DOCSLIB.ORG

Phylogenetics of Selected Mentha Species on the Basis of Rps8, Rps11 and Rps14 Chloroplast Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetics of Selected Mentha Species on the Basis of Rps8, Rps11 and Rps14 Chloroplast Genes Journal of Medicinal Plants Research Vol. 6(1), pp. 30-36, 9 January, 2012 Available online at http://www.academicjournals.org/JMPR DOI: 10.5897/JMPR11.658 ISSN 1996-0875 ©2012 Academic Journals Full Length Research Paper Phylogenetics of selected Mentha species on the basis of rps8, rps11 and rps14 chloroplast genes Attiya Jabeen1, Bin Guo2, Bilal Haider Abbasi1, Zabta Khan Shinwari1 and Tariq Mahmood3* 1Department of Biotechnology, Quaid-i-Azam University, Islamabad-45320, Pakistan. 2Key Laboratory of Resource Biology and Biotechnology in Western China, Ministry of Education, School of Life Science, Norhtwest University, Xi'an-710069, P. R. China. 3Department of Plant Sciences, Quaid-i-Azam University, Islamabad-45320, Pakistan. Accepted 20 June, 2011 Mentha is a genus of family Lamiaecae, and is well known for its great medicinal and economic values. It is widely distributed over five continents (excluding Antarctica and South America) of the world. In order to construct the phylogeny and to investigate the genetic variability among seven Mentha species polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) (CAPS) marker technique was used. Three chloroplast genes rps8, rps11 and rps14 were used to amplify from the chloroplast genome of seven Mentha species. rps8 gene was tested on broad range of annealing temperatures but no amplification was observed while rps11 and rps14 regions of Mentha cpDNA were successfully amplified and subjected to PCR-RFLP. For restriction digestion of the amplified PCR product, twelve different restriction enzymes were used and the resulting restriction pattern was resolved on PAGE. Comparison of Nicotiana tabacum and Mentha rps11 and rps14 genes was also performed. The data was analyzed by using the software numerical taxonomy and multivariate analysis system (NTSYS) pc version 2.01 showing considerable level of genetic similarity among the Mentha species. It was also found that Eam1104I and Alw44I based PCR-RFLP of rps14 gene could serve as a specific marker for Mentha spicata identification and differentiation. Key words: Mentha, polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), chloroplast genes, rps, phylogenetic analysis. INTRODUCTION environmental conditions and grow best in wet and moist Genus Mentha comprises of 18 species and additional 11 environments where they usually grow 10 to 120 cm tall hybrids (Šarić-Kundalić et al., 2009) that are distributed and are invasive in nature (Brickell and Trevor, 2002). over the five continents mainly in temperate and sub- The genus Mentha has long list of pharmacological temperate regions of the world. Among these Mentha properties and is also of great economic importance due aquatica L. and Mentha pulegium L. are well known as to the presence of volatile oils in their vegetative parts. aromatic plants. Most of the Mentha varieties are almost Mint is used for treating nausea, bronchitis, flatulence, exclusively perennial herbs and are mainly found in anorexia, ulcerative colitis, and liver ailments (Bhat et al., Europe, Australia, Central Asia, and North Africa (Harley 2002; Iscan et al., 2002; Moreno et al., 2002). It also has and Brighton, 1977; Chambers, 1992; Brickell and Zuk, antioxidant properties and therefore can be used for 1997; Bhat et al., 2002; El-Ghorab, 2006). Species treating several chronic and degenerative diseases belonging to genus Mentha can be found in diverse (Ames et al., 1993; Lachance et al., 2001; Liu, 2003). M. pulegium L. essential oil have antimicrobial activity and also possesses cytotoxic activity against different human *Corresponding author. E-mail: [email