Guide Rnas with 5 Caps and Novel Box C/D Snorna-Like Domains For

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Current Biology, Vol. 14, 1985–1995, November 23, 2004, 2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.cub.2004.11.003 Guide RNAs with 5؅ Caps and Novel Box C/D snoRNA-like Domains for Modification of snRNAs in Metazoa

Kazimierz T. Tycowski, Alar Aab, duced by small nucleolar RNP particles (snoRNPs). Box and Joan A. Steitz* C/D snoRNPs direct 2Ј-O-methylation, while box H/ACA Department of Molecular Biophysics particles are involved in pseudouridylation (reviewed in and Biochemistry [4]). The RNA components of the snoRNPs select the Howard Hughes Medical Institute sites for modification by engaging in extensive base Yale University School of Medicine pairing interactions with the substrate RNA, while meth- 295 Congress Avenue ylation and pseudouridylation are believed to be carried New Haven, Connecticut 06536 out by a snoRNP core protein specific to each particle class. Box C/D snoRNPs are composed of a small RNA mole- Summary cule, typically 70–90 nt long in vertebrates, and a set of at least four proteins: fibrillarin, which is the methyltrans- Background: Spliceosomal snRNAs and ribosomal ferase [5, 6], Nop56, Nop58, and 15.5 kDa (reviewed RNAs in metazoans contain numerous modified resi- in [4]). All box C/D snoRNAs contain four conserved Ј dues that are functionally important. The most common sequence elements: boxes C and D close to the 5 and Ј modifications are site-specific 2Ј-O-methylation and 3 termini, respectively, and internal copies of each box Ј Ј pseudouridylation, both directed by small ribonucleo- referred to as C and D . The termini usually form a short protein particles. Each particle is composed of a short stem, which together with boxes C and D conform to guide RNA and a set of several proteins. All previously an RNA structural motif termed the kink-turn (K-turn) characterized modification guide RNAs in metazoa are [7], found also in U4 snRNA [8, 9], 23S rRNA [10], and encoded in and processed from introns. prokaryotic mRNAs [11]. The box C/D snoRNA kink-turn Results: We have identified and characterized three motif has been identified as the binding site for the 15.5 novel guide RNAs for conserved 2Ј-O-methylation of U2, kDa protein [7, 12], which is essential for further particle U4, and U12 snRNAs. Two guides, termed mgU2-25/61 assembly, including the binding of fibrillarin [13]. and mgU12-22/U4-8, appear to be independently tran- The spliceosomal snRNPs undergo biogenesis in one scribed as judged by the presence of methylated guano- of two ways. U6 (and most likely U6atac) snRNA is syn- sine caps at their 5Ј ends and upstream promoters simi- thesized by RNA polymerase III (pol III) and is modified lar to those of telomerase RNA. These guide RNAs are and assembled with proteins in the nucleus (reviewed each composed of a canonical box C/D snoRNA and a in [14]). In contrast, U1, U2, U4, and U5 (and most likely novel box C/D snoRNA-like domain, where the CЈ/DЈ U11, U12, and U4atac) snRNAs are made by RNA pol II motif, rather than C/D, can be folded into a conserved and follow a distinct maturation pathway (reviewed in kink-turn structure. The snoRNA-like domains are pre- [14]). These newly transcribed RNAs are exported to dicted to direct 2Ј-O-methylation of invariant G residues the cytoplasm, where they assemble with the Sm core that occupy analogous positions in the U2 and U12 proteins and undergo cap trimethylation. Subsequently, snRNA secondary structures. A third guide, mgU2-19/30 the RNPs are shipped back to the nucleus; there, they RNA, is composed of two canonical box C/D snoRNA are believed to transit through the nucleoplasmic struc- domains encoded within a single intron. tures known as Cajal bodies where they acquire numer- Ј Conclusions: This is the first description in metazoan ous 2 -O-methyl groups and pseudouridines [15]. Addi- cells of 5Ј-capped modification guide RNAs that appear tion of these modifications may trigger further assembly to be independently transcribed. Since plant, yeast, and with snRNP-specific proteins, e.g., the U2-specific SF3a protozoan guide RNAs are mostly independently tran- and SF3b splicing factors [16–18]. Indeed, unmodified scribed, the identification of such RNAs argues that an- U2 snRNA binds the Sm core proteins but fails to assem- cestral metazoans possessed independently tran- ble with the SF3a and SF3b factors [19]. scribed guide RNAs and only later, during the evolution By constructing libraries of small RNAs, several guide of metazoan organisms, did the guide RNA genes shift RNAs for modification of RNA pol II-transcribed spliceo- to introns. somal snRNAs have been recently isolated from vertebrate [20–23], Drosophila [24], and plant [25] species. The vertebrate snRNA guides are more complex than Introduction their counterparts for modifying rRNA; often they consist of two snoRNA domains. These composite guides pos- Stable RNAs in eukaryotic cells are subject to extensive sess either one box C/D and one H/ACA [22] or two box posttranscriptional modification (reviewed in [1]). The H/ACA [23] domains. Others are typical single-domain most common modifications in ribosomal RNAs (rRNA) box C/D or box H/ACA RNAs [20, 22]. Consistent with Ј and small nuclear RNAs (snRNA) are 2 -O-methylation the subnuclear localization of the modification process of selected sugar moieties and conversion of specific [15], these guides are found in Cajal bodies and are often uridines to pseudouridines (reviewed in [2, 3]). Both referred to as Cajal body-specific RNAs or scaRNAs [22, types of modification in rRNA and U6 snRNA are intro- 23]. A tetranucleotide has been identified as a signal responsible for targeting box H/ACA scaRNAs to Cajal *Correspondence: [email protected] bodies [26]. Current Biology 1986

