1
Molecular Epidemiology of Trypanosoma (Herpetosoma) rangeli (Kinetoplastida:
Trypanosomatidae) in Ecuador, South America, and Study of the Parasite Cell Invasion
Mechanism in vitro
A dissertation presented to
the faculty of
the College of Arts and Sciences of Ohio University
In partial fulfillment
of the requirements for the degree
Doctor of Philosophy
Segundo Mauricio Lascano
November 2009
© 2009 Segundo Mauricio Lascano. All Rights Reserved. 2
This dissertation titled
Molecular Epidemiology of Trypanosoma (Herpetosoma) rangeli (Kinetoplastida:
Trypanosomatidae) in Ecuador, South America, and Study of the Parasite Cell Invasion
Mechanism in vitro
by
SEGUNDO MAURICIO LASCANO
has been approved for
the Department of Biological Sciences
and the College of Arts and Sciences by
Mario J. Grijalva
Associate Professor of Biomedical Sciences
Benjamin M. Ogles
Dean, College of Arts and Sciences 3
ABSTRACT
LASCANO, SEGUNDO M., Ph.D., November 2009, Biological Sciences
Molecular Epidemiology of Trypanosoma (Herpetosoma) rangeli (Kinetoplastida:
Trypanosomatidae) in Ecuador, South America, and Study of the Parasite Cell Invasion
Mechanism in vitro. (154 pp.)
Director of Dissertation: Mario J. Grijalva
Trypanosoma rangeli is a protozoan hemoflagellate able to infect insects of the
subfamily Triatominae (Hemiptera: Reduviidae), mammals, and humans in the American
continent. Although the human infection by T. rangeli is non-pathogenic, the importance
of the study of this parasite resides in the fact that it shares the same vectors and mammal
reservoirs with T. cruzi, the pathogenic parasite causative of Chagas disease. This
situation commonly results in misdiagnosis of Chagas disease in patients living in areas
where the two parasites overlap spatially and temporarily.
The occurrence of T. rangeli in Ecuador had not been documented prior to this
study and only sporadic reports of T. rangeli-like organisms had been published. This
study was divided in two sections: the objective of the first was to establish the presence
of T. rangeli in Ecuador and to carry out an investigation of the relationship of the parasite with its Triatominae vectors and mammal hosts in two regions of the country.
Rhodnius ecuadoriensis, Panstrongylus howardi, and Triatoma carrioni were found naturally infected with T. rangeli. Mixed infections with T. rangeli and T. cruzi were also observed in those vectors. Analysis of host preferences for blood meal revealed that 4 the triatomines analyzed had fed on several species of mammals (common rat, mice, dog, cat, goat, guinea pig, human) and an avian species (chicken). The identification of the blood meal sources can contribute to the understanding of the epidemiology of T. cruzi and T. rangeli transmission cycles.
The objective of the second part of the study was to investigate the mechanism that T. rangeli uses to invade mammalian cells. Immunofluorescence assays were used for this purpose. The Choachi strain of T. rangeli and BALB/c fibroblasts were chosen to evaluate the cell invasion process. T. rangeli invades cells primarily by a lysosome- dependent fashion similar to that of T. cruzi, although T. rangeli seems to lack the alternative lysosome-independent pathway that has been described for T. cruzi. Cells infected with T. rangeli did not show signs of intracellular division up to 288 hours post- infection and parasitemia in BALB/c mice was transient and declined rapidly overtime.
Approved: ______
Mario J. Grijalva
Associate Professor of Biomedical Sciences 5
ACKNOWLEDGMENTS
I am indebted to a number of people who helped me during the dissertation process. Without them, I could not have completed this project. I would like to acknowledge:
My advisor, Dr. Mario Grijalva, who introduced me to the world of Chagas disease and trypanosomiasis, for his support, guidance, friendship, and patience, and also for encouraging and challenging me throughout my academic career.
Dr. Edwin Rowland, for his continued academic support, technical advice, and guidance.
The members of my dissertation committee: Dr. Calvin James and Dr. Sarah
Wyatt, for their help, advice, and constructive criticism.
Dr. Edmundo C. Grisard, for his valuable advice and support, and the kind donation of culture stocks of trypanosomes.
Dr. Jaime Costales, for his friendship and technical advice.
The technicians and students at the Center for Infectious Disease Research at
Catholic University of Ecuador for their help during various stages of the process.
Christian Stork, MSc, for his willingness to help and guide me through the process of getting acquainted with fluorescence and confocal microscopy.
Dr. William Romoser, for his selfless support, advice, guidance, and sincere friendship. 6
Abbey Wojno, MA, for all her loyal support and understanding throughout the completion of this dissertation.
The Graduate Student Senate and the Student Enhancement Award Program of
Ohio University for the financial support provided to carry out different sections of this dissertation.