protected], cell lines (Afroditi et al., 1995; Shirazi et al., 2004; [email protected] Mahboubi and Haghi, 2008). Mint essential oils are also Jabeen et al. 31 known to possess psychoactive actions (Umezu et al., and for DNA typing, was used. 2001). Peppermint oil can be efficiently used in replacement of the synthetic drugs to reduce hyperperistaltic state in patient’s stomach during MATERIALS AND METHODS endoscopy treatment (Asao et al., 2003; Micklefield et al., 2003). Mentha oils are enriched in monoterpenes and are Plant material being used in food, cosmetics and pharmaceutical Seven Mentha species (Mentha royleana, Mentha longifolia, M. industry (Bhat et al., 2002). Peppermint oil is used as spicata, Mentha × piperita, Mentha suaveolens, M. arvensis and M. flavoring agent in pharmaceuticals, oral preparations and pulegium) were collected from Quaid-i-Azam University, Islamabad different food items (Budavari et al., 1989; Gupta, 1991). and Qarshi Industries, Hattar. Young leaves were removed from Spearmint is being used in spices as well (Kokkini et al., them and stored at 4C. 1995). M. pulegium oil is used for scenting soaps, synthetic menthol manufacturing and can also be used as DNA isolation insect repellent and oil from Mentha spicata is known for possessing genotoxic potentials (Bhat et al., 2002; Richards’s (1997) cetyl trimethyl ammonium bromide (CTAB) Franzios et al., 1997). protocol of DNA isolation was adopted with some modifications. Systematics of genus Mentha is difficult to understand Approximately 0.3 g of plant material along with 1 ml of preheated CTAB buffer was grinded by pestle and mortar. The finely crushed due to high incidence of polyploidy, diversity in the leaf tissues were then transferred to 1.5 ml eppendorf tubes, which morphology and chromosome number, frequent were then incubated for 30 min at 65ºC. After incubation, interspecific hybridization and vegetative propagation. centrifugation at 10,000 rpm for 10 min was performed, the Natural interspecific hybridization occurs with high supernatant was transferred to new eppendorf tubes to which an frequency both in cultivation and wild population of equal quantity of chloroform/isoamyl alcohol (24:1) was added. These tubes were inverted for 5 to 6 times then again centrifugation Mentha (Morton, 1956; Harley and Brighton, 1977; on above mention conditions was performed and supernatant was Gobert et al., 2002; Tucker and Chambers, 2002). collected. This step was performed 2 to 3 times then to supernatant Several cytological, morphological, chemical and an equal volume of isopropanol was added for DNA precipitation, molecular markers have been used to develop again centrifugation at 10,000 rpm for 10 min was done, relationship among Mentha species. Flavonoids supernatant was discarded and to DNA pellet 70% cold ethanol variations (Voirin et al., 1999), diversity in pollen was added for washing the pellets. The pellets were air dried at morphology (Celenk et al., 2008), isozyme polymorphism room temperature and then resuspended in 30 to 40 µl of 0.1 × TE (Tris EDTA) buffer containing 2 µl (10 µg/µl) of RNase. After this (Mustafa et al., 2005; Fadhel and Boussaïd, 2004), DNA samples were incubated at 37ºC for half an hour to remove random amplified polymorphic DNA (RAPD) markers RNA and purified samples were stored at -20ºC for further use. (Khanuja et al., 2000, Shinwari et al., 2011), amplified DNA presence in the samples and its quality was assessed by fragment length polymorphism (AFLP) markers (Gobert running DNA samples mixed with loading dye (Bromophenol Blue) et al., 2002), inter simple sequence repeats–polymerase on 1% agarose gel prepared in 0.5 × TAE (Tris-Acetate-EDTA). chain reaction (ISSR-PCR) technique (Smolik et al., 2007) and chloroplast DNA variations (Bunsawat et al., Primer designing 2004) have been used in past to study genus