An oficial publication of the Society for Conservation of Domestic Animal Biodiversity

Chief Editor Dr. B. Prakash ICAR-CIRC, Meerut

Executive Editor Dr. S.K. Niranjan ICAR-NBAGR, Karnal

Editor Dr. Indrajit Ganguly ICAR-NBAGR, Karnal Advisory Board Dr MR Jayshankar Head, AG & B, Veterinary College, Hebbal, Bangalore Dr Sosamma Iype Vechur Conservation Trust, Mannuthy, Thrissur Dr GS Brah Director, School of Animal Biotechnology, GADVASU, Ludhiana Dr BP Mishra Joint Director Research, ICAR-IVRI, Izatnagar Dr DK Sadana ILSI Centre, Model Town, Karnal Dr CV Singh Professor (AG&B), GBPUA&T, Pantnagar Dr SM Deb Director, ICAR- NRC on Yak, Dirang

Dr BK Joshi Ex-Director, ICAR-NBAGR, Karnal

Editorial Office Animal Genetics Division, NBAGR P.O. Box 129, Karnal-132001 (Haryana), India For more information please visit www.nbagr.res.in

Subscription (Annual) Indian Foreign Individual Rs 300.00 US $ 100.00 Institutional Rs. 600.00 US $ 150.00 Single copy Rs. 300.00 US $ 75.00

Published by Society for Conservation of Domestic Animal Biodiversity Printer : Aaron Media, Karnal

JOURNAL OF LIVESTOK BIODIVERSITY VOLUME 6, NUMBER 1, 2016

RNA isolation from crossbred bull spermatozoa for analysing differential 01 abundance of sperm speciic gene transcripts Indrajit Ganguly, Sushil Kumar, G K Gaur, Umesh Singh, D K Mandal, Mahesh Kumar, Indranil Bagchi, Bimlendu Roy, Sunil Kumar, Sandeep Mann and Rani Singh

Genetic polymorphism in 5'UTR of myostatin (MSTN) gene in Nilagiri sheep 07 Amiya Ranjan Sahu, V. Jeichitra, R. Rajendran and A. Raja

Morphological Variability and Management of Lonand Sheep of Maharashtra 11 Dinesh Kumar Yadav, Reena Arora and Anand Jain

Fixation of K allele in K232A polymorphism in DGAT1 gene in Sahiwal and Hariana 16 cattle Anita Sharma, Madhu Tiwari, Satyendra Pal Singh, Deepak Sharma, Sumit Kumar and Vijay Pandey

Physical features and management of migratory Nari cattle population of Rajasthan 19 PK Singh, RK Pundir, D.K. Sadana and H.S. Rathore

Characterization of sequence variation in caprine growth hormone gene and its 25 association with milk production traits in two Indian goat breeds Satpal Dixit, Sandeep Kumar, Manoj Kumar Vyas, M K Singh, OP Pathodiya, Anurodh Sharma and S Jayakumar

Genetic Bottleneck effect and Analysis of Intra-population Genetic Diversity in 33 Gaddi Goat Breed of Western Himalayas Using Microsatellite Markers S Gurdeep Singh, YP Thakur, RK Taggar, Amitoz Kaur, Dibyendu Chakraborty, Dhirender Kumar and Varun Sankhyan

Volume 6 Number 1, 2016 RNA isolation from crossbred bull spermatozoa for analysing differential abundance of sperm speciic gene transcripts

Indrajit Ganguly*1, Sushil Kumar, G K Gaur, Umesh Singh, D K Mandal, Mahesh Kumar, Indranil Bagchi, Bimlendu Roy, Sunil Kumar, Sandeep Mann and Rani Singh ICAR-Central Institute for Research on Cattle, Meerut-250001, Uttar Pradesh, India ABSTRACT Although mature spermatozoa seem to be transcriptionally inert, however, thousands of mRNA transcripts have been reported to be present inside the mature sperm, being trapped during the course of spermatogenesis. These remnants RNAs may perhaps serve as a potential “markers” of spermatogenesis by virtue of their involvement, directly or indirectly, in the process of fertilization, early embryonic cleavage, and fertility. Gene expression profiling of mammalian sperm is a novel non-invasive tool to evaluate male fertility. RNA isolation from sperm is little tricky in contrast to RNA isolation from testis, and required stringent RNA quality control. The present study demonstrates a comprehensive RNA isolation protocol from crossbred Frieswal (HF X Sahiwal) bull semen, with stringent quality/purity checking, critically required for studying differential abundance of sperm transcripts. Initially, semen samples were subjected to discontinuous (45:90) Percoll gradient centrifugation, explicitly eliminating damaged spermatozoa and contaminating somatic cells. Total RNA was extracted from sperm pellets using heated Tri reagent and an on-column DNase treatment was carried out. The cDNA was synthesized using RT-PCR. The cDNA samples were then ampliied by PCR using speciic intron spanning primers to rule out contamination, if any, within isolated sperm RNA by g-DNA (PRM1 and DAZL), testicular germ cells like spermatocytes (KIT), epithelial cells (E-cadherin- CDH1) and leucocyte (CD4 and CD45). Further, the presence of transcripts like DazL, PRM1, PRM2, PRM3, TNP1, and TNP2 were also demonstrated in the ejaculated spermatozoa by PCR ampliication. This method together with rigorous quality assurance mentioned here are minimum requirement for bias free analysis of differential abundance of sperm transcripts as well as high throughput transcriptomics research. Keywords: Frieswal, sperm RNA, Percoll, spermatogenesis, HF X Sahiwal Present address: 1ICAR-NBAGR, Karnal, Haryana *Corresponding author: [email protected]. INTRODUCTION somatic RNA contaminant (WBC, epithelial cells, and Mature spermatozoa are generally transcriptionally immature diploid spermatocytes). Therefore, inactive; however, they harbour a variety of mRNA stringent protocol for sperm RNA isolation with molecules, assumed to be originated from the proper quality control for excluding probable trapped cytoplasmic content remaining after contamination arising from genomic DNA and spermiogenesis (Gilbert et al. 2007). Recent studies somatic cell RNA need to ascertained before proposed that the composition and quantity of proceeding to work with sperm RNA. Here, we are sperm RNA transcripts might have a valuable presenting a method for isolation of high-quality diagnostic signiicance for male fertility as well as RNA from Crossbred (Frieswal: HF X Sahiwal) bull putative role in chromatin repackaging, genomic sperm with stringent quality control as well as imprinting and early embryonic development ampliication of few sperm transcripts to show its (Miller et al. 2005). It has been estimated that each reliability towards characterizing RNA abundance in spermatozoon, haploid spermatid and diploid the sperm cells and utilization of such RNA for somatic cell contains approximately 10–20 fg, 450 fg searching suitable biomarkers speciic to fertility or and 10–20 pg of total RNA, respectively (Krawetz, embryonic development. 2005; Gilbert et al. 2007; Goodrich et al. 2007). It MATERIALS AND METHODS shows that each somatic cell holds approximately Experimental Samples 1000 times more RNA than a mature spermatozoon. Semen samples were obtained from crossbred Because of the above fact, the spermatozoal Frieswal bulls with the aid of an AV (42-45ºC) at early transcript proile could easily be distorted by morning by the semen collector. Immediately after

01 Volume 6 Number 1, 2016 collection it was assessed for normal semen quality Sperm Separation Procedure parameters. Ejaculates were quickly placed in a Sperm puriication was carried out on a o water bath at 34 C, after collection, and evaluated for discontinuous gradient of 45 and 90% (v/v) Percoll volume, sperm concentration and progressive (Fig.1). Generally the preparation of 90% Percoll motility per cent. Sperm concentration was solution using a 9: 1 mixture of Percoll and a 10x estimated by using a photometer (Accucell, IMV- stock of Sp-TALP (Parrish et al. 1988) was avoided France) after appropriate calibration for bovine because it may give rise a hyperosmotic solution due semen. Semen was diluted in tris-egg yolk-citric acid- to the presence of considerable solid Percoll beads in fructose-glycerol extender and progressive motility the solution (Parrish et al. 1995). A modiication was was assessed subjectively (in scale of 0–100% at therefore used here (as proposed by Parrish et al. nearest 5% intervals), by placing a drop of diluted 1995) to produce a medium that was iso-osmotic semen on a glass slide covered with a cover slip and with Sp-TALP. Briely, to prepare 90% Percoll viewing at least 5 microscopic ields at 200x solution as per modiication, Percoll was mixed 9: 1 magniication under a phase-contrast microscope with a concentrated solution containing 31 mM KCl, itted warm stage (37 0C). Testicular tissues of buffalo 800 mM NaCl, 3 mM NaH2PO4 and 100 mM HEPES. (Bubalus bubalis) were collected from a local abattoir The pH of the concentrated solution was previously in RNA later, transported to the laboratory and adjusted to pH 7.3 with 1 N NaOH. The following 0 stored at -80 C before use. c h e m i c a l s w e r e t h e n a d d e d ( m M i n a l

Evaluation of viability of spermatozoa concentrations): CaC12 (2.0), MgC12 (0.4), lactic acid

Both eosin nigrosin (EN) vital stain and hypo- (21.6) and NaHC03 (25.0).To prepare the 45% Percoll osmotic swelling test (HOST) were used for the solution, the 90% Percoll medium was mixed 1: 1 evaluation of the sperm plasmalemma integrity. For with Sp-TALP. The gradient consisted of 0.5 ml of the EN test, smears were prepared by mixing 20 μl fresh semen sample layered over 2 ml of 45% Percoll of sperm fraction and an equal volume of EN solution and 2 ml of 90% Percoll in a 15-ml conical plastic (1 g eosin, 5g nigrosin, 2.9 g sodium citrate in 100ml tube. The tube was centrifuged at 700 g for 30 min. of distilled water). The percentage of membrane- The pellet from the bottom was carefully collected intact sperm identiied by EN was determined by after discarding above layers, washed and counting 200 sperm under magniication (×400) centrifuged twice at 250 g for 5 min in Sp-TALP with bright-ield microscopy. Unstained sperm were solution. The pellet containing the motile 0 viable whereas sperm showing partial or complete spermatozoa was kept at -80 C in RNAlater (Ambion, purple staining were considered as dead cells. Austin, TX, USA) until RNA extraction. The response of bovine spermatozoa to the HOS test was assessed with fructose and sodium citrate solution (150 mOsm/L). After semen collection, 100μL of raw semen was added to 1.0 mL of pre- warmed (37oC) HOS solution, mixed gently and incubated for 1 hour at 37oC. Similarly, for each ejaculate a control sample was incubated in 2.9% sodium citrate solution, isotonic to seminal plasma. After incubation, a small drop of thoroughly mixed sample was placed on a clean grease free glass slide, Figure 1. Percoll gradient centrifugation covered with a cover slip and observed under a phase contrast microscope at x400 magniication. From RNA extraction from spermatozoa each smear a total of 100 spermatozoa were Extraction of total RNA from bovine spermatozoa, evaluated viewing at least in ive different ields. and buffalo (bubalus bubalis) testicular tissues was carried out using Tri Reagent (Sigma). The protocol

02 Volume 6 Number 1, 2016 was followed according to the manufacturer's recommendations. The complementary DNA were recommendation with minor modiications. For then ampliied by PCR using speciic primers to extraction, the TRI reagent was heated at 600C and check contamination, within isolated Sperm RNA, by the samples were incubated for half an hour. The g-DNA (PRM1, DAZL), testicular germ cells like most important part to remember here is to vortex spermatocytes (KIT), epithelial cells (E-cadherin- the sample vigorously and pipetting several times CDH1) and leucocyte (CD4 and CD45) (Table 1). The through a sterile syringe itted with a 24 gaze needle reverse transcription PCR (RT-PCR) products were after every 10 min of incubation to completely resolved in 1x Tris-acetate EDTA, 2 % agarose gel dissociate sperm membranes. In order to prevent stained with ethidium bromide. Primers were any bias potentially arising from the RNA extraction d e s i g n e d u s i n g P r i m e r 3 S o f t w a r e procedure, the same method was used for RNA (http://frodo.wi.mit.edu/primer3/input.htm). isolation from the buffalo testicular tissue samples. Genomic DNA contamination of the RNA samples Equal number of spermatozoa (100 million) was was tested by RT-PCR using intron spanning primers used for RNA isolation from each sample. The speciic to bovine protamine 1 (PRM1) and deleted subsequent steps of the protocol were performed as azoospermia-like (DAZL) genes. The positive control recommended by the manufacturer. Total RNA was a puriied bovine genomic DNA extracted from sample (aqueous phase) were then passed through a blood using GenElute™ Blood Genomic DNA Kit RNA extraction column (GenElute Binding column, (Sigma–Aldrich). Similarly, absence of epithelial and Sigma) upon which an RNAse-free, DNAse I germ cell contaminant in spermatozoal RNA was treatment (Ambion) was performed in order to tested using primers speciic to molecular markers eliminate contaminating genomic DNA from the like CDH1 and KIT, respectively, where buffalo samples. RNA was quantiied with a Nanodrop ND- testicular cDNA was used as positive control. 1000 spectrophotometer (Nanodrop, Thermo Fisher Leukocyte contamination was evaluated by using Scientiic, Wilmington, Delaware USA). PCR primers targeting the CD4 and CD45 antigen. Sperm RNA Quality assessment The positive control for leukocyte contamination Total RNA (~60 ng) extracted from crossbred bull were (1) cDNA of WBC obtained from reverse spermatozoa and buffalo (Bubalus bubalis) testicular transcribed total RNA extracted from a blood sample tissues were subjected to reverse transcription using using Histopaque 1077 and TRI reagent Protoscript First Strand cDNA Synthesis Kit (New (Sigma–Aldrich) as per manufacturer's instruction and England Biolabs, Beverly, MA) as per manufacturer's (2) Buffalo testicular cDNA. Table 1. Checking of contaminations in the RNA isolated from spermatozoa Contamination Gene/ Primer name/ sequences GenBank ID Product size (bp) marker Genomic DNA PRM1 PRM1F- 5'AGATACCGATGCTGCCTCAC3' NM_174156 234 (334 PRM1R-5'GTGGCATGTTCAAGATGTGG3' with intron) Genomic DNA DAZL DAZL-F 5' CAC CAG CCA AGG CTA TGT TT 3' NM_001081725 158 (573 DAZL-R 5' CAC CAG TTC GAT CCG TGA TT 3' with intron) Somatic cell B. Taurus CDH1-F 5'CCG TGA GAG TTT TCC CAC AT 3' NM_001002763.1 296 E-cadherin CDH1-R 5'CAT TGG TGA CTG GGT CTG TG 3' (CDH1) Somatic cell v-kit oncogene KIT-F 5'GAC CTG GAG GAC TTG CTG AG3' XM_612028 316 homolog KIT-R 5'AGG GGC TGC TTC CTA AAG AG3' Leucocytes Cd4 CD4-F 5' CAA TGG CAA AGT CCT GTT GG 3' AJ535319 184 CD4-R 5' GAT CTG AGA CAT CCG TTC TGC 3' Leucocytes CD45 CD45-F 5' GACATCGCAGTGTTTGTTGC 3' NM_001206523.1 239 CD45-R 5' GGAGGTTCACATTCCTCTCC 3'

03 Volume 6 Number 1, 2016 Table 2. Primers used to amplify speciic sperm transcripts Sl. No. Gene/ Primer name/ sequences GenBank ID Product size (bp) marker 1 PRM2 PRM2F 5' CCACGTGAAGAGTCCAACTG 3' NM_174157.3 128 PRM2R 5' TGTGAGTCCTCCCGTAGACC 3' 2 PRM3 PRM3F 5'GCGTGAGCCAGGATAACTTC 3' NM_001078053.1 169 PRM3R 5'ACCTCTGAGTCGGCGTCTT 3' 3 TPN1 TNP1F 5’GACCAGCCGCAAATTAAAGA 3’ NM_174199.2 85 TNP1R 5’ TTTGCTGCCACTTCTTTTGA 3’ 4 TPN2 TNP2 F- 5’ACAGACACACCATGCACTCC 3’ NM_174200.1 100 TNP2 R- 5’ CTTGATCACCTTTCCCTCCA 3’

Ampliication of PRM2, PRM3 TPN1and TPN2 Here we tried to isolate quality RNA from mature After a thorough quality check of isolated RNA, few spermatozoa of Crossbred Frieswal (HF X Sahiwal) bull additional sperm transcripts like protamine 2 (PRM2), semen with stringent purity/quality veriication as well as protamine 3 (PRM3), transition protein 1 (TNP1) and ampliication of few additional sperm speciic transcripts. transition protein 2 (TNP2) were ampliied by RT-PCR The discontinuous Percoll gradient (Fig.1) used to purify utilizing speciic primer pairs (Table 2). This was further the semen samples eliminated the damaged spermatozoa, to conirm the isolated RNA quality and suitability of RNA dead cells and cell debris, ensuring the downstream isolation procedure in the downstream experiments of experiments with RNA from intact cells. Microscopic studying transcript abundance in the spermatozoa of examination as well as PCR based quality checking different category of bulls. conirmed the results of absolutely pure spermatozoa RESULTS AND DISCUSSION obtained after Percoll density gradient centrifugation. Routine semen quality parameters like volume, Synthesis and translation of testis-speciic mRNAs are concentration, initial progressive motility, etc were governed by stringent physiological and genetically measured for each sample. EN vital staining as well as HOS control mechanisms. The mRNAs found in mature test was also performed. Unstained sperm were viable spermatozoa appear to be untranslated remnants and whereas sperm showing partial or complete purple may be used as a ingerprint of spermatogenesis staining were considered as dead cells (Fig.2A). Under (Ostermeier et al 2002). Understanding the differential HOS test, sperm without swollen or coiled tails were transcripts abundance in the sperm of normal vs impaired considered as non-viable (Fig.2B). HOS test showed individual is very useful to associate the altered amounts signiicant (P< 0.01) positive correlation with progressive of speciic transcripts with the problems of motility(r= 0.91) and sperm viability (r= 0.93) (data not spermatogenesis. Around 5,000 different mRNA shown). transcripts have been reported in sperm and 25% of them encode for proteins involved in transcription and Because of the membrane sturdiness of the bovine regulation of transcription (Miller and Ostermeier, 2006). spermatozoa, total RNA was extracted by incubating Most of the mRNAs in sperm are found to be involved in the functions of cell proliferation, signal transduction, and oncogenesis, all of which are related to spermatogenesis (Ostermeier et al. 2002). These surviving mRNA transcripts may therefore be a useful indicator of gene activity during the critical steps of spermatogenesis, and could give information about mechanisms of testicular problems, fertility and embryonic development. Although it seems very straightforward to target sperm transcripts as an alternative noninvasive procedure for understanding Figure 2. EN vital staining and Hypo-osmotic swelling male gonadal problems, however, it may leads to erroneous test (HOST) for crossbred Frieswal sperm. A. Unstained results until one standardized RNA isolation procedure sperm are viable and sperm showing partial or complete purple are dead. B. HOST-responded sperm showing critically taking all sorts of precaution to restrict typical coiling of tail and non-responded with no coiling. contamination from other sources is employed.

