DOCSLIB.ORG

The Evolutionary History of Chromosomal Super-Integrons Provides an Ancestry for Multiresistant Integrons

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Evolutionary History of Chromosomal Super-Integrons Provides an Ancestry for Multiresistant Integrons The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons Dean A. Rowe-Magnus*, Anne-Marie Guerout*, Pascaline Ploncard*, Broderick Dychinco†, Julian Davies†, and Didier Mazel*‡ *Unite´de Programmation Mole´culaire et Toxicologie Ge´ne´ tique, Centre National de la Recherche Scientifique Unite´de Recherche Associe´e 1444, De´partement des Biotechnologies, Institut Pasteur, 25 Rue du Dr. Roux, 75724 Paris, France; and †Department of Microbiology and Immunology, University of British Columbia, 6174 University Boulevard, Vancouver, BC, Canada V6T 1Z3 Communicated by Allan Campbell, Stanford University, Stanford, CA, November 2, 2000 (received for review August 1, 2000) Integrons are genetic elements that acquire and exchange exog- located downstream of a resident promoter internal to the intI enous DNA, known as gene cassettes, by a site-specific recombi- gene, drives expression of the encoded proteins (13). Most of the nation mechanism. Characterized gene cassettes consist of a target attC sites of the integron cassettes identified to date are unique. recombination sequence (attC site) usually associated with a single Their length and sequence vary considerably (from 57 to 141 bp) open reading frame coding for an antibiotic resistance determi- and their similarities are primarily restricted to their boundaries, nant. The affiliation of multiresistant integrons (MRIs), which which correspond to the inverse core site (RYYYAAC) and the contain various combinations of antibiotic resistance gene cas- core site [G2TTRRRY; 2, recombination point (11, 14)]. settes, with transferable elements underlies the rapid evolution of More than 60 different antibiotic-resistance genes, covering multidrug resistance among diverse Gram-negative bacteria. Yet most antimicrobials presently in use, have been characterized in the origin of MRIs remains unknown. Recently, a chromosomal cassette structures (15). The stockpiling of exogenous genetic super-integron (SI) harboring hundreds of cassettes was identified loci to create multiresistant integrons (MRIs) has contributed in the Vibrio cholerae genome. Here, we demonstrate that the substantially to the current dilemma in the treatment of infec- activity of its associated integrase is identical to that of the MRI tious disease (2, 8, 15, 16), as MRIs harboring up to five different integrase, IntI1. We have also identified equivalent integron su- resistance cassettes have been described (17). However, the ␥ perstructures in nine distinct genera throughout the -proteobac- origin of integrons and their cassettes has remained obscure. terial radiation. Phylogenetic analysis revealed that the evolution- Recently a distinct type of integron was discovered in the ary history of the system paralleled that of the radiation, indicating Vibrio cholerae genome (18). Located on the smaller of the two that integrons are ancient structures. The attC sites of the 63 circular chromosomes (19), this element spans 126 kb and antibiotic-resistance gene cassettes identified thus far in MRIs are gathers at least 179 cassettes (20, 21) into a single structure highly variable. Strikingly, one-fifth of these were virtually iden- termed a super-integron (SI), dwarfing previously identified tical to the highly related yet species-specific attC sites of the SIs MRIs. Of particular interest were the observations that: (i) the described here. Furthermore, antimicrobial resistance homologues cassette-associated attC sites, termed VCRs [for Vibrio cholerae were identified among the thousands of genes entrapped by these repeats (22); other repeated sequences are named