All known metazoan modification guide RNAs are en- the first observation of a doublet box C/D RNA. The coded within introns of either protein coding or noncod- doublet and the mgU2-30 singlet accumulate to equiva- ing genes (reviewed in [27]). Exonucleolytic trimming of lent levels in HeLa cells, while mgU2-19 is less abundant -All three RNAs are precipitable with anti .(%20–%10ف) the spliced and debranched introns gives rise to mature snoRNAs with 5Ј-monophosphate and 3Ј-hydroxyl ter- fibrillarin antibodies (data not shown). mini [28, 29]. A small fraction of yeast and plant snoRNAs The proposed secondary structures of the mgU2-19 exhibit similar gene organization. However, most snoRNAs and mgU2-30 domains in mgU2-19/30 RNA conform to in these organisms are independently transcribed either those of canonical box C/D snoRNAs, with boxes C and as mono- or polycistronic units (reviewed in [30]). In D involved in putative kink-turn formation (Figure 3). yeast, the polycistronic as well as some monocistronic Consistent with this observation, the 5Ј and 3Ј ends of RNAs are processed by RNase III to yield the mature the individual mgU2-19 and mgU2-30 RNAs map to the RNAs [31, 32]. positions common to all box C/D snoRNAs (Figure 3 Here, we describe the identification and characteriza- and data not shown). (The 5Ј ends were mapped by tion of three novel metazoan guide RNAs for 2Ј-O-meth- primer extension, while the 3Ј ends were inferred from ylation of spliceosomal snRNAs. One guide is composed the migration of the RNAs in the gel and the length of of two canonical box C/D snoRNA domains and two the terminal stems.) Unexpectedly, the 5Ј end of the feature a box C/D snoRNA downstream of a novel box doublet mgU2-19/30 extends 28 nts upstream of the C/D snoRNA-like domain. In all cases, the domains are mgU2-19 domain, as determined by primer extension. arranged in tandem. While one guide is encoded in and At present, the functional significance of this extension, appears to be processed from an intron, the two others as well as how it is protected from 5Ј exonucleases, is exhibit novel genomic organization. They are apparently unclear. encoded in intergenic regions and appear to be independently transcribed. Identification of Guide RNAs with Novel Box C/D snoRNA-like Domains Results Discovery of the doublet organization of mgU2-19/30 RNA prompted us to examine whether recently identified A Doublet Intron-Encoded Box C/D Guide RNA, canonical box C/D RNAs proposed to direct 2Ј-O-meth- mgU2-19/30 ylation of vertebrate RNA pol II-transcribed snRNAs rep- Since the 2Ј-O-methylation patterns of the major resent stable domains of longer RNAs. By constructing spliceosomal snRNAs from several vertebrate species libraries of small RNAs, Huttenhofer et al. [20] identified have been established (compiled in [3, 33]), we predicted three mouse canonical box C/D RNAs, MBII-19, MBII- the sequences of the antisense elements for 2Ј-O-meth- 119, and MBII-382, which they proposed guide the modi- ylation of U1, U2, U4, and U5 snRNAs. We then designed fication of U2, U4, and U2 snRNAs, respectively. Using query sequences for database searches also including a similar approach, Darzacq et al. [22] identified a human boxes C, CЈ, D, and DЈ (see Experimental Procedures MBII-119 homolog termed U91. for details). Using database searches, we have identified the hu- Using the BLAST algorithm, we found an 80 nt long man homolog of MBII-382. Northern blot analysis of sequence in the human database that can specify an MBII-382 and U91 revealed longer RNAs of about 400 RNA containing boxes C, CЈ, D, and DЈ as well as a 10 nucleotides in HeLa cells (Figure 2, lanes 4 and 6). Com- nt long antisense element that positions A30 of U2 parison of genomic sequences between various ver- snRNA for 2Ј-O-methylation. We named this putative tebrate species revealed a striking evolutionary conser- guide RNA methylation guide for U2 snRNA residue 30 vation of the 5Ј but not the 3Ј flanking sequences of (mgU2-30). Human mgU2-30 RNA was independently MBII-382 and U91, arguing that the longer forms pos- identified later by Zhou and Qu as Z32 snoRNA (Gen- sess 5Ј extensions. Indeed, 5Ј and 3Ј end mapping by Bank Accession Number AJ009638). Inspection of the primer extension and polyA tailing followed by RT-PCR, genomic sequences surrounding mgU2-30 revealed an- respectively (data not shown), revealed RNAs of 420 or other box C/D snoRNA sequence about 175 nts up- 421 nts in length, with the 3Ј ends similar or identical to stream. This putative guide RNA possesses an 8 nt long those reported for MBII-382 or U91, respectively. antisense element for methylation of G19 also in U2 Portions of the sequences upstream of the MBII-382 snRNA and is therefore referred to as mgU2-19. Indeed, and U91 domains can be folded into box C/D snoRNA- G19 has been reported to be 2Ј-O-methylated (see Fig- like secondary structures with antisense elements pre- ure 1) [3, 33]. dicted to direct 2Ј-O-methylation of G25 in U2 snRNA Surprisingly, both putative guide RNA sequences re- and G22 in U12 snRNA, respectively (Figures 4A and side within the same intron of the apparently single copy 4B). Therefore, we named the longer forms mgU2-25/ KIAA1731 human gene specifying a protein of unknown 61and mgU12-22/U4-8. In mgU2-25/61, the mgU2-61 function. Related copies (93% identical) of both RNAs domain corresponds to MBII-382, which has been pre- are also found in an intron of the translation initiation dicted to direct methylation of C61 in U2 snRNA [20]. factor eIF1A gene. Full-size mgU2-19 and mgU2-30 In mgU12-22/U4-8, the mgU4-8 domain is identical to probes hybridized to species of the expected size (Fig- U91 RNA that was predicted to guide methylation of C8 ure 2, lanes 1 and 2). However, each probe also hybrid- in U4 snRNA [22]. ized to an RNA that possesses both mgU2-19 and Interestingly, in the upstream domains, U2-25 and mgU2-30 domains, referred to as mgU2-19/30. This is U12-22, the CЈ/DЈ motif rather than C/D can form puta- 5Ј End-Capped Modification Guide RNAs in Metazoa 1987

Figure 1. Human U2 and U12 snRNAs Modified nucleotides are specified as follows. Am, Cm, Gm, and Um: 2Ј-O-methyladenosine, -cytidine, -guanosine, and -uridine, respectively; 6 6 2,2,7 m A: N -methyladenosine; m3 G: 2,2,7-tri-methylguanosine; ⌿: pseudouridine. The 2Ј-O-methylated residues that are the products of mgRNAs described here are indicated by solid arrows. Modification of U2 and pseudouridylation of U12 snRNA were established earlier (compiled in [3]), while 2Ј-O-methylation of U12 has been determined in this report (see Figure 5). The branch site recognition sequences and the Sm sites are boxed and shaded, respectively. The dotted arrow marks the 9e primer used in the experiment shown in Figure 5. tive kink-turns. The primary and secondary structures whether the kink-turns are also conserved phylogeneti- of these motifs are highly similar (Figure 4C), even cally, we identified mgU2-25/61 and mgU12-22/U4-8 though the remaining sequences in mgU2-25/61 and RNAs from other species by searching genomic se- mgU12-22/U4-8 RNAs are completely different. To learn quence databases using the human RNAs as query se-

Figure 2. Northern Blot Analysis of Human mgU2-19/30, mgU2-25/61, and mgU12-22/ U4-8 RNAs HeLa cell nuclear RNA was fractionated on 8% denaturing polyacrylamide gels, blotted to Zeta-probe membranes and probed for mgU2-19/30 RNA using riboprobes specific for either the mgU2-19 (lane 1) or mgU2-30 (lane 2) domain, for mgU2-25/61 RNA with oligonucleotide probes for either the U2-25 (lane 3) or mgU2-61 (lane 4) domain, and for mgU12-22/U4-8 RNA with oligonucleotide probes for either the U12-22 (lane 5) or mgU4-8 (lane 6) domain. The faint bands in lanes 3 and 5 do not seem to represent the 5Ј domains because they are not reproducible. The mgU2-19/30 RNA frequently separates into two bands or a dominant lower band with a smear above. The slow-migrating forms most likely reflect either alternative structural conformers or a retardation of mgU2-19/30 RNA by virtue of its interaction with other RNA(s) since they collapse to the lower band when partially purified mgU2-19/30 RNA preparations are subjected to electrophoresis. Interestingly, mgU2-19/30 RNA contains a 40 nt long GU repeat, which may hybridize to abundant CA repeats present in numerous precursor and mature mRNAs. “O” marks the gel origin. Current Biology 1988

