an isotype from Loa loa that is apparently not of way that may lead to under-dosing and select for the development

E. Tydén et al. / Molecular & Biochemical Parasitology 190 (2013) 38–43 43

of AR [26]. Furthermore, the use of anthelmintics against A. galli [12] Silvestre A, Humbert JF. A molecular tool for species identiﬁcation and benzim-

idazole resistance diagnosis in larval communities of small ruminant parasites.

has been restricted, and it can be assumed that the selection for AR

Experimental Parasitology 2000;95:271–6.

against BZ substances until now has been minimal.

[13] Schwab AE, Boakye DA, Kyelem D, Prichard RK. Detection of benzimidazole

In conclusion, a PCR has been developed that can be used to resistance-associated mutations in the ﬁlarial nematode Wuchereria ban-

crofti and evidence for selection by albendazole and ivermectin combination

screen for SNP 167, 198 and 200 in P. equorum and A. galli. These

treatment. American Journal of Tropical Medicine and Hygiene 2005;73:

SNP were absent in all adult worms analysed. However, the phy- 234–8.

logenetic analysis suggests that we should not necessarily expect [14] Silvestre A, Cabaret J. Mutation in position 167 of isotype 1 ␤-tubulin gene of

Trichostrongylid nematodes: role in benzimidazole resistance. Molecular and

these speciﬁc SNP to occur in ascarids. Importantly, the genomic

Biochemical Parasitology 2002;120:297–300.

sequence data presented here provide the basis for the investiga-

[15] Prichard RK. Genetic variability following selection of Haemonchus contortus

␤

tion of other possible SNP within the -tubulin gene that could be with anthelmintics. Trends in Parasitology 2001;17:445–53.

used to monitor the emergence of BZ resistance, so that measures [16] Ghisi M, Kaminsky R, Maser P. Phenotyping and genotyping of Haemonchus

contortus isolates reveals a new putative candidate mutation for ben-

can be taken to counter it before it becomes widespread.

zimidazole resistance in nematodes. Veterinary Parasitology 2007;144:

313–20.

Conﬂict of interest statement [17] Hodgkinson JE, Clark HJ, Kaplan RM, Lake SL, Matthews JB. The role of poly-

morphisms at ␤ tubulin isotype 1 codons 167 and 200 in benzimidazole

resistance in cyathostomins. International Journal for Parasitology 2008;38:

The authors of this paper declare that there is no conﬂict of 1149–60.

interest with respect to funding or any other issue. [18] Diawara A, Drake LJ, Suswillo RR, Kihara J, Bundy DAP, Scott ME, et al. Assays

␤

to detect -tubulin codon 200 polymorphism in Trichuris trichiura and Ascaris

lumbricoides. PLOS Neglected Tropical Diseases 2009;3:e397.

Acknowledgements

[19] Maddison DR, Maddison WP. MacClade: analysis of phylogeny and character

evolution. Sunderland: Sinauer Associates; 2000.

[20] Pei J, Kim B-H, Grishin NV. PROMALS3D: a tool for multiple sequence and

This study was supported by the Swedish-Norwegian Founda-

structure alignment. Nucleic Acids Research 2008;36:2295–300.

tion for Equine Research. We are grateful to the owners of studies

[21] Huson DH, Bryant D. Application of phylogenetic networks in evolutionary

for participation in the trial. studies. Molecular Biology and Evolution 2006;23:254–67.

[22] Abascal F, Zardoya R, Posada D. ProtTest selection of best-ﬁt models of protein

evolution. Bioinformatics 2005;21:2104–5.

Appendix A. Supplementary data

[23] Morrison DA. Introduction to phylogenetic networks. Uppsala: RJR Produc-

tions; 2011.

[24] Höglund J, Morrison DA, Engström A, Nejsum P, Jansson DS. Population genetic

Supplementary data associated with this article can be

structure of Ascaridia galli re-emerging in non-caged laying hens. Parasite Vec-

found, in the online version, at http://dx.doi.org/10.1016/

tors 2012;5:97–9.

j.molbiopara.2013.05.003. [25] Osterman Lind E, Christensson D. Anthelmintic efﬁcacy on Parascaris equorum

in foals on Swedish studs. Acta Veterinaria Scandinavica 2009;51:45.

[26] Höglund J, Jansson DS. Infection dynamics of Ascaridia galli in non-caged laying

References

hens. Veterinary Parasitology 2011;180:267–73.

[27] Bennett AB, Barker GC, Bundy DAP. A beta-tubulin gene from Trichuris trichiura.

