Journal of Medicinal Plants Research Vol. 6(1), pp. 30-36, 9 January, 2012 Available online at http://www.academicjournals.org/JMPR DOI: 10.5897/JMPR11.658 ISSN 1996-0875 ©2012 Academic Journals Full Length Research Paper Phylogenetics of selected Mentha species on the basis of rps8, rps11 and rps14 chloroplast genes Attiya Jabeen1, Bin Guo2, Bilal Haider Abbasi1, Zabta Khan Shinwari1 and Tariq Mahmood3* 1Department of Biotechnology, Quaid-i-Azam University, Islamabad-45320, Pakistan. 2Key Laboratory of Resource Biology and Biotechnology in Western China, Ministry of Education, School of Life Science, Norhtwest University, Xi'an-710069, P. R. China. 3Department of Plant Sciences, Quaid-i-Azam University, Islamabad-45320, Pakistan. Accepted 20 June, 2011 Mentha is a genus of family Lamiaecae, and is well known for its great medicinal and economic values. It is widely distributed over five continents (excluding Antarctica and South America) of the world. In order to construct the phylogeny and to investigate the genetic variability among seven Mentha species polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) (CAPS) marker technique was used. Three chloroplast genes rps8, rps11 and rps14 were used to amplify from the chloroplast genome of seven Mentha species. rps8 gene was tested on broad range of annealing temperatures but no amplification was observed while rps11 and rps14 regions of Mentha cpDNA were successfully amplified and subjected to PCR-RFLP. For restriction digestion of the amplified PCR product, twelve different restriction enzymes were used and the resulting restriction pattern was resolved on PAGE. Comparison of Nicotiana tabacum and Mentha rps11 and rps14 genes was also performed. The data was analyzed by using the software numerical taxonomy and multivariate analysis system (NTSYS) pc version 2.01 showing considerable level of genetic similarity among the Mentha species. It was also found that Eam1104I and Alw44I based PCR-RFLP of rps14 gene could serve as a specific marker for Mentha spicata identification and differentiation. Key words: Mentha, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), chloroplast genes, rps, phylogenetic analysis. INTRODUCTION environmental conditions and grow best in wet and moist Genus Mentha comprises of 18 species and additional 11 environments where they usually grow 10 to 120 cm tall hybrids (Šarić-Kundalić et al., 2009) that are distributed and are invasive in nature (Brickell and Trevor, 2002). over the five continents mainly in temperate and sub- The genus Mentha has long list of pharmacological temperate regions of the world. Among these Mentha properties and is also of great economic importance due aquatica L. and Mentha pulegium L. are well known as to the presence of volatile oils in their vegetative parts. aromatic plants. Most of the Mentha varieties are almost Mint is used for treating nausea, bronchitis, flatulence, exclusively perennial herbs and are mainly found in anorexia, ulcerative colitis, and liver ailments (Bhat et al., Europe, Australia, Central Asia, and North Africa (Harley 2002; Iscan et al., 2002; Moreno et al., 2002). It also has and Brighton, 1977; Chambers, 1992; Brickell and Zuk, antioxidant properties and therefore can be used for 1997; Bhat et al., 2002; El-Ghorab, 2006). Species treating several chronic and degenerative diseases belonging to genus Mentha can be found in diverse (Ames et al., 1993; Lachance et al., 2001; Liu, 2003). M. pulegium L. essential oil have antimicrobial activity and also possesses cytotoxic activity against different human *Corresponding author. E-mail: [email protected], cell lines (Afroditi et al., 1995; Shirazi et al., 2004; [email protected] Mahboubi and Haghi, 2008). Mint essential oils are also Jabeen et al. 31 known to possess psychoactive actions (Umezu et al., and for DNA typing, was used. 2001). Peppermint oil can be efficiently used in replacement of the synthetic drugs to reduce hyperperistaltic state in patient’s stomach during MATERIALS AND METHODS endoscopy treatment (Asao et al., 2003; Micklefield et al., 2003). Mentha oils are enriched in monoterpenes and are Plant material being used in food, cosmetics and pharmaceutical Seven Mentha species (Mentha royleana, Mentha longifolia, M. industry (Bhat et al., 2002). Peppermint oil is used as spicata, Mentha × piperita, Mentha suaveolens, M. arvensis and M. flavoring agent in pharmaceuticals, oral preparations and pulegium) were collected from Quaid-i-Azam University, Islamabad different food items (Budavari et al., 1989; Gupta, 1991). and Qarshi Industries, Hattar. Young leaves were removed from Spearmint is being used in spices as well (Kokkini et al., them and stored at 4C. 1995). M. pulegium oil is used for