Mentha systematics. Three pairs of primer that amplify ribosomal protein S8 (rps8), The molecular markers are playing key role in revealing ribosomal protein S11 (rps11) and ribosomal protein S14 (rps14) inter- and intra- specific DNA sequence variations. The were designed from tobacco chloroplast genome (Accession # choice of marker depends on the type of application, the Z00044.2) present in National Institutes of Health, United States (NIH) genetic sequence database, GenBank. Primers were level of polymorphism required, time constraint, financial designed by using online available Primer 3 (version 0.4.0) software limitation and availability of sufficient technical facilities (http//primer3.source-forge.net/). The sequence of the primers is as and expertise (Kumar et al., 2009). Randomly amplified follows; polymorphic DNA molecular marker system has widely been sued in different studies (Kayani et al., 2011; rps8F: 5΄ ATGGGTAGGGACACTATTGCTG 3΄; Mahmood et al., 2011a; Mahmood et al., 2011b; rps8R: 5΄ TTACCAGATATAACACAAAATCTCTCC 3΄; Mahmood et al., 2011c; Nazar & Mahmood, 2011; rps11F: 5΄ TGGCAAAAGCTATACCGAAAA 3΄; rps11R: 5΄ TTCGGAGGTCTACAGCCATT 3΄; Shinwari et al., 2011; Mahmood et al., 2010a; Mahmood rps14F: 5΄ ATGGCAAGGAAAAGTTTGATTC 3΄ et al., 2010b). However, PCR-RFLP (CAPS) is now also rps14R: 5΄ TTACCAACTTGATCTTGTTGCTCCT 3΄ a routine molecular marker system (Mahmood et al., 2011d; Mahmood et al., 2011e; Saeed et al., 2011). In the present study, in order to resolve the complex PCR Optimization relationship among seven Mentha species PCR-RFLP PCR amplification was performed in a volume of 25 µl containing (CAPS) technique, that is one of the rapid and reliable 12.5 µl of 2× PCR Master Mix (Fermentas), 9.5 µl of nuclease free marker techniques for determining genetic relationship water, 25 pmol (1 µl) of forward and reverse primer each and 1 µl 32 J. Med. Plants Res. Table 1. Restriction enzymes that cleaved rps11 and rps14 amplified product from seven Mentha species. Amplified
Load more

Recommended publications
  • Essential Oil Composition of Four Varieties of Mentha Longifolia L
    Received: 24th Feb-2014 Revised: 25th March-2014 Accepted: 30th March-2014 Research article ESSENTIAL OIL COMPOSITION OF FOUR VARIETIES OF MENTHA LONGIFOLIA L. FROM NORTHERN PARTS OF IRAN GitiBarzin¹, Ali Mazooji² and Fahimeh Salimpour³ 1Department of Biology, Islamshahr Branch, Islamic Azad University, Islamshahr, Iran 2Department of Biology, Roudehen Branch, Islamic Azad University, Roudehen, Iran 3Department of Biology, North Tehran Branch, Islamic Azad University, Tehran, Iran Corresponding author Email: [email protected] ABSTRACT: Mentha (Mint) is common named “poneh” belongs to Lamiaceae family and has used in traditional medicine for a long time. M. longifolia is one of the most important species of this genus and consists of seven varieties in Iranica Flora. Many researchers studied about identification and correlation between this species and environmental factors. By attention that environmental factors influence the composition of essential oils, so the aim of this study is to analyze the composition of the oil of Mentha longifolia growing wild in different areas of Northern parts of Iran. Based on our results, monoterpenes and sesquiterpenes are the most chemical compounds in this species. The major components were Carvon ( 1.1- 26.6%); 1,8-cineol (3.4- 11.2%); cis-piperitone oxide(1.59- 34.94%), Pulegone (14.96-31.25%); Menthone (2.8-15.05%) and iso- Menthone (0.96- 43.79%0. M. longifolia var. chlorodictya is reported as the best varity of this species can used in traditional medicine and breeding programs. Keywords: Chemical component, Iran, Lamiaceae, Mentha INTRODUCTION Species (commonly known as mint), belonging to the Lamiaceae family, are widely distributed in Eurasia, Australia and South and North of Africa [1,2].