similarly] SIs. Because the gene cassettes of SIs are substrates for MRIs, these displayed a strikingly high degree of sequence relatedness, unlike data identify SIs as the source of contemporary MRIs and their their counterparts of MRIs; (ii) the attC site of two MRI cassettes. However, our demonstration of the metabolic functions, antibiotic-resistance gene cassettes, CARB4 and dfrVI, was sim- beyond antibiotic resistance and virulence, of three distinct SI gene ilar to the VCRs; and (iii) the V. cholerae SI cassettes were cassettes indicates that integrons function as a general gene- substrates for the class 1 integrase of MRIs (18). capture system for bacterial innovation. These relationships led us to hypothesize that MRIs evolved from SIs through the entrapment of intI genes and their cognate he impact of lateral gene transfer on bacterial evolution is attI sites into highly mobile structures like transposons. Subse- Tunderscored by the realization that foreign DNA can rep- quent harvesting of cassettes from various SI sources then led to resent up to one-fifth of a given bacterial genome (1). Perhaps the establishment of contemporary MRIs. In this scenario, each the most striking embodiment of its affect on microbial adap- distinct attC site of MRI cassettes would represent a specific SI tation has been the rapid and widespread emergence of similar cluster containing related attC sites, as in V. cholerae. If SIs are antibiotic-resistance profiles among phylogenetically diverse the progenitors of MRIs and their cassettes, then the SI inte- Gram-negative clinical and environmental isolates over the last grases should be active, the cassettes should encode adaptive half-century (2). The localization of antibiotic-resistance deter- functions, and SIs should be numerous in the bacterial kingdom. minants to mobile entities such as plasmids and transposons Here, we have demonstrated that the V. cholerae SI integrase is readily explained this phenomenon (3–6). Closer examination active for site-specific cassette recombination, and we have revealed that in many cases a new type of genetic element, termed an integron, harbored the resistance determinants. In- tegrons are natural cloning and expression systems that incor- Abbreviations: MRI, multiresistant integron; SI, super-integron; VCR, Vibrio cholerae re- porate open reading frames and convert them to functional peated sequence (repeated sequences of other species are named similarly); IS, insertion genes (for review see refs. 7 and 8). The integron platform codes sequence; Tn, transposon. for an integrase (intI) that mediates recombination between a Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. AF180939, AY014398–AY014401, AF324210, AF324211, proximal primary recombination site (attI) and a secondary AF324482–AF324484, and AF324934–AF324946). target called an attC site [or 59-base element (59be)]. The attC ‡To whom reprint requests should be addressed. E-mail: [email protected]. site is normally found associated with a single open reading The publication costs of this article were defrayed in part by page charge payment. This frame (ORF), and the attC-ORF structure is termed a gene article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. cassette (9–12). Insertion of the cassette at the attI site, which is §1734 solely to indicate this fact. 652–657 ͉ PNAS ͉ January 16, 2001 ͉ vol. 98 ͉ no. 2 Downloaded by guest on September 29, 2021 Table 1. VchIntIA-dependent recombination frequencies for the GCGTT) and Vmarlip3 (GAATTCTTATGGTTTTAATGC- CARB4 and ORF1::cat cassette substrates GAAAGTTAAAAAG). The product was digested with NdeI Strain Plasmid Recombination frequency and BamHI and cloned into pET3a digested with the same enzymes to give pET3aVml. T7 RNA polymerase-dependent ␻32 pSU38::CARB4, pVC3 5.0 ϫ 10Ϫ3 lipase expression in recombinant E. coli BL21(DE3)pLysS was Ϫ ␻34 pSU38::CARB4 Ͻ10 6 