7
DEDICATION
To my parents
8
TABLE OF CONTENTS
Page
Abstract ...... 3
Acknowledgments...... 5
Dedication ...... 7
List of Tables ...... 12
List of Figures ...... 13
List of Abbreviations ...... 15
Introduction ...... 16
Taxonomic position ...... 17
Biology of Trypanosoma rangeli ...... 19
Vectors of T. rangeli ...... 20
Reservoirs of T. rangeli ...... 21
Life cycle in the vertebrate host ...... 22
Life cycle in the invertebrate host ...... 23
Pathogenicity to the insect vector ...... 27
Biochemistry and Molecular Biology ...... 30
Lysis by complement ...... 31
Lectin discrimination of cell surface carbohydrates ...... 31
Neuraminidase production ...... 33
Antigenic characterization ...... 33 9
Isoenzyme analysis ...... 34
DNA analysis ...... 36
Epidemiology ...... 39
Specific Aims ...... 41
Materials and Methods ...... 43
Study areas ...... 43
Informed consent ...... 44
Insect collection ...... 44
Taxonomic identification and entomological indexes ...... 45
Insect samples collection ...... 46
Blood source identification ...... 49
Parasite controls ...... 52
Molecular characterization algorithm ...... 53
DNA sequencing for confirmation of parasite identity ...... 56
Cell culture maintenance ...... 56
Parasite culture maintenance ...... 57
DNA Polyacrylamide Gel Electrophoresis (PAGE) ...... 59
Polyclonal antibody production in mice ...... 60
Infection studies ...... 62
Statistical analysis ...... 64
Results ...... 65 10
Collection of triatomines and their samples ...... 65
Initial screening showed amplification of DNA from trypanosomes ...... 66
Presence of T. cruzi DNA in the triatomine samples was confirmed in a PCR reaction with primers that amplify the 24Sα rDNA gene ...... 67
Specific PCR reactions for T. rangeli confirmed the molecular identity of this parasite ...... 67
Occurrence of mixed infections with T. cruzi and T. rangeli was confirmed in samples of triatomines ...... 68
The analysis of the genetic variability of the T. rangeli isolates revealed the presence of genotype KP1 (-) ...... 69
DNA automated sequencing of DNA products from T. rangeli isolates confirmed the molecular identity of the parasite ...... 69
The blood meal source of the triatomines was determined by molecular analysis of their intestinal contents...... 71
The infection by trypomastigote forms of T. rangeli to mice is transient and declines rapidly over time ...... 72
Three different strains of T. rangeli were used to assess infectivity in mammalian cells in culture ...... 73
The infection by T. rangeli is achieved early in the cell-parasite interaction process
...... 74 11
Treatment of cells with the actin inhibitor cytochalasin D decreases the infection rate
of T. rangeli ...... 75
Wortmannin pre-treatment of cells reduced the infection rate of T. rangeli ...... 75
Lysosome-associated membrane proteins are present early in the infection process of
T. rangeli ...... 76
Discussion ...... 77
Bibliography ...... 98
Appendix ...... 148
Appendix 1: Working algorithm of PCR reactions carried out with the samples of
intestinal contents, feces, hemolymph, and salivary glands obtained from triatomines
collected in Manabí and Loja provinces of Ecuador...... 148
Appendix 2: List of triatomines collected in Manabí and Loja provinces in Ecuador
and used in the analyses in this study...... 149 12
LIST OF TABLES
Page
Table 1: Geographical distribution of Rhodnius species showing T. rangeli in their salivary glands ...... 118
Table 2: T. cruzi and T. rangeli enzymes showing electrophoretic mobility polymorphisms ...... 119
Table 3: Primer oligonucleotides used in the PCR reactions ...... 120
Table 4: Coordinates and altitude of the localities where triatomines were collected in Manabí and Loja provinces of Ecuador ...... 121
Table 5: Entomological indexes, species, and total number of insects collected in each of the study communities ...... 122
Table 6: Numbers and species of Triatomine collected in each community and the habitats where they were found ...... 124
Table 7: Number of triatomines (R. ecuadoriensis, P. howardi, T. carrioni) analyzed in the study according to their developmental stage ...... 125
Table 8: Total number of samples (hemolymph, feces, intestinal contents, and salivary glands) taken from the triatomines analyzed in the study ...... 126
Table 9: Species of Triatominae found in Ecuador, total number of samples collected from each species and percentages of natural infection by T. cruzi and T. rangeli ...... 127
Table 10: Mammal species found to serve as blood meal source for triatomines. Several species of mammals and an avian species were identified by PCR assays as the source of blood meal for triatomines ...... 128