04 Volume 6 Number 1, 2016 the spermatozoa in TRI reagent for half an hour at cells was always conirmed by visual examination of (600C). To avoid any potential bias arising from the the semen fractions under microscope. Furthermore, extraction procedure, spermatozoa as well as buffalo the absence of contamination of germ cells and testicular tissue samples were extracted with the epithelial cells in all the RNA extractions was tested same method. Spectrophotometer values of sperm by RT-PCR targeting speciic molecular markers like RNA samples were observed between1.70–1.75 for KIT and CDH1, respectively (Table 1, Fig. 4). OD260/OD280. In contrast, RNA isolated from Contamination free RNA sample was chosen for buffalo testicular tissues had an OD260/OD280 ratio further processing. between1.8–2.0, indicating that they were pure and An assessment of contamination by cells of clean. Samples with desired OD ratios were subjected to further quality check to assure utmost sample purity. In order to overcome genomic DNA contamination (gDNA) in the isolated sperm RNA an on-column DNase treatment was carried out. Further to check complete elimination of gDNA from the samples intron spanning primers speciic to DAZL and PRM1 genes were targeted. In the presence of genomic DNA, the intron-spanning primers produced an Figure. 4 Epithelial and germ cell contaminant in the isolated RNA was tested by PCR targeting specic markers like amplicon of 334 bp and 573 bp for DAZL and PRM1 CDH1 and KIT using an equivalent of 100 ng of sperm genes, respectively (Fig. 3). Sperm cDNA samples cDNA, buffalo testis cDNA, and gDNA samples. The without genomic DNA contamination were used for absence of PCR products specic to CDH1 (Fig 4A. lane 2) further works. and KIT (Fig 4B. lane 3) reveal sample purity. M: molecular ladder (2-log DNA ladder-0.1 -10.0 kb, NEB, Beverly, MA, The absence of contamination by somatic and germ USA)

Figure 3. Checking of isolated sperm RNA for genomic DNA contamination. a. Intron-spanning PRM1primers produce an amplicon of 234 bp from pure spermatozoa cDNA, without gDNA contamination. An amplicon of 334 bp is obtained from gDNA with PRM1primers. b. Figure 5. Assessment of contamination by cells of Spermatozoa cDNA sample giving rise an amplicon of hematopoietic origin (leucocytes) using PCR targeting the 158 bp corresponding to DazL cDNA without gDNA marker CD4 and CD45. The absence of contamination (lane 3 contamination. An amplicon of 573 bp is obtained from and 5) shows purity of sperm RNA. M: molecular ladder (2- gDNA with DazL primers. M: molecular ladder (2-log log DNA ladder-0.1 -10.0 kb, NEB, Beverly, MA, USA) DNA ladder-0.1 -10.0 kb, NEB, Beverly, MA, USA)

05 Volume 6 Number 1, 2016 investigations. The entire study is supported by World Bank funded National Agricultural Research Project of ICAR, New Delhi REFERENCES Ganguly I, Gaur GK, Kumar S, Mandal DK, Kumar M, Singh U, Kumar S and Sharma A. 2013. Differential expression of protamine 1 and 2 Figure 6. Showing PCR amplications of different genes in mature spermatozoa of normal and transcripts. Sample used as template for PCR is mentioned in motility impaired semen producing crossbred the top, whereas, amplicon length has been indicated at the Frieswal (HF×Sahiwal) bulls. Research in bottom of the gure. Veterinary Science. 94: 256–262. hematopoietic origin (leucocytes) was carried out by Gilbert I, Bissonnette N, Boissonneault G, Vallee M, RT-PCR using the CD4 and CD45 marker. The Robert C. 2007. A molecular analysis of the presence of contamination as observed in WBC (Fig. population of mRNA in bovine spermatozoa. 5: lane1 and 6), buffalo testicular tissue (Fig. 5: lane Reproduction. 133: 1073– 86. 2, 7) and gDNA (Fig. 5: lane 2 and 8) remained Goodrich R, Johnson G, Krawetz SA. 2007. The undetected in the sperm samples (Fig. 5: lane 3 and preparation of human spermatozoal RNA for 5) used for further analysis. clinical analysis. Archives of Andrology. 53: After a thorough quality checking of isolated RNA, 161–167. additional sperm transcripts like protamine 2 Krawetz SA. 2005. Paternal contribution: new (PRM2), protamine 3 (PRM3), transition protein 1 insights and future challenges. Nature Reviews (TNP1) and transition protein 2 (TNP2) were Genetics. 6:633–642. ampliied by RT-PCR utilizing speciic primer pairs Miller D, Ostermeier GC. 2006. Spermatozoal RNA: (Table 2, Fig 6). Ampliication of desired products Why is it there and what does it do? further conirmed the isolated sperm RNA quality Gynécologie Obstétrique & Fertilité. 34: 840- and suitability of this procedure for further 846. downstream experiments of studying transcript Miller D, Ostermeier GC and Krawetz SA. (2005) The abundance in different category of bulls (Ganguly et c o n t rove r s y, p o t e n t i a l a n d ro l e s o f al. 2013). spermatozoal RNA. Trends in Molecular In conclusion, the present study demonstrated a Medicine. 11: 156–163. comprehensive RNA isolation protocol from Ostermeier GC, Dix DJ, Miller D, Khatri P, Krawetz SA. crossbred bull semen with stringent quality/purity 2002. Spermatozoal RNA proiles of normal checking mandatory for researchers entering in this fertile men. Lancet. 360:772-777. ield for studying differential abundance of sperm transcript. It is always to remember that very Parrish JJ, Krogenaes A and Susko-Parrish JL. 1995. negligible somatic RNA contaminant (WBC, Effect of bovine sperm separation by swimup e p i t h e l i a l c e l l s , a n d i m m a t u r e d i p l o i d or percoll on success of in vitro fertilization and spermatocytes) could easily distort any embryo development. Theriogenology. 44:859- spermatozoal transcript proile. 869. ACKNOWLEDGEMENTS Parrish JJ, Susko-Parrish JL, Winer MA and First NL. 1988. Capacitation of bovine sperm by heparin. The authors are grateful to Director, CIRC, Meerut and Biology of Reproduction. 38:1171-1180. Director, Frieswal Project, Meerut for providing necessary facilities to carry out the present

06 Volume 6 Number 1, 2016 Genetic polymorphism in 5’UTR of myostatin (MSTN) gene in Nilagiri sheep Amiya Ranjan Sahu*1, V Jeichitra2, R Rajendran3 and A Raja4 Department of Animal Genetics and Breeding, Madras Veterinary College, Chennai, India ABSTRACT The study was undertaken to detect the genetic variation in the part of 5'UTR, exon 1 and part of intron 1 (797 bp) of MSTN gene in Nilagiri breed of sheep by Tetra-primer ARMS-PCR. Randomly, eight samples of the PCR product were sent for sequencing. The analysis revealed the presence of SNP at 711 C>A in 5'UTR of MSTN gene. The identiied SNP was genotyped by Tetra-primer ARMS-PCR. The C711A locus of MSTN gene is characterized by the higher frequency of allele “C” in this breed. The effect of mutation in this gene with growth traits were analysed by association study using least- squares and had no signiicant effect on growth traits. Key words: Sheep, growth traits, myostatin gene, polymorphism, tetra-primer ARMS-PCR Present address: 1Ph.D Scholar, Division of Animal Genetics and Breeding, Indian Veterinary Research Institute, Izatnagar; 2Associate Professor, Department of Animal Genetics and Breeding, Veterinary College and Research Institute, Orathanadu; 3Professor, Directorate of Research, TANUVAS, Chennai; 4Professor, Department of Animal Biotechnology, Madras Veterinary College, TANUVAS, Chennai *Corresponding author: [email protected]

INTRODUCTION acts as a negative regulator of muscle cell growth, According to 19th Livestock Census, India possesses where the loss of functional myostatin is known to 65.06 million sheep (Anon., 2012) which constitute cause the “double-muscled” phenotype in different 12.7 per cent of the total livestock population of India species (Grobet et al. 1998; Kambadur et al. 1997; and ranks third in the world sheep population. The and McPherron and Lee, 1997 in cattle; Broad et al. contribution of sheep to total meat production in the 2000 in sheep and Li et al. 2006 in goat). Studies on country is around 7.12 per cent. India is endowed the polymorphism of MSTN gene and its association with large and biologically diverse sheep genetic with growth traits are not available among Indian resources as relected by the availability of 40 breeds breeds of sheep. Hence the objective of this study of sheep. Among these Nilagiri breed is best in terms was to detect the polymorphism of myostatin of mutton and wool quality which is directly (MSTN) gene, and to analyse the association between indicating the body growth. genetic variants and growth traits. Myostatin (MSTN) gene also called as growth MATERIALS AND METHODS differentiation factor 8 (GDF 8) gene is located on The blood samples were collected in vacutainers chromosome 2 of sheep. Myostatin, the protein containing EDTA as an anticoagulant from Nilagiri whose expression is under the control of MSTN gene breed (n = 103) at Sheep Breeding Research Station,

Table 1. Primer sequences used to amplify MSTN gene Sl. No. Primer sequence (5'-3' end) Annealing temp. Product size (°C) Part of 5' UTR, Forward: gtc aaa tga atc agc tca ccc t 60.0 797 bp exon 1 and Reverse: tcc tta cgt aca agc cag cag intron 1 of MSTN Forward inner 51.5 A allele = 225 MSTN-711 aaa agc aaa aga aaa gta aaa gga gga C allele = 156 Reverse inner Outer = 325 caa tac aat ctt ttt cct tgc tct tat tg Forward outer gga ata taa aaa gcc act tgg aat aca g Reverse outer agt ctt gag gat tta ttg ttt tgt ctc c

07 Volume 6 Number 1, 2016 Sandynallah. The genomic DNA was extracted by viz., birth, weaning (3-months), 6, 9 and 12 months using standard Phenol-Chloroform extraction using least-squares procedures (Harvey, 1990). procedure (Sambrook et al. 1989) by using DNAzol RESULTS AND DISCUSSION reagent, instead of SDS and proteinase K. The region On analysing the nucleotide sequences, it was found 797 bp (part of 5' UTR, exon 1 and intron 1) of the that there was no change in the coding region. MSTN gene was ampliied by using the primer However, in 5'UTR, a 711C>A transversion was found sequences designed by Fast PCR Primer designing in this breed. Sequence analysis of C711A locus software (Table 1). revealed the presence of all three genotypes viz., CC, The total 8 samples were sequenced for 797 bp CA and AA which is given in the chromatogram fragment of MSTN gene. The amplicons were (Figure 1). The different sizes of ampliied products sequenced in both forward and reverse directions at M/s. Euroins Genomics India Pvt. Ltd., Bangalore. The instrument used for sequencing was ABI PRISM 3730XL Genetic analyzer (Applied Biosystems, USA). Sequence data were analysed using the SeqMan program of LASERGENE software (DNASTAR Inc., USA). The sequences were assembled and screened for SNPs. Two sets of primers were designed for genotyping the individual animals with respect to the SNP from an online “Tetra-primer ARMS-PCR” d e s i g n i n g s o f t w a r e (http://cedar.genetics.soton.ac.uk/public_html/pri mer1.html; Ye et al. 2001) (Table 1). The Tetra- primer ARMS PCR conditions are given in Table 2 Figure 1. Chromatogram of 711C>A in 5’UTR of MSTN gene in Nilagiri sheep. The genotypes were assigned on the basis of band pattern of the PCR products. The allele and genotype frequencies were calculated by standard formula obtained were 156 bp, 225 bp and 325 bp (Figure 2). (Falconer and Mackay, 1996). The χ2 test of goodness The CC homozygote showed two fragments viz., 156 of it was carried out from observed and expected bp and 325 bp; AA homozygote showed two numbers to check whether the population was in fragments viz., 225 bp and 325 bp; and CA Hardy-Weinberg equilibrium (Falconer and Mackay, heterozygote showed all the three fragments viz., 1996) at the C711A locus of MSTN gene. The 156 bp, 225 bp and 325 bp. The genotypic polymorphisms observed at the C711A locus of frequencies of CC, CA and AA were 0.437, 0.320 and MSTN gene in Nilagiri sheep breed was analysed for 0.243 respectively, and the allele frequencies of C and the association with body weights at various ages A were 0.5970 and 0.4030. The locus was signiicantly (P<0.01) deviated from Hardy- Table 2. PCR protocol for genotyping through Tetra-primer ARMS-PCR Step Process Temperature (°C) Duration 1 Initial denaturation 95 5 min 2 Denaturation 95 45 sec 3 Annealing 51.5 60 sec 4 Extension 72 45 sec 5 Back to steps 2 to 4 35 cycles 6 Final extension 72 5 min 7 Hold 4 Until the samples are removed

08 Volume 6 Number 1, 2016 Table 3. Least-squares means ± S.E. (kg) 711C>A in MSTN gene on growth traits Body weight at various Nilagiri breed NS ages AA (16) CA (21) CC (36) Prob Birth weight 3.071 ±0.126 2.900±0.112 2.919±0.094 0.4296 3 months weight 11.574±0.622 11.201±0.554 11.201±0.464 0.8324 6 months weight 15.397±0.668 15.746±0.595 15.372±0.498 0.8538 9 months weight 17.805±0.709 18.960±0.632 18.615±0.529 0.3771 12 months weight 20.731±0.816 21.759±0.727 21.677±0.609 0.4844 Figures in parentheses indicate number of records used for analysis, NS = not signiicant. Weinberg equilibrium. This may be due to less locus in 5'UTR of MSTN gene on growth traits viz., sample size and selection forces. The 711C>A birth, weaning (three months) six, nine and 12 transversion in 5'UTR observed in Nilagiri breed months weight in Nilagiri breed was found to be non- studied is the irst report in Indian sheep breeds. signiicant (Table 3). The 711C>A in 5'UTR of MSTN Similar inding (-41C→A in 5'UTR) was earlier gene is a novel mutation and the irst report in sheep. reported by Gan et al. (2008) in different Chinese Previous studies on association analysis with growth pure and synthetic breeds. traits for this mutation were not reported earlier in sheep. Hence it may be concluded that the effect of Absence of SNP in intron 1 of MSTN gene observed in this mutation on growth traits in other breeds of this study is similar to the report of Dehnavi et al. sheep need to be investigated. (2012) in Zel sheep by PCR-SSCP. However, Ansary et al. (2008) identiied three unique SSCP patterns for CONCLUSION intron 1 region of GDF8 gene in Baluchi sheep. Zhou The 5'UTR of MSTN gene is polymorphic in Nilagiri et al. (2008) also reported the transversion of G→T in sheep breed of Tamil Nadu, India. The SNP 711 C>A is intron 1 of MSTN gene and the same could not be a novel and irst report among Indian sheep breeds. detected in this sheep breed. The exon 1 of MSTN But this mutation had no signiicant association with gene was completely identical to the reference growth traits. Absence of signiicant association of sequence that can be used as a candidate gene for this mutation with body weight may be due to evolutionary studies. selection, polygenic inluence and deicit of grazing land. The effects of different genotypes observed at C711A ACKNOWLEDGEMENTS M 1 2 3 4 5 6 7 8 Authors are thankful to the Sheep Breeding Research Station, Sandynallah for the necessary support to carry out the research work. REFERENCES Anon. 2012. 19th Livestock Census 2012. Department of Animal Husbandry and Dairying, Ministry 325 bp 225 bp of Agriculture, Government of India, New 156 bp Delhi. Ansary M, Tahmoorespour M, Valeh MV, Nassiry MR and Shahroudi FE. 2008. Investigation of polymorphism of GDF-8 gene and its Figure 2. Tetra-primer ARMS-PCR genotyping of C711A, association with average daily gain in Baluchi Lane M: 50 bp DNA ladder; Lanes 3, 6 and 7: AA (225 bp + sheep. Proceedings of 30th Congress of Animal 325 bp); 2, 4 and 8: CC (156 bp + 325 bp); and 1 and 5: CA Science, Ferdowsi University of Mashhad, (156 bp, 225 bp and 325 bp) of Nilagiri sheep. Mashhad, Iran.