induced by the addition of isopropyl ␤-D-thiogalactoside (IPTG) ␻33 pSU38::ORF1-cat, pVC3 1.6 ϫ 10Ϫ2 to a final concentration of 0.5 mM on solid LB medium ␻35 pSU38::ORF1-cat Ͻ10Ϫ5 containing 100 ␮g͞ml ampicillin, 25 ␮g͞ml chloramphenicol, and 0.5% tributyrin as previously described (27). Positive clones produced a zone of clearing caused by hydrolysis of the lipid in determined the metabolic function of three SI cassettes: a the surrounding medium. Control strains carried the vector sulfate-binding protein, a psychrophilic lipase, and a restriction without insert. enzyme. Furthermore, a systematic search for SI structures beginning with Vibrio and closely related species and extending Identification of the Integrase Genes. A primer to rpmI (L35), to distantly related genera has revealed that this gene acquisition R16–1 (CCAAACGCCATTCTGCCTAAG), and VCR1 (18) machinery is an ancient system that is widespread among the were used to amplify VmiintIA from Vibrio mimicus genomic proteobacteria. DNA. Primers VCR1 and H7–1 (GGACTATGGCAAGTTC- CTCT), which targeted infC (IF3), were used to amplify the Materials and Methods entire VmeintIA gene from Vibrio metschnikovii chromosomal Bacterial Strains, PCR, Sequencing, and Phylogenetic Analysis. Bac- DNA. The VmeintIA gene was used to probe a Listonella pelagia terial strains were provided by the Collection de l’Institut HindIII library in pNot218R [modified from the phagemid Pasteur (CIP). All genomic DNA was isolated by using the pTZ18R vector (Pharmacia) to include in-frame NotI sites on Qiagen DNEasy Kit. PCR-amplified genes were cloned by both sides of the multiple cloning site]. Single-strand DNA was using the TA TOPO cloning kit (Invitrogen) and verified prepared after infection with M13K07 helper phage. This library by sequencing of the corresponding genomic clones [performed was used in a PCR with the M13 forward primer and a set of degenerate intI
Load more

Recommended publications
  • Mobile Genetic Elements in Streptococci
    Curr. Issues Mol. Biol. (2019) 32: 123-166. DOI: https://dx.doi.org/10.21775/cimb.032.123 Mobile Genetic Elements in Streptococci Miao Lu#, Tao Gong#, Anqi Zhang, Boyu Tang, Jiamin Chen, Zhong Zhang, Yuqing Li*, Xuedong Zhou* State Key Laboratory of Oral Diseases, National Clinical Research Center for Oral Diseases, West China Hospital of Stomatology, Sichuan University, Chengdu, PR China. #Miao Lu and Tao Gong contributed equally to this work. *Address correspondence to: [email protected], [email protected] Abstract Streptococci are a group of Gram-positive bacteria belonging to the family Streptococcaceae, which are responsible of multiple diseases. Some of these species can cause invasive infection that may result in life-threatening illness. Moreover, antibiotic-resistant bacteria are considerably increasing, thus imposing a global consideration. One of the main causes of this resistance is the horizontal gene transfer (HGT), associated to gene transfer agents including transposons, integrons, plasmids and bacteriophages. These agents, which are called mobile genetic elements (MGEs), encode proteins able to mediate DNA movements. This review briefly describes MGEs in streptococci, focusing on their structure and properties related to HGT and antibiotic resistance. caister.com/cimb 123 Curr. Issues Mol. Biol. (2019) Vol. 32 Mobile Genetic Elements Lu et al Introduction Streptococci are a group of Gram-positive bacteria widely distributed across human and animals. Unlike the Staphylococcus species, streptococci are catalase negative and are subclassified into the three subspecies alpha, beta and gamma according to the partial, complete or absent hemolysis induced, respectively. The beta hemolytic streptococci species are further classified by the cell wall carbohydrate composition (Lancefield, 1933) and according to human diseases in Lancefield groups A, B, C and G.