scenting soaps, synthetic menthol manufacturing and can also be used as DNA isolation insect repellent and oil from Mentha spicata is known for possessing genotoxic potentials (Bhat et al., 2002; Richards’s (1997) cetyl trimethyl ammonium bromide (CTAB) Franzios et al., 1997). protocol of DNA isolation was adopted with some modifications. Systematics of genus Mentha is difficult to understand Approximately 0.3 g of plant material along with 1 ml of preheated CTAB buffer was grinded by pestle and mortar. The finely crushed due to high incidence of polyploidy, diversity in the leaf tissues were then transferred to 1.5 ml eppendorf tubes, which morphology and chromosome number, frequent were then incubated for 30 min at 65ºC. After incubation, interspecific hybridization and vegetative propagation. centrifugation at 10,000 rpm for 10 min was performed, the Natural interspecific hybridization occurs with high supernatant was transferred to new eppendorf tubes to which an frequency both in cultivation and wild population of equal quantity of chloroform/isoamyl alcohol (24:1) was added. These tubes were inverted for 5 to 6 times then again centrifugation Mentha (Morton, 1956; Harley and Brighton, 1977; on above mention conditions was performed and supernatant was Gobert et al., 2002; Tucker and Chambers, 2002). collected. This step was performed 2 to 3 times then to supernatant Several cytological, morphological, chemical and an equal volume of isopropanol was added for DNA precipitation, molecular markers have been used to develop again centrifugation at 10,000 rpm for 10 min was done, relationship among Mentha species. Flavonoids supernatant was discarded and to DNA pellet 70% cold ethanol variations (Voirin et al., 1999), diversity in pollen was added for washing the pellets. The pellets were air dried at morphology (Celenk et al., 2008), isozyme polymorphism room temperature and then resuspended in 30 to 40 µl of 0.1 × TE (Tris EDTA) buffer containing 2 µl (10 µg/µl) of RNase. After this (Mustafa et al., 2005; Fadhel and Boussaïd, 2004), DNA samples were incubated at 37ºC for half an hour to remove random amplified polymorphic DNA (RAPD) markers RNA and purified samples were stored at -20ºC for further use. (Khanuja et al., 2000, Shinwari et al., 2011), amplified DNA presence in the samples and its quality was assessed by fragment length polymorphism (AFLP) markers (Gobert running DNA samples mixed with loading dye (Bromophenol Blue) et al., 2002), inter simple sequence repeats–polymerase on 1% agarose gel prepared in 0.5 × TAE (Tris-Acetate-EDTA). chain reaction (ISSR-PCR) technique (Smolik et al., 2007) and chloroplast DNA variations (Bunsawat et al., Primer designing 2004) have been used in past to study genus Mentha systematics. Three pairs of primer that amplify ribosomal protein S8 (rps8), The molecular markers are playing key role in revealing ribosomal protein S11 (rps11) and ribosomal protein S14 (rps14) inter- and intra- specific DNA sequence variations. The were designed from tobacco chloroplast genome (Accession # choice of marker depends on the type of application, the Z00044.2) present in National Institutes of Health, United States (NIH) genetic sequence database, GenBank. Primers were level of polymorphism required, time constraint, financial designed by using online available Primer 3 (version 0.4.0) software limitation and availability of sufficient technical facilities (http//primer3.source-forge.net/). The sequence of the primers is as and expertise (Kumar et al., 2009). Randomly amplified follows; polymorphic DNA molecular marker system has widely been sued in different studies (Kayani et al., 2011; rps8F: 5΄ ATGGGTAGGGACACTATTGCTG 3΄; Mahmood et al., 2011a; Mahmood et al., 2011b; rps8R: 5΄ TTACCAGATATAACACAAAATCTCTCC 3΄; Mahmood et al., 2011c; Nazar & Mahmood, 2011; rps11F: 5΄ TGGCAAAAGCTATACCGAAAA 3΄; rps11R: 5΄ TTCGGAGGTCTACAGCCATT 3΄; Shinwari et al., 2011; Mahmood et al., 2010a; Mahmood rps14F: 5΄ ATGGCAAGGAAAAGTTTGATTC 3΄ et al., 2010b). However, PCR-RFLP (CAPS) is now also rps14R: 5΄ TTACCAACTTGATCTTGTTGCTCCT 3΄ a routine molecular marker system (Mahmood et al., 2011d; Mahmood et al., 2011e; Saeed et al., 2011). In the present study, in order to resolve the complex PCR Optimization relationship among seven Mentha species PCR-RFLP PCR amplification was performed in a volume of 25 µl containing (CAPS) technique, that is one of the rapid and reliable 12.5 µl of 2× PCR Master Mix (Fermentas), 9.5 µl of nuclease free marker techniques for determining genetic relationship water, 25 pmol (1 µl) of forward and reverse primer each and 1 µl 32 J. Med. Plants Res. Table 1. Restriction enzymes that cleaved rps11 and rps14 amplified product from seven Mentha species. Amplified