Table S1. The effects of MLP on lifespan. Exprement Strain Condition Deaths Mean lifespan±SEM Increase P value (day) (%) 1 N2 Control 107 17.54±0.48 25mg/L MLP 110 21.67±0.35 23.54 <0.001 N2 (25℃ ) Control 95 13.64±0.74 25mg/L MLP 102 15.93±0.34 16.78 <0.001 daf-16(mu86)I Control 97 14.02±0.56 25mg/L MLP 106 14.55±0.72 3.78 >0.05 daf- Control 85 13.02±0.34 12(rh61rh411) 25mg/L MLP 94 13.58±0.46 4.30 >0.05 nhr-80(tm1011)III Control 79 16.38±0.78 25mg/L MLP 86 16.70±0.26 1.95 >0.05 pha-4(zu225)V Control 91 14.78±0.37 25mg/L MLP 103 15.13±0.51 2.36 >0.05 skn-1 (zu67)IV Control 123 8.54±0.39 25mg/L MLP 108 9.12±0.48 6.79 <0.05 sir-2.1(ok434)IV Control 98 18.03±0.19 25mg/L MLP 104 19.56±0.61 8.48 <0.01 mev-1(kn1)III Control 90 9.08±0.29 25mg/L MLP 89 10.89±0.76 19.93 <0.001 glp-1(e2141)III Control 86 19.13±0.77 25mg/L MLP 93 18.89±0.49 -1.25 >0.05 2 N2 Control 94 17.85±0.43 25mg/L MLP 102 23.51±0.67 31.70 <0.001 N2 (25℃ ) Control 120 14.58±0.19 25mg/L MLP 115 17.91±0.56 22.84 <0.001 daf-12(m20)X Control 88 13.18±0.19 25mg/L MLP 98 13.76±0.64 4.40 >0.05 nhr-80(tm1011)III Control 97 15.67±0.37 25mg/L MLP 134 16.01±0.47 2.16 >0.05 pha-4(zu225)V Control 89 14.43±0.19 25mg/L MLP 100 15.12±0.84 4.78 >0.05 skn-1 (zu67)IV Control 120 8.01±0.97 25mg/L MLP 131 9.13±0.16 13.98 <0.001 sir-2.1(ok434)IV Control 83 17.13±0.84 25mg/L MLP 96 18.67±0.23 8.99 <0.01 mev-1(kn1)III Control 70 8.58±0.29 25mg/L MLP 69 10.89±0.76 26.92 <0.001 glp-1(e2141)III Control 98 19.35±0.37 25mg/L MLP 102 19.74±0.15 2.02 >0.05 daf-16(mu86)I Control 78 14.38±0.37 25mg/L MLP 84 14.91±0.34 3.68 >0.05 3 N2 Control 110 18.08±0.73 25mg/L MLP 121 22.07±0.54 22.06 <0.001 N2 (25℃ ) Control 113 14.11±0.37 25mg/L MLP 99 18.03±0.77 27.78 <0.001 daf-12(m20)X Control 87 13.97±0.46 25mg/L MLP 91 14.35±0.59 2.72 >0.05 nhr-80(tm1011)III Control 105 16.02±0.80 25mg/L MLP 112 16.49±0.43 2.93 >0.05 pha-4(zu225)V Control 120 15.31±0.91 25mg/L MLP 131 15.97±0.34 4.31 >0.05 skn-1 (zu67)IV Control 99 9.10±0.46 25mg/L MLP 110 10.21±0.37 12.20 <0.01 sir-2.1(ok434)IV Control 99 18.47±0.91 25mg/L MLP 121 20.08±0.28 8.72 <0.01 mev-1(kn1)III Control 90 8.38±0.39 25mg/L MLP 89 10.13±0.96 20.88 <0.001 glp-1(e2141)III Control 103 18.13±0.45 25mg/L MLP 124 18.32±0.28 1.04 >0.05 daf-16(mu86)I Control 119 14.34±0.37 25mg/L MLP 105 14.87±0.58 3.70 >0.05 Sum of 3 experiments Total Mean increase (%) Lifespan tests of glp-1(e2141)III were performed at 25℃ , lifespan of N2 worms were performed at 20 and 25℃. Lifespan tests of other mutants were all performed at 20℃ . The table shows the number of dead animals. Animals that crawled off the plate, bagged, or burst were censored and were therefore excluded from all analysis. P values were calculated for individual experiments. All statistics were calculated using SPSS software (SPSS, Chicago, IL, USA). The log rank (Kaplan-Meier method) test was used for statistical analysis. SEM: standard error of mean. Table S 2. Results of dosage response analysis. Concentration 1 5 25 125 312.5 625 (mg/L) Extension fold 0.97±0.13 1.13±0.08 1.26±0.05 0.98±0.09 0.86±0.04 0.82±0.01 (average ±SD)
P value >0.05 <0.01 <0.001 >0.05 <0.01 <0.01 (vs control)
Extension fold: average of 3 independent experiments. SD: standard deviation P value: t-test Tabler S 3. Treatment with MLP improved H2O2 resistance.