13
LIST OF FIGURES
Page
Figure 1: A) Reported distribution of T. cruzi and T. rangeli in the American continent. B) Study area...... 129
Figure 2: Schematic representation of the life cycle of T. rangeli ...... 130
Figure 3: Different forms of T. rangeli ...... 131
Figure 4: Position of the conserved regions of the minicircles of T. rangeli ...... 132
Figure 5: Representative gel showing the product obtained with a PCR that amplifies both T. cruzi and T. rangeli DNA (primers S35-S36)...... 133
Figure 6: Representative gel showing the amplified DNA products for the 24Sα rDNA of T. cruzi with primers D71/D72 ...... 134
Figure 7: Representative gel showing the product obtained with a PCR assay that amplifies a specific repetitive nuclear element (P542) in the T. rangeli DNA sequence ...... 135
Figure 8: Representative gel showing the amplification of the conserved regions in T. rangeli minicircles (primers S35/S36/KP1-L) ...... 136
Figure 9: Representative gel showing the pattern of products obtained with a multiplex PCR (primers TC1, TC2, TC3, TR and ME) used to differentiate T. cruzi I, T. cruzi II, and T. rangeli ...... 137
Figure 10: Representative gel showing the products obtained with a multiplex cyt b PCR for the amplification of animal and human DNA ...... 138
Figure 11: Polyacrylamide gel (6%) silver stained showing the products of DNA amplification with primer 3303 ...... 139
Figure 12: Parasitemia of BALB/c mice infected with three different strains of T. rangeli ...... 140
Figure 13: Quantification of infection by T. rangeli parasites in BALB/c mouse fibroblasts ...... 141
14
Figure 14: T. rangeli invasion of cells in culture occurs early during the cell-parasite interaction ...... 142
Figure 15: Treatment of cells with cytochalasin D reduced the infection by T. rangeli ...... 143
Figure 16: Pre-treatment of cells with wortmannin resulted in a decrease in the infection rate of T. rangeli ...... 144
Figure 17: T. rangeli is able to invade mammalian cells ...... 145
Figure 18: Lysosome-associated membrane 2 (LAMP-2) is seen surrounding an internalized trypomastigote of T. rangeli ...... 146
Figure 19: Pre-treatment of cells with cytochalasin D resulted in a decrease of the number of LAMP-2 positive vacuoles containing internalized parasites ...... 147
15
LIST OF ABBREVIATIONS
DAPI = 4’6’diamidino 2 phenylindole
DMEM = Dulbecco’s modified Eagle medium
FBS = Fetal bovine serum
IgG = Immunoglobulin G
LAMP-2 = Lysosome associated membrane protein 2
LIT = Liver infusion tryptose broth
PBS = Phosphate buffered saline
PAGE = Polyacrylamide gel electrophoresis
PI-3 = Phosphoinositide 3-kinase 16
Introduction
Trypanosoma (Herpetosoma) rangeli (Kinetoplastida: Trypanosomatidae) is a protozoan parasite of humans, domestic and wild mammals, and Triatominae (Hemiptera:
Reduviidae) insects in southern North America, Central, and South America
(D’Alessandro et al., 1992; Cuba Cuba, 1998, D’Alessandro et al., 1999). First described by Tejera (1920) in Venezuela based on morphological differences with Trypanosoma cruzi from a sample of intestinal contents of the triatomine Rhodnius prolixus, this parasite is usually found in mixed infections together with T. cruzi in both invertebrate and vertebrate hosts (Steindel et al., 1994).
Whereas T. cruzi is a pathogenic parasite known to be the etiologic agent of
Chagas disease, T. rangeli is considered harmless for the mammalian host, though damaging to the insect vector (D'Alessandro and Saravia, 1992). Chagas disease occurs throughout the American continent, from southern United States to Argentina, and it is believed that currently 5 - 6 million people are infected with T. cruzi, and other 25 million are at risk of contracting the infection (WHO, 2002). Both parasites have a similar geographical distribution, they share the same vertebrate hosts, and in some areas they have the same insect vectors (D'Alessandro and Saravia 1992; Cuba Cuba 1998).
Mixed infections represent a serious problem for the differential diagnosis of T. cruzi and, therefore, the epidemiology of Chagas disease, because T. rangeli and T. cruzi share approximately 60% of the antigenic determinants recognized by the humoral 17 immune response (Afchain, 1979). This feature may cause cross-reactivity between the two parasites in immuno-serological assays, which confounds the correct identification of each species in those areas where both are present (Guhl et al., 1985). Thus, the study of the distribution and epidemiology of T. rangeli takes on real, practical importance. The following sections provide more information about different aspects of T. rangeli.