[1] Kaplan RM. Drug resistance in nematodes of veterinary importance: a status Molecular and Biochemical Parasitology 1999;103:111–6.

report. Trends in Parasitology 2004;20:477–81. [28] Blaxter ML, De Ley P, Garey JR, Liu LX, Scheldemann P, Vierstraete A, et al.

[2] Prichard RK. Markers for benzimidazole resistance in human parasitic nema- A molecular evolutionary framework for the phylum Nematoda. Nature

todes? Parasitology 2007;134:1087–92. 1998;392:71–5.

[3] Prichard RK, Hall CA, Kelly JD, Martin ICA, Donald AD. The problem [29] Mitreva M, Blaxter ML, Bird DM, McCarter JP. Comparative genomics of nema-

of anthelmintic resistance in nematodes. Australian Veterinary Journal todes. Trends in Genetics 2005;2:573–81.

1980;56:239–51. [30] Webster LM, Johnson PC, Adam A, Mable BK, Keller LF. Absence of three known

[4] Coles GC, Jackson F, Pomroy WE, Prichard RK, von Samson-Himmelstjerna G, benzimidazole resistance mutations in Trichostrongylus tenuis, a nematode par-

Silvestre A, et al. The detection of anthelmintic resistance in nematodes of asite of avian hosts. Veterinary Parasitology 2008;158:302–10.

veterinary importance. Veterinary Parasitology 2006;136:167–85. [31] Schwenkenbecher JM, Albonico M, Bickle Q, Kaplan RM. Characterization of

[5] Jansson DS, Nyman A, Vågsholm I, Christensson D, Göransson M, Fossum O, beta-tubulin genes in hookworms and investigation of resistance-associated

et al. Ascarid infections in laying hens kept in different housing systems. Avian mutations using real-time PCR. Molecular and Biochemical Parasitology

Pathology 2010;39:525–32. 2007;156:167–74.

[6] Wolstenholme AJ, Fairweather I, Prichard R, von Samson-Himmelstjerna G, [32] Hansen TVA, Nejsum P, Olsen A, Thamsborg SM. Genetic variation in codons

Sangster NC. Drug resistance in veterinary helminths. Trends in Parasitology 167, 198 and 200 of the beta-tubulin gene in whipworm (Trichusris spp.)

2004;20:469–76. from a range of domestic animals and wildlife. Veterinary Parasitology

[7] Lacey E. The role of the cytoskeletal protein, tubulin, in the mode of action 2013;193:141–9, doi:10.1016/j.vetpar.2012.12.003.

and mechanism of drug resistance to benzimidazoles. International Journal for [33] Albonico M, Wright V, Bickle Q. Molecular analysis of the ␤-tubulin

Parasitology 1988;18:885–936. gene of human hookworms as a basis for possible benzimidazole resis-

[8] Geary TG, Null SC, Favreau MA, Tang L, Prichard RK, Hatzenbuhler NT, et al. tance on Pemba Island. Molecular and Biochemical Parasitology 2004;134:

Three ␤-tubulin cDNAs from the parasitic nematode Haemonchus contortus. 281–4.

Molecular and Biochemical Parasitology 1992;50:295–306. [34] Lindgren K, Ljungvall O, Nilsson O, Ljungström B-L, Lindahl C, Höglund J.

[9] Beech RN, Skuce P, Bartley DJ, Martin RJ, Prichard RK, Gilleard JS. Parascaris equorum in foals and in their environment on a Swedish stud

Anthelmintic resistance: markers for resistance, or susceptibility. Parasitology farm, with notes on treatment failure of ivermectin. Veterinary Parasitology

2011;138:160–74. 2008;151:337–43.

␤

[10] Elard L, Comes AM, Humbert JF. Sequences of -tubulin cDNA from [35] Eng JKL, Blackhall WJ, Osei-Atweneboana MY, Bourguinat C, Galazzo D,

benzimidazole-susceptible and -resistant strains of Teladorsagia circumcincta, a Beech RN, et al. Ivermectin selection on ␤-tubulin: evidence in Onchocerca

nematode parasite of small ruminants. Molecular and Biochemical Parasitology volvulus and Haemonchus contortus. Molecular and Biochemical Parasitology

1996;79:249–53. 2006;150:229–35.

[11] Kwa MSG, Veenstra JG, Roos MH. Benzimidazole resistance in Haemonchus [36] Jansson DS, Vågsholm I, Nyman A, Christensson D, Göransson M, Fossum O,

contortus is correlated with a conserved mutation in beta tubulin isotype 1. et al. Ascarid infections in laying hens kept in different housing systems. Avian

Molecular and Biochemical Parasitology 1994;63:299–303. Pathology 2010;39:525–32.