09 Volume 6 Number 1, 2016 Broad TE, Glass BC, Greer GJ, Robertson TM, Bain WE, Harvey WR. 1990. Mixed Model Least-squares and Lord EA and McEwan JC. 2000. Search for a Maximum Likelihood Computer Programme. locus near to myostatin that increases PC-2 version. Ohio State University, muscling in Texel sheep in New Zealand. Colombus. Proceeding of New Zealand Society for Kambadur R, Sharma M, Smith TPL and Bass JJ. 1997. Animals 60: 110-112. Mutations in myostatin (GDF8) in double- Dehnavi E, Azari MA, Hasani S, Nassiry MR, Mohajer muscled Belgian Blue and Piedmontese M, Ahmadi AK, Shahmohamadi L and cattle. Genome Research 7: 910-916. Yousei S. 2012. Polymorphism of myostatin Li XL, Wu ZL, Gong YF, Liu YQ, Liu ZZ, Wang XJ, Xin TR gene in Intron 1 and 2 and Exon 3, and their a n d J i Q. 2 0 0 6 . S i n g l e n u c l e o t i d e associations with yearling weight, using polymorphism identiication in the caprine PCR-RFLP and PCR-SSCP techniques in Zel myostatin gene. Journal of Animal Breed. sheep. Biotechnology Research International Genetics 123: 141-144. 2012:1-5. McPherron AC and Lee SJ. 1997. Double muscling in Falconer DS and Mackay TFC. 1996. Introduction to cattle due to mutations in the myostatin Quantitative Genetics. (4th Ed.). Longman gene. Proceedings of National Academy of Group Limited, England. Science USA 94: 12457-12461. Gan SQ, Du Z, Liu SR, Yang YL, Shen M, Wang XH, Yin Sambrook JE, Fritsch F and Maniatis T. 1989. JL, Hu XX, Fei J, Fan JJ, Wang JH, He QH, Zhang Molecular Cloning: A Laboratory Manual, 2nd YS and Li N. 2008. Association of SNP Ed. Cold spring Harbor Laboratory Press, haplotypes at the myostatin gene with New York, USA. muscular hypertrophy in sheep. Asian­ Ye S, Dhillon S, Ke X, Collins AR and Day INM. 2001. An Australian Journal of Animal Science 21: 928- eficient procedure for genotyping single 935. nucleotide polymorphisms. Nucleic Acids Grobet L, Pncelet D, Royo LJ, Brouwers B, Pirottin D, Research 29: 88. Michaux C, Menissier F, Zanotti M, Dunner S Zhou H, Hickford JGH and Fang Q. 2008. Variation in and George M. 1998. Molecular deinition of the coding region of the myostatin (GDF8) an allelic series of mutations disrupting the gene in sheep. Molecular Cellular Probes 22: myostatin function and causing double- 67-68. muscling. Mammalian Genome 9: 210-213.

10 Volume 6 Number 1, 2016 Morphological variability and management of Lonand sheep of Maharashtra Dinesh Kumar Yadav*, Reena Arora and Anand Jain ICAR-National Bureau of Animal Genetic Resources, Karnal-132 001 (Haryana), India ABSTRACT To characterize Lonand sheep of Maharashtra, 7 morphometric traits (height at withers, body length, chest girth, paunch girth, ear length, tail length and body weight were recorded on 114 animals. The study included animals having 2- 8 tooth. Management practices, production and reproduction traits were recorded using interview method. The average body weights of rams and ewes were 42±3.69 and 29.3±0.45 kg whilst the chest girth were 81.3±2.25 and 74.4±0.37 cm respectively. Males were 47% heavier than females. The coeficient of variation of all traits ranged from 3.8 % to 27.8 %. The average lock size of 41 locks was 85.7 which comprised 65.2 ewes, 1.6 rams and 18.9 lambs. The animals were primarily maintained under extensive management system. The locks were migratory, mostly within the Satara district. Introduction of Madgyal rams in locks was observed. Breed purity was 14.7 %. Age at irst lambing was 16-18 months. Daily milk yield was 200 ml and lactation length was 90 days. Average annual greasy wool yield was around 500 gm. The study has contributed to the knowledge of morphometric characterization and population structure of Lonand sheep, and would enable to have insight for its conservation and improvement programmes.

Keywords: Characterization, Lonand, morphometric traits, sheep *Corresponding author: [email protected]

INTRODUCTION respond to the present and future needs of sheep The Indian sheep accounts 65.06 million heads and production and human needs. The ICAR-National occupies third position worldwide. It is a traditional Bureau of Animal Genetic Resources, a nodal source of livelihood for marginalized communities in government agency for registration of livestock the drought prone areas. The total sheep population breeds in India, has registered 40 sheep breeds of Maharashtra is 25.8 lakh. This accounts for 3.97% (www.nbagr,res.in). One of these, the Deccani breed is of the total sheep in the country (19th Livestock widely distributed in the Deccan plateau across the Census, 2012). About 1 lakh families depend upon four states of Maharashtra, Andhra Pradesh, sheep rearing in Maharashtra. Contribution of sheep Telangana and Karnataka. The distribution area of the in total meat production of the state is around 11%. breed lies between 160 to 200N latitude and 720 to Indian sheep breeds/populations are endowed with 780E longitude. The Deccani is a medium-sized course- many traits like disease resistance, tolerance to high wool sheep breed reared mainly for mutton. The breed temperature and humidity, multiple births, high feed is well adapted to the semi-arid environment of the conversion eficiency etc. The genotypes have Maharashtra state and thrives well through long performed better than exotic breeds under low input migration, poor nutrition and draught, and tropical conditions and climatic stresses especially during diseases. There are ive sheep ecotypes viz. Kolhapuri, draughts (Karim and Prince, 2011). Sheep breeds of Lonand, Madgyal, Solapuri and Sangamneri in India exhibit large variations in the morphology and Maharashtra (Ghanekar, 1983; Gokhale, 2003; Karim production. Distinct phenotypic characteristics have and Prince, 2011) and they exhibit distinct been deined for these breeds (Acharya, 1982; Bohra morphological characteristics (Yadav et al. 2014), et al. 1993; Sahana et al. 2001, 2004; Kumar et al. thrive in less favoured rural areas and are reared 2006; Singh et al. 2007; Yadav et al. 2009, 2011); mainly by the marginalized and landless farmers. however decrease in breed purity, a major concern, Despite their distinct identity, the morphometric has been observed primarily due to intermixing standards of the ecotypes are yet to be deined. This between them and needs to be tackled on priority. paper provides a comprehensive morphometric Sheep genetic diversity signiies a unique resource to description, management practices, and production and reproduction traits of the Lonand sheep.

11 Volume 6 Number 1, 2016 MATERIALS AND METHODS was carried out using JMP software of SAS (2012). Purposive sampling was used to determine the RESULTS AND DISCUSSION distribution area of the Lonand sheep. Villages Habitat and Population Status having Lonand sheep were identiied for data The Lonand sheep might have been named after recording based on information of the animal Lonand, a village in Khandala taluka in Satara district husbandry oficials and shepherds. Interview of Maharashtra. The origin of Lonand sheep is not method was used for data collection on management known but is believed to have originated through practices, production and reproduction parameters. local adaptation of Deccani sheep. The ecotype is The age was determined by dentition and the distributed in Man, Phalton, Khandala, Koregaon and animals having two or more permanent teeth were Wai talukas of Satara district of Maharashtra. But included in the study. A dial spring balance was used over the years, the farmers have introduced Madgyal to determine body weight (BW) in kilogram (kg). rams in the sheep locks for better growth. The Body dimensions were measured using a steel tape intervention was due to state government's policy of with records taken to the nearest centimeter (cm) providing Madgyal rams for better growth. holding the animal in normal standing position. The Migration also had its effect on breeding of Lonand traits measured were body length (BL), height at sheep with Madgyal and other rams. As a result withers (HW), chest girth (CG), paunch girth (PG), currently the ecotype is conined mainly to the ear length (EL) and, tail length (TL). The sheep Phalton taluka. In the average lock size of 85.7 originated from 41 different locks and were reared sheep, 12.6 exhibited Lonand characteristics, a under extensive management system. One hundred substantial decrease in breed purity in the fourteen sheep (10 males and 104 females) were distribution area. Figure 1 shows the distribution recorded on above parameters. Statistical analysis area of Lonand Sheep. Table 1 gives total sheep population of the Satara district. Table 1. Sheep population of Satara district of Maharashtra (2012)* S. No. Block/Taluka Exotic/ Indigenous Total crossbred 1 Jaoli 17 484 501 2 Karad 319 14876 15195 3 Khandala 151 37426 37577 4 Khatav 298 18467 18765 5 Koregaon 2680 12180 14860 6 Mahabaleshwar 6 73 79 7 Man 50 94216 94266 8 Patan 188 1168 1356 9 Phaltan 2162 63672 65834 10 Satara 100 6034 6134 11 Wai 341 9313 9654 Total 6312 257909 264221 *Source-19th Livestock Census 2012- Maharashtra State Morphometric Characteristics Lonand are hardy, large, polled (hornless), white coat sheep. They have straight back line, medium deep Figure 1 : Distributor Area of Lonard Sheep barrel, narrow forehead, straight nose line, medium

12 Volume 6 Number 1, 2016 to long drooping ears, gray hooves, long thin and Management Practices, Production and Reproduction strong legs, medium and thin tail. Head, face, belly Lonand sheep are primarily maintained on grazing. and legs are devoid of wool. Some of the animals also Flocks are grazed for 8-10 hours daily walking a have short and notched ear. This is a coarse wool distance of 3-10 km/day. The sheep locks migrate mutton-type sheep. within Satara district to nearby places viz. Saple, Morphological Variability Vatar, Masur, Karar and Patan during December Table 2 gives the means and variability of –July. Majority of the farmers provide housing morphometric traits of adult Lonand sheep. The especially during night. While on migration the average body weights of males and females were locks are housed in open ields with temporary 42±3.69kg and 29.3±0.45 kg respectively. Similar fencing of either ropes or iron wires around the body weights were reported in Chokla sheep (Jain et enclosures. In most of the cases, the sheep pens are al. 2009). Body length and height at withers of located adjacent to the owner's dwelling. The Chokla sheep were smaller than Lonand. The body boundaries of the enclosures are made of tree biometry relects that Lonand sheep are large in size branches/ bushes/rope or wire netting. Some with medium tail. Two-tooth animals weighed 35 kg farmers also housed their sheep in stone wall in males and 25 kg in females. The body weights thatched houses. Water is provided two times a day. between 12 and 15 months are important from Lambs are cared by women, children and elder breeding point of view. Substantial sexual persons at home for 15-30 days, thereafter they join d i m o r p h i s m wa s o b s e r ve d i n a l l s e ve n the lock for grazing. The Groundnut cake, jowar, morphometric traits (Table-2). Males were 43% maize and wheat bran (daliya) are provided to lambs heavier than females; however the estimate may be regularly. In addition to suckling mother's milk, most slightly biased due to small sample size of males. of the farmers feed the lambs on goat milk. Babool Coeficient of variation (%) varied from 3.8 (BL) to leaves (a source of protein) are specially fed to 27.8 (BW). The large value of coeficient of variation lambs. The lambs lick a hanging mineral brick for ear length may be ascribed to the presence of (chatan) in the paddock to meet out the requirement short and notched ears in some female animals and of essential minerals. Lambs of ewes which give small sample size in males. Higher values of more milk are selected for future stock. Pneumonia, Coeficient of variation (%) in males may be bluetongue (BT), numbness, bloat or tympany, attributed to small sample size. Similar results were enterotoxemia (ET), foot-and-mouth disease (FMD), reported by Yadav et al. (2013, 2014) in other Indian ecthyma, haemorrhagic septicemia (HS) and peste sheep breeds. des petits ruminants (PPR) were reported diseases. Table 2. Mean, standard error, coeficient of variation, range and sexual dimorphism of the morphological traits in Lonand ecotype of Deccani sheep

Female (104) Male (10) Sexual Morphometric Mean Coeficient Range Mean ± SE Coeficient of Range dimorphism Trait ± SE of variation variation (m/f) BW 29.3±0.45 15.8 18-40 42.0±3.69 27.8 24-65 1.43 BL 71.9±0.26 3.8 62-77 79.9±1.52 6.0 72-86 1.11 HW 69.5±0.29 4.4 59-77 77.0±1.54 6.3 68-83 1.11 CG 74.4±0.37 5.1 65-82 81.3±2.25 8.8 69-92 1.09 PG 74.9±0.45 6.2 63-86 80.1±2.42 9.6 70-95 1.07 EL 14.8±0.35 24.5 4-21 15.4±1.37 28.1 10-21 1.04 TL 15.5±0.22 14.6 11-21 17.3±0.88 15.9 13-21 1.03 BW, body weight; BL, body length; HW, height at withers; CG, chest girth; PG, paunch girth; EL, ear length; TL, tail length

13 Volume 6 Number 1, 2016 Vaccination against FMD, ET, HS and PPR is done by weekly. These are usually sold in groups and government agencies. Dipping and deworming are butchers and traders purchase them on visual also performed by the farmers themselves. Mortality appraisal. A sheep owner's income depends largely among the adult sheep and lambs were between 5- on the number of saleable lambs produced per ewe 10 % and 4-8 % respectively. Breeding rams were per year. Three months old male and female lambs raised by the farmers at their locks. Rams were fetch a market price of Rs 3500 and Rs 3000 selected on the basis of body size and conformation. respectively. The main reason for the existence of a Body weight, lustrous white wool with long staple ewe is the production of lambs. Sheep farmers length, compact body with good height, short face generally keep the ewe lambs for replacement lest having straight nose line, were some of the preferred opt for distress sale to meet out emergency traits for selection of rams. Some farmers exchange monetary requirements. Depending upon the the rams to avoid inbreeding. condition of the animal, prices of adult ewes and October-November was the main lambing season rams varies from Rs 8000-9000 and Rs 10000- and March-April, the minor. Lambing rate was 12000 respectively. reported as 70- 90 %. Lambing interval was stated CONCLUSION as 7-8 months. Litter size was single, but 3-5% Lonand is an important mutton-type sheep of percent of ewes give birth to twins. Age at irst Maharashtra and play important socio-cultural as lambing was 16-18 months. Age and weight at well as economic roles in the lives of Dhangar and puberty in females were around 11-12 months and Ramoshi communities. The dwindling population of 24 kg. Age at irst breeding in males was 10-12 Lonand sheep indicated its threatened status. The month and weight at two teeth age was 35 kg. study further showed that there is substantial Breeding life of a ram was 6-7 years. Daily milk yield shrinkage in its breeding tract limiting it to some was 200 ml and lactation length was 90 days. pockets of Satara district. Lack of remunerative price Shepherds keep breeding rams with ewes. Most of of wool, disfavour for breed purity due to perceived the farmers kept one or two rams. The average lock better growth and monetary gains from Madgyal size was 85.7 which comprised 65.2 ewes, 1.6 rams crossed lambs and non- availability of proven rams and 18.9 lambs. The farmers have introduced were some of the impediments in its proliferation. Madgyal and other sheep in their locks. The existing genetic dilution in the farmers' locks is Consequently, the breed purity has been diluted to a posing further dangers to its identity and population large extent. The percentage of Lonand in the status. Planned and concerted efforts for its surveyed locks was 14.7. The major income from breeding and improvement are needed to save this rearing Lonand sheep is earned from the sale of important sheep from extinction. Raising true to lambs at 3-4 months of age. Lonand lamb of this age breed rams is the biggest challenge. It should be fetches a price of Rs 3000 while its counterpart of taken up with immediate effect. Best pure bred ram Madgyal sheep fetches a price of Rs 4000. This gain in competition shows should be organized by the income has tempted the farmers to breed the Lonand Punyashloke Ahilyadevi Maharashtra Mendhi va ewes with Madgyal rams. State government has also Sheli Vikas Mahamandal Ltd., Pune, Maharashtra. supported the farmers by providing Madgyal rams. For recognizing an ecotype/population as a breed, The survey indicated that breed purity of Lonand formation of a breed society is a necessity. Lonand sheep has come down to 15%. sheep breeder's society may be formed. The true to breed locks may be raised and when population Lonand sheep are shorn twice a year in becomes stable, it should be registered as a breed. January/February and June/July. Average annual This study has contributed to the knowledge of greasy wool yield is around 500 gm. The price of characterization and population structure of Lonand wool is Rs 15 per kg. Lambs are sold at the age of 3-4 sheep, and would enable to have insight for its months in local markets (mandies) organised conservation and improvement programmes.