Taxonomic position
T. rangeli is the second known trypanosome that infects humans in the Americas, and some of the biological characteristics of this parasite make it one of the most interesting trypanosomes of mammals. Hoare (1972) classified the mammalian trypanosomes in two sections, the Stercoraria and the Salivaria, based on the site of development in the insect vector and especially in the route of transmission. The
Stercoraria comprise the mammalian trypanosomes transmitted by the posterior route
(feces), whereas in the Salivaria section are those trypanosomes of mammals transmitted by the anterior route (saliva). Within this last group are all the African trypanosomes transmitted by tsetse flies (Hoare, 1972).
Although T. rangeli was originally placed and is currently classified as a stercorarian parasite, this taxonomic position has been quite debated and even challenged by the fact that in several experiments no effective infection of mammals was observed when forms of the parasite present in the feces of triatomines were used for inoculation 18
(Stevens et al., 1999). Infective forms of T. rangeli develop in both the anterior (salivary glands) and posterior (hind gut) parts of the insect, though the forms able to cause infection in mammals have been seen almost exclusively in the salivary glands (Grisard et al., 1999b). Some authors, however, affirm that posterior transmission of T. rangeli might occur, but it would be by far the most unusual mechanism (Grisard et al., 1999b).
T. rangeli presents features of Stercoraria and Salivaria, as Hoare (1972) himself recognized, but since it has most of the other characteristics of the subgenus
Herpetosoma, it was left in the stercorarian group. It is believed though to be a phylogenetic link between Stercoraria and Salivaria (D'Alessandro and Saravia, 1992).
The classification of T. rangeli as belonging to the subgenus Herpetosoma has also been questioned and challenged. As opposed to other members of the subgenus, T. rangeli does not present host specificity and rather has a wide variety of hosts (Hoare,
1972). Despite the fact that T. rangeli does share many of the morphological and behavioral features of the rest of the Herpetosoma, Añez (1982), based on evidence that showed only anterior transmission of the parasite was possible, proposed to add T. rangeli to the Salivaria section and to create a new subgenus Tejeraria, which only representative would be T. rangeli. This proposal did not gain much attention.
19
Biology of Trypanosoma rangeli
Given the similarities of T. rangeli with T. cruzi, some authors (D'Alessandro and
Saravia 1992; Cuba Cuba, 1998) have defined as the basic biological “gold standard” for identification and characterization of T. rangeli strains that the parasites can develop in the hemolymph of the triatomine vector, invade its salivary glands, and be transmitted to the mammal host by the bite. Currently, the same parameters are still used when new strains of the parasite are studied.
Morphologically, T. rangeli presents most of the characteristics of the members of the subgenus Herpetosoma (D'Alessandro and Saravia, 1992). Several different forms of the parasite can be seen, depending upon whether the parasite is infecting an insect or a mammal, the stage of development, and the specific organ or tissue where the parasite is at the time of observation. In mammals, the blood trypomastigote forms of T. rangeli are large and slender, with the undulating membrane well developed and the nucleus located in the anterior half of the body (D'Alessandro and Saravia, 1992) (Figure 3). Doubtful reports of rounded forms (amastigotes) and pseudocysts in tissues of vertebrate hosts are found in the literature (Scorza et al., 1986; Urdaneta-Morales and Tejero, 1986). Some illustrations in those reports show forms similar to those of T. cruzi, and this could be attributed to the fact that in those studies the authors possibly did not use pure cultures of
T. rangeli, but rather mixed cultures of T. cruzi – T. rangeli, a common risk to be taken 20 into account in laboratories that work with both parasites (D'Alessandro and Saravia,
1992).
In the invertebrates, the following forms are likely to be found: amastigotes, epimastigotes, spheromastigotes, and trypomastigotes in the intestine; trypomastigotes, epimastigotes, metacyclic trypomastigotes in the hemolymph; intracellular rounded forms inside the hemocytes; and, metacyclic trypomastigotes in the salivary glands (Añez,
1983).
Vectors of T. rangeli
Triatominae insects are considered the biologically proven vectors of T. rangeli, since members of this subfamily are capable of harboring T. rangeli in their salivary glands and developing metacyclic trypomastigotes under natural or laboratory conditions
(D'Alessandro and Saravia, 1999). Species of the genus Rhodnius occurring throughout
Central and South America have been associated with T. rangeli transmission due to their high susceptibility to infection by this parasite (D'Alessandro and Saravia, 1992; Cuba
Cuba, 1998; D'Alessandro and Saravia, 1999; Guhl and Vallejo, 2003). Twelve of the 15 described species of Rhodnius have shown vectorial capacity either in natural or experimental conditions in 17 countries of the American continent (Guhl and Vallejo,
2003) (Table 1). 21
To date, besides Rhodnius species, only Triatoma dimidiata collected in human dwellings in Colombia has been reported in the literature as presenting natural infection by T. rangeli in salivary glands (Marinkelle, 1968). The presence of flagellates similar to
T. rangeli in the intestine of an insect is not necessarily an evidence of vectorial capacity of the insect, because the status of confirmed vector is only granted to a triatomine when metacyclic trypomastigotes infective for a vertebrate are present in the salivary glands.