Figure 3. Human mgU2-19/30 RNA Primary and predicted secondary structures of the snoRNA domains are shown, as well as base pairing interactions between the antisense elements and U2 snRNA. Boxes C and DorCЈ and DЈ are circled in black or grey, respectively. The arrows and arrowheads in- dicate the ends of mgU2-19 and mgU2-30 RNAs, respectively. The 2Ј-O-methylated residues in U2 snRNA are marked by “m.”

quences in the BLAST algorithm. We found putative methylated site [34]. The appearance of a stop at G23 mgU2-25/61 RNA genes in several vertebrate (dog, in the HeLa cell RNA (lanes 5–7) but not in the in vitro- mouse, rat, frog [X. tropicalis], pufferfish, and zebrafish) produced RNA (lanes 8–10) strongly indicates that G22 and in two chordate Ciona species, as well as mgU12- is indeed 2Ј-O-methylated. This analysis also revealed 22/U4-8 RNA in mouse and rat. The expression of the that A8 and G18 undergo 2Ј-O-methylation as well. mouse and rat RNAs was validated by the identification of EST clones either identical or highly similar to the mgU2-25/61 and mgU12-22/U4-8 RNAs Possess genomic sequences. EST database searches further Methylated Guanosine Caps identified an X. laevis mgU2-25/61 RNA. The human mgU2-25/61 and mgU12-22/U4-8 genes ap- All the mgU2-25/61 and mgU12-22/U4-8 sequences pear to be located in intergenic spacers (our unpub- possess 5Ј snoRNA-like domains with conserved anti- lished data), suggesting that both RNAs are indepen- sense elements for 2Ј-O-methylation of G25 in U2 and dently transcribed. Since the majority of snRNAs and G22 in U12 snRNA, respectively, followed by kink-turn some snoRNAs that are independently synthesized by structures (Figure 4C and data not shown). They also RNA polymerase II possess trimethylguanosine (TMG) contain canonical 3Ј snoRNA domains. Whereas the caps, we checked whether mgU2-25/61 and mgU12-22/ kink-turn structures are nearly identical in all identified U4-8 RNAs were precipitable by the monoclonal K121 vertebrate and chordate species, boxes C and D in the anti-TMG antibody (Figure 6A). Immunoprecipitation of U2-25 and U12-22 domains diverge significantly from deproteinized HeLa cell nuclear RNA revealed signifi- of mgU2-25/61 precipitating with (%15ف) their consensus sequences; in fact, box C in the U2-25 cant amounts domain cannot be identified by sequence comparison the anti-TMG (lane 3) but not the control anti-Sm (lane of (%2ف) alone (Figures 4A and 4B and data not shown). This 2) antibody. Small but significant levels may explain why the U2-25 and U12-22 domains do not mgU12-22/U4-8 were precipitable by anti-TMG (lane 3 accumulate by themselves in HeLa cells (Figure 2, lanes and data not shown). Note that about 30% of intron- 3 and 5). encoded mgU2-30 was also precipitable with anti-TMG (lane 3), even though this RNA is not expected to pos- The G22 Residue in U12 snRNA Is 2؅-O-Methylated sess a methylated guanosine cap. However, inclusion of The G25 residue has been found to be 2Ј-O-methylated an RNA denaturation step prior to immunoprecipitation in all studied animal, plant, and yeast U2 snRNAs [3, (lane 4) abolished this signal, suggesting that interaction 33]. However, the methylation status of the analogous of mgU2-30 with its methylation substrate, U2 snRNA, residue in U12 snRNA has not yet been established. which does contain a TMG cap and is efficiently (Ͼ50%) Therefore, we performed primer extension analysis of precipitable under both sets of conditions (lanes 3 and the 5Ј portion of human U12 snRNA in the presence of 4), was responsible. Neither the intron-encoded doublet suboptimal concentrations of dNTPs (Figure 5). Under mgU2-19/30 RNA nor any of the singlet RNA products such conditions, 2Ј-O-methyl groups interfere with the of mgU2-25/61 and mgU12-22/U4-8 was precipitable normal progression of reverse transcriptase and cause upon denaturation of the RNA (lane 4). In contrast, RNA the enzyme to stop frequently one nucleotide before the denaturation increased the precipitability of mgU2-25/ 5Ј End-Capped Modification Guide RNAs in Metazoa 1989

Figure 4. Human mgU2-25/61 and mgU12-22/U4-8 RNAs (A and B) Primary and predicted secondary structures of the snoRNA and snoRNA-like domains. The arrows and arrowheads mark the ends of mgU2-61 (MBII-382) and mgU4-8 (U91) RNAs, respectively. (C) Predicted kink-turn structures (boxed) in the U2-25 and U12-22 domains of selected vertebrate (human [H. sapiens], mouse [M. musculus], frog [X. laevis], pufferfish [T. rubripes], and zebrafish [D. rerio]) and chordate (sea squirt [C. savignyi]) species. Canonical boxes C and D are circled in black, while the diverged boxes C and D, as well as boxes CЈ and DЈ, are gray. The 2Ј-O-methylated residues in U2 and U4 snRNAs are marked by “m.”

61 to 30% and particularly that of mgU12-22/U4-8 to ciency. Taken together, these data suggest that a sub- 17% (lane 4), indicating that the caps were poorly acces- stantial fraction of mgU2-25/61 RNA possesses a sible in the native RNAs. These data strongly suggest trimethylated guanosine cap. On the other hand, we did that both mgU2-25/61 and mgU12-22/U4-8 RNAs con- not observe detectable precipitation of mgU12-22/ tain methylated guanosine caps, while mgU2-19/30 and U4-8 RNA by the R1131 serum. Thus, the data are most the singlets do not. However, the extent of methylation consistent with this RNA containing monomethylated of these caps could not be assessed, since the K121 guanosine cap. A detailed assessment of the methyla- anti-TMG antibody has been recently demonstrated to tion status of the 5Ј caps in both RNAs will need further possess a significant affinity for monomethylated caps investigation. [32]. Thus, because of the low efficiency of immunoprecipitation, particularly of mgU12-22/U4-8, monomethyl The mgU2-25/61 and mgU12-22/U4-8 RNA Genes caps could not be excluded. The presence of methylated guanosine caps argues that To confirm that mgU2-25/61 and mgU12-22/U4-8 mgU2-25/61 and mgU12-22/U4-8 RNAs are indepen- RNAs indeed possess trimethylated caps, we used the dently transcribed by RNA pol II. To obtain additional TMG-specific R1131 serum [35]. A significant fraction evidence in support of this notion, we searched the of mgU2-25/61 RNA was precipitated by the sequences flanking the coding regions of mgU2-25/61 (%6ف) R1131 antibody (Figure 6B, lanes 3 and 4). Considering and mgU12-22/U4-8 RNAs for promoter and 3Ј end for- the lower precipitation efficiency of control U2 snRNA mation signals. Since we mapped the ends of both RNAs (11%) with R1131, both K121 and R1131 antibodies pre- in human (data not shown), we first looked for these cipitate mgU2-25/61 RNA with comparable relative effi- signals in this organism. We also mapped the ends of Current Biology 1990