    [Show full text]
  • Essential Oils from Apple Mint (Mentha Suaveolens) and Passionflower Fruit (Passiflora Incarnata): Studies on Cognition, Coordination, and Chemical Components
    UNDERGRADUATE RESEARCH Essential Oils from Apple Mint (Mentha suaveolens) and Passionflower Fruit (Passiflora incarnata): Studies on Cognition, Coordination, and Chemical Components Evelyn F. Patrick*, Jessie Bowers*, Shannon Read*, Brett R. Lackey, Christine Murphy, and Sandra L. Gray Clemson University, Clemson, SC 29634 *Undergraduate authors. All contributed equally to this manuscript. Plant essential oils (EO) are used as perfumes, lotions and air fresheners because of their pleasant aromas, but EO also have the ability to elicit changes in mood and behavior. These activities are influenced by the mode of administration and by multiple signaling pathways. The EO aromas from organically grown apple mint (Mentha suaveolens) and passionflower fruit (Passiflora incarnata) were assessed for their effects on cognition and coordination. Participants completed two tasks designed to test working memory and bimanual task efficiency in rooms infused with apple mint, passionflower fruit or control EO. Bimanual coordination was assessed using the Intercept2 program and the Memory Span component of CogLab 2.0 was utilized as a test of working memory. Then, the EO were analyzed by GC-MS, resulting in the identification of several compounds with affinity towards olfactory receptors and neurotransmitter systems. For specific memory subtests within CogLab, EO from apple mint aided number recall, whereas passionflower fruit hindered recall of numbers and letters that sound similar. Passionflower fruit EO slightly enhanced bimanual task coordination. The results indicate that specific aromas may differentially affect task performance. Introduction the respective flasks and hydrodistilled for 2 hr on a Clevenger- Elucidating the bioactivities of essential oils (EO) involves type apparatus at a level sufficient for the water to boil and understanding interactions between multiple systems.
    [Show full text]
  • Phenolic Composition, in Vitro Antioxidant Effects and Tyrosinase Inhibitory Activity of Three Algerian Mentha Species : M
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by HAL-Rennes 1 Phenolic composition, in vitro antioxidant effects and tyrosinase inhibitory activity of three Algerian Mentha species: M. spicata (L.), M. pulegium (L.) and M. rotundifolia (L.) Huds (Lamiaceae) Fatiha Brahmi, Didier Hauchard, Naima Guendouze, Khodir Madani, Martin Kiendrebeogo, L´eocadie Kamagaju, Caroline St´evigny, Mohamed Chibane, Pierre Duez To cite this version: Fatiha Brahmi, Didier Hauchard, Naima Guendouze, Khodir Madani, Martin Kiendrebeogo, et al.. Phenolic composition, in vitro antioxidant effects and tyrosinase inhibitory activ- ity of three Algerian Mentha species: M. spicata (L.), M. pulegium (L.) and M. rotundifo- lia (L.) Huds (Lamiaceae). Industrial Crops and Products, Elsevier, 2015, 74, pp.722-730. <10.1016/j.indcrop.2015.04.038>. <hal-01165427> HAL Id: hal-01165427 https://hal-univ-rennes1.archives-ouvertes.fr/hal-01165427 Submitted on 22 Sep 2015 HAL is a multi-disciplinary open access L'archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destin´eeau d´ep^otet `ala diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publi´esou non, lished or not. The documents may come from ´emanant des ´etablissements d'enseignement et de teaching and research institutions in France or recherche fran¸caisou ´etrangers,des laboratoires abroad, or from public or private research centers. publics ou priv´es. Phenolic composition, in vitro
    [Show full text]
  • Nature Conservation
    J. Nat. Conserv. 11, – (2003) Journal for © Urban & Fischer Verlag http://www.urbanfischer.de/journals/jnc Nature Conservation Constructing Red Numbers for setting conservation priorities of endangered plant species: Israeli flora as a test case Yuval Sapir1*, Avi Shmida1 & Ori Fragman1,2 1 Rotem – Israel Plant Information Center, Dept. of Evolution, Systematics and Ecology,The Hebrew University, Jerusalem, 91904, Israel; e-mail: [email protected] 2 Present address: Botanical Garden,The Hebrew University, Givat Ram, Jerusalem 91904, Israel Abstract A common problem in conservation policy is to define the priority of a certain species to invest conservation efforts when resources are limited. We suggest a method of constructing red numbers for plant species, in order to set priorities in con- servation policy. The red number is an additive index, summarising values of four parameters: 1. Rarity – The number of sites (1 km2) where the species is present. A rare species is defined when present in 0.5% of the area or less. 2. Declining rate and habitat vulnerability – Evaluate the decreasing rate in the number of sites and/or the destruction probability of the habitat. 3. Attractivity – the flower size and the probability of cutting or exploitation of the plant. 4. Distribution type – scoring endemic species and peripheral populations. The plant species of Israel were scored for the parameters of the red number. Three hundred and seventy (370) species, 16.15% of the Israeli flora entered into the “Red List” received red numbers above 6. “Post Mortem” analysis for the 34 extinct species of Israel revealed an average red number of 8.7, significantly higher than the average of the current red list.
