Plasmid Dnas for Rho Gtpases, Mdia Isoforms and Their Mutants

Supplementary Method: mutant, N-mDia3, the AccI/BamHI fragment of the full length mDia 3 in pCR vector (Invitrogen) Plasmid DNAs for Rho GTPases, mDia isoforms was subcloned in pEGFP vector. Expression of N- and their mutants. mDia3 in HeLa cells induced the active mDia Complementary DNAs for mDia2 and mDia3 were phenotype such as cell elongation and actin isolated by polymerase chain reaction–based filament alignment as did N3-mDia13. Constructs cloning from cDNA libraries of mouse testis and for GFP-EB1 and dsRed2-histoneH2B-k will be lung with primers based respectively on the described elsewhere. reported mDia2 cDNA sequence1 and on the partial 3' sequence for mDia3 cDNA (Y15910) and Isolation of CENP-A as a binding protein of the expressed sequence tags (BB576753, AV318338, FH2 region of mDia1. AA921166) homologous to the reported sequence We previously found that expression of active of hDia2 cDNA (ref. 2). The nucleotide sequences forms of mDia1 such as N3-mDia1 induced of the cDNAs for each gene isolated from the testis elongation of HeLa cells and aligned MTs in and lung libraries were identical and were parallel to the long axis of the elongated cells8. The consistent with the sequences present in the mouse MT alignment by active mDia1 was suppressed by genomic DNA database. cDNA for the RBDs of co-expression of the shorter mDia1 fragment mDia2 (amino acids 33 to 411) and mDia3 (amino spanning the FH2 region, and mutations to alanine acids 3 to 294) were subcloned into pThioHis or of the lysine residues at 989, 994 and 999 in the pVP-16, and cDNA for the H3 region and the FH2 FH2 region abolished the MT aligning activity of region of mDia3 were subcloned into pBTM. The active mDia1, suggesting that the FH2 region is constructs for the RBD, the H3, and the FH2 critically involved in MT alignment8. In order to fragments of mDia1 were previously described3.4. identify putative binding partners for the FH2 The pBTM plasmids for RhoA, Rac1, and Cdc42 region, we carried out yeast two hybrid screening mutants were as described5. The pGEX-RhoA, with the FH2 region of mDia1 as a bait9. We also pGEX-Cdc42, and pGEX-Rac1 plasmids were also used the FH2 region fragment with the K->A described previously3. The cDNAs from plasmids mutation, the FH2-KA3, as a bait for negative for dominant active and dominant negative mutants control. cDNAs for mDia1-FH2 (amino acids 829- of RhoA, Rac1, and Cdc42 (ref. 6) were subcloned 1106) and mDia1-FH2-KA3 (amino acids 829- into pEGFP as described7. A dominant active 1106) were produced by PCR using pGEX-4T-1- mutant of mDia1,N3mDia1, was described mDia1 and pEGFP-N3-mDia1-KA3 (ref. 8) as a previously3. For preparation of an active mDia3 template, respectively, with 5’- GGAATTCCATATGGTAAAAGAGCTGAAAGT with the spindle MTs in mitotic HeLa cells9. GCTG-3’ as the forward primer and 5’- Analysis using various truncation mutants of mDia1 TCCCCCGGGACGAAGTAGTCACCTAGCTC-3’ revealed that the minimum fragment that localizes as the reverse primer. The resultant PCR fragments to the spindle MT is the C-terminal fragment of the were digested with EcoRI and SmaI and then putative FH3 region of mDia1 designated H3 subcloned into pGBKT7 (Clontech). These (amino acids 431-603), and that a H3 mutant with a plasmids were also digested with BamHI and EcoRI mutation of Leu455 in this region to Glu (H3- and the fragments were subcloned into pBTM116. L455E) showed the markedly attenuated The yeast L40 strain harboring pGBKT7- localization. We sought for a binding partner of this mDia1-FH2 was transformed with pACT2 fused region of mDia1 using yeast two-hybrid screening with a human HeLa cDNA library (Clontech). with H3 as a