The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons Dean A. Rowe-Magnus*, Anne-Marie Guerout*, Pascaline Ploncard*, Broderick Dychinco†, Julian Davies†, and Didier Mazel*‡ *Unite´de Programmation Mole´culaire et Toxicologie Ge´ne´ tique, Centre National de la Recherche Scientifique Unite´de Recherche Associe´e 1444, De´partement des Biotechnologies, Institut Pasteur, 25 Rue du Dr. Roux, 75724 Paris, France; and †Department of Microbiology and Immunology, University of British Columbia, 6174 University Boulevard, Vancouver, BC, Canada V6T 1Z3 Communicated by Allan Campbell, Stanford University, Stanford, CA, November 2, 2000 (received for review August 1, 2000) Integrons are genetic elements that acquire and exchange exog- located downstream of a resident promoter internal to the intI enous DNA, known as gene cassettes, by a site-specific recombi- gene, drives expression of the encoded proteins (13). Most of the nation mechanism. Characterized gene cassettes consist of a target attC sites of the integron cassettes identified to date are unique. recombination sequence (attC site) usually associated with a single Their length and sequence vary considerably (from 57 to 141 bp) open reading frame coding for an antibiotic resistance determi- and their similarities are primarily restricted to their boundaries, nant. The affiliation of multiresistant integrons (MRIs), which which correspond to the inverse core site (RYYYAAC) and the contain various combinations of antibiotic resistance gene cas- core site [G2TTRRRY; 2, recombination point (11, 14)]. settes, with transferable elements underlies the rapid evolution of More than 60 different antibiotic-resistance genes, covering multidrug resistance among diverse Gram-negative bacteria. Yet most antimicrobials presently in use, have been characterized in the origin of MRIs remains unknown. Recently, a chromosomal cassette structures (15). The stockpiling of exogenous genetic super-integron (SI) harboring hundreds of cassettes was identified loci to create multiresistant integrons (MRIs) has contributed in the Vibrio cholerae genome. Here, we demonstrate that the substantially to the current dilemma in the treatment of infec- activity of its associated integrase is identical to that of the MRI tious disease (2, 8, 15, 16), as MRIs harboring up to five different integrase, IntI1. We have also identified equivalent integron su- resistance cassettes have been described (17). However, the ␥ perstructures in nine distinct genera throughout the -proteobac- origin of integrons and their cassettes has remained obscure. terial radiation. Phylogenetic analysis revealed that the evolution- Recently a distinct type of integron was discovered in the ary history of the system paralleled that of the radiation, indicating Vibrio cholerae genome (18). Located on the smaller of the two that integrons are ancient structures. The attC sites of the 63 circular chromosomes (19), this element spans 126 kb and antibiotic-resistance gene cassettes identified thus far in MRIs are gathers at least 179 cassettes (20, 21) into a single structure highly variable. Strikingly, one-fifth of these were virtually iden- termed a super-integron (SI), dwarfing previously identified tical to the highly related yet species-specific attC sites of the SIs MRIs. Of particular interest were the observations that: (i) the described here. Furthermore, antimicrobial resistance homologues cassette-associated attC sites, termed VCRs [for Vibrio cholerae were identified among the thousands of genes entrapped by these repeats (22); other repeated sequences are named similarly] SIs. Because the gene cassettes of SIs are substrates for MRIs, these displayed a strikingly high degree of sequence relatedness, unlike data identify SIs as the source of contemporary MRIs and their their counterparts of MRIs; (ii) the attC site of two MRI cassettes. However, our demonstration of the metabolic functions, antibiotic-resistance gene cassettes, CARB4 and dfrVI, was sim- beyond antibiotic resistance and virulence, of three distinct SI gene ilar to the VCRs; and (iii) the V. cholerae SI cassettes were cassettes indicates that integrons function as a general gene- substrates for the class 1 integrase of MRIs (18). capture system for bacterial innovation. These relationships led us to hypothesize that MRIs evolved from SIs through the entrapment of intI genes and their cognate he impact of lateral gene transfer on bacterial evolution is attI sites into highly mobile structures like transposons. Subse- Tunderscored by the realization that foreign DNA can rep- quent harvesting of cassettes from various SI sources then led to resent up to one-fifth of a given bacterial genome (1). Perhaps the establishment