Molecular & Biochemical Parasitology

Molecular & Biochemical Parasitology 190 (2013) 38–43 Contents lists available at SciVerse ScienceDirect Molecular & Biochemical Parasitology Sequencing of the ␤-tubulin genes in the ascarid nematodes Parascaris equorum ଝ and Ascaridia galli ∗ E. Tydén , A. Engström, D.A. Morrison, J. Höglund Department of Biomedical Sciences and Veterinary Public Health, Section for Parasitology, Swedish University of Agricultural Sciences, S-750 07 Uppsala, Sweden a r t i c l e i n f o a b s t r a c t Article history: Benzimidazoles (BZ) are used to control infections of the equine roundworm Parascaris equorum and Received 14 March 2013 the poultry roundworm Ascaridia galli. There are still no reports of anthelmintic resistance (AR) to BZ in Received in revised form 7 May 2013 these two nematodes, although AR to BZ is widespread in several other veterinary parasites. Several single Accepted 9 May 2013 nucleotide polymorphisms (SNP) in the ␤-tubulin genes have been associated with BZ-resistance. In the Available online 16 May 2013 present study we have sequenced ␤-tubulin genes: isotype 1 and isotype 2 of P. equorum and isotype 1 of A. galli. Phylogenetic analysis of all currently known isotypes showed that the Nematoda has more diversity Keywords: among the ␤-tubulin genes than the Vertebrata. In addition, this diversity is arranged in a more complex Parascaris equorum pattern of isotypes. Phylogenetically, the A. galli sequence and one of the P. equorum sequences clustered Ascaridia galli ␤-Tubulin with the known Ascaridoidea isotype 1 sequences, while the other P. equorum sequence did not cluster ␤ Anthelmintic resistance with any other -tubulin sequences. We therefore conclude that this is a previously unreported isotype PCR 2. The ␤-tubulin gene sequences were used to develop a PCR for genotyping SNP in codons 167, 198 and 200. No SNP was observed despite sequencing 95 and 100 individual adult worms of P. equorum and A. galli, respectively. Given the diversity of isotype patterns among nematodes, it is likely that associations of genetic data with BZ-resistance cannot be generalised from one taxonomic group to another. © 2013 The Authors. Published by Elsevier B.V. All rights reserved. 1. Introduction been controlled by the strategic use of ML [4]. However, today ML- resistance is recognised as a worldwide problem in P. equorum [4]. Anthelmintic resistance (AR) has become a major problem in On the other hand, the BZ fenbendazole (FBZ), is still effective, and veterinary medicine, and constitutes a threat to animal welfare therefore the anthelmintic currently recommended for treatment. and productivity [1]. Recently, AR has also been reported as an The poultry roundworm Ascaridia galli is another ascarid, which has emerging problem in soil transmitted human parasites [2]. Per def- increased substantially in laying hens during the last decade due to inition, AR is an inherited phenomenon resulting from changes the ban on traditional battery cages [5]. Although there are still no in the genomes of the parasites that subsequently lead to phe- reports of AR in this nematode, the BZ flubendazole (FLU), is the only notypes with a reduced response to anthelmintic treatment [3]. anthelmintic substance currently available for treatment against Both macrocyclic lactones (ML) and benzimidazoles (BZ) are com- this parasite. Unlike most other anthelmintics, FLU is administered mon broad-spectrum anthelmintics that have been used for several to the birds for several days in their drinking water. As drug admin- decades to control animal parasitic diseases. Unfortunately, the istration is based on voluntary oral intake, underdosing is likely to extensive use of ML and BZ over many years has led to the devel- occur, which is one potential factor that has been identified as being opment of high levels of AR, particularly in different nematodes of important for the rapid development of AR [6]. horses and ruminants [for review see 1]. Although the underlying mechanisms of AR development in Parascaris equorum is one of the most pathogenic parasites in nematodes essentially remain unknown, it is understood that AR foals and yearlings. For many years this ascarid roundworm has can arise in different ways. However, for BZs a change in the molecular target causing failure at the binding site is believed to be the major mechanism [6]. The mode of action of BZ is disruption of microtubule equilibrium, which is essential for maintenance of ଝ ␤ This is an open-access article distributed under the terms of the Creative cellular homeostasis. BZ binds to -tubulin, preventing the poly- Commons Attribution-NonCommercial-ShareAlike License, which permits non- merisation of the ␣-and ␤ subunits to form heterodimers [7]. Most commercial use, distribution, and reproduction in any medium, provided the eukaryotic cells express multiple variants or isoforms of closely original author and source are credited. ∗ related ␤-tubulins that are the products of distinct genes [8]. ␤- Corresponding author. Tel.: +46 18 671208; fax: +46 18 673334. E-mail address: [email protected] (E. Tydén). Tubulin sequences are highly conserved in metazoans, including 0166-6851/$ – see front matter © 2013 The Authors. Published by Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.molbiopara.2013.05.003 E. Tydén et al. / Molecular & Biochemical Parasitology 190 (2013) 38–43 39 Table 1 Primers used for isolation of ␤-tubulin genes in A. galli and P. equorum. Species Primer Oligonucleotide sequence (5 –3 ) a A. galli/P. equorum F degenerate CAAGTGGAGCKGGHCACAACTGGC a A. galli/P. equorum R degenerate CGBAGATCHGCATTCAGCTGHCCAGG a A. galli/P. equorum F degenerate nested CTYGGTGGAGGYACMGGWTC A. galli RACE gene-specific primers GGGTCGCATTGTACGGCTCCAGGACGA P. equorum RACE gene-specific primers GGAGACGGGACGACCGAGAACGAGCT a Designed according to [18]. nematodes, but there are also differences that are most pronounced reagents were from Applied Biosystems, apart from BSA that was in the carboxy-terminal parts of the genes [8]. For many years, supplied from New England Biolabs. The cycling parameters for ◦ BZ resistance has been believed to be associated with a structural the amplification consisted of an initial denaturation at 95 C for ◦ change in the ␤-tubulin molecule that causes reduced binding of 5 min, followed by 40 cycles of 95 C for 45 s, primer annealing at ◦ ◦ BZ and thus absence of the anthelmintic effect [9]. This structural 50–65 C for 45 s, and extension at 72 C for 1 min, with a prolonga- TM change in the ␤-tubulin molecule is thought to be associated with tion of the final extension of 3 min (Bio-Rad, My Cycler thermal SNP in the ␤-tubulin isotype 1 gene. In sheep nematodes such as cycler). The PCR product from the first PCR at an annealing tem- ◦ Haemoncus contortus and Trichostrongylus spp., mainly three dif- perature of 52.9 C was then used as a template for the subsequent ferent SNPs have been reported to be responsible for BZ resistance: amplification using the nested primer (Table 1), together with the substitution of phenylalanine (TTC) by a tyrosine (TAC) at codon outer antisense primer used in the first PCR. Nested PCR was per- 200 [10–13], or at codon 167 also leading to a shift from (TTC) by formed under the same conditions as the first PCR. Prior to cloning, a ␮ a tyrosine (TAC) at codon 200 [14], and/or a change of glutamate 5 L aliquot of PCR product from the nested reaction was examined (GAA) to alanine (GCA) at codon 198 [16]. Homozygous resistance on a 1% agarose electrophoresis gel buffered with Tris-Borat-EDTA mutations in more than one locus are never found, which suggests (TBE) to confirm the size of the product. The amplified PCR products ® that ␤-tubulin can tolerate one mutation, but that two mutations were cloned into pGEM -T Easy Vector Systems (pGMT, Promega), make the protein dysfunctional and thus are lethal for the parasite according to the manufacturer’s instructions. Amplification of the [17]. 3 and 5 ends of each cDNA from P. equorum and A. galli was then As noted above, there are currently no studies reporting BZ resis- performed using rapid amplification cDNA ends (RACE) from Invit- tance in either P. equorum or A. galli. However, BZ resistance is likely rogen. Based on the sequenced fragment, gene-specific primers to occur in the near future, as overreliance on one drug class and were designed individually for the 5 and 3 ends of the of ␤-tubulin underdosing are potential risk factors for the development of AR in gene of P. equorum and A. galli (Table 1). PCR product of 3 and 5 ® both species [4]. The overall aim of the present study was to provide were finally cloned using a TOPO TA vector sequencing kit (Invit- sequences of ␤-tubulin gene isotype 1 and isotype 2 of P. equorum rogen), according to the manual. and A. galli, and to compare these sequences with those of other nematodes in a phylogenetic context. Moreover, we developed a 2.3. Sequencing PCR for detection of SNPs in codons 167, 198 and 200. Altogether 20 clones from 3 RACE and 20 clones from 5 RACE of 2. Materials and methods each nematode were sequenced. Aliquots of colony PCR products were analysed by electrophoresis on Tris-Borate electrophoresis 2.1. Parasitic material for RNA extraction and cDNA synthesis buffer (TBE) 1.5% agarose gels. Prior to sequencing, the remaining PCR products were purified using 10 U Fermentas Exonuclease I Adult P. equorum were expelled from naturally infected horses (ExoI, Thermo Scientific), according to the manufacturer’s descrip- ® ® with fenbendazole (Axilur vet. 19% oral paste, Intervet), and tion. The amplicons were sequenced using the Big Dye Terminator washed immediately with DEPC-treated water and stored at v3.1 Cycle Sequencing Kit Protocol (Applied Biosystems), accord- ◦ −80 C. One adult A. galli was collected at necropsy from naturally ing to the manufacturer.

Load more