fied yet another promoter motif, a Staf-responsive element (Staf-r.e.), located only a few nucleotides upstream of the TATA box. The consensus sequence of this motif in the mgU2-25/61 promoter closely matches (95% iden- tity) the 19 nt long consensus derived earlier from the alignment of small RNA promoters and from binding site selection [36]. The sequence comparison also revealed several other blocks of conserved mammalian sequences whose identities remain to be established. However, it did not identify either the PSE or the octamer motif, two key elements of the snRNA gene promoters (reviewed in [37]). Similar alignment of the mgU12-22/U4-8 gene promoters from five mammalian species did not identify snRNA-type promoter elements or a TATA box. Instead, an inverted CCAAT motif was identified about 30 nts upstream of the transcription start sites (Figure 7 and Supplemental Figure S2). Searches of the 3Ј flanking sequences failed to identify in either of the genes the 3Ј box that is essential for 3Ј end formation of the RNA Figure 5. Mapping 2Ј-O-Methyl Groups in Human U12 snRNA pol II-transcribed snRNAs (reviewed in [38]). Taken to- The 5Ј end-labeled primer 9e (see Figure 1) [59] was extended by gether, these observations further argue that vertebrate reverse transcriptase in the presence of decreasing amounts (0.5, 0.083, and 0.014 mM) of dNTPs using either HeLa cell nuclear RNA mgU2-25/61 and mgU12-22/U4-8 RNAs are transcribed (lanes 5–7) or in vitro synthesized U12 snRNA (lanes 8–10). Lanes 1–4 independently by RNA pol II utilizing TATA-containing show U12 sequencing ladders generated by the dideoxynucleotide and TATA-less mRNA gene-type promoters, respec- termination method in the presence of 0.5 mM dNTPs using HeLa tively. nuclear RNA. 2Ј-O-methyl groups are identified at A8, G18, and G22 (see Figure 1). Subnuclear Localization of the Doublet and Singlet Guide RNAs mgU2-25/61 in frog X. laevis; however, the gene encod- Several guide RNAs for modification of RNA pol II-tran- ing this RNA was not found in the sequence database. scribed snRNAs, including U91 (here referred to as Therefore, we searched the mgU2-25/61 gene of the mgU4-8), have been demonstrated to reside in Cajal closely related species X. tropicalis. bodies and thus are recovered in the nucleoplasmic Putative TATA elements were located about 25 nts fraction during HeLa cell fractionation [22, 23]. To check upstream of the transcription start sites in both human whether this is also the case for mgU2-19/30, mgU2- and frog mgU2-25/61 genes (Figure 7). Alignment of 25/61, and mgU12-22/U4-8 RNAs or the single domain about 250 nts of the human and frog 5Ј flanking se- species, we separated purified HeLa cell nuclei into nu- quences with corresponding regions from five other ver- cleoplasmic and nucleolar fractions and probed for the tebrate species revealed conservation of this element guide RNAs by Northern blotting (Figure 8). Interestingly, (see Supplemental Figure S1). This alignment also identi- all three doublet RNAs cofractionate with the nucleo-

Figure 6. mgU2-25/61 and mgU12-22/U4-8 RNAs Possess Methylated Guanosine Caps RNAs were precipitated from a HeLa cell nuclear RNA preparation with either K121 monoclonal (lanes 3 and 4 in panel [A]) or R1131 polyclonal (lanes 3 and 4 in panel [B]) anti-TMG antibodies and probed for the indicated RNAs by Northern blotting. The Y12 monoclonal anti-Sm antibody (lanes 2) was used as a negative control. The RNA shown in lanes 4 and 7 was denatured prior to immunoprecipitation by heating for 5 min at 94ЊC in water and snap cooling on ice. Lanes 1 and 5–7 show input and supernatant RNAs, respectively, from half as many cells as in lanes 2–4. 5Ј End-Capped Modification Guide RNAs in Metazoa 1991

Figure 7. Schematic Representation of the Vertebrate mgU2-25/61 and mgU12-22/U4-8 Genes The organization of the vertebrate telomerase RNA and other small RNA genes are shown for comparison. The coding regions are rep- resented by arrow-ended bars. SPH (Staf-r.e.) is present in 70% of small RNA gene promoters [36]. The DSE in some genes contains additional motifs. The distance between the PSE and DSE may vary greatly. Not drawn to scale. Conservation of the mgU2-25/61 and mgU12-22/U4-8 promoter sequences is shown in Supplemental Figures S1 and S2, respectively.

plasm along with the control Cajal body-associated U85. C/D snoRNA-like domain upstream of a typical box C/D In contrast, all the singlet RNAs, including mgU4-8 (U91) domain. RNA, were recovered predominantly in the nucleolar fraction, similar to U15 snoRNA. These results are con- A Novel Conserved snoRNA-like Domain sistent with the Cajal body localization of the doublets In the atypical 5Ј domains of mgU2-25/61 and mgU12- mgU2-19/30, mgU2-25/61, and mgU12-22/U4-8, al- 22/U4-8 RNAs, boxes CЈ and DЈ rather than C and D are though at present we cannot exclude that other nucleo- putatively involved in kink-turn formation, while boxes plasmic locale(s) may harbor these RNAs. Because the C and D in both RNAs diverge significantly from the mgU4-8 (U91) sequences are also present in the more consensus sequences (Figure 4). Conservation of the abundant mgU12-22/U4-8 doublet, the Cajal body signal CЈ/DЈ kink-turn across a wide range of organisms sug- reported by Darzacq et al. [22] most likely originated gests that it, rather than a C/D motif, binds the 15.5 from hybridization to mgU12-22/U4-8 RNA. kDa protein that nucleates further assembly of the 5Ј domains. In a canonical snoRNA, the 15.5 kDa protein Discussion binds the C/D motif, an interaction essential for the assembly of other snoRNP core proteins [7, 12, 13, 39]. We have identified three novel box C/D guide RNAs for Since the 5Ј domains do not accumulate by themselves, 2Ј-O-methylation of RNA pol II-transcribed snRNAs. One it is difficult to assess by immunoprecipitation whether of these RNAs, mgU2-19/30, is composed of two canoni- they bind the 15.5 kDa and other box C/D snoRNP core cal box C/D snoRNA domains, while two others, mgU2- proteins, since all of these proteins are expected to 25/61 and mgU12-22/U4-8, each possess a novel box be also present on the 3Ј domains. We attempted to separate the domains by oligonucleotide-directed cleavage using RNase H, but thus far the experiments have been unsuccessful. The protein composition of the 5Ј domains will be the focus of separate studies. In mgU2-25/61 and mgU12-22/U4-8 RNAs, the 5Ј domains appear to be circularly permuted versions of the canonical box C/D snoRNAs. Such permuted snoRNAs are unstable by themselves (Figure 2), most likely due to susceptibility of their ends to exonucleolytic trimming. It is well established that an intact C/D motif is essential for the accumulation of canonical snoRNAs (reviewed in [27, 40]). In the case of mgU2-25/61 and mgU12-22/ U4-8 RNAs, protection of the 5Ј domains against 5Ј and 3Ј exonucleases is apparently provided by the methylated guanosine caps and the 3Ј snoRNA domains, respectively.