According to these criteria, T. rangeli-like trypanosomes have been found in other genera of Triatominae, but their vector capacity has not been demonstrated since no trypanosomes were observed in their hemolymph or salivary glands. Those genera are
Cavernicola, Dipelogaster, Eratyrus, Panstrongylus, and Triatoma, and currently these are not considered T. rangeli vectors because no effective infection to vertebrate animals has been confirmed in these triatomines (D'Alessandro and Saravia, 1992; D'Alessandro and Saravia, 1999; Guhl and Vallejo, 2003).
Reservoirs of T. rangeli
T. rangeli, unlike other members of the subgenus Herpetosoma, does not have a specific host (D'Alessandro and Saravia, 1992; Cuba Cuba, 1998; D'Alessandro and
Saravia, 1999; Guhl and Vallejo, 2003) and rather can parasitize a wide range of vertebrates ranging from rats and mice to hamsters, rabbits, dogs, guinea pigs, and bats to primates and humans. Five orders of vertebrates have been reported as reservoirs of T. 22 rangeli: Carnivora, Edentata, Marsupialia, Primate, and Rodentia (D'Alessandro and
Saravia, 1992; Cuba Cuba, 1998; D'Alessandro and Saravia, 1999; Guhl and Vallejo,
2003).
Life cycle in the vertebrate host
Despite the fact that thousands of natural and experimental infections in mammals and in humans have been reported (D'Alessandro and Saravia, 1992; Cuba Cuba, 1998;
Guhl and Vallejo, 2003), many aspects of the epidemiology and parasitism of T. rangeli in the vertebrate host are still unknown. The reproductive features that make T. rangeli non-pathogenic for mammals, though being quite similar to T. cruzi, are still to be elucidated. Knowledge about cell entry and exit (if there is such) remains to be answered. Most of the studies carried out with the purpose of demonstrating intracellular forms in tissues of mammals experimentally infected with T. rangeli have been inconclusive (Cuba Cuba, 1998). Osorio and collaborators (1995) reported the presence of amastigote-like forms inside U937 promonocytic cells, but they did not observe replication of the intracellular forms, maybe because of the short time lapse of their experiment (7 days).
Inoculative or anterior station transmission is undoubtedly the route of infection of T. rangeli for vertebrates. This mode of transmission is by far more efficient than the posterior station transmission used by T. cruzi. The efficiency of the transmission could 23 be one of the explanations for the maintenance of the parasite even when only low levels of metacyclic trypomastigotes are present in the salivary glands of the vector (Guhl and
Vallejo, 2003). Since triatomines are capillary feeders, it is possible that metacyclic trypomastigotes from the salivary glands of the insect enter directly in the blood stream of the mammal host (D'Alessandro and Saravia, 1992). Parasitemias are usually low (~7 trypanosomes or fewer / 5 mm3 blood) and of short duration (2 - 3 weeks), though
parasitemias that lasted from 7 months to 3 years have been observed in experimentally
infected mice, rats and larger animals (Añez, 1981; D'Alessandro and Saravia, 1992).
Almost nothing is known about the parasitemia in humans. It seems unlikely that in the
case of long-lasting parasitemias (up to 3 years), T. rangeli only survives in the vertebrate without multiplication. Since other members of the subgenus Herpetosoma divide either as amastigotes or epimastigotes in mammal tissues (D'Alessandro and Saravia, 1992), it could be expected that T. rangeli does the same. Molecular biology techniques such as
PCR and immunohistochemistry specific for T. rangeli could be used to elucidate the presence and division capability of this parasite in the tissues of the vertebrate host.
Life cycle in the invertebrate host
As opposed to vertebrates, the life cycle of T. rangeli in the invertebrate host is well known and has distinctive features that make it fascinating and unique in comparison with other trypanosomes. The hallmark of that life cycle is the invasion of 24 the hemocoel, free multiplication in the hemolymph and inside hemocytes, and the invasion and multiplication in the salivary glands (D'Alessandro and Saravia, 1992; Cuba
Cuba, 1998).
T. rangeli develops in triatomines of any nymphal stage and in insects of both sexes, and the infection is maintained during molting (D'Alessandro and Saravia, 1992).
Usually, the parasites ingested with the blood meal start to multiply when they reach the midgut (D'Alessandro and Saravia, 1992). From here, they can follow two pathways: either reach the rectum and get excreted with the feces, or enter the hemocoel and reach the hemolymph where they can divide as free parasites or invade and multiply within hemocytes (Grisard et al., 1999b). From the hemolymph, the parasites can invade the salivary glands and reproduce and differentiate into metacyclic trypomastigotes, which are the infective forms that will be inoculated in the mammalian host.