bait. The yeast L40 strain harboring Initial transformation yielded 1.0×106 pBTM-H3 that encodes LexA DNA-binding protein transformants. These transformants were then fused to H3, was transformed with pVP16 fused amplified in culture medium without uracil, with a mouse embryo cDNA library. tryptophan and leucine for 16 h. Approximately Approximately 3.6 x 107 transformants were 2.0×108 transformants were obtained. Among these obtained and amplified during the 4 h culture before more than 2×103 clones were grown on His (-) spreading on histidine-free plates. Among 9.2 x 107 plates, and about 90% of these clones showed β - transformants, 382 clones were isolated as His+ and galactosidase activity. Among 50 clones picked up, LacZ+ and cultured in medium without tryptophan. 17 clones were segregated from the bait plasmid. 226 clones were segregated from the bait plasmid. The pACT2 plasmids were recovered from all these Segregated clones were then mated with a yeast clones and cDNA inserts were sequenced. Among AMR70 strain bearing either the bait construct, these, 15 clones were derived from the same cDNA, LexA-fused lamin or LexA-fused H3-L455E. We which encoded human centromere protein A obtained 31 clones that were positive for the bait (CENP-A). We selected one clone (clone 5) and and negative for lamin and L455E. To confirm plasmid from clone 5 was used for co- these interaction the pVP16 plasmids were transformation of the L40 yeast strain with bait recovered from these clones and retransformed to constructs. L40 strain bearing H3, lamin or L455E. Fourteen pVP16 plasmids reacted with the bait but not with Isolation of heterochromatin protein (HP)-1 as a lamin or L455E (clone 7 was shown in binding protein of the H3 region of mDia1. Supplementary Fig. 5 as representative data). DNA We previously found that mDia1 was associated sequencing of these plasmids revealed that 12 pVP16 plasmids possessed HP1, that one pVP16 13556–13560 (1996). plasmids possessed HP1 and that one pVP16 6. Hirose, M. et al. Molecular dissection of the plasmids possessed heat shock protein hsc73. Rho-associated protein kinase (p160ROCK)- cDNA for HP1 was then cloned from mouse regulated neurite remodeling in neuroblastoma cDNA library, and used for two hybrid assay with N1E-115 cells. J. Cell Biol. 141,1625–1636 H3, yielding a similar positive signal. (1998). 7. Tsuji, T. et al. ROCK and mDia1 antagonize 1. Alberts, A. S., Bouquin, N., Johnston, L. H. & Rho-dependent Rac activation in Swiss 3T3 Treisman, R. Analysis of RhoA-binding fibroblasts. J. Cell Biol. 157, 819–830 (2002). proteins reveals an interaction domain 8. Ishizaki, T., Morishima, Y., Furuyashiki, T., conserved in heterotrimeric G protein  Kato, T., Narumiya, S. Coordination of subunits and the yeast response regulator microtubules and actin cytoskeleton by a Rho protein Skn7. J. Biol. Chem. 273, 8616–8622 effector, mDia1. Nat. Cell Biol., 3, 8-14 (1998). (2001). 2. Bione, S. et al. A human homologue of the 9. Vojtek, A.B. , Hollenberg, S.M. and Cooper, Drosophila melanogaster diaphanous gene is J.A. Mammalian Ras interacts directly with the disrupted in a patient with premature ovarian serine/threonine kinase Raf. Cell, 74, 205-214 failure: evidence for conserved function in (1993). oogenesis and implications for human sterility. Am. J. Hum. Genet. 62, 533–541 (1998). 3. Watanabe, N. et al. Cooperation between mDia1 and ROCK in Rho-induced actin reorganization. Nat. Cell Biol., 1, 136-143 (1999). 4. Kato, T. et al. Localization of a mammalian homolog of Diaphanous, mDia1, to the mitotic spindle in HeLa cells. J. Cell Sci., 114, 775- 784 (2001). 