14 Volume 6 Number 1, 2016 ACKNOWLEDGEMENTS Cary, NC, 1989-2007 We are thankful to Director, ICAR-National Bureau of Jain A, Singh G, Yadav DK. 2009. Chokla-an endangered sheep genetic resource. Indian J. Animal Genetic Resources, Karnal for providing Anim. Sci. 79 (10): 1071-1072. support. Financial assistance provided by Indian Karim SA and Prince LLL. 2011. Sheep genetic Council of Agricultural Research, Krishi Bhawan, resources in India and improving productivity New Delhi is gratefully acknowledged. Department through Fec B introgression. In: Proceedings of of Animal Husbandry, Maharashtra is acknowledged VIII Annual Convention of Society of for facilitating the ield work. Technical assistance Conservation of Domestic Animal Biodiversity & National Symposium on Animal Genetic provided by Subhash Chander, Technical Oficer is Resources for Sustainable Livestock Sector in duly acknowledged. Completion of this project could India, 18-19 February, Bhubaneswar, Orissa, not have been accomplished without the support of India, pp56-69. the sheep owners, all are gracefully acknowledged. Kumar D, Singh G, Jain A. 2006. Characterization and We are thankful to Dr. Avnish Kumar, Principal evaluation of Muzaffarnagri sheep. Ind. J. Small Scientist, ICAR-NBAGR, Karnal for providing map Rumin. 12 (1): 48–55. Sahana G, Gupta SC and Nivsarkar AE. 2001. Garole: which were 'Reproduced by permission of Surveyor The prolic sheep of India. Anim. Genet. General of India on behalf of Govt. of India under Resour. Inf. 31: 55-63. License No. BP15CDLA452. All rights reserved.' Sahana G, Jain A and Maity SB. 2004. Characterization REFERENCES and evaluation of Jalauni sheep. Anim. Genet. Resour. Inf. 34: 67-73. Acharya RM, 1982. Sheep and goat breeds of India. Singh G, Jain A and Yadav DK. 2007. Evaluation of Nali FAO Animal Production and Health Paper, 30. sheep under eld conditions. Indian J. Anim. FAO, Rome, Italy Sci. 77 (11): 1158-1160. Bhatia S, Arora R. 2005. Biodiversity and conservation Yadav DK, Singh G, Jain A, Singh S and Paul A K. 2009. of Indian sheep genetic resources-an overview. Fitting of growth models and evaluation of Asian-Aust. J. Anim. Sci. 18: 1387-1402. Marwari sheep under eld conditions. Ind. J. Bohra SDJ, Jain A, Sharma SC. 1993. Kheri a new type Anim. Sci. 79 (12): 1242-44. of sheep in Rajasthan (India). Wool and Yadav DK, Arora R, Bhatia S and Singh G. 2011. Woollens of India. Jan-Mar, 23-24. Morphological characterization, production Ghanekar VM. 1983. Deccani sheep – a study in and reproduction status of Munjal –A retrospect. Part-II. Wool and Woollens of India threatened sheep population of North-West 20: 51–63 India. Ind. J. Anim. Sci. 81(9): 943-945. Gokhale SB. 2003. Survey, evaluation and Yadav DK, Jain A, Kulkarni VS, Govindaiah MG, characterization of Deccani sheep breed. Aswathnarayan T and Sadana DK. 2013. Network Project Report, NBAGR, Karnal and Classication of four ovine breeds of southern BAIF Development Research Foundation, peninsular zone of India: Morphometric study Pune, p5 using classical discriminant function analysis. 19th Livestock Census (2012). All India Report, SpringerPlus 2:29. Department of Animal Husbandry, Dairying & Yadav DK and Arora R. 2014. Genetic discrimination of Fisheries , Ministry of Agriculture, Government Muzaffarnagri and Munjal sheep of northwestern of India, Krishi Bhavan, New Delhi. semi-arid zone of India based on microsatellite FAO, 2000. World Watch List for domestic animal markers and morphological traits. Indian Journal diversity, 3rd edn. Information Division, FAO, of Animal Sciences 84(5):527-532. Rome. JMP Version 9.0: SAS Institute Inc.

15 Volume 6 Number 1, 2016 Fixation of K allele in K232A polymorphism of DGAT1 gene in Sahiwal and Hariana cattle Anita Sharma1, Madhu Tiwari2, Satyendra Pal Singh2*, Deepak Sharma2, Sumit Kumar2 and Vijay Pandey3 Department of Animal Genetics and Breeding, College of Veterinary Sciences & Animal Husbandry, DUVASU, Mathura-281001 (UP), India ABSTRACT Diacylglycerol O-acyltransferase 1 (DGAT1) is one of the key enzymes in controlling the rate of triglyceride synthesis in adipocytes, it has been studied as a candidate for association with the milk fat content in cattle. In the present investigation, K232A polymorphism in exon 8 region of DGAT1 gene has been studied using EaeI/PCR-RFLP assay in Sahiwal and Hariana cattle breeds. The restriction digestion of the 491 bp PCR product showed the presence of KK genotype with a genotypic frequency of 1.0. The KA and AA genotypes were not observed in the screened samples. The allelic frequency of DGAT1 K allele was calculated as 1.0 and that of DGAT1 A allele was zero. The present study revealed monomorphic nature of DGAT1 gene in the screened samples of Sahiwal and Hariana breed.

Key words: DGAT1 gene, polymorphism, Hariana, Sahiwal, EaeI/PCR-RFLP Present address: 1College of Biotechnology, DUVASU, Mathura (UP), India; 2Department of Animal Genetics and Breeding, College of Veterinary Sciences & Animal Husbandry, DUVASU, Mathura, India; 3Department of Veterinary Biochemistry, College of Veterinary Sciences & Animal Husbandry, DUVASU, Mathura, India *Corresponding author : [email protected]

INTRODUCTION been observed in the exotic cattle (Bos taurus) Diacylgycerol O-acyltransferase 1 (DGAT1) plays a including Holstein-Friesian, Fleckvieh Jersey and central role in formation of lipid in different tissues German cattle breeds (Grisart et al. 2001; Spelman et of biological body and metabolism of cellular al. 2002; Winter et al. 2002; Thaller et al. 2003 and glycerolipids. It catalyzes the inal step in Tabaran et al. 2015). Considering limited study in triacylglycerol (TAG) biosynthesis by converting Indian cattle (Bos indicus) breeds (Tantia et al. 2006; diacylgycerol (DAG) and fatty acyl-coenzyme A (CoA) Ganguly et al. 2013), the present study was into triacylglycero1 (Wang et al. 2007). The DGAT1 undertaken to investigate the status of K232A gene is characterized in cattle, buffalo, pig, monkey, polymorphism and allele frequency of DGAT1 gene human, mice and rat. The DGAT1 gene is 1470 bp in in Indian Sahiwal and Hariana cattle. size encoding for 489 amino acid precursors, MATERIALS AND METHODS comprising of 17 exons with a molecular mass of ~55 Location and animal source KDa. Grisart et al. (2002), Winter et al. (2002) and The study was undertaken at Instructional Livestock Weller et al. (2003) identiied a polymorphism in Farm Complex (ILFC) and Department of Animal exon 8 of the DGAT1 gene in Bos taurus, AA → GC Genetics and Breeding, DUVASU, Mathura (UP). A exchange resulting in a non-conservative total of 100 animals of Sahiwal (n = 50) and Hariana substitution of amino acid 232 Lysine (K) → Alanine (n = 50) cattle were used for the present study. The (A). This polymorphism has been associated with animals were randomly selected and were reared increased fat yield, fat and protein percentage as well under standard management conditions. as decrease in milk production and protein content. Sampling and analytical methods Therefore, DGAT1 is considered a strong candidate Three ml of blood was collected in EDTA containing gene for improving milk fat contents and its vacutainer tubes. The genomic DNA was isolated by composition. whole blood DNA extraction kit (Genei-Merck, India). Several polymorphism studies of DGAT1 gene and its The quality of DNA was checked by using 0.7% association with milk yield and composition have agarose electrophoresis and the quantity of DNA was

16 Volume 6 Number 1, 2016 estimated by spectrophotometer. 1 M 2 3 4 The PCR was performed by using Forward Primer: '5'-CAC CAT CCT CTT CCT CAA G-'3' and Reverse Primer: '5'-AAG GAA GCA AGC GGA CAG-'3' reported by Winter et al. (2002). The PCR reaction contained 25µl reaction mixture that included 10µmol of each primer, 100mM dNTP, 1X Taq buffer (with 2.0 mM MgCl2), 1.0 units Taq polymerase and 50 ng of genomic DNA as template. The PCR was performed with denaturation at 94oC for 5 minutes followed by 30 cycles each of 94oC for 30 seconds, 58oC for 30 seconds, 72oC for 40 seconds and then a inal step at 72oC for 5 minutes. The products were analyzed by 1.0 % agarose gel electrophoresis. Figure 1. DGAT/EaeI PCR-RFLP assay showing The ampliied products were digested by EaeI genotype pattern in 2.0% agarose gel; Lane 1: restriction enzyme for PCR-RFLP assay. 10 µl of Undigested PCR product, 2: Marker (100 bp ladder), 2, ampliied product was digested with 10 units of EaeI 3, 4 : KK genotype (491 bp only). enzyme for 5 hours at 37ºC in water bath. The and Ganguly et al. (2013) as they obtained very high digested products were detected by electrophoresis allelic frequency of DGAT1 K allele (0.97) in different in 2% agarose gel in 1X TBE buffer and eithidium cattle breeds. Tantia et al. (2006) also reported ixed bromide (10 mg/µl). DGAT1 K allele in six cattle (Bos indicus) and ive Statistical analysis buffalo (Bubalus bubalis) breeds of India. In contrast, The data was generated by estimating the in several studies the frequency of K allele was frequencies of different ampliied products. The ranged from 0.27 to 0.65 in Holestein irisian cattle allelic frequency and genotypic frequencies of (Nowacka-Woszuk et al. 2008). There are several DGAT1 gene was estimated by standard procedure reports indicating that DGAT1 K allele is signiicantly (Falconer and Mackay, 1996). associated with high fat yield, fat and protein RESULTS AND DISCUSSION percentage as well as decrease in milk production The PCR of screened samples revealed 491 bp and protein content (Tabaran et al. 2015). product by performing agarose gel electrophoresis. In the present study, we observed absence of K232A The EaeI/PCR-RFLP assay of the 491 bp PCR product polymorphism of exon 8 region of DGAT1 gene in showed the presence of KK genotype with a Hariana and Sahiwal cattle, consequently we could not genotypic frequency of 100% (Figure 1). KA and AA establish any association between genotype and milk genotype were not found in the screened samples production trait because in these cattle DGAT1 K allele and had zero genotypic frequency. The KK genotypic were found ixed. Further investigations in large frequency were found almost similar to inding of population of these cattle may be useful for studying Kaupe et al. (2004) in Nellore (99%), white Fulani the status of this allele/SNP in order to exploit it for (92%); Lacorte et al. (2006) in Brazilian breeds marker assisted selection for milk traits in cattle. Nellore (100%), Guzerat (100%), Red Sindhi (95%), ACKNOWLEDGEMENT Gyr (94%) and Ganguly et al. (2013) in Sahiwal The Instructional Livestock Farm Complex (ILFC), (96%) cattle breed. DUVASU, Mathura (U.P.) is gratefully acknowledged for In the present study, the allelic frequency of DGAT1 K providing help during sample and data collection. The allele was calculated as 1.0 and that of DGAT1 A allele authors are thankful to Vice Chancellor, DUVASU, was zero. The results were almost similar to the Mathura, (U.P) for providing necessary facilities during reports of Kaupe et al. (2004); Lacorte et al. (2006) entire research work at this esteemed university.

17 Volume 6 Number 1, 2016 REFERENCES yield and composition. Genome Research 12: Falconer DS and Mackay TFC. 1996. An Introduction 222–231. to quantitative genetics. 4th ed. Songman Kaupe B. Brandt H, Prinzenberg EM and Erhardt G. Ltd. Esser, England. 2007. Joint analysis of the inluence of Ganguly I , Kumar S, Gaur GK, Singh U, Kumar A, CYP11B1 and DGAT1 genetic variation on Kumar S et al. 2013. DGAT1 polymorphism milk production, somatic cell score, K232A in Sahiwal (Indian Zebu) and Frieswal conformation, reproduction, and productive (Holstein Friesian X Sahiwal crossbred) lifespan in German Holstein cattle. Journal cattle. Indian Journal of Animal Research 47: of Animal Science, 85: 11-21. 360-363. Lacorte GA, Machado MA, Martinez ML, Campos AL, Grisart B, Coppieters W, Farnir F, Karim L and Ford C. Maciel RP, Verneque RS et al. 2006. DGAT1 2002. Positional candidate cloning of a QTL K232A polymorphism in Brazilian cattle in dairy cattle: identiication of a missense breeds. Genetics and Molecular Research, 5: mutation artiicial selection in cattle in the 475-482. bovine DGAT1 gene with major effect on milk

18 Volume 6 Number 1, 2016 Physical features and management of migratory Nari cattle population of Rajasthan PK Singh*, RK Pundir, D.K. Sadana and H.S. Rathore1 National Bureau of Animal Genetic Resources, Karnal, Haryana 132 001

ABSTRACT The Nari cattle are maintained as migratory herds in Pali and Sirohi districts of Rajasthan. In this study phenotypic characterization of the Nari cattle was carried out through systematic survey in its breeding tract and the breed descriptors were developed for its registration as a distinct breed. The population of Nari cattle in the breeding tract is expected to be more than 50,000. Nari cattle have compact body and are strong and active. The cows are generally white or grey in coat colour; the bulls are white, dark grey or black in colour. Biometry of 354 animals, which included nine different body measurements in different age and sex groups, was recorded. When compared with Kankrej breed of cattle, the body measurements viz. body length, height at withers, chest girth and paunch girth of Nari cattle are lower. The average horn length of Nari cattle was 51.68 cm, which is more than Kankrej and other indigenous cattle breeds. The circumference of horn at base is larger in Kankrej cattle than in Nari. This indicated that Nari cattle may be having the longest horn compared with all the indigenous cattle breeds of India. The animals are kept in big herds with size varying from 20-100 animals under pastoral production system as well as under extensive production system as stationary herds. The average age at irst calving was 3.5 to 4.5 years with a calving interval of 1.25 to 2 years. On an average the bulls start mating at the age of 3.0 to 3.5 years and used for breeding up to around 10 years of the age. The life span of the animals was around 20 years with life time number of calvings of 8-10. It was observed that the peak milk yield of Nari cows ranged from 3 to 8 kg. Animals of this breed are playing a signiicant role in the rural livelihood of Raika community in terms of milk and bullocks power for agricultural operations. This cattle population has not been included in the list of recognized cattle breeds of India. The unique physical features, biometry and their production system makes Nari cattle population as having distinct identity, therefore, may be registered as a new cattle breed of India. Keeping in view the declining population status of Nari cattle, there is a need to take up sustainable measures for its genetic improvement and conservation Key Words: Biometry, Performance, Population status, Nari, cattle, characterization. Present address: 1LPPS, Sadri, Pali, Rajasthan *Corresponding address : [email protected]