The forms found in the midgut of triatomines are round or oval shaped small flagellate or aflagellate, epimastigotes without well developed undulating membranes, and trypomastigotes, which are usually shorter and outnumbered by the epimastigotes
(Vallejo et al., 1988; D'Alessandro and Saravia, 1992). The epimastigotes are usually the dividing forms. Epimastigotes and trypomastigotes of similar morphological characteristics have been seen in the feces as well, although Tobie (1965) reported that the trypomastigotes found in the feces of Rhodnius prolixus were quite different from those present in the salivary glands. 25
The flagellates in the hemolymph - also epi and trypomastigotes - are similar to those in the midgut. Depending on the stage of the infection in the triatomine, large numbers of elongated epimastigotes can be found in the hemolymph (Cuba Cuba, 1998), which may have a whitish color due to the abundant presence of trypanosomes. The same is true for the salivary glands. Cuba Cuba (1998) reports that the salivary glands of
R. prolixus are usually bright red and therefore easily identifiable in healthy, uninfected individuals, but that they change to a white color upon infection with T. rangeli. The epimastigotes in the hemolymph can undergo binary division or multiple division of big masses of trypanosomes from where the epimastigotes come out (D'Alessandro and
Saravia, 1992). Metacyclic trypomastigotes have also been seen in the hemolymph, some in the process of dividing. Besides the extracellular forms, intracellular forms in hemocytes are also seen in the hemolymph (D'Alessandro and Saravia, 1992; Cuba Cuba,
1998). Those forms can be either coiled or long epimastigotes or trypomastigotes, amastigotes, or spheromastigotes (Cuba Cuba, 1998). It is not quite clear yet if those intracellular forms are developing stages of the parasite, or if they are only phagocytosed parasites (D'Alessandro and Saravia, 1992).
Approximately a week after the invasion of the hemolymph, epimastigotes appear in the salivary glands, some of them still in binary or multiple division (D'Alessandro and
Saravia, 1992). Long trypomastigotes are also present at this time, and by day 10, metacyclic trypomastigotes are present, which will be the most prevalent forms in the salivary glands after a few days. The metacyclic trypomastigotes are short if compared 26 with long forms of epimastigotes and medium sized trypomastigotes that can also be seen in the salivary glands (Añez, 1981; D'Alessandro and Saravia, 1992). The entry mechanism into the salivary gland involves accumulation of the parasites around the salivary gland capsule, disruption of the inner layers of the capsule, passing of the parasites between the muscle cells, and penetration of the basal membrane of the glandular cells (D'Alessandro and Saravia, 1992). Electron microscopy has shown that the flagellum penetrates the cells first, and that the cytoplasm of the infected cell invaginates and forms a vacuole in which the parasite is transported through the glandular cell to the lumen of the conducts of the salivary gland (Cuba Cuba, 1998; Guhl and
Vallejo, 2003). Figure 2 shows a diagram of a simplified life cycle of T. rangeli, and figure 3 illustrates some of the forms of the parasite that have been seen either in the vector or in the reservoirs.
It is important to mention that according to several authors (Añez et al., 1987;
D'Alessandro and Saravia, 1992; Cuba Cuba, 1998; Machado et al., 2001; Guhl and
Vallejo, 2003) not all triatomines exposed to T. rangeli become infected. This is greatly influenced by the relatively high heterogeneity of T. rangeli. Many factors play a role in the behavior of T. rangeli in the insect host: identity of the strain, age of the culture, form of maintenance of the parasite (i.e. culture only or culture-insect-culture, culture-insect- mammal-culture, etc.). Machado and collaborators (2001) observed that, when using strains of T. rangeli from different geographical origins, some species of the genus
Rhodnius from South America were susceptible to infection of the hemolymph but not of 27 the salivary glands, which could suggest a good level of adaptation between strains and vectors of the same geographical origin. Experimentally, T. rangeli parasites from cultures are directly inoculated into the insect’s hemocoel to guarantee a successful invasion of the salivary glands in order to keep the infectivity of the culture forms for long periods of time (Cuba Cuba, 1998).
Triatominae insects can become infected when they ingest circulating trypomastigotes from an infected mammal. D’Alessandro and Saravia (1992) affirm that it is possible that a vector can become infected by ingestion of metacyclic trypomastigotes recently inoculated in the mammal by another triatomine. Cannibalism and hematoklepty are not unusual among triatomines, and these might be other sources of infection of a healthy individual, but it is not known how important it could be in the epidemiology and maintenance of the parasite in nature. Insects other than triatomines have been reported to be infected by T. rangeli. Among those, Cimex sp. (bedbugs) and sandflies (Phlebotominae) are the most important ones (Miles et al., 1983), though the role of these species in the transmission of T. rangeli has been proven insignificant.