of contemporary MRIs. In this scenario, each the most striking embodiment of its affect on microbial adap- distinct attC site of MRI cassettes would represent a specific SI tation has been the rapid and widespread emergence of similar cluster containing related attC sites, as in V. cholerae. If SIs are antibiotic-resistance profiles among phylogenetically diverse the progenitors of MRIs and their cassettes, then the SI inte- Gram-negative clinical and environmental isolates over the last grases should be active, the cassettes should encode adaptive half-century (2). The localization of antibiotic-resistance deter- functions, and SIs should be numerous in the bacterial kingdom. minants to mobile entities such as plasmids and transposons Here, we have demonstrated that the V. cholerae SI integrase is readily explained this phenomenon (3–6). Closer examination active for site-specific cassette recombination, and we have revealed that in many cases a new type of genetic element, termed an integron, harbored the resistance determinants. In- tegrons are natural cloning and expression systems that incor- Abbreviations: MRI, multiresistant integron; SI, super-integron; VCR, Vibrio cholerae re- porate open reading frames and convert them to functional peated sequence (repeated sequences of other species are named similarly); IS, insertion genes (for review see refs. 7 and 8). The integron platform codes sequence; Tn, transposon. for an integrase (intI) that mediates recombination between a Data deposition: The sequences reported in this paper have been deposited in the GenBank database (accession nos. AF180939, AY014398–AY014401, AF324210, AF324211, proximal primary recombination site (attI) and a secondary AF324482–AF324484, and AF324934–AF324946). target called an attC site [or 59-base element (59be)]. The attC ‡To whom reprint requests should be addressed. E-mail: [email protected]. site is normally found associated with a single open reading The publication costs of this article were defrayed in part by page charge payment. This frame (ORF), and the attC-ORF structure is termed a gene article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. cassette (9–12). Insertion of the cassette at the attI site, which is §1734 solely to indicate this fact. 652–657 ͉ PNAS ͉ January 16, 2001 ͉ vol. 98 ͉ no. 2 Downloaded by guest on September 29, 2021 Table 1. VchIntIA-dependent recombination frequencies for the GCGTT) and Vmarlip3 (GAATTCTTATGGTTTTAATGC- CARB4 and ORF1::cat cassette substrates GAAAGTTAAAAAG). The product was digested with NdeI Strain Plasmid Recombination frequency and BamHI and cloned into pET3a digested with the same enzymes to give pET3aVml. T7 RNA polymerase-dependent ␻32 pSU38::CARB4, pVC3 5.0 ϫ 10Ϫ3 lipase expression in recombinant E. coli BL21(DE3)pLysS was Ϫ ␻34 pSU38::CARB4 Ͻ10 6 induced by the addition of isopropyl ␤-D-thiogalactoside (IPTG) ␻33 pSU38::ORF1-cat, pVC3 1.6 ϫ 10Ϫ2 to a final concentration of 0.5 mM on solid LB medium ␻35 pSU38::ORF1-cat Ͻ10Ϫ5 containing 100 ␮g͞ml ampicillin, 25 ␮g͞ml chloramphenicol, and 0.5% tributyrin as previously described (27). Positive clones produced a zone of clearing caused by hydrolysis of the lipid in determined the metabolic function of three SI cassettes: a the surrounding medium. Control strains carried the vector sulfate-binding protein, a psychrophilic lipase, and a restriction without insert. enzyme. Furthermore, a systematic search for SI structures beginning with Vibrio and closely related species and extending Identification of the Integrase Genes. A primer to rpmI (L35), to distantly related genera has revealed that this gene acquisition R16–1 (CCAAACGCCATTCTGCCTAAG), and VCR1 (18) machinery is an ancient system that is widespread among the were used to amplify VmiintIA from Vibrio mimicus genomic proteobacteria. DNA. Primers VCR1 and H7–1 (GGACTATGGCAAGTTC- CTCT), which targeted infC (IF3), were used to amplify the Materials and Methods entire VmeintIA gene from Vibrio metschnikovii chromosomal Bacterial Strains, PCR, Sequencing, and Phylogenetic Analysis. Bac- DNA. The VmeintIA gene was used to probe a Listonella pelagia terial strains were provided by the Collection de l’Institut HindIII library in pNot218R [modified from the phagemid Pasteur (CIP). All genomic DNA was isolated by using the pTZ18R vector (Pharmacia) to include in-frame NotI sites on Qiagen DNEasy Kit. PCR-amplified genes were cloned by both sides of the multiple cloning site]. Single-strand DNA was using the TA TOPO cloning kit (Invitrogen) and verified prepared after infection with M13K07 helper phage. This library by sequencing of the corresponding genomic clones [performed was used in a PCR with the M13 forward primer and a set of degenerate intI