INTRODUCTION besides, the dual purpose breeds like Hariana, Rajasthan is the sixth largest state of India with Mewati and Malvi and the good quality draught respect to cattle population and possesses about breed i.e. Nagori. Four ifth of the milk produced by 6.1% (12.12 million) of total cattle population of the cattle (about 80.1%) is contributed by indigenous country (199.08 million). The cattle population of cattle breeds and non-descript cows. Though the this state may further be categorized as 43.62% of proportion of non-descript cattle in Rajasthan purebreds, 1.01% graded indigenous, 48.64% non- (48.64%) is well below the national proportion of descript indigenous and 6.73% exotic/crossbreds. 69.65%, some more cattle population of the state As per the milk production statistics, Rajasthan is may deserve the status of a breed but so far kept contributing 10.6% (13.51 million tonnes) of the under the non-descript category due to lack of any national milk production in 2012 (127.90 million systematic attempts for their characterization. One tonnes). The milk produced in Rajasthan is shared by such population locally known as Nari cattle was exotic/crossbred cattle, indigenous cattle, buffalo explored so as to characterize it phenotypically by and goats which are contributing 7.30, 29.46, 51.10 making systematic surveys in its native tract. and 12.14 percent, respectively to the total milk MATERIALS AND METHODS production of Rajasthan (2011-12). Indigenous The survey was undertaken in 8 villages of Bali tehsil breeds with good milk productivity viz. Gir, Rathi, in Pali district and 13 villages in 3 tehsils of Sirohi Tharparkar and Kankrej are reared in this state districts. During the survey 25 farmers of Bali and 33

19 Volume 6 Number 1, 2016 farmers of sirohi district were interviewed to collect word 'Nar' which means hills in the local parlance. information of management and performance of The breeding tract of Nari cattle is at the foothill area Nari cattle by using a predesigned questionnarie of Aravalli hills of Rajasthan, therefore it is called as developed for the purpose. A total of 344 animals Nari. The climate of the region is semi-arid tropical. were studied for the physical traits of the Nari cattle. Maximum temperature of the area may go up to 450C The morpho-metric measurements body length during hottest months i.e. April to June. Annual (BL), Height at withers (Height), Chest Girth (CG), rainfall in the area ranges from 300 to 668 mm. Paunch Girth (PG), Face Length (FL), Face width Maximum elevation of land in Pali and Sirohi districts (FW), Tail Length with or without switch (TLS and are 1099 and 1722 m, respectively. TL), horn length (HL), horn circumference (HC) and Population status ear length (EL) were recorded on 354 animals The population of Nari cattle is reported to be about belonging to different age groups and sexes. 50,000 in the two districts of Rajasthan state. The Production and reproduction performance traits herd size of Nari cattle varied from 20 to 100, bigger were obtained by interviewing their owners. The herds were seen in Sirohi district as compared to Pali. reproduction and production traits (age at irst The herd size was reported to be decreasing during calving, daily milk yield, lactation period, inter- last 2-3 decades mainly due to shrinkage in grazing calving period and number of inseminations per land. conception) were recorded on 66 lactating cows. The General management practices in rearing of Nari data collected from the study were compiled and cattle analyzed by using standard statistical procedures. The Nari cattle are mainly maintained by the Raika/ RESULTS AND DISCUSSION Rewari communities in Sirohi and Pali districts of Origin, geographical distribution and native Rajasthan. These communities are keeping these environment of the breed: herds as traditional business. As informed by a local At present Nari cattle are distributed in Bali tehsil of NGO, Bheel and Gujars maintained this breed in the Pali district and entire Sirohi district of Rajasthan past but presently Raika community is responsible for state (Figure 1). These locations lie on 24015' and maintaining this breed. In Bali tehsil the animals 25018'North latitude 72016' and 73028' East migrate to the hilly area of the Aravalli hills adjoining longitude. to Bali tehsil. In Sirohi district the Raika community This cattle population has historically been named as migrates along with their Nari herds in November/ 'Nari' by the community. Nari is derived from the December every year to Gujarat state due to unavailablity of adequate feed and fodder. They cover about 200 km of distance of migration and inally stay in the places like Himatnagar (Banaskantha) or Idar Kher Brahma. The onward journey is often completed in about 30 days. The community moves along with their families including non school going childern. During the migration, the luggage is carried over donkeys/ camels. Around 4-8 raika families join together to make the herd of approximately 400- 500 animals (Figure. 2) and 8-10 donkeys are required to carry their luggage and other goods. The return journey is completed in 8-10 days mostly after onset of rains i.e. July/ August. From August to October/ November, they stay in their villages. Some Nari herds were reported to migrate upto the state of Haryana. Figure 1. Geographical distribution of Nari cattle

20 Volume 6 Number 1, 2016 placenta was often removed in it natural course without human intervention. The practices like de- worming and de-horning were generally not observed in the management of Nari calves. Physical Characteristics Different parameters of physical characteristics of Nari cattle are presented as overall as well as seperately for the adult male, females and calves (table 1). The animals were strong and active with compact body. Cows were white or greyish white in Figure 2. Big herd of Nari cattle colour in majority of animals i.e. 96.39% and bulls When animals were not in migration, they were kept were either white (58.97%), greyish white (35.90%) under low input system of management. The animals or black (5.13%) (Figure 3 & 4). Face was moderate were sent for grazing in forest or harvested in length (44.01 and 46.22 cm in cows and bullocks, agricultural ields from morning till evening. The respectively) and width (14.35 and 15.58 cm in cows grazing hours was generally 9 a.m. to 6 p.m. during and bullocks, respectively), muzzle was black (64.1% which the herds covered about 2-3 km distance. The in bullocks and 76.72% in cows) in majority of supplementary feeding to the animals was observed animals but sometimes carroty (30.77% in bullocks in the herds and animals were offered dry and green and 6.89% in cows) or mixed (5.13% in bullocks and fodder by the farmers especially to the lactating 16.39% in cows) in colour. Forehead was fairly cows. Some farmers offered 1-2 kg concentrate to broader and slightly concave. Neck was short and their lactating cows. The calves up to 3 months of age stout. Horns were generally wide-spread, long, thick were not allowed to go for grazing and kept solely on at bottom and pointed at tips. The shape of horns dam's milk. The feeding of the calves was directly varied from straight (15.7%), curved (51.45%) and from the teats. The farmers allowed the calves to spirally curved (32.85% cases). The overall suckle the colostrum. The breeding method opted by orientation of horns was mostly outward (51.74%) farmers was natural mating. About 2 to 5 bulls were but forward and outward & forward orientations available in the herds depending on the size of herd were also observed in 25.29% and 22.97% cases, (Figure. 2). The young males started their irst service respectively. It was interesting to note that the horns at the age of 3.0-3.5 years of age and used for breeding of males were mostly forward in orientation (59%) up to the age of 10 years. The bulls were selected on the whereas, the females had the horns mostly outwards basis of their physique and conformation. The (55%). The orientation of horns in this population

Figure 3. Nari cow Figure 4. Nari bull

21 Volume 6 Number 1, 2016 was found to be unique and different from Kankrej were also observed in some cases especially in males. cattle and other long horn cattle breeds of Southern Dewlap was large in majority of cows as well as India. The colour of horn was generally grey/ bullocks/ bulls. The naval lap was also large in blackish. Majority of cows and bullocks/ bulls majority of cases (68.42%) and penis sheath lap was possessed large and well developed hump (82.95% large in all the Nari animals studied in the breeding in cows and 66.67% in bullocks/ bulls). Colour of tract. The shape of udder was found to be bowl shape eyelid and hooves were generally black. The ears in majority of cases whereas, 54.72% cows had were short, erect and horizontal in orientation in cylindrical and funnel shape teats. The teat tips were maximum cases, however, slightly drooping ears pointed in 45.28% cases and round in 54.72%. Tail

Table 1. Physical traits of Nari cattle in different age and sex groups Number of animals (% with in group) Trait Class Adult Male Adult Femal Over All Coat Colour Black 2 (5.13) 4 (1.31) 6 (1.74) White 23 (58.97) 245(80.32) 268(77.91) Greyish white 14 (35.90) 49 (16.07) 63 (18.31) Red 0 (0) 7 (2.30) 7 (2.04) Muzzle Colour Black 25 (64.10) 234 (76.72) 259(75.29) Pinkish 12 (30.77) 21 (6.89) 33 (9.59) Mixed 2 (5.13) 50 (16.39) 52(15.12) Tail Colour Black 28 (71.79) 177 (58.03) 205 (59.59) Creamy 4 (10.26) 88 (28.85) 92(26.74) Mixed 7 (17.95) 40 (13.12) 47 (13.67) Horn Colour Black 15 (38.46) 126 (41.31) 141 (40.99) Creamy 2 (5.13) 9 (2.95) 11 (3.20) Mixed 22 (56.41) 170 (55.74) 192 (55.81) Horn Shape Curved 18 (46.15) 95 (31.15) 113 (32.85) Spirally Curved 10 (25.64) 167 (54.75) 177 (51.45) Straight 11 (28.21) 43 (14.10) 54 (15.70) Horn Orientation Forward 23 (58.97) 64 (20.98) 87 (25.29) Outwards 10 (25.64) 168 (55.08) 178 (51.74) Forward & Outwards 6(15.39) 73 (23.94) 79 (22.97) Ear Orientation Horizontal 23 (58.97) 273 (89.51) 296(86.05) Slightly drooping 16 (41.03) 32 (10.49) 48 (13.95) Drooping 0 (0.00) 0 (0.00) 0 (0.00) Hump Large 26 (66.67) 253 (82.95) 279 (81.10) Medium 13(33.33) 49 (16.07) 62(18.02) Small 0 (0.00) 3 (0.98) 3 (0.88) Dewlap Large 39 (100.00) 293 (96.06) 332(96.51) Medium 0 (0.00) 12 (3.94) 12 (3.49) Naval lap Large - 91 (68.42) - Medium - 28 (21.05) - Small - 14 (10.53) - Penis sheath lap Large 39 (100.00) - - Udder Shape Bowl - 50(94.34) - Round - 3 (5.66) - Teat shape Cylinderical 29 (54.72) - Funnel 24 (45.28) - Teat tip Pointed 24(45.28) - Round 29 (54.72) -

22 Volume 6 Number 1, 2016 was broader at base and tapered towards the end. It Pundir et al (2011) estimated the above biometrical was long with large tuft of hair, black in colour. Basic parameters of 407 Kankrej cows in Palanpur district temperament of animals was found to be docile. of Gujarat and reported higher estimates than that of Morpho­metric measurements Nari cows obtained in the present study. The horn The height at withers, body length, chest girth, length of Nari cows estimated in this study was 51.68 paunch girth, horn length, horn circumference, ear cm, which was higher than Kankrej cows but the horn length, face length, face width and tail length with circumference obtained in this study was lower than and without switch were recorded in 354 animal of that of Kankrej cows as reported by Pundir et al ive age/sex groups. The means along with their (2011). This indicates that Nari cows are smaller in s t a n d a r d e r r o r s o f n i n e d i ff e r e n t b o d y body conformation with longer but thinner horns as measurements for all the ive groups are presented in compared to Kankrej cows found in same or table 2. The height at withers, body length, chest adjoining area. The horn length of southern Indian girth, paunch girth were obtained as 120.87, 119.30, cattle breeds like Hallikar as 35.78 cm by Singh et al 153.00 and 166.90 cm, respectively in cows. The (2008), Bargur as 35.2 cm by Pundir et al (2009), corresponding values for bullocks were estimated as Khillar as 46.31 cm by Gokhale et al (2009) and 130.59, 129.22, 175.16 and 185.84 cm, respectively. Pulikulam as 37.22 cm by Singh et al (2012) were

Table 2. Morphometric traits of Nari cattle in different age and sex groups Figures in parentheses indicate range Age/Sex Groups Parameters Cows Bullocks Heifers Young males Calves below (N=175) (N=27) (1-3 years of age) (1-3 years of age) 1 year (N=84) (N=54) (N=14) Height at withers 120.87±0.29 130.59±1.43 108.39±1.05 100.57±1.82 89.12±0.93 (112-131) (121-154) (89-128) (89-116) (68-111) Body Length 119.30±0.37 129.22±1.21 102.50±1.03 89.21±2.10 79.95±0.86 (108-134) (120-150) (88-120) (76-109) (56-97) Chest Girth 153.00±0.56 175.16±2.18 128.37±1.79 111.86±2.77 96.81±1.31 (137-177) (159-207) (104-161) (101-136) (64-125) Paunch Girth 166.90±0.73 185.84±1.92 134.83±1.90 115.71±2.69 101.01±1.58 (135-198) (170-216) (106-172) (98-134) (66-132) Horn Length 51.68±0.70 55.56±1.69 - - - (33-76) (41-74) Horn Circumference 19.53±0.14 22.59±1.69 - - - (14-26) (19-27) Ear Length 27.01±0.12 28.89±0.20 24.26±0.25 24.79±0.87 21.98±0.25 (17-30) (27-32) (20-28) (22-35) (15-26) Face Length 44.01±0.16 46.22±0.0.46 37.17±0.44 33.00±0.88 28.55±0.35 (39-52) (43-53) (29-45) (28-40) (19-38) Face Width 14.35±0.07 15.58±0.23 12.85±0.12 11.93±0.32 10.77±0.14 (12-17) (14-19) (11-15) (10-14) (7-15) Tail Length 92.63±0.52 98.26±1.08 77.19±1.49 67.69±1.94 59.30±1.05 (72-111) (90-116) (60-104) (56-83) (35-93) Tail Length 116.40±0.50 124.30±1.20 92.98±1.96 83.43±3.13 70.15±1.05 with Switch (100-132) (117-138) (75-123) (68-114) (40-97)

23 Volume 6 Number 1, 2016 lower than that of horn length of Nari cattle obtained animals. Therefore, this population needs to be in the present study, which clearly indicated that the registered as a recognized distinct cattle breed of horn of Nari cattle is perhaps biggest in all the Indian India. Keeping in view the declining population cattle breeds. The face length of Nari cows (44.01cm) status of the breed, there is a need to take up are comparable with Kankrej cows (44.09 cm) as sustainable measures for the improvement and reported by Pundir et al (2011). The tail length of conservation of this population. A nucleus herd may Nari cows as obtained in the present study was be established in the breeding tract for production of slightly higher than that of Kankrej cows (Pundir et bull calves and studies on the qualities of the Nari al, 2011). The biometrical parameters of Nari cattle cattle specially the disease resistance, tolerance of revealed that this cattle population is different from hot and humid climatic conditions in open housing Kankrej and other cattle found in Pali and Sirohi system may be initiated. Shrinkage in grazing land districts of Rajasthan and deserve a status of a distict area and unavailability of adequate drinking water breed of cattle of Indian origin. are major constraints which are adversely affecting Performance the population status of the breed. These problems The milk yield of the Nari cows varied from 3 to 8 kg should be well addressed by the Forest and Animal per day with an average of 5.36 kg per day. The age at Husbandry departments of state government. A sexual maturity in males was about 3.0 to 3.5 years Breed Society may also be established for protecting and age at irst calving of cows was between 3.5 to 5.0 the interest of the owners of this breed. years of age. On an average 8-10 calvings in a life span ACKNOWLEDGEMENT of 20 years were observed in the herds. The cows in The authors are thankful to the Director, National the herd showed good reproductive health and Bureau of Animal Genetic Resources, Karnal for repeat breeding was to the extent of maximum 3% providing necessary facilities to the project and only. The lactation length varied from 9 months to 15 Department of Animal Husbandry, Rajasthan months depending upon sex of calves, less in male especially Veterinary Oficers of Sirohi district for calves and more in female calves. The inter-calving their help during the survey. period varied between 15 to 24 months. REFERENCES The animals are adapted to hot climate in the areas of Gokhale S.B., Bhagat R.L., Singh P.K. and Singh Gurmej foothills of Aravalli and perform better than other .2009. Morphometric characteristics and utility cattle breeds in that area. The animals can well pattern of Khillar cattle in breed tract. The survive on grazing and in the open housing system in Indian Journal of Animal Sciences 79: 47-51. all kinds of weather. These animals are contributing Pundir R K, Kathiravan P, Singh P K and Manikhandan signiicantly in the livelihood of Raika community in V A .2009. Bargur cattle: status, characteristics terms of medium to moderate milk production and and performance. The Indian Journal of Animal bullocks. The animals are more resistant to Sciences 79: 681-685. communicable and parasitic diseases as compared to Pundir R K, Singh P. K., Singh K. P. and Dangi P. S. crossbreds in that area under hot and humid climate. 2011.Factor analysis of biometric traits of Kankrej cows to explain body conformation. The bullocks of this breed are active and well suited Asian-Aust. J. Anim. Sci. 24: 449 – 456 to agricultural operations and local transport but Singh P.K., Pundir R.K., Ahlawat S.P.S., Naveen Kumar due to mechanization of agriculture, the farmers S., Govindaiah M.G., Asija K. 2008. Phenotypic generally sell the male calves at the age of 1 to 2 years characterization and performance evaluation to the farmers/ businessmen coming from Madhya of Hallikar cattle in its native tract. The Indian Pradesh and Gujarat states. Adult bullock pair of Nari Journal of Animal Sciences 78:211-214. cattle costs about Rs. 20 - 25 thousand. Singh P.K., Pundir R.K., Kumarsamy P. and Recommendations and conclusions Vivekanandan P. 2012. Management and physical features of migratory Pullikulam Nari cattle population is a unique population in cattle of Tamil Nadu. The Indian Journal of terms of the physical feature and management of the Animal Sciences 82:1587-1590.