0.5 mM H2O2 1 mM H2O2 1.5 mM H2O2 Control 25mg/L MLP Control 25mg/L MLP Control 25mg/L MLP
1 0.85 0.95 0.64 0.83 0.16 0.59 2 0.91 0.97 0.59 0.86 0.24 0.62 3 0.87 0.98 0.73 0.91 0.14 0.47 average 0.88 0.96 0.65 0.86 0.18 0.56 SD 0.03 0.02 0.07 0.04 0.05 0.08 t-test 0.010 0.010 0.002 The data showed the survival fractions of day 6 MLP-treated worms after incubated in indicated concentrations of
H2O2 for 5 hours. SD: standard deviation. Tabler S 4. Treatment with MLP improved oxidant resistance induced by paraquat.
Experiment Treatment Survival fraction 8 day 10 day 12 day 14 day 16 day 1 Control 0.91 0.81 0.65 0.42 0.16 25mg/L MLP 0.97 0.90 0.77 0.61 0.34 2 Control 0.93 0.85 0.51 0.37 0.11 25mg/L MLP 0.99 0.97 0.72 0.58 0.35 3 Control 0.95 0.84 0.59 0.39 0.08 25mg/L MLP 1.00 0.96 0.83 0.41 0.27 Average ± SD Control 0.93±0.02 0.83±0.02 0.58±0.07 0.39±0.03 0.12±0.04 25mg/L MLP 0.98±0.02 0.94±0.04 0.77±0.06 0.53±0.11 0.32±0.04 t-test 0.018 0.012 0.021 0.094 0.004 The data showed the survival franctions. The survival fractions were caulated every other day from day 8 after treated by 25 mg/L MLP. SD: standard deviation. Table S 5. Effects of MLP on reproduction of wild type worms at 20℃ strain total progeny of P value days of laying P value(vs n, N one worms eggs control) t-test N2 control 213.15±40.09 5.75±1.03 57,3 25 mg/L MLP 155.29±21.13 <0.05 4.13±0.75 <0.0001 69,3 Reproduction assays, using N2 worms treated with the compound from hatching, single L4 worm was transferred to a fresh plate, then transferred at the same time each day. The offspring of each worm were hatched at 25 ℃ and counted at L4 or young adult. P values were carried out by using t-test n: total worms number of all trails in each treatment N: number of independent experiments Table S 6. The average intensity of sudan black B stained droplets in MLP-treated N2 worms.
Worms Control 25mg/L MLP 1 689.40 839.43 2 764.37 872.46 3 590.59 747.97 4 713.83 923.54 5 523.55 860.34 6 561.62 888.45 7 588.76 741.16 8 556.07 787.99 9 515.02 747.76 10 695.56 831.96 11 613.50 788.87 12 569.64 771.99 13 613.21 811.74 14 524.17 795.76 15 555.61 878.12 16 561.53 862.83 17 534.94 730.56 18 578.10 772.95 19 583.46 914.03 20 565.34 758.37 Average 594.91 816.31 SD 68.80 60.56 T-test <0.001 Relative 1.00±0.12 1.37±0.10 fold±SD
The intensity was calculated using the Metamorph software package (Molecular Devices, Sunnyvale, CA, USA). SD: standard deviation. Table S 7. The average intensity of sudan black B stained droplets in MLP-treated CF1903 worms.