Differential Subnuclear Localization of the Doublet and Singlet Guide RNAs Figure 8. Intranuclear Localization of Human mgU2-19/30, mgU2- For all three doublet guide RNAs, the snoRNA but not 25/61, and mgU12-22/U4-8 RNAs the snoRNA-like domains accumulate to significant lev- HeLa cell nuclei were fractionated into nucleoplasm and nucleoli. RNA was isolated from each fraction, resolved on 8% denaturing els as separate RNA species (Figure 2). For instance, polyacrylamide gels, and probed for the indicated RNAs by Northern the abundance of the mgU2-30 singlet is comparable blotting. to that of the corresponding mgU2-19/30 doublet spe- Current Biology 1992

cies. At present, the mechanism by which the singlet the presence of mgU2-25/61 and mgU12-22/U4-8 se- RNAs are produced is unknown. quences on differently sized RNAs. Since the corresponding doublet and singlet mgRNAs Since all cellular RNAs carrying methylated guanosine localize to different subnuclear compartments (Figure 8), caps are produced by RNA polymerase II, we favor the the question of which form(s) perform the modification idea that this polymerase synthesizes mgU2-25/61 and reactions in the cell arises. RNA pol II-transcribed mgU12-22/U4-8 RNAs. This notion is further supported snRNAs are believed to undergo modification in the nu- by the occurrence in the vertebrate mgU2-25/61 and cleoplasmic Cajal bodies [15], and because the doublet mgU12-22/U4-8 genes of the type of promoter elements RNAs cofractionate with the nucleoplasm, they most that usually directs the synthesis of mRNA (Figure 7). All likely are the functional entities in the cell. It is conceiv- previously characterized metazoan modification guide able that the singlet forms are simply stable by-products RNAs are encoded in introns and therefore are cotrans- generated during turnover of the doublet species. They cribed with their host genes (reviewed in [27]). This is the may localize by default to the nucleoli because they first report of independently transcribed modification may lack putative Cajal body retention signal(s). Such guide RNAs in metazoan cells. a retention signal has been recently proposed for box Among the metazoan small nuclear RNAs, seven of H/ACA RNAs [26]. On the other hand, nucleoli, as well the nine snRNAs contributing to the major and minor as Cajal bodies, have been implicated in U2 snRNA spliceosomes (reviewed in [37]), telomerase RNA [46], modification [41], and snRNP components are observed and box C/D U3, U8, and most likely U13 snoRNAs in nucleoli upon injection into either mammalian somatic (reviewed in [27]) are produced by RNA pol II. Whereas cells or Xenopus oocytes [42, 43]. Thus, it remains to the genes for the spliceosomal snRNAs and U3 and U8 be established whether the box C/D singlets contribute snoRNAs possess unique promoter and 3Ј end forma- to the modification of RNA pol II-transcribed snRNAs. tion signals (reviewed in [37, 38, 47]), the telomerase RNA gene also carries a promoter that resembles those of protein coding genes [48, 49]. Therefore, the tran- Importance of the 2؅-O-Methyl Modifications scription units of mgU2-25/61, mgU12-22/U4-8 RNAs, Directed by the snoRNA-like Domains and vertebrate telomerase RNA are similar. Another of mgU2-25/61 and mgU12-22/U4-8 RNAs common feature of all three RNAs is the presence of Among the 2Ј-O-methyl groups directed by the guide snoRNA domains at their 3Ј ends. The H/ACA snoRNA RNAs described in this report, those present at G25 in U2 domain in vertebrate telomerase RNA is essential for and G22 in U12 snRNA deserve comment. Methylation of its accumulation and proper 3Ј end formation [50, 51]. G25 is conserved in all studied animal, plant, and yeast Whether this is also the case for mgU2-25/61 and U2 snRNAs [3]. G25 is located within the 5Ј proximal mgU12-22/U4-8 RNAs remains to be established. stem-loop structure of U2 snRNA that constitutes a part Although the mgU2-25/61, mgU12-22/U4-8, and telo- of the region believed to interact with the essential splic- merase RNA gene promoters all possess elements char- ing factor SF3b [17]. Moreover, modification of the first acteristic of protein coding genes, each promoter is 27 nts in Xenopus U2 snRNA is necessary for the assem- unique. Most prominently, the mgU2-25/61 RNA pro- bly of the functional U2 snRNP particle [19]. The G25 moter features a Staf-responsive element that is found and G22 residues occupy analogous positions in the 5Ј in 70% of snRNA promoters recognized by either RNA stem-loops of U2 and U12 snRNAs, respectively (see pol II or pol III [36]. The Staf-responsive element binds Figure 1). Since the SF3b complex is a component the zinc finger protein Staf that is capable of activating shared by both the U2 and U12 snRNPs [44], it is very transcription of not only snRNA but also mRNA genes likely that the modifications at G25 and G22 contribute [52]. However, only four protein coding genes, whose to the recognition of U2 and U12 snRNAs by the SF3b transcription is activated by Staf, have been identified complex. so far ([53] and references therein). The discovery of the Staf binding site in an mRNA-type promoter directing Unusual pol II-Type Promoter Elements synthesis of a small RNA will undoubtedly also aid in for the mgU2-25/61 and mgU12-22/U4-8 understanding the transcription of protein coding genes. RNA Genes The presence of methylated guanosine caps on mgU2- 25/61 and mgU12-22/U4-8 strongly argues that these Independently Transcribed Modification Guide RNAs are independently transcribed. All known RNA RNAs in Metazoa—Evolutionary Implications capping reactions require a 5Ј triphosphate, and tran- Independent transcription is common among yeast, scription initiation is the only way a transcript can ac- plant and protozoan modification guide RNAs (reviewed quire a 5Ј triphosphate. The single known exception to in [30, 54]). The discovery of mgU2-25/61 and mgU12- 5Ј triphosphate-dependent capping is the snatching of 22/U4-8 RNAs supports the idea that independently a capped oligonucleotide from a host mRNA in cells transcribed guide RNAs were common in an early ances- infected by orthomyxovirus [45]. We think it highly un- tor that gave rise to animal, plant and yeast cells. Only likely that our HeLa cells are infected by an orthomyxovi- later, during the evolution of metazoan organisms, have rus, and snatched caps have previously been seen only snoRNA genes shifted to introns. Because the 3Ј do- on viral mRNAs, not on cellular small RNAs. Moreover, mains of mgU2-25/61 or mgU12-22/U4-8 are stable by in our numerous Northern blot analyses of both mgU2- themselves, either duplication followed by transposition 25/61 and mgU12-22/U4-8 RNAs using a variety of oligo- or retrotransposition of a mgU2-25/61- or mgU12-22/ nucleotide and full-size probes, we have never detected U4-8-type gene into an intron would give rise to an 5Ј End-Capped Modification Guide RNAs in Metazoa 1993