24 Volume 6 Number 1, 2016 Characterization of sequence variation in caprine growth hormone gene and its association with milk production traits in two Indian goat breeds Satpal Dixit*, Sandeep Kumar, Manoj Kumar Vyas1, M K Singh1, O.P. Pathodiya2, Anurodh Sharma, and S Jayakumar ICAR-National Bureau of Animal Genetic Resources, Karnal 132 001 (Haryana) India ABSTRACT

Genetic polymorphism in complete caprine growth hormone (GH) gene was investigated by screening 309 DNA samples of both sexes belonging to two Indian goat breeds namely Jamunapari (140) and Sirohi (169) using PCR - single strand conformation polymorphism (SSCP) and DNA sequencing. Twenty four SNPs located in promoter (C160A G164A, T193C), intron 1 (C400T, A497G, G499A and G563A), exon 2 (G781A), exon 3 (G1121A, C1148T, G1170A), intron 3 (G1212T, G1284C), exon 4 (G1442A, A1532G, G1551A, G1578C and C1585T), intron 4 (G1602C), exon 5 (G1938C, G1956C, G2049C, G2058C) and 3 UTR (T2197A) regions were identiied. All the identiied SNPs were analyzed for association with different milk production traits. Out of all polymorphic loci analyzed, the SNP located at 781th bp of GH had signiicant effect on different milk production traits of Sirohi goats. Locus GH_164 and GH_1212 of GH gene were found to be signiicantly associated with milk production traits in Jamunapari goats. The SNPs at the caprine GH associated with the milk production traits may be used as markers in selection of goats for high milk yield.

Keywords: Markers, GH gene, SNP, Jamunapari, Sirohi Present address: 1Central Institute for Research on Goats, Makhdoom, Mathura, Uttar Pradesh, India-281122; 2Maharana Pratap University of Agriculture & Technology, Rajasthan, India *Corresponding author: [email protected]

INTRODUCTION MATERIALS AND METHODS Production traits of domestic animals are always of Animals and phenotypic data major concern in livestock especially in breeding for The data on Jamunapari (N=140) and Sirohi (N=169) its determinant economic value. Growth hormone goats were collected from the locks maintained at (GH) gene is the main regulator of milk production, Central Institute for Research on Goats (CIRG), postnatal somatic growth, stimulating anabolic Makhdoom, Mathura (U.P., India) and Livestock processes such as cell division, skeletal growth and Research Center, Vallabhnagar (Rajasthan). Milk yield protein synthesis (Katoh et al. 2008). Therefore, it has data at an interval of 90 and 140 days was collected. been widely used as candidate marker in several The protein, fat and solid not fat percentage of milk livestock species including cattle (Katoh et al. 2008), was estimated using electronic milk tester namely sheep (Marques et al. 2006), and goat (Malveiro et al. lactoscan (Bulgaria made). 2001; Hua et al. 2009; Wickramaratne et al. 2010; Blood samples collection and DNA extraction Zhang et al. 2011). Most of the studies on GH gene Approximately 8-10 ml blood was collected from polymorphisms and their association with production each animal in EDTA coated vacutainer tubes and traits have been conducted mainly in Cattle. There are stored in deep freezer at -20oC till DNA isolation. few reports on polymorphisms in entire GH gene and Genomic DNA was isolated using standard their association with traits of economic importance procedure of proteinase-K digestion (Sambrook et in goats. Hence, the objectives of present study were al. 1989). After checking the quality and quantity of to identify single nucleotide polymorphisms (SNPs) genomic DNA, it was diluted to a inal concentration in entire GH gene and to determine their inluence on of 50-100 ng /µl in nuclease free water and stored at milk production traits of Jamunapari and Sirohi 4°C for further use. goats.

25 Volume 6 Number 1, 2016 Table 1. Fragment location, primer sequence and annealing temperature & details of primers used in amplifying growth hormone gene Location Primer sequence (5'-3') Amplicon Size (bp) Annealing Temp (0C) Promoter 5' (13-363 bp) F - cccagggattaaacctgagtc 325 63.0 R - ctctgctgggccctttttat 5'-U-E1-I1(345-693 bp) F - gggggaaagggagagagaag 379 64.0 R - ccctagggagagaccaggag I1-E2-I2 (674-1030 bp) F – gatcaggcatccagctctct 396 60.0 R – tcactgccttattcggaacc I2-E3-I3 (1011-1344 bp) F - ggttccgaataaggcagtga 449 63.5 R - caccaccaccaaccatcat I3-E4-I4 (1326-1667 bp) F - ccaccaaccacccatctgcc 214 60.0 R - gaagggaccaagaacgcc I4-E5-D(1648-2012 bp) F - ctagcagccagtcttgacc 388 56.0 R - ggggaggggtaacaacagat E5-3'-D(1993-2344 bp) F - ctgcacaagacggagacgta 352 58.0 R - tcacagagaaggggatgtgc 3'-D (2325-2506 bp) F - gcacatccccttctctgtga 182 56.0 R - cttcccactcttggaggcta

U = up stream E = exon, I = intron, D = downstream, bp = base pairs, F – Forward primer, R – Reverse primer

Primer synthesis and PCR ampliication software was used for formatting the sequences to Primers were designed based on published goat GH make them compatible with the other desired sequence (accession number D00476) by PRIMER3 softwares. The sequences were aligned with respect to s o f t w a r e a v a i l a b l e o n l i n e the complete goat reference sequence (Kioka et al. ( h t t p : / / f r o d o . w i . m i t . e d u / c g i b i n / 1989) downloaded from NCBI by using Clustal W primer3/primer3_www_slow.cgi). Eight sets of software (Thompson et al. 1997). The sequence data overlapping primers at 5' and 3' ends were designed to were then analyzed with Chromas Pro 1.49 amplify the complete GH gene sequence in the studied (http:/www.technelysium.com.au) and Blast 2.0 goat breeds (Table 1). Polymerase chain reaction was (Altschul et al. 1990) softwares for identiication of carried out in a inal reaction volume of 25 µl in SNPs. thermocycler (PTC-thermal cycler, MJ research, USA). Statistical analysis The annealing temperature of all the fragments Association between polymorphism of GH gene and ranged from 56-64˚C. The ampliied product was milk traits was analyzed using general linear model analyzed by electrophoresis on 1.5% agarose gel at of SPSS software (Version 8.0). The following model 100V for 20 minutes using ethidium bromide staining. was used to analyse the signiicant effect of genotype Single strand conformation polymorphism (SSCP) and of GH gene on milk traits. DNA sequencing Yijklmn= µ + Si + Tj + Ok + Gl + Pm + b (xijklm-x) + eijklmn SSCP analysis was carried out as per standard protocol th th Yijklmn = Milk traits of the n individual born in i season, (Orita et al. 1989). The samples showing unique band jth kidding type, kth kidding order, lth genotype and with pattern in SSCP gels for each investigated fragment mth sex. were selected for further DNA sequencing. The PCR th th xijklm= Weight of doe of n individual in i season, product of 10 µl of each unique sample was puriied jthkidding type, kth kidding order, lth genotype and with with PCR puriication kit (Labmate) and was mth sex sequenced with ABI 3100 automated DNA sequencer µ = Overall mean (Applied Biosystem). The “Edit seq”of DNA star

26 Volume 6 Number 1, 2016 th Si = Fixed effects of i seasons Jamunapari goats were monomorphic at the promoter th (160 bp, 164bp), intron 1 (400bp) while Sirohi breed Tj = Fixed effects of j kidding type O = Fixed effect of kth kidding order was observed monomorphic at intron 1 (497bp, k 499bp, 564bp) and exon 3 regions (1121-1170bp). G = Fixed effect of lth genotype l Our results are consistent with polymorphism at 781, Pm= Fixed effect of mth sex 1148, 1532 and 1585bp reported in other locks such b = Regression coeficient of milk traits on doe's as Chengdu-Ma, Boer, Savanna and Kalahari goats (Li weight at kidding et al. 2004, Hua et al. 2009, Amie Marini et al. 2012). RESULTS AND DISCUSSION The exon 1 region in the present study was Polymorphisms of GH gene homozygous and monomorphic which was consistent with the reports on other Indian goat breeds The complete growth hormone gene was ampliied (Wickramaratne et al. 2010) as well as in sheep (Oir R using eight overlapping fragments. SSCP analysis & Gootwine E 1997). revealed 1 to 5 distinct variants across the different fragments. The polymorphism observed in both the Effect of GH genotypes on milk production traits breeds has been presented in Table 2. A total of twenty Three out of twenty four investigated SNPs inluenced four SNPs located in promoter (C160A G164A, the milk traits of Jamunapari and one of twenty four in T193C), intron 1 (C400T, A497G, G499A and G563A), the Sirohi goats (Table 3, 4). Locus G164A signiicantly exon 2 (G781A), exon 3 (G1121A, C1148T, G1170A), inluenced the milk yield at 90, 140 days and total milk intron 3 (G1212T, G1284C), exon 4 (G1442A, A1532G, yield and effect was non-signiicant on rest of the G1551A, G1578C and C1585T), intron 4 (G1602C), studied traits in Jamunapari goats (Table 4). The locus exon 5 (G1938C, G1956C, G2049C, G2058C) and 3 explained 3.7% (Milk yield at 140 days) to 4.2% (milk UTR (T2197A) regions were identiied. To our best yield at 90 days) of the phenotypic variability for milk. knowledge, all the SNPs except four ones at 781, 1148, The animals with genotype GA yielded more milk 1532 and 1585bp are novel ones in Indian goats. In our compared to the animals with genotype GG by 18.99, earlier study on Osmanabadi and Sangamneri breeds 17.83 and 18.21% at 90, 140 days and total milk yield, of goat (Wickramaratne et al. 2010), SNPs at 164, respectively. Locus G164A of Sirohi breed was 193, 497, 499, 1551, 1578 and 1585bp of GH gene polymorphic but no pattern was signiicantly were also detected (Wickramaratne et al. 2010). associated with any of the traits (Table 4).

Table 2. The location and polymorphism detected in growth hormone (GH) gene of Sirohi and Jamunapari breeds of goats

Fragment Region Nucleotide Sequence Sequence2 Reference Breeds Remark2 Amino Position change sequence Acid change/ codon number Sirohi Jamunapari

5'UTR (13-364) 5'UTR 160 C/A GCCATCA GCCCTCA + - Tv 164 G/A TCAAGCT TCAGGCT + + Ts 193 T/C TGACGAG TGATGAG + + Ts

E1- I1 (315-693) Intron1 400 C/T AGATGAC AGACGAC + - Ts 497 A/G GGGGGAA GGGAGAA - + Ts 499 G/A GAGAACT GAGGACT - + Ts 564 G/A TCTACAC TCTGCAC - + Ts

I1-E2-I2 Exon 2 781 G/A TCCAGCC TCCGGCC + + Ts Ser-Gly (635-1030) (S-G)/35

27 Volume 6 Number 1, 2016

I2-E3-I3 Exon 3 1121 G/A CCAAAAC CCAGAAC - + Ts No (1011-1344) Change AA / 72 1148 C/T CTCTGAA CTCCGAA - + Ts No Change AA / 81 1170 G/A ACGAGCA ACGGGCA - + Ts Gly-Ser G-S / 89 Intron 3 1212 G/T CTATGAC CTAGGAC + + Tv 1284 G/C GGCCTTC GGCGTTC + + Tv

I3-E4-I4 Exon 4 1442 G/A TTCACAT TTCGCAT + + Ts (1318-1754) Arg-His (R-H) / 103 1532 A/G CGGGCCG CGGACCG + + Ts Asp-Gly (D-G) / 133 1551 G/A GCTAAAG GCTGAAG + + Ts No Change AA / 139 1578 G/C GGCCCTG GGCGCTG + + Tv No Change AA/148 1585 C/T ATGTGGG ATGCGGG + + Ts Arg-Try (R-W) / 151 Intron 4 1602 G/C GTTCTTG GTTGTTG + + Tv

I4-E5-I5 Intron 4 1831 -/C GCCCTTC GCC-TTC + + In Insertion (1706-2093 Exon 5 1938 G/C GCGCAGT GCGGAGT + + Tv No Change AA / 176 1956 G/C GCTCAAG GCTGAAG + + Tv] No Change AA / 182 2049 G/C GGCCAGC GGCGAGC + + Tv No Change AA/213 2058 G/C CGCCTTC CGCGTTC + + Tv No Change AA / 216

E5-3'UTR 3 UTR 2088 C/- ACCC-TCC ACCCCTCC + + Del Deletion (1993-2344) 2197 T/A TTCAAGG TTCTAGG + + Tv

Downstream 3' 3down Monomorphic + + (2325-2506) region stream a Nucleotide change observed(bold) when aligned with exotic sequence (Accession No. D00476), no nucleotide changes within the population in both the breeds. b (+)Nucleotide variation detected in that breed, (-) Not detected; c AA-Amino acid, Gly-Glycine, Ser- Serine, Arg- Arginine, His- Histine, Asp-Aspartate, Try- Tyrosine ; d Ts : Transition, Tv: Transversion

28 Table.3: Least-square analysis of different milk production traits of various genotypes of GH gene in Jamunapari goats

Position Fragment Genotypes(N) Fat (%) Protein (%) Lactose (%) SNF (%) 90DMY (l) 140DMY (l) TMY (l) LL (days)

GH_164 G/A 5'UTR N.S N.S N.S N.S S S S N.S GA (103) 3.58±0.32 3.46±0.06 5.09±0.09 9.40±0.18 84.21±4.08a 123.07±5.69a 148.52±7.15a 198.43±3.86 GG (37) 3.87±0.38 3.36±0.07 4.95±0.11 9.10±0.21 70.77±4.90b 104.44±6.83b 125.64±8.58b 197.74±4.64 P value 0.038 0.039 0.043 R 2 Value 4.26 3.70 3.18 GH_1148

29 C/T Exon 3 N.S N.S N.S N.S N.S S S N.S CT (55) 2.71±0.53 3.47±0.10 5.11±0.16 9.42±0.30 92.16±7.31 141.33±10.19a 177.11±12.69a 201.60±6.63 GT 3.15±0.49 3.42±0.05 5.07±0.15 9.34±0.28 94.17±6.77 139.23±9.44b 172.56±11.75b 208.11±6.14 TT (62) 3.73±0.26 3.42±0.05 5.04±0.08 9.30±0.15 78.62±3.58 115.68±5.00b 138.60±6.22b 195.68±3.25 P value 0.019 0.004 R 2 Value 8.75 11.35 GH_1212 G/T Intron 3 N.S N.S N.S N.S S S S N.S GG (45) 2.94±0.33 3.45±0.07 5.11±0.11 9.41±0.20 94.30±4.96a 141.85±6.86a 177.51±8.81a 206.14±4.56 TT (55) 3.40±0.27 3.45±0.05 5.09±0.09 9.39±0.16 78.03±3.98b 116.41±5.51b 141.45±7.07ab 195.90±3.66 GT (40) 4.57±0.68 3.30±0.15 4.81±0.22 8.89±0.42 89.16±10.07b 127.55±13.94b 137.76±7.88b 199.83±9.26 P value 0.039 0.018 0.005 R 2 Value 7.42 8.83 11.50

Values with different superscripts in the same column are signiicantly different at P 0.05, N.S.= Non-signiicant, S-Signiicant, 90DMY = 90 Days milk V yield, 140DMY = 140 Days milk yield, TMY = Total milk yield, LL = Lactation length, N = Number of observation, SNF = Solid not fat, UTR= Untranslated olume 6Number1,2016 region, (l)-liter Volume 6 Number 1, 2016 Table 4.: Least-square analysis of different milk production traits of various genotypes of GH gene in Sirohi goats SNP Fragment Genotype (N) Fat (%) Protein (%) Lactose (%) SNF (%) LL TMY Exon 2 N.S. N.S. S S N.S. N.S. G781A GG (135) 5.44±0.91 3.27±0.08 4.75±0.12a 8.76±0.22a 152.81±0.91 95.91±2.66 AA (34) 4.23±1.10 3.52±0.10 5.15±0.15b 9.48±0.27a 153.44±1.11 96.31±3.23 P value 0.048 0.046 R 2 Value 4.56 4.66 Values with different superscript in the same column are signiicantly different at P ≤ 0.05, NS- Non-signiicant, S- Signiicant, N- Total number of animals with respective genotype, SNF-Solid not fat, TMY- Total milk yield, LL- Lactation length