    [Show full text]
  • Piggybac Transposase Tools for Genome Engineering.Pdf
    piggyBac transposase tools for genome engineering PNAS PLUS Xianghong Lia,b, Erin R. Burnightc, Ashley L. Cooneyd, Nirav Malanie, Troy Bradye, Jeffry D. Sanderf,g, Janice Staberd, Sarah J. Wheelanh, J. Keith Joungf,g, Paul B. McCray, Jr.c,d, Frederic D. Bushmane, Patrick L. Sinnd,1, and Nancy L. Craiga,b,1 aHoward Hughes Medical Institute and bDepartment of Molecular Biology and Genetics, The Johns Hopkins University School of Medicine, Baltimore, MD 21205; cGenetics Program, Carver College of Medicine, The University of Iowa, Iowa City, IA 52242; dDepartment of Pediatrics, Carver College of Medicine, The University of Iowa, Iowa City, IA 52242; eDepartment of Microbiology, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104; fMolecular Pathology Unit, Center for Computational and Integrative Biology, and Center for Cancer Research, Massachusetts General Hospital, Boston, MA 02129; gDepartment of Pathology, Harvard Medical School, Boston, MA 02115; and hDivision of Biostatistics and Bioinformatics, Department of Oncology, The Johns Hopkins University School of Medicine, Baltimore, MD 21205 Edited by Richard A. Young, Massachusetts Institute of Technology, Cambridge, MA, and approved May 1, 2013 (received for review December 30, 2012) The transposon piggyBac is being used increasingly for genetic stud- site-directed mutagenesis of the PB catalytic domain and isolated − ies. Here, we describe modified versions of piggyBac transposase an excision competent/integration defective (Exc+Int ) PB. We − that have potentially wide-ranging applications, such as reversible also find that introduction of the Exc+Int mutations into a hy- − transgenesis and modified targeting of insertions. piggyBac is dis- peractive version of PB (5, 8, 15) yields an Exc+Int transposase tinguished by its ability to excise precisely, restoring the donor site whose excision frequency is five- to six-fold higher than that of to its pretransposon state.
    [Show full text]
  • Evolutionary Genomics of Conjugative Elements and Integrons
    Université Paris Descartes École doctorale Interdisciplinaire Européenne 474 Frontières du Vivant Microbial Evolutionary Genomic, Pasteur Institute Evolutionary genomics of conjugative elements and integrons Thèse de doctorat en Biologie Interdisciplinaire Présentée par Jean Cury Pour obtenir le grade de Docteur de l’Université Paris Descartes Sous la direction de Eduardo Rocha Soutenue publiquement le 17 Novembre 2017, devant un jury composé de: Claudine MÉDIGUE Rapporteure CNRS, Genoscope, Évry Marie-Cécile PLOY Rapporteure Université de Limoges Érick DENAMUR Examinateur Université Paris Diderot, Paris Philippe LOPEZ Examinateur Université Pierre et Marie Curie, Paris Alan GROSSMAN Examinateur MIT, Cambdridge, USA Eduardo ROCHA Directeur de thèse CNRS, Institut Pasteur, Paris ِ عمحمود ُبدرويش َالنرد َم ْن انا ِٔ َقول ُلك ْم ما ا ُقول ُلك ْم ؟ وانا لم أ ُك ْن َ َج ًرا َص َق َل ْت ُه ُالمياه َفأ ْص َب َح ِوهاً و َق َصباً َثق َب ْت ُه ُالرياح َفأ ْص َب َح ًنايا ... انا ِع ُب َالن ْرد ، ا َرب ُح يناً وا َس ُر يناً انا ِم ُثل ُك ْم ا وا قل قليً ... The dice player Mahmoud Darwish Who am I to say to you what I am saying to you? I was not a stone polished by water and became a face nor was I a cane punctured by the wind and became a lute… I am a dice player, Sometimes I win and sometimes I lose I am like you or slightly less… Contents Acknowledgments 7 Preamble 9 I Introduction 11 1 Background for friends and family . 13 2 Horizontal Gene Transfer (HGT) . 16 2.1 Mechanisms of horizontal gene transfer .