intron-encoded snoRNA corresponding to the 3Ј do- scribed with T7 and SP6 polymerase, respectively. Human U12 main. It will be interesting to learn whether mgU2-25/61 snRNA transcripts were prepared from pT7T3U12 plasmid (created and mgU12-22/U4-8 RNAs represent molecular fossils by inserting U12 preceded by a T3 promoter into the SmaI site of the pGEM-3Z vector) cut with SmaI using T3 RNA polymerase. of independently-transcribed modification guide RNAs or whether a larger class of such guides exists in modern Supplemental Data metazoan organisms. Supplemental Data including two figures showing sequence alignments of the promoter regions of the mgU2-25/61 and mgU12-22/ Experimental Procedures U4-8 RNA genes are available at http://www.current-biology.com/ cgi/content/full/14/22/1985/DC1/. Deoxyoligonucleotides 162, TCGTCTATCTGATCAATTCATCACTTCT; 163, ACTCAGATTGC Acknowledgments GCAGTGGTCTCGT; 168, GCCACGTTTTCATAATCCTCTC; 174, CAA TGGGACCTGATCATATAAGG; 178, GATCAAATAAGATCAAAGTGT We thank Reinhard Luhrmann for R1131 antibody; Lara Weinstein AAGCGG; 275, CCTCAGTCTGTTCTCAGAACATACTCC; U85(161), Szewczak and Tets Hirose for many stimulating discussions and CAAGCTAAGTCCTTTAGGACCCTTG; U2-79-98, CCATTTAATATA suggestions; Shobha Vasudevan for computer advice; and L.W. TTGTCCTC; U15-4, GAGAACATCCCCAAGTC; 9e, GTGAGGATTCG Szewczak and Nick Conrad for critical reading the manuscript. This GGCGTCACCCC. work was supported by grant GM26154 from the National Institutes of Health. J.A.S is an investigator of the Howard Hughes Medical Nucleotide Database Searches and Sequence Alignments Institute. The query sequences for putative guides for 2Ј-O-methylation of major spliceosomal snRNAs were as follows: TGATGA(N)3-5(antisense Received: June 21, 2004 element)CTGA(N)6TGATGA(N)12-14CTGA or TGATGA(N)12-14CTGA(N)6 Revised: September 29, 2004 TGATGA(N)3-5(antisense element)CTGA. The antisense elements Accepted: September 29, 2004 were 11 nt long. The public human sequence databases were que- Published: November 23, 2004 ried on the NCBI server (http://www.ncbi.nlm.nih.gov/) using the BLAST algorithm. Sequence alignments were performed using the References T-coffee program with the default parameters on the ch.EMBnet server (http://www.ch.embnet.org). 1. Limbach, P.A., Crain, P.F., and McCloskey, J.A. (1994). Sum- mary: the modified nucleosides of RNA. Nucleic Acids Res. 22, .Mapping 2؅-O-Methyl Groups 2183–2196 The positions of 2Ј-O-methyls were identified by primer extension 2. Maden, B.E.H. (1990). The numerous modified nucleotides in carried out in the presence of limiting amounts of dNTPs [34]. Primer eukaryotic ribosomal RNA. Prog. Nucleic Acid Res. Mol. Biol. hybridization, extension reactions, and sequencing conditions were 39, 241–303. as described [55] except that the concentrations of dNTPs were as 3. Massenet, S., Mougin, A., and Branlant, C. (1998). Posttranscrip- indicated and actinomycin D (40 ␮g/ml) was included. tional modifications in the U small nuclear RNAs. In Modification and Editing of RNA, H. Grosjean and R. Benne, eds. (Washing- Cell Fractionation, Immunoprecipitations, ton, DC: ASM Press), pp. 201–227. and Northern Blot Analyses 4. Terns, M.P., and Terns, R.M. (2002). Small nucleolar RNAs: ver- Human HeLa cells were fractionated as described [56]. For immuno- satile trans-acting molecules of ancient evolutionary origin. precipitations, HeLa cell nuclei were isolated according to [57], and Gene Expr. 10, 17–39. RNA was extracted with Trizol (Invitrogen) according to the manu- 5. Tollervey, D., Lehtonen, H., Jansen, R., Kern, H., and Hurt, E.C. facturer’s protocol. Immunoprecipitations with anti-Sm Y12, anti- (1993). Temperature-sensitive mutations demonstrate roles for TMG K121 (Calbiochem-Oncogen Research), and anti-TMG R1131 yeast fibrillarin in pre-rRNA processing, pre-rRNA methylation, (generous gift from R. Luhrmann) antibodies were performed as and ribosome assembly. Cell 72, 443–457. described [58]. RNAs were resolved in 8% denaturing polyacryl- 6. Wang, H., Boisvert, D., Kim, K.K., Kim, R., and Kim, S.H. (2000). amide gels and electroblotted to Zeta-Probe GT membranes (Bio- Crystal structure of a fibrillarin homologue from Methanococcus Rad). To detect mgU2-19 or mgU2-30 RNAs, the membranes were jannaschii, a hyperthermophile, at 1.6 A˚ resolution. EMBO J. 19, hybridized with internally labeled antisense mgU2-19 or mgU2-30 317–323. riboprobes. For the detection of both mgU2-25/61 and mgU2-61 7. Watkins, N.J., Se´ gault, V., Charpentier, B., Nottrott, S., Fabrizio, (MBII-382), 5Ј end-labeled oligonucleotide 162 was used, while for P., Bachi, A., Wilm, M., Rosbash, M., Branlant, C., and Lu¨ hr- the detection of mgU2-25/61 only, oligonucleotide 178, which hy- mann, R. (2000). A common core RNP structure shared between bridizes to sequences within the U2-25 domain, was utilized. To the small nucleolar box C/D RNPs and the spliceosomal U4 visualize both mgU12-22/U4-8 and mgU4-8 (U91) or mgU12-22/4-8 snRNP. Cell 103, 457–466. only, the membranes were hybridized to a mixture of oligonucleo- 8. Nottrott, S., Hartmuth, K., Fabrizio, P., Urlaub, H., Vidovic, I., tides 163 and 275 or 168 and 174, respectively. Oligonucleotides Ficner, R., and Lu¨ hrmann, R. (1999). Functional interaction of a 168 and 174 are complementary to sequences within the U12-22 novel 15.5kD [U4/U6.U5] tri-snRNP protein with the 5Ј stem- domain. U2, U15, and U85 RNAs were detected with oligonucleo- loop of U4 snRNA. EMBO J. 18, 6119–6133. tides U2-79-98, U15-4, and U85(161), respectively. Hybridizations 9. Vidovic, I., Nottrott, S., Hartmuth, K., Lu¨ hrmannn, R., and Ficner, with riboprobes and washes were carried out according to the Bio- R. (2000). Crystal structure of the spliceosomal 15.5kD protein Rad protocol. Hybridizations with oligonucleotides were performed bound to a U4 snRNA fragment. Mol. Cell 6, 1331–1342. in ExpressHyb Solution (Clontech) at 42ЊC for at least 5 hr, and 10. Klein, D.J., Schmeing, T.M., Moore, P.B., and Steitz, T.A. (2001). washes were carried out in 0.2ϫ SSC and 0.2% SDS at 30ЊC–42ЊC. The kink-turn: a new RNA secondary structure motif. EMBO J. 20, 4214–4221. Plasmids, In Vitro Transcription, and Riboprobes 11. Winkler, W.C., Grundy, F., Murphy, B.A., and Henkin, T.M. (2001). mgU2-19 and mgU2-30 riboprobes were synthesized from pGEM- The GA motif: An RNA element common to bacterial antitermina- hU2-19S and pGEM-hU2-30 plasmids, respectively. pGEM-hU2-19S tion systems, rRNA, and eukaryotic RNAs. RNA 7, 1165–1172. contains the human mgU2-19 sequence plus 11 and 8 nts of 5Ј and 12. Szewczak, L.B., DeGregorio, S.J., Strobel, S.A., and Steitz, J.A. 3Ј flanking sequences, respectively, cloned into the SmaI site of the (2002). Exclusive interaction of the 15.5 kD protein with the pGEM-3Z vector. The pGEM-hU2-30 plasmid carries human mgU2- terminal box C/D motif of a methylation guide snoRNP. Chem. 30 plus 28 and 22 nts of 5Ј and 3Ј flanking sequences, respectively, Biol. 9, 1095–1107. cloned as above. For transcription, the pGEM-hU2-19S and pGEM- 13. Watkins, N.J., Dickmanns, A., and Luhrmann, R. (2002). Con- hU2-30 plasmids were linearized with HindIII and EcoRI and tran- served stem II of the box C/D motif is essential for nucleolar Current Biology 1994