RESULTS AND DISCUSSION Effect of GH genotypes on milk production traits Polymorphisms of GH gene Three out of twenty four investigated SNPs The complete growth hormone gene was ampliied inluenced the milk traits of Jamunapari and one of using eight overlapping fragments. SSCP analysis twenty four in the Sirohi goats (Table 3, 4). Locus revealed 1 to 5 distinct variants across the different G164A signiicantly inluenced the milk yield at 90, fragments. The polymorphism observed in both the 140 days and total milk yield and effect was non- breeds has been presented in Table 2. A total of signiicant on rest of the studied traits in Jamunapari twenty four SNPs located in promoter (C160A goats (Table 4). The locus explained 3.7% (Milk yield G164A, T193C), intron 1 (C400T, A497G, G499A and at 140 days) to 4.2% (milk yield at 90 days) of the G563A), exon 2 (G781A), exon 3 (G1121A, C1148T, phenotypic variability for milk. The animals with G1170A), intron 3 (G1212T, G1284C), exon 4 genotype GA yielded more milk compared to the (G1442A, A1532G, G1551A, G1578C and C1585T), animals with genotype GG by 18.99, 17.83 and intron 4 (G1602C), exon 5 (G1938C, G1956C, 18.21% at 90, 140 days and total milk yield, G2049C, G2058C) and 3 UTR (T2197A) regions respectively. Locus G164A of Sirohi breed was were identiied. To our best knowledge, all the SNPs polymorphic but no pattern was signiicantly except four ones at 781, 1148, 1532 and 1585bp are associated with any of the traits (Table 4). novel ones in Indian goats. In our earlier study on CONCLUSIONS Osmanabadi and Sangamneri breeds of goat The SNPs (G164A, G781A, C1148T, G1212T,) at the (Wickramaratne et al. 2010), SNPs at 164, 193, 497, caprine GH that has been found to be associated with 499, 1551, 1578 and 1585bp of GH gene were also the milk production traits may be used as markers in detected (Wickramaratne et al. 2010). selection of goats for superior milk quality and milk Jamunapari goats were monomorphic at the yield. However, as the study was based on a limited promoter (160 bp, 164bp), intron 1 (400bp) while sample size, reconirmation of indings is warranted Sirohi breed was observed monomorphic at intron 1 with an adequate sample size. The nucleotide (497bp, 499bp, 564bp) and exon 3 regions (1121- changes which were commonly detected in both the 1170bp). Our results are consistent with studied breeds need to be investigated in other polymorphism at 781, 1148, 1532 and 1585bp Indian goat breeds as well to conirm whether they reported in other locks such as Chengdu-Ma, Boer, are speciic only to Indian goat breeds. Further, the Savanna and Kalahari goats (Li et al. 2004, Hua et al. SNPs detected at the caprine GH gene might provide 2009, Amie Marini et al. 2012). The exon 1 region in useful information for the phylogeny of different goat t h e p re s e n t s t u dy wa s h o m o z yg o u s a n d breeds. monomorphic which was consistent with the reports REFERENCES on other Indian goat breeds (Wickramaratne et al. Altschul SF, Gish W, Miller W, Myers EW and Lipman 2010) as well as in sheep (Oir R & Gootwine E 1997). DJ. 1990. Basic local alignment search tool.

30 Volume 6 Number 1, 2016 Journal of Molecular Biology 215: 403-410. Yang LG. 2009. Polymorphism of the growth Amie Marini AB, Aslinda K, Moh. Hifzan R, Muhd hormone gene and its association with Faisal AB and Musaddin K. 2012. HaeIII- growth traits in Boer goat bucks. Meat RFLP Polymorphism of growth hormone Science 81(2): 391−395. gene in Savanna and Kalahari goats. Katoh K, Kouno S, Okazaki A, Suzuki K and Obara Y. Malaysian Journal of Animal Science 15:13- 2008. Interaction of GH polymorphism with 19. body weight and endocrine functions in Beckmann JS, Kashi Y, Hallerman FM, Nave A and Japanese black calves. Domestic Animal Soller M. 1986. Restriction Fragment Length Endocrinology 34(1): 25–30. Polymorphism among Israeli Holstein- Kioka N. Manabe E, Abe M, Hashi H, Yato M, Okuno M, Friesian dairy bulls Animal. Genetics 17: 25- Yamano Y, Sakai H, Komano T, Utsumi K and 38. Iritani A. 1989. Cloning and sequencing of C h i t ra R a n d A rav i n d a k s h a n T V. 2 0 0 4 . goat growth hormone gene. Agricultural Polymorphism at growth hormone gene in Biological Chemistry 53: 1583–1587. Malabari goats investigated by PCR-RFLP. Li MY, Pan QH, Pan YC, Shen W, Min LJ and Ren ZY. Indian Journal of Animal Sciences 74 (12): 2004. Polymorphism analysis of goat growth 1215-1218. hormone (GH) gene by PCR-RFLP. Journal of Cowan CM, Dentine MR. and Schuler LA. 1989. RFLP Laiyang Agricultural Colleague 21(1), 6–9 (in associated with growth hormone and Chinese, with English abstract). prolactin gene in Holstein bulls: evidence for Malveiro E, Pereira M, Marques PX, Santos IC, Belo C a novel growth hormone allele. Animal and Renaville R. 2001. Polymorphisms at the Genetics 20: 157-165. ive exons of the growth hormone gene in the Falaki M, Prandi A, Corradini C, Sneyers M, Gengler N, algarvia goat: Possible association with milk Massart S, Fazzini U, Burney A., Portetelle, D. traits. Small Ruminant Research. 41 (2): and Renaville, R. 1997. Relationship of 163–170. growth hormone gene and milk protein Marques MR, Santos IC, Carolino N, Belo CC, Renaville polymorphism to milk production traits in R, Cravador A. 2006. Effects of genetic Simmental cattle. Journal of Dairy Research polymorphisms at the growth hormone gene 64: 47-56. on milk yield in Serra da Estrela sheep. Hallerman EM, Nave A, Kashi Y, Holzer Z and Journal of Dairy Research. 73(4): 394–405. Beckman JS. 1987. Restriction fragment Oir R and Gootwine E. 1997. Ovine growth hormone length polymorphisms in dairy and beef g e n e d u p l i c a t i o n – s t r u c t u r a l a n d cattle at the growth hormone and prolactin evolutionary implications. Mammalian loci. Animal Genetics. 18: 213-222. Genome 8: 770–772. Hillbert P, Marcotte A, Schwers A, Hanset R, Vassart G Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. and Georges M. 1989. Analysis of genetic 1989. Detection of polymorphisms of variation in the Belgian Blue Cattle breed human DNA by gel electrophoresis as single- using DNA sequence polymorphism at the strand conformation polymorphism. growth hormone, low density lipoprotein Proceedings of the National Academy of receptor, α-subunit of glycoprotein Sciences 86: 2766–2770. hormones and thyroglobulin loci. Animal Sambrook J, Fritsch EF and Maniatis, T. 1989. Genetics 20: 383. Molecular Cloning: A Laboratory Manual, 2nd Hua GH, Chen SL, Yu JN, Cai KL, Wu CJ, Li QL, Zhang CY, Ed. Cold Spring Laboratory Press, Cold Liang AX, Han L, Geng LY, Shen Z, Xu DQ and Spring Harbour, NY.

31 Volume 6 Number 1, 2016 Theilmann JL, Skow LC, Baker JF, and Womack JE. Agricultural Research 21(4): 398 – 411. 1989. Restriction fragment length Yao J, Aggre SE, Zadworn D, Hayes JF and Kuhnlein U. polymorphisms for growth hormone, 1996. Sequence variation in the bovine prolactin, osteonectin, crystalline, Growth hormone gene characterized by ibronectin and 21-steroid hydroxylase in single strand conformation polymorphism cattle. Animal. Gentics. 20: 257. (SSCP) analysis and their association with Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, milk production traits in holsteins. Genetics. and Higgins DG. 1997. The CLUSTAL_X 144: 1809-1816. windows interface: Flexible strategies for Zhang C, Liu Y, Huang K, Zeng W, Xu D, Wen Q, and multiple sequence alignment aided by Yang L. 2011. The association of two single quality analysis tools. Nucleic Acids Research. nucleotide polymorphisms (SNPs) in growth 25: 4876–4882. hormone (GH) gene with litter size and

Wickramaratne SHG, Ulmek BR, Dixit SP, Kumar S superovulation response in goat-breeds. and Vyas MK. 2010. Use of Growth Hormone Genetics and Molecular Biology 34 (1): 49-55. G e n e P o l y m o r p h i s m i n S e l e c t i n g Osmanabadi and Sangamneri Goats. Tropical

32 Volume 6 Number 1, 2016 Genetic bottleneck effect and analysis of intra-population genetic diversity in Gaddi goat breed of Western Himalayas using microsatellite markers S Gurdeep Singh*, YP Thakur, RK Taggar, Amitoz Kaur, Dibyendu Chakraborty, Dhirender Kumar and Varun Sankhyan Department of Animal Genetics and Breeding, Dr. G. C. Negi College of Veterinary & Animal Sciences, CSKHPKV, Palampur, Himachal Pradesh, INDIA ABSTRACT

Genetic characterization of Gaddi goat breed was carried out with the objective to study the Bottleneck and genetic variability in the existing population. A reliable approach to measure the genetic distance between and within animal genetic resources is to estimate the difference in the frequencies of different genetic variants (alleles) at a number of marker loci. The breeds that share same alleles at similar frequencies are genetically closely related, whereas those having the same alleles at different frequencies or different allele's altogether are further apart. The variability within a breed can also be estimated by examining the number and frequency of alleles. In the present study, microsatellite markers based molecular genetic characterization of “Gaddi”, a goat breed native to north temperate western Himalayan region of India, was carried out to analyze existing intra population diversity. The multi-locus genotype data was generated on 51 Gaddi goats sampled across different locations of the breeding tract in Himachal Pradesh using 15 FAO recommended goat speciic microsatellite markers, which gave ampliication and observed and effective number of alleles, gene frequency, observed and expected heterozygosity were estimated. The screened loci were not found to be in accordance with Hardy Weinberg equilibrium for several microsatellite frequencies except INRABERN172 and

MAF065. The overall mean FIS (0.102 ± 0.02) ranged between -0.1406 (INRABERN-172) to 0.2527 (SPS113). The overall

mean FIS (0.102) observed in the present study indicated a 10.2 percent shortfall of heterozygosity in the population studied. The Ewens-Watterson test for neutrality indicated that observed F value of for 11 microsatellite loci except four (MAF70, ILSTS029, P19 (DYA) and SPS113) lied within the lower and upper boundaries of the 95% conidence region for expected F. The qualitative graphical method was employed to visualize the allele frequency spectra.The mode shift analysis revealed L-shaped curve conirming that the population had not experienced genetic bottleneck effect in recent past and is in mutation-drift equilibrium. Key Words: Gaddi, Characterization, Microsatellite, Ewens-Watterson, Genetic bottleneck *Corresponding author: [email protected] INTRODUCTION (Variable number Tandem repeats), STR (Short India is one of the world's largest mega biodiversity Tandem Repeats) and SSR (Simple Sequence centre gifted with rich genetic resources in terms of Repeats) or Microsatellites. The microsatellite loci its goat breeds. A breed is a genetic resource or could also prove highly informative markers for the geographically deined population. The breed can be construction of genetic linkage maps which could be deined and recognized as intraspeciic group, the used in search for quantitative trait loci associated members of which share particular morphological with economically important traits (Georges et al. characteristics that distinguish them from other 1995; Womack and Kata, 1995). Hundreds of such groups. The Genetic variation between and microsatellites are being characterized from the within the breeds also described as genetic diversity, bovine, ovine and porcine genomes and these is the raw material for animal breeders to act upon eventually led to the production of high density for bringing genetic improvement in livestock. The genetic linkage maps (Barendse and Armitage, 1994; population structure and genetic variation among Bishop et al. 1994; Eggen and Fries, 1995). The breeds have been studied using different markers availability of a wide range of microsatellites from including detection of polymorphism at DNA level livestock species has also generated interest in including such markers like RFLP (Restriction studies of variation and evolutionary relationships Fragment length polymerase), RAPD (Random among livestock populations and a number of such Ampliication of Polymorphic DNA), VNTR's studies (Buchanan et al. 1994; Forbes et al. 1995; Kim et al. 2002) have appeared in the literature. The

33 Volume 6 Number 1, 2016 present study was therefore undertaken to were resolved on 6 percent denaturing (urea) genetically characterize Gaddi goat germplasm using polyacrylamide gels along with 50 and 100 bp DNA suitable goat speciic microsatellite markers for ladders at 40-45W. Microsatellite alleles were analyzing the prevalent genetic diversity within visualized by silver staining. existing breed population, a pre-requisite for Statistical Analysis of Microsatellite data undertaking future genetic improvement and breed The microsatellite genotype data were analyzed conservation programme for the breed. using POPGENE version (1.3.1) software to calculate MATERIALS AND METHODS allele frequencies, observed and effective number of Collection of Blood Samples alleles, observed and effective heterozygosities and Seventy ive venous blood samples were collected at polymorphism information content in the random from genetically unrelated animals of either population. It was used to compute summary sex but different age groups of Gaddi goat breed from statistics (e.g., allele frequency, gene diversity, different locations of its natural breeding tract and genetic distance, F-statistics, multilocus structure adjoining areas of Palampur and other districts of etc.) for single-populations. The PIC was assessed Himachal Pradesh. using allelic frequencies evaluated according to Isolation of DNA samples (Botstein et al. 1980). Out of these, 51 samples with desired quantity and Hardy­Weinberg equilibrium and Linkage quality were further processed for DNA isolation by disequilibrium phenol-chloroform extraction method (Sambrook et The test for deviation from Hardy-Weinberg al. 1989). The quality of DNA was assessed through equilibrium was based on genotypic frequencies and 0.7 percent horizontal mini-submarine agarose gel Wright's ixation index (FIS) statistics using F-Stat electrophoresis. The purity of DNA was assessed by software (Goudet, 2002) and results were discussed calculating ratio of optical densities at 260 nm and and interpreted accordingly. The exact tests for 280 nm. The samples with OD ratio (OD260/OD280) deviations from Hardy-Weinberg equilibrium (HWE) ranging from 1.7 to 1.9 was used in subsequent were performed using the GENEPOP package experiments. (Raymond and Rousset, 1995). Primer prepartion Bottleneck analysis 15 FAO (DADIS MoDAD) recommended goat speciic The BOTTLENECK program (Cornuet and Luikart, microsatellite markers for genetic diversity analysis 1996) was applied to determine if there had been viz. ILSTS005, TGLA53, ETH10, OarFCB48, MAF70, past bottlenecks in population size at any locality. It ILSTS029, SRCRSP5, BM6444, INRABERN172, tests for the departure from mutation drift MAF065, DRBPP1, P19 (DYA), OarAE54, SPS113, equilibrium based on heterozygosity deicient or TRBV6, which gave ampliication were included in excess. The bottleneck compares heterozygosity the analysis. expected at Hardy-Weinberg equilibrium to the Processing of DNA Samples heterozygosity expected at mutation drift equilibrium in same sample that has the same size The microsatellite loci were ampliied in and same number of alleles. programmable thermal cycler (Bio-Rad, S 1000) after optimization. The PCR programme used RESULTS AND DISCUSSION involved initial denaturation at 940C for 3 minutes The overall allelic diversity, a reasonable indicator of and 30 cycles of denaturation at 940C for 30 seconds, genetic variation within the population displayed annealing for 45 seconds, extension at 720C for 45 high genetic variation in the breed and all 15 markers seconds and inal extension at 720C for 10 minutes. exhibited ample polymorphism for evaluating within Documentation of PCR product was done in 1.5 breed genetic variability. The measures of genetic percent Agarose Gel Electrophoresis at 2-5 V/cm. diversity estimated in Gaddi goat population under The PCR products for different microsatellite loci study are presented in Table 1. All 15 microsatellite