5. Reid, T. et al. Rhotekin, a new putative target for Rho bearing homology to a serine/threonine kinase, PKN, and rhophilin in the Rho-binding domain. J. Biol. Chem. 271, Supplementary Figure 2 Cyclin B degradation through mitosis in toxin B-treated mitotic HeLa cells. Mitotic cells were enriched by nocodazole, and treated either with toxin B or vehicle. Toxin B Supplementary Figure 1 Electron microscopy of was then removed and the cells were either released toxin B-treated mitotic cells. HeLa cells by removal of nocodazole or further incubated in synchronized in prometaphase by nocodazole were the continued presence of nocodazole. Cell lysates treated with or without toxin B for 2 h. The cells were prepared at 0, 0.5, 1, 2 and 4 h after removal were fixed and subjected to electron microscopy at of toxin B, and subjected to Western blot analysis 60 min after removal of nocodazole. Compared to with anti-cyclin B1 antibody (clone CB169, Upstate control cells (a), chromosomes in the toxin B- biotechonology). While cyclin B1 degradation was treated cells were misaligned, and MT attachment significantly delayed but occurred in the toxin B- was not found at kinetochores of some treated cells, the continued presence of nocodazole chromosomes (b3). Bar, 1 m (a1, b1) and 200 nm completely suppressed this degradation, and no (a2, a3, b2, b3). progression of toxin B-treated cells to interphase occurred in the presence of nocodazole (data not shown). Thus, the spindle check-point mechanism is affected by the toxin B treatment, but this effect of toxin B is not seen when MT binding is completely suppressed by nocodazole treatment. Supplementary Figure 5 Interaction of the H3 fragment of mDia1 and heterochromatin protein (HP)-1. Yeast two hybrid screening was performed with the H3 fragment of mDia1 as a bait, and HP-1 Supplementary Figure 3 Structures of the three was isolated as a binding protein as described in mDia isoforms. Residue numbers for the boundaries Supplementary Method. Interaction of HP1 with of the Rho-binding (RBD), FH3, FH1 and FH2 H3, H3-L455E and lamin was examined in L40 domains are indicated, as is the percentage yeast strain. Note a significant β -galactosidase sequence identity (similarity) for each domains of staining on HP-1 interaction with H3 but little with mDia2 and mDia3 compared with those of mDia1. H3-L455E and lamin. H3, and FH2 fragments of mDia1 and mDia3 used in the two hybrid assay are also shown.

Supplementary Figure 4 Interaction of FH2 fragment of mDia1 and CENP-A. Yeast two hybrid screening was performed with the FH2 fragment of mDia1 as a bait, and CENP-A was isolated as a binding protein as described in Supplementary Method. Interaction of CENP-A with FH2, FH2- KA3 and lamin was examined by co-transformation Supplementary Figure 6 (above) and 7 (below) in L40 yeast strain. Note a significant β - Interaction of mDia3 with HP1 and CENP-A. The galactosidase staining on co-transformation with yeast two-hybrid assay was performed with the H3 pGBKT7-mDia1-FH2, little on co-transformation of mDia3 as a LexA fusion protein and HP1 with pBTM encoding mDia1-FH2-KA3 mutant and isoforms (, , ) as VP16 fusion proteins (above) no staining on co-transformation with pBTM or with the FH2 region of mDia3 as a LexA fusion encoding LexA-fused lamin. protein and CENP-A or two CENP-A fragments, mt1 (residues 8-142) and mt2 (residues 40-142) as panel), GFP-mDia1 (lane 1, middle and right ACT2 fusion proteins. As found for mDia1, the H3 panels), GFP-mDia2 (lane 2, middle and right fragment and the FH2 fragment of mDia3 bound panel) and GFP-mDia3 (lane 3, middle and right directly to all isoforms ( and ) of HP1 and panel) were subjected to immunoblot with anti CENP-A, respectively. mDia3 antibody (left and middle panels) or anti- GFP antibody (right panel). Arrows denotes the position of endogenous mDia3.