localization and is required, along with the 15.5K protein, for 34. Maden, B.E. (2001). Mapping 2Ј-O-methyl groups in ribosomal the hierarchical assembly of the box C/D snoRNP. Mol. Cell. RNA. Methods 25, 374–382. Biol. 22, 8342–8352. 35. Luhrmann, R., Appel, B., Bringmann, P., Rinke, J., Reuter, R., 14. Will, C.L., and Lu¨ hrmann, R. (2001). Spliceosomal UsnRNP bio- Rothe, S., and Bald, R. (1982). Isolation and characterization of genesis, structure and function. Curr. Opin. Cell Biol. 13, rabbit anti-m3 2,2,7G antibodies. Nucleic Acids Res. 10, 7103– 290–301. 7113. 15. Jady, B.E., Darzacq, X., Tucker, K.E., Matera, A.G., Bertrand, 36. Schaub, M., Myslinski, E., Schuster, C., Krol, A., and Carbon, E., and Kiss, T. (2003). Modification of Sm small nuclear RNAs P. (1997). Staf, a promiscuous activator for enhanced transcrip- occurs in the nucleoplasmic Cajal body following import from tion by RNA polymerases II and III. EMBO J. 16, 173–181. the cytoplasm. EMBO J. 22, 1878–1888. 37. Hernandez, N. (2001). Small nuclear RNA genes: a model system 16. Brosi, R., Groning, K., Behrens, S.E., Luhrmann, R., and Kramer, to study fundamental mechanisms of transcription. J. Biol. A. (1993). Interaction of mammalian splicing factor SF3a with Chem. 276, 26733–26736. U2 snRNP and relation of its 60-kD subunit to yeast PRP9. 38. Perumal, K., and Reddy, R. (2002). The 3Ј end formation in small Science 262, 102–105. RNAs. Gene Expr. 10, 59–78. 17. Kramer, A., Gruter, P., Groning, K., and Kastner, B. (1999). Com- 39. Cahill, N.M., Friend, K., Speckmann, W., Li, Z.H., Terns, R.M., bined biochemical and electron microscopic analyses reveal Terns, M.P., and Steitz, J.A. (2002). Site-specific cross-linking the architecture of the mammalian U2 snRNP. J. Cell Biol. 145, analyses reveal an asymmetric protein distribution for a box C/ 1355–1368. D snoRNP. EMBO J. 21, 3816–3828. 18. Will, C.L., Urlaub, H., Achsel, T., Gentzel, M., Wilm, M., and 40. Weinstein, L.B., and Steitz, J.A. (1999). Guided tours: from pre- Luhrmann, R. (2002). Characterization of novel SF3b and 17S cursor snoRNA to functional snoRNP. Curr. Opin. Cell Biol. 11, U2 snRNP proteins, including a human Prp5p homologue and 378–384. an SF3b DEAD-box protein. EMBO J. 21, 4978–4988. 41. Yu, Y.T., Shu, M.D., Narayanan, A., Terns, R.M., Terns, M.P., 19. Yu, Y.-T., Shu, M.-D., and Steitz, J.A. (1998). Modifications of and Steitz, J.A. (2001). Internal modification of U2 small nuclear U2 snRNA are required for snRNP assembly and pre-mRNA (sn)RNA occurs in nucleoli of Xenopus oocytes. J. Cell Biol. 152, splicing. EMBO J. 17, 5783–5795. 1279–1288. 20. Hu¨ ttenhofer, A., Kiefmann, M., Meier-Ewert, S., O’Brien, J., Leh- 42. Sleeman, J.E., and Lamond, A.I. (1999). Newly assembled rach, H., Bachellerie, J.-P., and Brosius, J. (2001). RNomics: an snRNPs associate with coiled bodies before speckles, sug- experimental approach that identifies 201 candidates for novel, gesting a nuclear snRNP maturation pathway. Curr. Biol. 9, small, non-messenger RNAs in mouse. EMBO J. 20, 2943–2953. 1065–1074. 21. Jady, B.E., and Kiss, T. (2001). A small nucleolar guide RNA 43. Gerbi, S.A., and Lange, T.S. (2002). All small nuclear RNAs functions both in 2Ј-O-ribose methylation and pseudouridyla- (snRNAs) of the [U4/U6.U5] Tri-snRNP localize to nucleoli; Iden- tion of the U5 spliceosomal RNA. EMBO J. 20, 541–551. tification of the nucleolar localization element of U6 snRNA. 22. Darzacq, X., Jady, B.E., Verheggen, C., Kiss, A.M., Bertrand, E., Mol. Biol. Cell 13, 3123–3137. and Kiss, T. (2002). Cajal body-specific small nuclear RNAs: a 44. Will, C.L., Schneider, C., Reed, R., and Luhrmann, R. (1999). novel class of 2Ј-O-methylation and pseudouridylation guide Identification of both shared and distinct proteins in the major RNAs. EMBO J. 21, 2746–2756. and minor spliceosomes. Science 284, 2003–2005. 23. Kiss, A.M., Jady, B.E., Darzacq, X., Verheggen, C., Bertrand, E., 45. Lamb, R.A., and Choppin, P.W. (1983). The gene structure and and Kiss, T. (2002). A Cajal body-specific pseudouridylation replication of influenza virus. Annu. Rev. Biochem. 