Shivange Et Al. Structure Function Relationships of Yersinia Mollaretii Phytase

Shivange et al. Structure function relationships of Yersinia mollaretii phytase Applied Microbiology and Biotechnology

Supporting Information for Iterative Key-residues interrogation of a phytase harboring thermostability increasing substitutions identified in directed evolution

Amol V. Shivangea,b,c, Danilo Roccatanob and Ulrich Schwaneberga,b * a Lehrstuhl für Biotechnologie, RWTH Aachen University, Worringerweg 1, D-52074 Aachen, Germany b School of Engineering and Science, Jacobs University Bremen gGmbH, Campus Ring 1, 28759 Bremen, Germany cPresent Address: Division of Biology and Biological Engineering, California Institute of Technology, Pasadena, California 91125, United States

Running Title: Phytase: structure function relationships

*Corresponding author: Prof. Dr. Ulrich Schwaneberg RWTH Aachen University Lehrstuhl für Biotechnologie Worringer Weg 1 52056 Aachen, Germany

Tel.: +49-241-80-24170 Fax: +49-241-80 22387 E-Mail: [email protected]

1 | 9 Supporting Information Shivange et al. Structure function relationships of Yersinia mollaretii phytase

Homology modeling of Ympytase

Template selection The amino acid sequence of Ymphytase was subjected to NCBI-BLAST (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) to identify homologous structure for Ymphytase by searching the structural database of protein sequences in the Protein Data Bank (PDB) (Berman et al. 2000). A template, E. coli phytase (1DKM) was selected based on highest percentage sequence identity (45%) and highest resolution of the crystal structure (Electronic supplementary material, Table S3 and Fig. S9). Sequence alignment and model building Sequence alignment of the query sequence with respective template was performed using dynamic programming alignment algorithm implemented in MODELLER (Sali 1996). This method provides an alignment slightly different from standard sequence-sequence alignment methods since it takes into account structural information from the template when constructing an alignment. This is done by using a variable gap penalty function that places gaps in solvent exposed regions, curved regions, and outside secondary structural elements (Supporting Information Fig. S9). Subsequently, the alignment was used by the same program to model the Ymphytase protein using 1DKM as a template structure. Validation of homology models The accuracy and validity of the generated homology model was analyzed with PROCHECK server implemented in SWISS-MODEL server (http://swissmodel.expasy.org) and 3D-profile programs (Bowie et al. 1991) (http://nihserver.mbi.ucla.edu/Verify_3D/). The latter calculates 3D to 1D compatibility score and performs Eisenberg analysis for depiction of correctly folded and misfolded regions in the protein structure.

2 Shivange et al. Structure function relationships of Yersinia mollaretii phytase

Fig. S1 PROCHECK-Ramachandran plot for the homology model of YmPhytase

Fig. S2 3D-profile window plots for Ymphytase homology model. The vertical axis shows the average 3D-1D score for the residue and horizontal line indicate residue number in the model. The residues with average positive score in 3D-1D slide window are reasonably folded.

Fig. S3 Radius of gyration of the backbone atoms (Cα, N, C) of Ymphytase throughout the simulation of wild-type (a; Wt) and variant M6 (b)

Fig. S4 Structural topology of Ymphytase model obtained from molecular dynamics simulation

Fig. S5 Hydrogen bonding network of Ymphytase wild-type deciphered by MD simulation. Amino acid residue G187 showed no hydrogen bonds with loop-G6 (a), T77 did not show any hydrogen bonds with D122 (b), K289 showed 2 – 3 hydrogen bonds with helix-L (c) but the frequency of second hydrogen bond was less compare to variant M6 and negligible hydrogen bonds with loop-CD (d)

8 Shivange et al. Structure function relationships of Yersinia mollaretii phytase Fig. S6 Salt bridge analysis of T77K with D122 showing the minimum distance between residues K77 and D122 throughout the simulation time. The average distance between K77 and D122 was 0.37 nm showing a salt bridge interaction (centroids of the side-chain charged group atoms in the residues lie within 0.4 nm of each other)

Fig. S7 A tetrameric model of Ymphytase constructed by superimposing monomers to biological assembly of Debaryomyces castellii phytase (PDB ID: 2GFI). Substitutions in Ymphytase variant M6 are shown in orange colored space filled model. Highly flexible loops observed in MD simulation (L92-T102, N247-P252, and Q304-Q317) are shown in red color. Residues involved in inter-monomer interaction calculated using PIC server (http://crick.mbu.iisc.ernet.in/~PIC/) are depicted in purple (hydrophobic interactions), yellow (ionic interactions), and blue (hydrogen bonding interactions) color