Pathogenicity to the insect vector
In contrast to what happens with the vertebrate reservoirs, T. rangeli is pathogenic for the invertebrate vector. Species of the genus Rhodnius have usually been used as a model for studies of the pathogenic effects of T. rangeli. One of the first reports of those 28 effects was made by Watkins (1971), who observed lysis of the muscle cells of the midgut of R. prolixus when T. rangeli parasites invaded the hemocoel. Cuba Cuba
(1975), using other species of Triatominae (Panstrongylus herreri and Dipetalogaster maximus) as models, observed evidence of damage such as deformities, interference with molting, and difficulties in eating when those species where infected with T. rangeli.
A very interesting report made by Garcia and collaborators (1994) states that the ability of R. prolixus to find the capillaries of the vertebrate host diminishes when the insect’s salivary glands are infected with T. rangeli. The authors attribute this effect to a decrease in the antihemostatic capability of some components of the saliva of the insect.
It would be interesting to study further in detail what is the fate of the parasites inoculated from a vector whose saliva has the characteristics described by Garcia and collaborators since a transformation into intracellular forms might be expected as a previous stage to their passage to the blood (Cuba Cuba, 1998).
The hemolymph and salivary glands are also affected upon infection of an insect by T. rangeli, and that type of effect can be easily visualized due to a change to a whitish color of both tissues. Additionally, a marked reduction of the hemocytes present in the hemolymph of infected insects has been reported (Cuba Cuba, 1998). Schaub (1992), when analyzing the effects of T. rangeli in triatomines, reported that infected individuals had a decrease in the concentration of free aminoacids in the hemolymph. However, this seemed to depend to a great extent on the virulence of the strain used for the experiments, 29 because the author also reported an increase in the concentration of alanine, glycine, and isoleucine when a highly virulent strain was used.
The cellular and humoral immune mechanisms by which some species of triatomines eliminate T. rangeli from their hemolymph are not completely understood.
Agglutination and lysis of T. cruzi and T. rangeli have been observed in the gut and hemolymph of R. prolixus (Ratcliffe et al., 1996), and it has been suggested that agglutinins interact with cell surface carbohydrates of the parasites, which in turn would determine the success or failure of the parasite to establish infection in the hemolymph or gut of the insect. These types of host-parasite interactions are going to determine if the parasite completes its biological cycle up to the invasion of the salivary glands and formation of metacyclic trypomastigotes, or the infection of the gut and hemolymph only, or gut only. A deeper understanding about the physiological and biochemical factors that prevent parasite invasion of either the hemolymph or the salivary glands of the triatomine is much needed (Grisard, 2002). In the case of the high susceptibility of the genus
Rhodnius to T. rangeli, it could be speculated that, as a result of an evolutionary pressure, the parasite developed mechanisms to evade the immune response of the insect, or that the parasite is somehow able to degrade or inhibit such mechanisms of protection elicited in the insect upon infection with the parasite (Cuba Cuba, 1998). However, these are only speculations that require proper experimentation in order to be confirmed.
Cuba Cuba (1998), in his experiments with infection of Dipetalogaster maximus by T. rangeli, observed that the parasites were present in the midgut and hemolymph of 30 the insect, but did not invade the salivary glands, regardless of the inoculation method used (feeding on laboratory infected animals, feeding from infected cultures, or intracoelomic inoculation). Moreover, the author reported active elimination of T. rangeli from the hemolymph of the insect by phagocytosis in the hemocytes. The same observations were true for Panstrongylus herreri.
Biochemistry and Molecular Biology
Studies of the biochemistry and molecular biology of T. rangeli are limited and have been made only with few isolates of specific geographic origin. Although T. rangeli appears to be less heterogeneous than T. cruzi, some of the observations made by different authors may not apply for all the strains of the parasite.
T. rangeli strains have been characterized using several biochemical techniques.
Among the most useful are complement-mediated lysis, neuraminidase production, lectin agglutination, antigenic characterization, isoenzyme analysis, and DNA analysis
(kinetoplast DNA, nuclear DNA, random amplified polymorphic DNA) (D'Alessandro and Saravia, 1992; Cuba Cuba, 1998; D'Alessandro and Saravia, 1999; Guhl and Vallejo,
2003).
31
Lysis by complement
Nogueira and collaborators (1975) were the first to report that selective lysis of epimastigotes of T. cruzi was mediated by complement in the absence of antibody.