    [Show full text]
  • 69. MENTHA Linnaeus, Sp. Pl. 2: 576. 1753. 薄荷属 Bo He Shu Herbs Annual Or Perennial, Aromatic, Often Rhizomatous Or Stoloniferous
    Flora of China 17: 236–239. 1994. 69. MENTHA Linnaeus, Sp. Pl. 2: 576. 1753. 薄荷属 bo he shu Herbs annual or perennial, aromatic, often rhizomatous or stoloniferous. Upper leaves sessile or subsessile; blade margin dentate, serrate, or crenate. Verticillasters (2–6)- to many flowered; floral leaves similar to stem leaves or reduced; bracts lanceolate to linear, ± distinct. Flowers bisexual or pistillate. Calyx funnelform to campanulate, 10–13-veined, throat glabrous or hairy, limb equally 5-toothed or 2-lipped, upper lip 3-toothed, lower lip 2-toothed. Corolla funnelform, ± regular or slightly irregular; tube generally included, throat slightly dilated or saccate in front, limb 4-lobed; lobes equal, entire, upper lobe slightly wider, emarginate or 2-lobulate. Stamens 4, subequal, divaricate, erect, exserted in bisexual flowers, included and often rudimentary in pistillate flowers, posterior 2 slightly longer than anterior 2; filaments glabrous; anther cells 2, parallel. Style exserted, apex equally 2-cleft. Nutlets ovoid, dry, smooth or slightly tuberculate, apex rounded, rarely hairy. About 30 species: mainly in north temperate regions, a few in the Southern Hemisphere; six native and six cultivated species in China. A number of species are widely cultivated for their aromatic properties and many cultivars have been developed. 1a. Calyx tubular or campanulate-tubular, slightly curved, 2-lipped; teeth of upper lip lanceolate-triangular, shorter than subulate teeth of lower lip; tube hairy at throat inside, closed in fruit, hirtellous outside, conspicuously veined; corolla saccate at throat in front ............................................................................................................................................................. 12. M. pulegium 1b. Calyx broadly campanulate or funnelform-campanulate, straight, regular; teeth ± equal; tube glabrous at throat, spreading in fruit, obscurely veined, not hirtellous; corolla throat slightly dilated, not saccate.
    [Show full text]
  • Indigenous Uses of Economically Important Flora of Margallah Hills National Park, Islamabad, Pakistan
    African Journal of Biotechnology Vol. 8 (5), pp. 763-784, 6 March, 2009 Available online at http://www.academicjournals.org/AJB ISSN 1684–5315 © 2009 Academic Journals Full Length Research Paper Indigenous uses of economically important flora of Margallah Hills National Park, Islamabad, Pakistan Asma Jabeen1, Mir Ajab Khan2, Mushtaq Ahmad2, Muhammad Zafar2* and Farooq Ahmad2 1Fatima Jinnah Women University, Rawalpindi, Pakistan. 2Department of Plant Sciences, Quaid-i-Azam University, Islamabad, Pakistan. Accepted 6 February, 2009 Informal interviews provided data about 245 useful plants of 77 families of 55 trees, 54 shrubs, 105 herbs, 15 climber, 10 grasses and 6 crops recorded from the Margallah Hills National Park, Islamabad. Two hundred and fifteen local/ vernacular names were noted of total plants. The inhabitants of the park have for a long time been dependent on surrounding plant resources for their food, health care, fodder, fuel wood and other cultural purposes. A list of plant species along with their local name, plant part/s used, popular uses (or troubles treated) are given. The pastoral nomads of the area make use of 159 (64.89%) as native medicine, 79 (32.24%) as fodder for their livestock, 47(19.18%) as fuelwood, 33 (13.46%) as food (fruits), 18 (7.34%) as vegetables, 14 (5.71%) as timber, 6 (2.44%) as industrial, 4 (1.63%) as tannin, 3 (1.22%) as gum and 2 (0.81%) as fiber. Medicinal uses of the 126 plant species have also been described. This information will serve as reference for the benefit of pharmacists, researchers, Hakims (herbalist), veterinarians and public at large.