    [Show full text]
  • A Homologous Recombination-Based Method of Genetic Engineering
    PROTOCOL Recombineering: a homologous recombination-based method of genetic engineering Shyam K Sharan1, Lynn C Thomason2, Sergey G Kuznetsov1 & Donald L Court3 1Mouse Cancer Genetics Program, Center for Cancer Research, National Cancer Institute at Frederick, Frederick, Maryland 21702, USA. 2SAIC-Frederick Inc., Gene Regulation and Chromosome Biology Laboratory, Basic Research Program, Frederick, Maryland, 21702, USA. 3Gene Regulation and Chromosome Biology Laboratory, Center for Cancer Research, National Cancer Institute at Frederick, Frederick, Maryland 21702, USA. Correspondence should be addressed to S.K.S. ([email protected]) or D.L.C. ([email protected]). Published online 29 January 2009; doi:10.1038/nprot.2008.227 Recombineering is an efficient method of in vivo genetic engineering applicable to chromosomal as well as episomal replicons in Escherichia coli. This method circumvents the need for most standard in vitro cloning techniques. Recombineering allows construction of DNA molecules with precise junctions without constraints being imposed by restriction enzyme site location. Bacteriophage homologous recombination proteins catalyze these recombineering reactions using double- and single-stranded linear DNA substrates, natureprotocols so-called targeting constructs, introduced by electroporation. Gene knockouts, deletions and point mutations are readily made, gene / m tags can be inserted and regions of bacterial artificial chromosomes or the E. coli genome can be subcloned by gene retrieval using o c . recombineering. Most of these constructs can be made within about 1 week’s time. e r u t a n . INTRODUCTION w w Recombineering is an in vivo method of genetic engineering used This protocol will emphasize modification of bacterial artificial w / / 1–5 : primarily in Escherichia coli that uses short 50 base homologies .
    [Show full text]
  • Multidrug Resistance and Integron Carriage in Clinical Isolates of Pseudomonas Aeruginosa in Tehran, Iran
    Turkish Journal of Medical Sciences Turk J Med Sci (2015) 45: 789-793 http://journals.tubitak.gov.tr/medical/ © TÜBİTAK Research Article doi:10.3906/sag-1408-120 Multidrug resistance and integron carriage in clinical isolates of Pseudomonas aeruginosa in Tehran, Iran Somayeh MOAZAMI GOUDARZI, Fereshteh EFTEKHAR* Department of Microbiology, Faculty of Biological Sciences, Shahid Beheshti University, G.C., Tehran, Iran Received: 25.08.2014 Accepted/Published Online: 12.11.2014 Printed: 30.07.2015 Background/aim: Pseudomonas aeruginosa is the cause of 10% of hospital-acquired infections. The organisms are often multidrug- resistant, mediated mostly by antibiotic-resistant integrons. The aim of this research was to study integron carriage and its association with multidrug resistance in burn and nonburn clinical isolates of P. aeruginosa. Materials and methods: A total of 112 P. aeruginosa clinical isolates were collected from the Motahari and Shohadaye Tajrish hospitals in Tehran between July and December 2011. Antibiotic susceptibility to 13 antibiotics was determined by disk diffusion. Detection of integron classes 1 and 2 and amplifications of internal variable regions (IVRs) of class 1 integrons were carried out by PCR and specific primers. Results: Among the 112 isolates, 77 were from burn patients and 35 were nonburn isolates. Multidrug resistance and class 1 integron carriage were both significantly higher in the burn isolates compared to the nonburn strains (97.4% vs. 22.8% and 82.3% vs. 17.7%, respectively). Class 2 integron (2.7%) was only present in the burn isolates. Amplification of IVRs of class 1 integrons revealed 3 different fragment arrays. Conclusion: The significant association between multidrug resistance and integron carriage among P.