Fig. S8 Hydrogen bonding network of Ymphytase residue Q154 in wild-type (a) and substitution Q154H in variant M6 over the time of MD simulation. Hydrogen bonds were calculated between residue 154 and the protein molecule

Table S1 Sequence of the primers used for site-directed and site saturation mutagenesis

Primer name Sequence Ymph_D52N_AS_F CAGAGTTAATGAATAATGTCACACCGGATAAG Ymph_T77K_AS_F GGTGCGCAATTAGTGAAACTGATGGGCGGCTTC Ymph_K139E_AS_F CATTATCAGGCTGATTTGGAGAAGGTTGATCCACTG Ymph_G187S_AS_F CCATTTGCCCAGATGAGCGAGATTCTCAATTTC Ymph_V298M_AS_F GTTGTTGCAACAGATTATGACGGCGCTAGTGCTTC YmG81E-F_AS GTGACACTGATGGGCGAATTCTATGGTGATTATTTC YmQ154H-F_AS CCGGTGTGTGTCATCTAGATTCGACAC YmL239V-F_AS CACTCTCATCCACAGTGGGTGAAATCTTCTTG YmK289E-F_AS CTTATATCGCCCGTCATGAGGGAACTCCGTTGTTG YmK289X-F_AS CTTATATCGCCCGTCATNNKGGAACTCCGTTGTTG

Table S2 Classification and mutational pattern of the variants identified in the 2nd round of SeSaM library screening

Group Variant Substitutions Templat SM2P3E4 e R2H, D52N, T77K, K139E, G187S, V298M Group I SM3P1F3 R2H, D52N, T77K, K139E, G187S, V298M, Q154H, L239V SM3P1B4 R2H, D52N, T77K, K139E, G187S, V298M, K289E Group II SM3P3D20 R2H, D52N, T77K, K139E, G187S, V298M, G81E SM3P1D5 R2H, D52N, T77K, K139E, G187S, V298M, V20L, G81D, K422R SM3P1F10 R2H, D52N, T77K, K139E, G187S, V298M SM3P1F1 R2H, D52N, T77K, K139E, G187S, V298M Group SM3P1A5 R2H, D52N, T77K, K139E, G187S, V298M, V24M III SM3P1B2 R2H, D52N, T77K, K139E, G187S, V298M SM3P1A6 R2H, D52N, T77K, K139E, G187S, V298M SM3P1C1 R2H, D52N, T77K, K139E, G187S, V298M Group SM3P1A3 R2H, D52N, T77K, K139E, G187S, V298M IV SM3P1C12 R2H, D52N, T77K, K139E, G187S, V298M, S260T

Table S3 Available templates for homology modeling of YmPhytase (*selected template)

Template % Resolution Mutation PDBID Identity (Å) (s) Ligand

1DKL 45 2.30 No No

1DKM* 45 2.25 A116T No

A116T, 1DKP 44 2.28 H17A Phytate

Glucose-1- 1NT4 33 2.40 H18A Phosphate

Fig. S9 Structure-sequence alignment of template and query sequence based on dynamic programming algorithm of MODELLER for YmPhytase.

Fig. S10 Activity-pH profile of the Ymphytase wildtype and variant M3 and M6.

Native polyacrylamide gel electrophoresis (PAGE) of wildtype Ymphytase and variant M3 and M6

Native polyacrylamide gel (10%) was prepared by omitting SDS from the routinely used polyacrylamide gel electrophoresis. NativeMark Unstained Protein Standard (Invitrogen) was used as a molecular marker to estimate the quaternary form of Ymphytase variants. Purified protein of Ymphytase variants [7 μL of protein and 3 μL of loading dye (tris 62.5 mM pH 6.8, glycerol 30%, bromophenol blue 0.01%)] were loaded into each lane of the native gel. The electrophoresis was performed using tris–glycine buffer (pH 8.3) and electrophoresis chamber was placed in an ice- water bath during the run. Protein bands were stained with Coomassie brilliant blue solution.

References

Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, Bourne PE (2000) The Protein Data Bank. Nucleic Acids Res 28(1):235-42 doi:10.1093/nar/28.1.235 Bowie JU, Luthy R, Eisenberg D (1991) A method to identify protein sequences that fold into a known three-dimensional structure. Science 253(5016):164-70 Sali A (1996) Comparative protein modeling by satisfaction of spatial restraints. Immunotechnology 2:279-80

15 | 9 Supporting Information