Worms Control 25mg/L MLP 1 704.52 831.91 2 982.80 807.13 3 557.91 689.04 4 956.48 879.16 5 598.59 727.29 6 569.26 826.62 7 699.60 617.90 8 658.26 694.16 9 632.16 689.95 10 827.37 736.20 11 775.89 706.52 12 713.62 621.58 13 776.02 613.60 14 616.88 671.17 15 639.28 693.82 16 650.74 751.30 17 618.28 636.37 18 696.78 633.31 19 690.91 856.84 20 642.00 717.67 Average 700.37 720.08 SD 114.88 82.26 T-test 0.54
The intensity was calculated using the Metamorph software package (Molecular Devices, Sunnyvale, CA, USA). SD: standard deviation. Worm Gene Relative expression fold (vs Average SD P value (t-test) control) N2 Exp1 Exp 2 Exp 3 sod-3 4.14 3.58 3.89 3.87 0.28 <0.001 lipil-4 2.95 2.46 3.02 2.81 0.31 <0.001 fard-1 2.07 1.88 2.18 2.04 0.15 0.002 unc- 1.93 1.85 2.32 2.03 0.25 0.002 51 fat-6 3.78 4.17 3.95 3.96 0.20 <0.001 gst-4 1.85 2.01 2.12 1.99 0.14 <0.001 CF1903 sod-3 1.06 1.02 1.18 1.08 0.08 0.14 lipil-4 0.89 1.22 1.21 1.10 0.18 0.38 fard-1 1.08 1.18 0.93 1.06 0.12 0.43 unc- 0.86 1.03 1.21 1.03 0.18 0.76 51 fat-6 0.95 1.12 1.08 1.05 0.08 0.38 gst-4 1.77 1.98 1.67 1.80 0.16 <0.001
Table S 8. Gene expression regulated by 25mg/L MLP.
△△ The relative expression levels of genes were carried out using 2- CT method and normalized to act-1 Table S 9. Primers sequences. unc-51 F 5'-GCTGCTCTTGACGAGCTTTT-3' unc-5R 5'-ACAAATCCCTGTCGTTCCAG-3' fat-6 F 5'-GTCTCTGGTCCCACAAATCA-3' fat-6 R 5'-TGGATCAGCATCGGTATCAG-3' lipl-4 F 5'-ATGGCCGAGAAGTTCCTACATCGT-3' lipl-4 R 5'-GGTGAATTGGCGACCCAATCGAAA-3' gst-4 F 5’- TCCGTCAATTCACTTCTTCCG -3’ gst-4 R 5’- AAGAAATCATCACGGGCTGG-3’ sod-3 F 5’--3AGCATCATGCCACCTACGTGA-3’ ’ sod-3 R 5’-CACCACCATTGAATTTCAGCG-3’ fard-1 F 5’-GGGTTTTTGGGAAAGGTGAT-3’ fard-1 R 5’-CCACCGATTGCTTTCAATTT-3’ccaccgattgctttcaattt act-1 F 5’-TCGGTATGGGACAGAAGGAC-3’ act-1 R 5’-CATCCCAGTTGGTGACGATA-3’ Article title: Mulberry leaf polyphenols delay aging and regulate fat metabolism via the germline signaling pathway in Caenorhabditis elegans
Journal name: AGE
Author names: Shanqing Zheng, Sentai Liao, Yuxiao Zou, Zhi Qu, Weizhi Shen, Ying Shi
Affiliation: Sericulture & Agri-Food Research Institute, Guangdong Academy of Agricultural Sciences, No. 133 Yiheng ST Dongguanzhuang RD, Guangzhou 510610, China
Correspondence to: Shanqing Zheng, Ph.D., E-mail:[email protected] Sentai Liao, MD, E-mail: [email protected] Tel.: +86-020-8759-6248; Fax: +86-020-8723-6354.