    [Show full text]
  • An Optimized Preparation Method for Long Ssdna Donors to Facilitate Quick Knock-In Mouse Generation
    cells Article An Optimized Preparation Method for Long ssDNA Donors to Facilitate Quick Knock-In Mouse Generation Yukiko U. Inoue 1,* , Yuki Morimoto 1, Mayumi Yamada 2, Ryosuke Kaneko 3, Kazumi Shimaoka 1, Shinji Oki 4, Mayuko Hotta 1, Junko Asami 1, Eriko Koike 1, Kei Hori 1, Mikio Hoshino 1, Itaru Imayoshi 2,5 and Takayoshi Inoue 1,* 1 Department of Biochemistry and Cellular Biology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Ogawahigashi, Kodaira, Tokyo 187-8502, Japan; [email protected] (Y.M.); [email protected] (K.S.); [email protected] (M.H.); [email protected] (J.A.); [email protected] (E.K.); [email protected] (K.H.); [email protected] (M.H.) 2 Research Center for Dynamic Living Systems, Graduate School of Biostudies, Kyoto University, Kyoto 606-8501, Japan; [email protected] (M.Y.); [email protected] (I.I.) 3 KOKORO-Biology Group, Laboratories for Integrated Biology, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka 565-0871, Japan; [email protected] 4 Department of Immunology, National Institute of Neuroscience, National Center of Neurology and Psychiatry, Ogawahigashi, Kodaira, Tokyo 187-8502, Japan; [email protected] 5 Department of Deconstruction of Stem Cells, Institute for Frontier Life and Medical Sciences, Kyoto University, Kyoto 606-8507, Japan * Correspondence: [email protected] (Y.U.I.); [email protected] (T.I.) Abstract: Fluorescent reporter mouse lines and Cre/Flp recombinase driver lines play essential roles Citation: Inoue, Y.U.; Morimoto, Y.; in investigating various molecular functions in vivo.
    [Show full text]
  • Transposon Based Mutagenesis and Mapping of Transposon Insertion Sites Within the Ehrlichia Chaffeensis Genome Using Semi Random Two-Step Pcr
    TRANSPOSON BASED MUTAGENESIS AND MAPPING OF TRANSPOSON INSERTION SITES WITHIN THE EHRLICHIA CHAFFEENSIS GENOME USING SEMI RANDOM TWO-STEP PCR by VIJAYA VARMA INDUKURI B.S., ANDHRA UNIVERSITY, India, 2008 A THESIS Submitted in partial fulfillment of the requirements for the degree MASTER OF SCIENCE Department of Diagnostic Medicine/Pathobiology College of Veterinary Medicine KANSAS STATE UNIVERSITY Manhattan, Kansas 2013 Approved by: Major Professor Roman Reddy Ganta Copyright VIJAYA VARMA INDUKURI 2013 Abstract Ehrlichia chaffeensis a tick transmitted Anaplasmataceae family pathogen responsible for human monocytic ehrlichiosis. Differential gene expression appears to be an important pathogen adaptation mechanism for its survival in dual hosts. One of the ways to test this hypothesis is by performing mutational analysis that aids in altering the expression of genes. Mutagenesis is also a useful tool to study the effects of a gene function in an organism. Focus of my research has been to prepare several modified Himar transposon mutagenesis constructs for their value in introducing mutations in E. chaffeensis genome. While the work is in progress, research team from our group used existing Himar transposon mutagenesis plasmids and was able to create mutations in E. chaffeensis. Multiple mutations were identified by Southern blot analysis. I redirected my research efforts towards mapping the genomic insertion sites by performing the semi-random two step PCR (ST-PCR) method, followed by DNA sequence analysis. In this method, the first PCR is performed with genomic DNA as the template with a primer specific to the insertion segment and the second primer containing an anchored degenerate sequence segment. The product from the first PCR is used in the second PCR with nested transposon insertion primer and a primer designed to bind to the known sequence portion of degenerate primer segment.