Supplementary Figure 10 Co-localization of Supplementary Figure 8 Interaction of mDia3 mDia3 with HP-1 in the nucleus of interphase HeLa with RhoA, Rac1, and Cdc42. The yeast two-hybrid cells. HeLa cells were transfected with pFL-HP1 assay was performed with RBD of mDia3 as a (encoding Flag-HP1), fixed and stained with VP16 fusion protein and the indicated wild-type antibodies to mDia3 and to Flag. DNA was and mutant Rho GTPases as LexA fusion visualized with TOPRO-3. Co-staining for constructs. mDia3 bound to RhoA, Cdc42, and expressed Flag-tagged HP1 and endogenous Rac1, in a GTP-dependent manner. whereas mDia1 mDia3 is shown. Note that most of the nuclear bound selectively to RhoA3, and mDia2 bound to mDia3 signals overlapped with HP1 RhoA and Rac1 (data not shown). immunofluorescence. Bar, 5 m

Supplementary Figure 9 Specificity of anti-mDia3 antibody. Lysates of control HeLa cells (lane 1, left b panel) or cells expressing Flag-mDia3 (lane 2, left RNAi; immunofluorescence. Cells transfected with siRNA for mDia3 or that with scrambled sequence (control) were fixed at 24 h, and stained for mDia3 (green) and CENP-A (red). Bar, 5 m

Supplementary Figure 11 a, Specificity of anti- mDia1 antibody. Lysates of HeLa cells expressing GFP-mDia1 (lane 1), GFP-mDia2 (lane 2) and GFP-mDia3 (lane 3) were subjected to immunoblot with anti mDia1 antibody. Arrows denotes the position of endogenous mDia1. Note that anti- mDia1 antibody specifically detected endogenous mDia1 and GFP-mDia1 but not either endogenous or GFP-tagged mDia2 and mDia3 proteins b, Localization of mDia1.Interphase and mitotic HeLa cells were satined for mDia1 (green) and CENP-A (red). DNA was stained with TOPRO-3. Note that Supplementary Figure 13 Effects of active mDia1 is localized mostly in the cytoplasm in mutants of mDia isoforms on chromosome interphase cells. In mitosis, mDia1 is localized at alignment and segregation. Active form of mDia3, the poles to polar spindle MTs and found in the cell N-mDia3, was constructed by deletion of the N- cortex. Bar, 5 m terminal Rho-binding domain. Expression vectors encoding this cDNA or an active form of mDia1, N3-mDia1, was microinjected into NIH 3T3 cells synchronized in S phase. Cells were analyzed at 12 h (above) and 16 h (below) after injection. Note that chromosomal misalignment similar to those found in cells transfected with active Cdc42 or treated with toxin B or subjected to mDia3 RNAi Supplementary Figure 12 Depletion of mDia3 by was observed at 12 h in cells microinjected of the vector encoding either N-mDia3 or N3-mDia1 but not the vector alone. Production of multinucleate cells with abnormally shaped nuclei was apparent at 16 h also in cells microinjected of the vector encoding either N-mDia3 or N3- mDia1. The effects of N3-mDia1 probably reflects the CENP-A binding activity shared by this isoform. Bar, 5 m Supplementary Movie-1 (Figure 1a; mitosis of control cells) Supplementary Movie-3 (mitosis of control cells, merged images for GFP-EB1 and dsRed2- Supplementary Movie-2 (Figure 1b; mitosis of histoneH2B-k) toxin B-treated cells) Supplementary Movie-4 (mitosis of cells treated Fluorescence video microscopy of mitotic HeLa with mDia3 siRNA, merged images for GFP-EB1 cells transfected with pQBI25-Xbeta-tubulin1 was and dsRed2-histoneH2B-k) performed essentially as described2. Cells expressing a fusion construct of green fluorescent Supplementary Movie-5 (mitosis of cells treated protein (GFP) and -tubulin were arrested in with mDia3 siRNA, GFP-EB1 images) prometaphase by nocodazole treatment and then incubated for 2 h in the absence (control) or HeLa cells expressing GFP-EB1 and dsRed2- presence of C. difficile toxin B (10 ng ml-1). After histone H2B-k were transfected with siRNA for removal of nocodazole, DNA was counterstained mDia3. At 36 h after transfection, fluorescence with Hoechst 33342, and progression through video microscopy was performed on mitotic cells. mitosis was monitored by fluorescence video microscopy. Reference 1. Mimori-Kiyosue, Y., Shiina, N. & Tsukita, S. Adenomatous polyposis coli (APC) protein moves along microtubules and concentrates at their growing ends in epithelial cells. J. Cell Biol. 148, 505–518 (2000). 2. Haraguchi, T., Kaneda, T. & Hiraoka, Y. Dynamics of chromosomes and microtubules visualized by multiple-wavelength fluorescence imaging in living mammalian cells: effects of mitotic inhibitors on cell cycle progression. Genes Cells 2, 369-380 (1997).