    [Show full text]
  • Medicine Plants of Folk Medicine Used for Treatment of Gastro-Intestinal Problems in Fergana Valley
    국내․외 기술정보 Medicine plants of folk medicine used for treatment of gastro-intestinal problems in Fergana valley Valeriy V. Pak 식품기능연구본부 This article presents a review of indigenous medicinal plants used in folk medicine in Fergana valley (Uzbekistan) for treatment of gastro-intestinal problems. The 29 different plantsbelong to 18 different plant spices are presented. The methods of preparation of remedies and utilized parts of plants are described. Ⅰ. Introduction The purpose of this article is to review the remedies of the folk medicine for treatment of Plant products – as part of foods or botanical gastro-intestinal problems used in Fergana portions and powder – have been used with valley presenting the most densely populated varying success to cure and prevent diseases part of Uzbekistan. throughout history. Several diverse line of evidence indicates that medicinal plants represent the oldest and most widespread form of Ⅱ. Geographic characteristic medication. Until recently, plants were an of Fergana valley important source for the discovery of novel pharmacologically active compounds, with many Fergana valley occupiesa territory about 22.000 blockbuster drugs being derived directly or sq km and divided among Uzbekistan, Tajikistan indirectly from plants [1,2]. As it is estimated and Kyrgystan (Fig. 1). The Fergana Range by World Health Organization (WHO) that 25 % rises in the northeast and the Pamir in the of the active compounds in currently prescribed south. The Gissar and Alay ranges stand across synthetic drugs were first identified in plant the Fergana valley, which lies south of the sources [3]. Thus, to collect information about western Tian-Shan. The Xinjiang region of medicine plant used in folk medicine is valuable China borders the valley in the southeast.
    [Show full text]
  • Inhibitory Potential of Nine Mentha Species Against Pathogenic Bacterial Strains
    Pak. J. Bot., 47(6): 2427-2433, 2015. INHIBITORY POTENTIAL OF NINE MENTHA SPECIES AGAINST PATHOGENIC BACTERIAL STRAINS ALTAF HUSSAIN1*, NISAR AHMAD2, IQBAL AHMED QARSHI3, MUHAMMAD RASHID4, ZABTA K. SHINWARI5, 6 AND AZIZ-UL-IKRAM4 1Qarshi University, Lahore, Pakistan, 2Center for Biotechnology and Microbiology, University of Swat, Swat-1900, KPK, Pakistan, 3Qarshi Industries (Pvt.) Ltd, Lahore, Pakistan, 4Qarshi Industries (Pvt.) Ltd, Hattar, KPK, Pakistan, 5Department of Biotechnology, Quaid-i-Azam University, Islamabad, Pakistan 6Pakistan Academy of Sciences, Islamabad, Pakistan *Corresponding author’s e-mail: [email protected] Abstract Plants produce secondary metabolites, which are used in their growth and defense against pathogenic agents. These plant based metabolites can be used as natural antibiotics against pathogenic bacteria. Synthetic antibiotics caused different side effects and become resistant to bacteria. Therefore the main objective of the present study was to investigate the inhibitory potential of nine Mentha species extracts against pathogenic bacteria. The methanolic leaves extracts of nine Mentha species (Mentha arvensis, Mentha longifolia, Mentha officinalis, Mentha piperita, Mentha citrata, Mentha pulegium, Mentha royleana, Mentha spicata and Mentha suareolens) were compared for antimicrobial activities. These Mentha species showed strong antibacterial activity against four microorganisms tested. Mentha arvensis showed 25 mm and 30 mm zones of inhibition against Staphylococcus aureus, Vibrio cholera and Enterobacter aerogens. Moreover, Mentha longifolia showed 24 mm zone of inhibition against Staphylococcus aureus. Mentha officinalis showed 30 mm zone of inhibition against Staphylococcus aureus. 25 mm inhibitory zone was recorded against Staphylococcus aureus by Mentha piperita. Mentha royleana showed 25 mm zone of inhibition against Vibrio cholera, while Mentha spicata showed 21 mm, 22 mm and 23 mm zones of inhibition against Staphylococcus aureus, Vibrio cholera and Enterobacter aerogens.