    [Show full text]
  • Electroporation-Mediated and EBV LMP1-Regulated Gene Therapy in A
    Cancer Gene Therapy (2003) 10, 626–636 r 2003 Nature Publishing Group All rights reserved 0929-1903/03 $25.00 www.nature.com/cgt Electroporation-mediated and EBV LMP1-regulated gene therapy in a syngenic mouse tumor model Yu-hua Hsieh,1 Chang-jer Wu,2 Kai-ping Chow,3 Chia-lung Tsai,1 and Yu-sun Chang3 1Institute of Microbiology and Immunology, National Yang-Ming University, Shih-pai, Taipei 112, Republic of China; 2Institute of Preventive Medicine, National Defense Medical Center, Taipei 114, Republic of China; and 3Graduate Institute of Basic Medical Sciences, Chang-Gung University, Kwei-shan, Taoyuan 333, Taiwan, Republic of China. Latent membrane protein 1 (LMP1) is an Epstein–Barr virus (EBV)-encoded oncogene expressed in EBV-associated nasopharyngeal carcinoma (NPC). Previous studies indicate that a strategy combining LMP1-mediated NF-kB activation and the HSV thymidine kinase/Ganciclovir (HSVtk/GCV) prodrug system leads to regression of tumor growth in nude mice. To improve the efficacy of this strategy in immunocompetent hosts, we developed a therapeutic cassette, p6kB-EDL1E-tk, containing six copies of the NF-kB binding motif and an epithelial-specific EBV promoter, ED-L1E. The cassette was tested in a murine CT-26 carcinoma model in syngenic Balb/c mice. Coinjection of an LMP1-expressing vector and p6kB-EDL1E-tk by in vivo electroporation in mouse muscle revealed at least two-fold higher TK enzymatic activity than that of previously tested pLTR-tk. Furthermore, growth was attenuated in a group of mice containing LMP1-positive tumors that were intratumorally injected with the p6kB-EDL1E-tk cassette and GCV via in vivo electroporation, but not in mice treated with p6kB-EDL1E-tk or GCV alone.
    [Show full text]
  • Evaluation on Reprogramed Biological Processes in Transgenic Maize
    www.nature.com/scientificreports OPEN Evaluation on reprogramed biological processes in transgenic maize varieties using transcriptomics and metabolomics Wei Fu1, Pengyu Zhu1, Mingnan Qu2, Wang Zhi1, Yongjiang Zhang1, Feiwu Li3* & Shuifang Zhu1* Genetic engineering (GM) has great potential to improve maize productivity, but rises some concerns on unintended efects, and equivalent as their comparators. There are some limitations through targeted analysis to detect the UE in genetically modifed organisms in many previous studies. We here reported a case-study on the efects of introducing herbicides and insect resistance (HIR) gene cassette on molecular profling (transcripts and metabolites) in a popular maize variety Zhengdan958 (ZD958) in China. We found that introducing HIR gene cassette bring a limited numbers of diferential abundant genes (DAGs) or diferential abundant metabolites (DAMs) between transgenic events and non-transgenic control. In contrast, averaged 10 times more DAGs and DAMs were observed when performed comparison under diferent growing environments in three diferent ecological regions of China than the numbers induced by gene efects. Major biological pathways relating to stress response or signaling transduction could explain somehow the efects of growing environments. We further compared two transgenic events mediated ZD958 (GM-ZD958) with either transgenic parent GM-Z58, and other genetic background nonGM-Z58, nonGM-ZD958, and Chang7-2. We found that the numbers of DAGs and DAMs between GM-ZD958 and its one parent maize variety, Z58 or GM-Z58 is equivalent, but not Chang7-2. These fndings suggest that greater efects due to diferent genetic background on altered molecular profling than gene modifcation itself. This study provides a case evidence indicating marginal efects of gene pleiotropic efects, and environmental efects should be emphasized.