34 Volume 6 Number 1, 2016 Table 1. Measures of genetic diversity in Gaddi Goat breed of Western Himalayas

S. Locus name No. Size range Observed Expected Nei Average PIC No of allele heterozygosity heterozygosity heterozygosity 1 ILSTS005 6 172-218 0.6471 0.7983 0.7905 0.7905 0.758 2 TGLA53 9 126-260 0.7843 0.8903 0.8816 0.8816 0.8694 3 ETH10 8 200-210 0.7451 0.8569 0.8485 0.8485 0.8299 4 OarFCB48 7 149-173 0.7059 0.7793 0.7716 0.7716 0.7373 5 MAF70 7 134-168 0.7347 0.8390 0.8305 0.8305 0.8077 6 ILSTS029 7 148-170 0.6471 0.8344 0.8262 0.8262 0.803 7 SRCRSP5 5 156-178 0.7451 0.7659 0.7584 0.7584 0.7148 8 BM6444 10 118-200 0.8163 0.8473 0.8386 0.8386 0.8195 9 INRABERN172 9 234-256 0.9200 0.8147 0.8066 0.8066 0.7829 10 MAF065 9 116-158 0.7200 0.8487 0.8402 0.8402 0.821 11 DRBP1 15 195-229 0.8039 0.9128 0.9039 0.9039 0.8958 12 P19(DYA) 15 160-196 0.8824 0.9247 0.9156 0.9156 0.909 13 OarAE54 14 115-138 0.7200 0.8830 0.8742 0.8742 0.8263 14 SPS113 7 134-158 0.6200 0.8380 0.8296 0.8296 0.8061 15 TRBV6 7 217-255 0.7347 0.8132 0.8049 0.8049 0.7771 Mean 9 0.7484 0.8431 0.8347 0.8347 0.81052 S.E 0.82 0.02 0.01 0.01 0.01 0.01 loci that have been identiied to be polymorphic in conditions. domestic goats (Soranzo et al. 1999, Kim et al. 2002, The positive deviation from Hardy–Weinberg Ouai et al. 2002, Li et al. 2004, Dixit et al. 2008, Rout equilibrium indicated deviations from random et al. 2008 and Ramamoorthi et al. 2009) ampliied mating causing some studied loci to be homozygous successfully in Gaddi breed also. in these populations. This heterozygote deiciency

The overall mean FIS (0.102) observed in the present with mild inbreeding may be related to lock study indicated a 10.2 percent shortfall of management conditions like few does maintained heterozygosity in population studied, which was with continuous use of one or two breeding bucks comparatively lower than the heterozygote over longer duration. The mild FIS value indicated that deiciency reported in Ganjam goat (21.7 percent; some loci became homozygous presumably by Sharma et al. 2009), Gohilwari goat (26.4 percent; mating between relatives and consequent genetic Kumar et al. 2009), Kutchi goat (26 percent; Dixit et drift. Therefore, homozygous loci, relatedness and al. 2008) and Mehsana goat (14 percent; Aggarwal et population structure of the breeds, segregation of al. 2007). The mildly positive intra population non-amplifying (null) alleles, Wahlund effects inbreeding (FIS= 0.102±0.02) estimated in the (presence of population substructure), locus under present study indicated heterozygosity deicit or selection (genetic hitchhiking), scoring biases mild level of inbreeding. It generally happens when (heterozygotes scored incorrectly as homozygotes) population size is small and less gene exchange or inbreeding could be the most reasonable causes of occurs between it and other populations. The FIS mild heterozygote deicit as observed in present estimates ranged between -0.1406 (INRABERN-172) study. The mild inbreeding observed in the studied to 0.2527 (SPS113This level of inbreeding may be a population was in agreement with inbreeding values result of mild to moderate levels of mating between reported in some Europe and Middle east breeds (FIS closely related individuals under migratory = 0.10), Jamunapari (FIS=0.19), Mehsana (FIS=0.16),

35 Volume 6 Number 1, 2016

Mehsana (FIS=0.14) and overall FIS value of 0.183 The Ewens- Watterson test for neutrality indicated reported from all Indian goat breeds (Dixit et al. that observed F values for 11 of microsatellite loci

2012) including Gaddi goat (FIS value 0.22), which studied except for 4 loci (MAF70, ILSTS029, P19 were comparable to present indings. 14 out of 15 (DYA), and SPS113) lied within the lower and upper microsatellite loci studied, contributed to this deicit boundaries of 95% conidence interval region for of heterozygosity. expected F (Table 2). Similarly low inbreeding values were also reported The Chi-square (χ2) test for HW equilibrium revealed in 45 rare breeds of 15 European and Middle Eastern positive deviation from Hardy–Weinberg countries (Canon et al. 2006). On the other hand, some equilibrium at 13 microsatellite loci indicating that of the Indian breeds showed signiicant inbreeding samples were not drawn from large random mating such as Marwari (FIS=0.26) and Kutchi (FIS=0.23) population. The presence of low frequency null breeds. Similarly Fatima et al. (2008) depicted alleles segregating at these loci, Linkage between comparative low rate of inbreeding (-0.058, 0.057 and loci, sampling procedure, physical linkage, epistatic 0.070) of within population inbreeding coeficient selection and genetic hitchhiking could be the

(FIS) for Zalawadi, Gohilwadi and in Surti respectively. possible expected sources of the disequilibrium. The

Among the three breeds, the FIS values were highest for mode shift analysis revealed L-shaped curve for Surti breeds, possibly because of small population size. distribution of allelic frequencies indicating no These values relected low rate of inbreeding within mode-shift in the frequency distribution. This the populations as compared to 45 rare breeds of 15 conirms that the population had not experienced European and Middle Eastern countries reported by genetic bottleneck effect in the recent past and is in

Canon et al. (2006) (FIS = 0.10) which were comparable mutation-drift equilibrium. (Figure 1). with our indings in present study. Signiicant Genetic bottleneck effect heterozygote deiciency has also been reported in Microsatellite data were also subjected to statistical Marwari (F = 0.264) and Mehsani (F = 0.16) goat IS IS analysis to test whether the populations have breeds. Similarly Verma et al. (2010) reported undergone recent genetic bottleneck. Any signiicant positive F values from 0.118 (OarFCB304) IS population that experienced a recent bottleneck will to 1.0 (ETH225) with overall mean of 0.245.

Table 2. Ewens-Watterson test for neutrality in Gaddi goat population Locus n k Obs. F Min F Max F Mean* SE* L95* U95* ILSTS005 102 6 0.2395 0.1667 0.9068 0.4286 0.0209 0.2336 0.7662 TGLA53 102 9 0.1684 0.1111 0.8554 0.3071 0.0114 0.1676 0.5865 ETH10 102 8 0.1915 0.1250 0.8722 0.3462 0.0155 0.1820 0.6703 OarFCB48 102 7 0.2284 0.1429 0.8893 0.3789 0.0171 0.2051 0.7015 MAF70 98 7 0.1695 0.1429 0.8850 0.3672 0.0158 0.2041 0.6899 ILSTS029 102 7 0.1738 0.1429 0.8893 0.3774 0.0172 0.2084 0.7030 SRCRSP5 102 5 0.2716 0.2000 0.9246 0.4897 0.0265 0.2605 0.8687 BM6444 98 10 0.1614 0.1000 0.8332 0.2699 0.0085 0.1499 0.5010 INRABERN 172 100 9 0.1934 0.1111 0.8528 0.3022 0.0112 0.1656 0.5772 MAF065 100 9 0.1698 0.1111 0.8528 0.3067 0.0120 0.1654 0.5754 DRBP1 102 15 0.1158 0.0667 0.7632 0.1793 0.0030 0.1092 0.3212 P19(DYA) 102 15 0.0844 0.0667 0.7632 0.1774 0.0034 0.1061 0.3258 OarAE54 100 14 0.1258 0.0714 0.7738 0.1876 0.0036 0.1132 0.3392 SPS113 100 7 0.1704 0.1429 0.8872 0.3715 0.0168 0.2060 0.6990 TRBV6 98 7 0.2155 0.1429 0.8850 0.3784 0.0175 0.2099 0.7074

36 Volume 6 Number 1, 2016 show higher than expected (equilibrium) al. 2013) reported that the Najdi population of goat heterozgosity for a large number of loci. has not undergone bottleneck, as it suggests that any When a population goes through a bottleneck, rare unique alleles present in this breed may not have alleles tend to be lost and average number of alleles been lost and further Zaman et al. (2013) who analyzed bottleneck effect in Assam Hill Goat also revealed that the breed is non-bottle-necked where the mode-shift for the frequency distribution of alleles had a normal L-shaped curve stating that there was no recent and sudden reduction in the population. The present study revealed that the use of microsatellite loci can be effectively used for genetic characterization and diversity studies in Gaddi goats also. CONCLUSIONS

Figure 1. Mode shift analysis depicting absence of Overall there is mild to moderate heterozygous genetic bottleneck in Ardi goat, suggesting no deiciency at various loci indicating mild to moderate bottleneck in Gaddi goat. level of inbreeding in studied population. The analysis of studied microsatellite revealed high level per locus, or allelic diversity is reduced. of polymorphism and informativeness of markers for Heterozygosity, however, is not reduced genetic diversity analysis studies in Gaddi goats. The proportionally, because rare alleles contribute little signiicant variability relects that the existing Gaddi to heterozygosity. The qualitative graphical method goat population possess substantial genetic diversity (Cornuet and Leukart, 1996) was employed to with is good scope for bringing effective genetic visualize the allele frequency spectra. The improvement, conservation and designing future microsatellite alleles were categorized into 10 breeding policies for these goats. . Present study may frequency classes, which permits checking whether therefore be useful in characterization of local gaddi the scattering followed the normal L-shaped form, goat population and to study the genetic diversity where alleles with low frequency (0.01 – 0.1) were from the other recognized breeds which are mainly the most abundant. The mode shift analysis used for breeding in the adjacent area, and hence it exhibited no distortion of allelic frequency and L- will be helpful to develop strategies for conservation shaped curve with the L-shaped distribution of and utilization of to develop strategies for allelic frequencies indicating no mode-shift in the conservation and utilization of Gaddi goat breed but frequency distribution conirming that the Gaddi the study needs to be extended to include more goat breed had not experienced genetic bottleneck in microsatellites in a large sample size to further the recent past and is in mutation-drift equilibrium validate the results. as shown in Fig. 1. ACKNOWLEDGEMENTS The indings of present study were consistent with (Fatima et al. 2008) who reported non-signiicant This study was carried out with the support of heterozygote excess on the basis of IAM (Ininite CSKHPKV Palampur. The authors acknowledge the allele model), TPM (Two phase model) and SMM partial support and facilities provided by the other (Stepwise mutation model) as revealed from departments of institution. Wilcoxon sign-rank tests, along with a normal 'L'- REFRENCES shaped distribution of mode-shift test which Aggarwal RAK, Dixit SP, Verma NK, Ahlawat SPS, indicated no bottleneck in Zalawadi and Gohilwadi Kumar Y, Kumar S, Chander R and Singh KP. goat populations, whereas mild bottleneck in the 2007. Population genetics analysis of recent past for Surti breed. Similarly (Mahmoudi et Mehsana goat based on microsatellite

37 Volume 6 Number 1, 2016 markers. Curr. Sci., 92: 1133–1137. in congeneric mammals: domestic and Barendse W and Armitage SM. 1994. A genetic bighorn sheep. Mol. Biol. Evol., 12: 1106- linkage map of the bovine genome. Nat 1113. Genet., 6: 227-235. Georges M, Nielsen D, Mackinnon M, Okimoto R, Bishop MD, Kappes SM, Keele JW, Stone RT, Sunden Pasquino AT, Sargeant LS, Sorensen A, Steele SLF, Hawkins GA, Toldo SS, Fries R, Grosz MD, MR, Zhao X, Womack JE and Hoeschele I. Yoo J and Beattlie CW. 1994. A genetic linkage 1995. Mapping quantitative trait loci map for cattle. Genetics., 136:619-639. controlling milk production in dairy cattle by Botstein D, White RL, Skolnick M and Davis RW. 1980. exploiting progeny testing. Genetics., 139: Construction of a genetic linkage map in man 907-920. using RFLP. Am. J. Human Genet., 32: 324-331. Goudet J and Hered J. 2002. F-STAT version 2.9.3.2: a Buchanan FC, Adams LJ, Littlejohn RP, Maddox JF and program to estimate and test gene diversities Crawford AM. 1994. Determination of and ixation indices. F­stat., 86:485-486. evolutionary relationships among sheep Kim KS, Yeo JS and Choi CB. 2002. Genetic diversity of breeds using microsatellites. Genomics., 22: n o r t h - e a s t A s i a n c a t t l e b a s e d o n 397-403. microsatellite data. Anim. Genet., 33: 201- Canon J, Garcia D, Garcıa-Atance MA, ObexerRuff G, 204. Lenstra JA, Ajmone-Marsan, P and Dunner S. Kumar S, Dixit SP, Verma NK, Singh DK and Pande A. 2006. Geographical partitioning of goat 2009. Genetic diversity analysis of the diversity in Europe and the Middle East. Gohilwari breed of Indian goat (Capra hircus) Anim. Genet., 37: 327–334. using microsatellite markers. J. Anim. Vet. Sci., Cornuet JM and Luikart G. 1996. Description and 4(10.3844): 49-57. power analysis of two tests for detecting Li MH, Li K and Zhao SH. 2004. Diversity of Chinese recent population bottlenecks from allele Indigenous Goat Breeds: A conservation frequency data. Genetics., 144: 2001-2014. perspective. Asian­Aust. J. Anim. Sci., 17(5): Dixit SP, Verma NK, Ahlawat SPS and Aggarwal RAK. 726-732. 2008. Molecular genetic characterization of Mahmoudi B, Habibi R, Montazeri S and Babayev Sh Kutchi breed of goat. Curr. Sci., 95(7): 946- M . 2 0 1 3 . B o t t l e n e c k A n a lys i s a n d 952. Microsatellite Based Genetic Diversity in Dixit SP, Verma NK, Aggarwal RAK, Vyas MK, Rana J Najdi Goat Population. J Anim Sci Adv., 3(10): and Sharma A. 2012. Genetic Diversity and 544-550. Relationship among Indian goat breeds Ouai AT, Babilliot JM, Leroux C and Martin P. 2002. based on Microsatellite markers. Small Rum. Genetic diversity of the two main Moroccan Res., 105(1-3): 38-45. goat breeds: phylogenetic relationships with Eggen A and Fries R. 1995. An integrated cytogenetic four breeds reared in France. Small Rum. Res., and meiotic map of the bovine genome. Anim. 45(3): 225-233. Genet., 26: 215-236. Ramamoorthi J, Thilagam K, Sivaselvam SN and Fatima S, Bhong CD, Rank DN and Joshi CG. 2008. K a r t h i c k e ya n S M R . 2 0 0 9 . G e n e t i c Genetic variability and bottleneck studies in Characterization of Barbari goats using Zalawadi, Gohilwadi and Surti goat breeds of Microsatellite markers. J Vet Sci., 1: 73-76. Gujarat (India) using microsatellites. Small Raymond M and Rousset F. 1995. GENEPOP (version Rum. Res., 77(1): 58-64. 1.2): population genetics software for exact Forbes SH, Hogg JT, Buchanan FC, Crawford AM and tests and ecumenicism. J. Heredity., 86: 248- Allendorf FW. 1995. Microsatellite evolution 249.

38 Volume 6 Number 1, 2016 Rout PK, Joshi BM, Mandol A, Laloe D, Singh, L and Verma NK, Dixit SP, Aggarwal RAK, Dangi PS and Thangaraj K. 2008. Microsatellite based Joshi, BK. 2010. Phenotypic and genetic Phylogeny of Indian domestic goats. BMC characterization of sangamneri goat Gen., 9:11 breed. The Indian. J. Anim Sci., 80(11). Sambrook J, Fritsch F and Maniatis T. 1989. Womack JE and Kata SR. 1995. Bovine genome Molecular Cloning: A Laboratory Manual mapping: evolutionary inference and the 2nded Cold spring Harbour Cold Spring power of comparative genomics. Curr. Opin. Laboratory Press NY. Genet. Dev., 5: 725-733. Sharma R, Pandey AK, Prakash B, Mishra BP and Zaman UG, Nahardeka N, Laskar S, Ferdoci AM and Singh PK. 2009. Genetic diversity of ganjam Chetri AJ. 2013. Molecular characterization goat by microsatellite markers. Ind. Vet. J., 86: of assam hill goat. Am. J. Anm. Vet. Sci., 8 (2): 275-277. 98-103. Soranzo N, Provan J and Powell W. 1999. An example of microsatellite length variation in the mitochondrial genome of conifers. Genome., 42(158–161): 0831-2796.

39 Volume 6 Number 1, 2016 Volume 6 Number 1, 2016 Volume 6 Number 1, 2016