    [Show full text]
  • Gathered Wild Food Plants Among Diverse Religious Groups in Jhelum District, Punjab, Pakistan
    foods Article Gathered Wild Food Plants among Diverse Religious Groups in Jhelum District, Punjab, Pakistan Muhammad Majeed 1, Khizar Hayat Bhatti 1, Andrea Pieroni 2,3 , Renata Sõukand 4 , Rainer W. Bussmann 5 , Arshad Mahmood Khan 6 , Sunbal Khalil Chaudhari 7, Muhammad Abdul Aziz 2 and Muhammad Shoaib Amjad 8,* 1 Department of Botany, Hafiz Hayat Campus, University of Gujrat, Gujrat, Punjab 50700, Pakistan; [email protected] (M.M.); [email protected] (K.H.B.) 2 University of Gastronomic Sciences, Piazza Vittorio Emanuele II 9, 12042 Pollenzo/Bra (Cuneo), Italy; [email protected] (A.P.); [email protected] (M.A.A.) 3 Department of Medical Analysis, Tishk International University, Erbil 4401, Iraq 4 Department of Environmental Sciences, Informatics and Statistics, Ca’ Foscari University of Venice, Via Torino 155, 30172 Mestre, Italy; [email protected] 5 Department of Ethnobotany, Institute of Botany, Ilia State University, Tbilisi 0162, Georgia; [email protected] 6 Department of Botany, Govt. Hashmat Ali Islamia Degree College Rawalpindi, Rawalpindi 46000, Pakistan; [email protected] 7 Department of Botany, Sargodha Campus, Institute of Molecular Biology and Biotechnology, The University of Lahore, Sargodha 40100, Pakistan; [email protected] 8 Department of Botany, Women University of Azad Jammu and Kashmir, Bagh 12500, Pakistan * Correspondence: [email protected] Citation: Majeed, M.; Bhatti, K.H.; Abstract: Recent ethnobotanical studies have raised the hypothesis that religious affiliation can, in Pieroni, A.; Sõukand, R.; Bussmann, certain circumstances, influence the evolution of the use of wild food plants, given that it shapes R.W.; Khan, A.M.; Chaudhari, S.K.; kinship relations and vertical transmission of traditional/local environmental knowledge.
    [Show full text]
  • Hazrat Et Al., 2011)
    Available online freely at www.isisn.org Bioscience Research Print ISSN: 1811-9506 Online ISSN: 2218-3973 Journal by Innovative Scientific Information & Services Network RESEARCH ARTICLE BIOSCIENCE RESEARCH, 2020 17(2): 969-975. OPEN ACCESS Taxonomic and medicinal survey of Lamiaceae in the hilly area of Dir Kohistan, Khyber Pakhtunkhawa, Pakistan Ali Hazrat*1, Khan Sher2, Zakia Ahmad4, Muhammad Mukhtiar3, Zahid Fazal2, Shabana Bibi1, Jehan Zada1, Shah Zaman1, Gul Rahim1, Abid Ullah1 and Mohammad Nisar1 1Department of Botany University of Malakand, Chakdara, Dir Lower, Pakistan 2Department of Botany Shaheed Benazir Bhutto University Sheringal Dir Upper, Pakistan 3Department of Pharmacy, University of Poonch Rawalakot, Azad Kashmir, Pakistan 4Department of Botany University of Swat, KPK, Pakistan *Correspondence: [email protected] Received: 27-03-2020, Revised: 27-04-2020, Accepted: 01-05-2020 e-Published: 08-06- 2020 The local herbalists prepared different herbal drugs from different species of the selected family plant species for the treatment of different diseases. When preparing the drugs the scientific name is used during the processes of labeling of the drugs for this purpose a taxonomic survey was conducted in the study area to identify the plants to solve the problem of labeling. A total of twenty-four plant species and 18 genera of the selected family were collected from Dir Kohistan, with elevation ranges from 1300- 45000 meters during 2017-2018. They were taxonomically determined, recorded the information about these native plants, and have been described for the first time in the history of this area. Because the wild plant species are scarcely distributed therefore efforts should be made to conserve them.