    [Show full text]
  • Dissemination and Persistence of Plasmid Located, Integron
    University of Arkansas, Fayetteville ScholarWorks@UARK Theses and Dissertations 5-2016 Dissemination and Persistence of Plasmid Located, Integron Associated Antibiotic Resistant Genes in Wastewater Treatment Plant Effluent and Stream Water Bacteria _ Suhartono University of Arkansas, Fayetteville Follow this and additional works at: http://scholarworks.uark.edu/etd Part of the Environmental Microbiology and Microbial Ecology Commons, and the Water Resource Management Commons Recommended Citation Suhartono, _, "Dissemination and Persistence of Plasmid Located, Integron Associated Antibiotic Resistant Genes in Wastewater Treatment Plant Effluent and Stream Water Bacteria" (2016). Theses and Dissertations. 1538. http://scholarworks.uark.edu/etd/1538 This Dissertation is brought to you for free and open access by ScholarWorks@UARK. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of ScholarWorks@UARK. For more information, please contact [email protected], [email protected]. Dissemination and Persistence of Plasmid Located, Integron Associated Antibiotic Resistant Genes in Wastewater Treatment Plant Effluent and Stream Water Bacteria A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Cell and Molecular Biology by Suhartono Bogor Agricultural University Bachelor of Science in Biology, 2005 University of Manchester Master of Science in Medical and Molecular Microbiology, 2008 May 2016 University of Arkansas This dissertation is approved for
    [Show full text]
  • Bacterial Evolution on Demand
    INSIGHT ANTIBIOTIC RESISTANCE Bacterial evolution on demand Bacteria carry antibiotic resistant genes on movable sections of DNA that allow them to select the relevant genes on demand. PA˚ L J JOHNSEN, JOA˜ O A GAMA AND KLAUS HARMS genes known as gene cassettes. The ones Related research article Souque C, Escu- located at the start of the integron produce dero JA, MacLean RC. 2021. Integron activ- more proteins than the ones closer to the end ity accelerates the evolution of antibiotic (Collis and Hall, 1995). During stress situations resistance. eLife 10:e62474. doi: 10.7554/ – such as exposure to antibiotics – an enzyme eLife.62474 called integrase is produced, allowing the microbes to shuffle the order of the cassettes in the integron (Guerin et al., 2009). Conse- quently, gene cassettes encoding the appropri- ate adaptive response to an antibiotic will be acteria are the most abundant form of moved closer to the start, where expression lev- life and inhabit virtually every environ- els are higher (Figure 1). It has been proposed B ment on Earth, from the soil to the that this mechanism allows bacteria to adapt to human body. They display remarkable genetic fluctuating environmental conditions ‘on flexibility and can respond rapidly to environ- demand’, but this hypothesis has never been mental changes. Bacteria have developed differ- experimentally tested (Escudero et al., 2015). ent strategies to increase their genetic diversity, Now, in eLife, Ce´lia Souque, Jose´ A. Escu- including the use of mobile genetic elements, dero and Craig MacLean of the University of which can either move around the genome or be Oxford and the Universidade Complutense de transferred to a different bacterium.
    [Show full text]
  • An Efficient Recombination System for Chromosome Engineering in Escherichia Coli
    An efficient recombination system for chromosome engineering in Escherichia coli Daiguan Yu*, Hilary M. Ellis*, E-Chiang Lee†, Nancy A. Jenkins†, Neal G. Copeland†, and Donald L. Court*‡ *Gene Regulation and Chromosome Biology Laboratory and †Mouse Cancer Genetics Program, National Cancer Institute, Division of Basic Science, National Cancer Institute͞Frederick Cancer Research and Development Center, Frederick, MD 21702 Communicated by Allan Campbell, Stanford University, Stanford, CA, March 22, 2000 (received for review January 19, 2000) A recombination system has been developed for efficient chromo- frequencies of recombination with linear DNA containing long some engineering in Escherichia coli by using electroporated linear homologies by transforming in the presence of the bacteriophage DNA. A defective ␭ prophage supplies functions that protect and ␭ recombination functions (Exo and Beta) in a bacterial recBCD recombine an electroporated linear DNA substrate in the bacterial mutant background. This ␭ recombination system, like yeast, cell. The use of recombination eliminates the requirement for uses double strand break repair (10, 11). In a recBC sbcA strain, standard cloning as all novel joints are engineered by chemical short regions of homology can function in recombination of synthesis in vitro and the linear DNA is efficiently recombined into linear DNA; however, recombination is inefficient (12). In recϩ place in vivo. The technology and manipulations required are backgrounds, gene replacement on the chromosome has been simple and straightforward. A temperature-dependent repressor accomplished by integration and excision of episomes carrying tightly controls prophage expression, and, thus, recombination bacterial homology (13, 14). functions can be transiently supplied by shifting cultures to 42°C To obtain efficient recombination of linear donor DNA in for 15 min.
    [Show full text]