52, 467–506. guide RNA is composed of two box H/ACA snoRNA-like do- 46. Feng, J., Funk, W.D., Wang, S.S., Weinrich, S.L., Avilion, A.A., mains. Nucleic Acids Res. 30, 4643–4649. Chiu, C.P., Adams, R.R., Chang, E., Allsopp, R.C., Yu, J., et al. 24. Yuan, G., Klambt, C., Bachellerie, J.P., Brosius, J., and Hutten- (1995). The RNA component of human telomerase. Science 269, hofer, A. (2003). RNomics in Drosophila melanogaster: identifi- 1236–1241. cation of 66 candidates for novel non-messenger RNAs. Nucleic 47. Dahlberg, J.E., and Lund, E. (1988). The genes and transcription Acids Res. 31, 2495–2507. of the major small nuclear RNAs. In Structure and Function of 25. Marker, C., Zemann, A., Terhorst, T., Kiefmann, M., Kasten- Major and Minor Small Nuclear Ribonucleoprotein Particles, mayer, J.P., Green, P., Bachellerie, J.P., Brosius, J., and Hutten- M.L. Birnstiel, ed. (Berlin: Springer-Verlag), pp. 38–70. hofer, A. (2002). Experimental RNomics: identification of 140 48. Chen, J.L., Blasco, M.A., and Greider, C.W. (2000). Secondary candidates for small non-messenger RNAs in the plant Arabi- structure of vertebrate telomerase RNA. Cell 100, 503–514. dopsis thaliana. Curr. Biol. 12, 2002–2013. 49. Zhao, J., Bilsland, A., Hoare, S.F., and Keith, W.N. (2003). 26. Richard, P., Darzacq, X., Bertrand, E., Jady, B.E., Verheggen, Involvement of NF-Y and Sp1 binding sequences in basal tran- C., and Kiss, T. (2003). A common sequence motif determines scription of the human telomerase RNA gene. FEBS Lett. 536, the Cajal body-specific localization of box H/ACA scaRNAs. 111–119. EMBO J. 22, 1–11. 50. Mitchell, J.R., Cheng, J., and Collins, K. (1999). A box H/ACA 27. Filipowicz, W., and Pogacic, V. (2002). Biogenesis of small nu- small nucleolar RNA-like domain at the human telomerase 3Ј cleolar ribonucleoproteins. Curr. Opin. Cell Biol. 14, 319–327. end. Mol. Cell. Biol. 19, 567–576. 28. Tycowski, K.T., Shu, M.-D., and Steitz, J.A. (1993). A small nucle- 51. Fu, D., and Collins, K. (2003). Distinct biogenesis pathways for olar RNA is processed from an intron of the human gene encod- human telomerase RNA and H/ACA small nucleolar RNAs. Mol. ing ribosomal protein S3. Genes Dev. 7, 1176–1190. Cell 11, 1361–1372. 29. Kiss, T., and Filipowicz, W. (1995). Exonucleolytic processing 52. Schuster, C., Krol, A., and Carbon, P. (1998). Two distinct do- of small nucleolar RNAs from pre-mRNA introns. Genes Dev. 9, mains in Staf to selectively activate small nuclear RNA-type and 1411–1424. mRNA promoters. Mol. Cell. Biol. 18, 2650–2658. 30. Brown, J.W., Echeverria, M., and Qu, L.H. (2003). Plant sno- 53. Di Leva, F., Ferrante, M.I., Demarchi, F., Caravelli, A., Matarazzo, RNAs: functional evolution and new modes of gene expression. M.R., Giacca, M., D’Urso, M., D’Esposito, M., and Franze, A. Trends Plant Sci. 8, 42–49. (2004). Human synaptobrevin-like 1 gene basal transcription is 31. Chanfreau, G., Legrain, P., and Jacquier, A. (1998). Yeast RNase regulated through the interaction of selenocysteine tRNA gene III as a key processing enzyme in small nucleolar RNAs metabo- transcription activating factor-zinc finger 143 factors with evolu- lism. J. Mol. Biol. 284, 975–988. tionary conserved cis-elements. J. Biol. Chem. 279, 7734–7739. 32. Lee, C.Y., Lee, A., and Chanfreau, G. (2003). The roles of endo- 54. Uliel, S., Liang, X.H., Unger, R., and Michaeli, S. (2004). Small nucleolytic cleavage and exonucleolytic digestion in the 5Ј-end nucleolar RNAs that guide modification in trypanosomatids: processing of S. cerevisiae box C/D snoRNAs. RNA 9, 1362– repertoire, targets, genome organisation, and unique functions. 1370. Int. J. Parasitol. 34, 445–454. 33. Reddy, R. (1988). Compilation of small RNA sequences. Nucleic 55. Parker, K.A., and Steitz, J.A. (1987). Structural analysis of the Acids Res. 16, r71–r85. human U3 ribonucleoprotein particle reveal a conserved se- 5Ј End-Capped Modification Guide RNAs in Metazoa 1995

quence available for base pairing with pre-rRNA. Mol. Cell. Biol. 7, 2899–2913. 56. Tyc, K., and Steitz, J.A. (1989). U3, U8 and U13 comprise a new class of mammalian snRNPs localized in the cell nucleolus. EMBO J. 8, 3113–3119. 57. Dignam, J.D., Lebovitz, R.M., and Roeder, R.G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11, 1475– 1489. 58. Steitz, J.A. (1989). Immunoprecipitation of ribonucleoproteins using autoantibodies. Methods Enzymol. 180, 468–481. 59. Montzka, K.A., and Steitz, J.A. (1988). Additional low-abundance human small nuclear ribonucleoproteins: U11, U12, etc. Proc. Natl. Acad. Sci. USA 85, 8885–8889.

Accession Numbers

Nucleotide sequences of human mgU2-19/30, mgU2-25/61, and mgU12-22/U4-8 RNAs are available in the Third Party Annotation Section of the DDBJ/EMBL/GenBank databases under the accession numbers TPA: BK005567-BK005569.