    [Show full text]
  • New Approach for Using of Mentha Longifolia L. and Citrus Reticulata L
    materials Article New Approach for Using of Mentha longifolia L. and Citrus reticulata L. Essential Oils as Wood-Biofungicides: GC-MS, SEM, and MNDO Quantum Chemical Studies Hayssam M. Ali 1,2 , Wael A. A. Abo Elgat 3 , Mervat EL-Hefny 4 , Mohamed Z. M. Salem 5,* , Ayman S. Taha 6 , Dunia A. Al Farraj 1, Mohamed S. Elshikh 1, Ashraf A. Hatamleh 1 and Eslam M. Abdel-Salam 1 1 Botany and Microbiology Department, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia; [email protected] (H.M.A.); [email protected] (D.A.A.F.); [email protected] (M.S.E.); [email protected] (A.A.H.); [email protected] (E.M.A.-S.) 2 Agriculture Research Center, Timber Trees Research Department, Sabahia Horticulture Research Station, Horticulture Research Institute, Alexandria 21526, Egypt 3 Restoration Department, High Institute of Tourism, Hotel Management and Restoration, Abukir, Alexandria 21526, Egypt; [email protected] 4 Department of Floriculture, Ornamental Horticulture and Garden Design, Faculty of Agriculture (El-Shatby), Alexandria University, Alexandria 21545, Egypt; [email protected] 5 Forestry and Wood Technology Department, Faculty of Agriculture (EL-Shatby), Alexandria University, Alexandria 21545, Egypt 6 Conservation Department, Faculty of Archaeology, Aswan University, Aswan 81528, Egypt; Citation: Ali, H.M.; Elgat, W.A.A.A.; [email protected] EL-Hefny, M.; Salem, M.Z.M.; Taha, * Correspondence: [email protected] A.S.; Al Farraj, D.A.; Elshikh, M.S.; Hatamleh, A.A.; Abdel-Salam, E.M. Abstract: Background: Fungi growing on wood cause deterioration of stored food materials or New Approach for Using of Mentha discoloration of the wood itself, and the search for new and safe bioagents is recently needed.
    [Show full text]
  • Antioxidant, Antifungal, Antibiofilm, and Cytotoxic Activities of Mentha
    medicines Review Antioxidant, Antifungal, Antibiofilm, and Cytotoxic Activities of Mentha spp. Essential Oils Annarita Stringaro 1, Marisa Colone 1 and Letizia Angiolella 2,* 1 National Center for Drug Research and Evaluation, Italian National Institute of Health, Viale Regina Elena, 299, 00161 Rome, Italy; [email protected] (A.S.); [email protected] (M.C.) 2 Department of Public Health and Infectious Diseases, Sapienza University of Rome, P.le Aldo Moro, 5, 00185 Rome, Italy * Correspondence: [email protected]; Tel.: +39-06-4468-225 Received: 23 July 2018; Accepted: 15 October 2018; Published: 21 October 2018 Abstract: Since ancient times, plants have been used to preserve food, or for their health properties. Essential oils are complex mixtures of volatile compounds that are obtained from botanical material, specifically from aromatic plants. Lamiaceae is one of the most important families in the production of essential oils, as it has both antioxidant and antimicrobial properties. The essential oils of Mentha (the Lamiaceae family) have been extensively studied for their biological actions. In this review, we report the antioxidant, antifungal, antibiofilm, and cytotoxic properties of Mentha spp. essential oils. The first objective is to provide comprehensive information about the use of essential oils in the treatment of fungal infections, or as antioxidants and integrative anticancer therapy. The second is to explore the evidence supporting its effectiveness in treating diseases without causing any serious adverse reactions. Keywords: essential oil; Mentha spp.; antioxidant; antifungal; antibiofilm; toxicity 1. Introduction Plant essential oils (EOs) are produced predominantly using steam distillation, but can also be generated using fermentation, crushing, extraction, hydrolysis, and airing [1].
    [Show full text]