Unlike culture epimastigotes of T. cruzi, culture epimastigotes of T. rangeli are resistant to complement lysis activated by the alternate pathway (Guhl and Vallejo, 2003) and so are the forms found in the triatomine intestine (Marinkelle et al., 1986). This difference in susceptibility to complement-mediated lysis has been used to distinguish T. cruzi from
T. rangeli in cultures or in the intestine of the vectors (Schottelius and Muller, 1984;
Marinkelle et al., 1986).
Lectin discrimination of cell surface carbohydrates
Several researchers studied the surface sugars of T. cruzi and T. rangeli with the purpose of analyzing variations among trypanosomes of the New World and also to find a rapid and reliable method for the identification of those parasites whose geographical distribution overlaps (Schottelius, 1984; Schottelius and Muller, 1984; Marinkelle et al.,
1986). The results of those investigations revealed that many strains of T. cruzi were agglutinated by lectins that react with a broad spectrum of sugars. T. rangeli, on the other hand, reacts with few lectins (Schottelius and Muller, 1984). The researchers found that several lectins are specific for D-galactose, N-acetylgalactosamine, N-acetylglucosamine, 32 and N-acetylneuraminic acid sugars present in the surface of T. cruzi epimastigotes.
More results from the same studies indicated that T. cruzi and T. rangeli epimastigotes from cultures are agglutinated with lectins from Pisum sativum, Lens culinaris, and
Canavalia ensiformis because the parasites have glucose and mannose on their surface.
T. rangeli epimastigotes from culture are specifically agglutinated by Vicia villosa, which has high affinity for N-acetyl-D-galactosamine (Miranda Santos and Pereira, 1984).
It is important to point out that the above mentioned studies were done using culture forms of the parasites; therefore, studies about the differential stage-dependent expression of carbohydrate determinants in the surface of the parasites in vivo remain to be done. In fact, there is some evidence that shows patterns of lectin receptor expression in parasites in the vector’s hemolymph or midgut are different from the parasites in culture (D'Alessandro and Saravia, 1992; Cuba Cuba, 1998). D’Alessandro and Saravia
(1992; 1998) noted that if a given concentration of a lectin does not cause agglutination of the parasites, it does not necessarily mean that the complementary carbohydrate residue is not present in the parasite’s surface, because other factors such as conformation of the determinants and their location relative to other components in the surface can play a role to prevent agglutination.
33
Neuraminidase production
Although no T. rangeli enzyme that participates in parasite-host tissue interactions has been identified so far, neuraminidase has been found in T. cruzi and T. rangeli, and large amounts of it can be secreted by T. rangeli as evidenced by the easy detection of the enzyme in culture medium of this parasite (Pereira and Moss, 1985).
Neuraminidase is present in T. cruzi in low concentrations in culture forms
(epimastigotes), but it differs considerably (specificity, pH optimum, etc.) from neuraminidase from T. rangeli, which enables it to be considered as a marker for the latter parasite (Pereira and Moss, 1985; Schottelius, 1987). Moreover, it was found that a specific inhibitor of neuraminidase from T. cruzi present in healthy human plasma does not affect neuraminidase from T. rangeli, even when used at high concentrations (Prioli et al., 1987).
Antigenic characterization
Antigenic cross-reactivity between T. cruzi and T. rangeli has been shown through a series of experiments that used techniques such as ELISA, indirect immunofluorescence, immunoelectrophoresis, immunoblotting, and double immunodiffusion (Afchain, 1979; Anthony et al., 1979; Guhl, 1982; Grogl and Kuhn,
1984; Basso et al., 1991; O'Daly et al., 1994; Saldana and Sousa, 1996, Moraes et.al., 34
2008 ). Saldana and collaborators (1995), using immunoblotting, described the finding of an antigen of ~43 kDa specific for epimastigotes of T. rangeli. Although the authors confirm that this is a marker specific for the parasite, the use in their experiments of hyperimmune sera from experimental animals could have overestimated the specificity of the reaction. Most of these studies have concluded that both parasites share more than
50% of their soluble antigenic composition, therefore, antigenic characterization has not been considered as a useful method for differentiation of T. cruzi from T. rangeli. The use of monoclonal antibodies against T. rangeli does improve the specificity of these assays and can be used with confidence for differentiation, especially in serological analysis (Anthony et al., 1981).
Isoenzyme analysis
When proteins are placed in an electric field, their mobility is determined mainly by their net charge. Changes such as mutations affect the electrophoretic mobility of the proteins. A mutation most likely results in the production of a protein that has a net charge different from that of the original protein. Enzyme electrophoresis is a method that allows for the evaluation of different patterns of charge-dependent mobility that generate polymorphisms. Those polymorphisms may in turn reflect genetic change. The organisms that are closely related at the phylogenetic level are expected to present similar patterns of electrophoretic mobility. 35
The isoenzyme analysis approach was first used with several strains of T. cruzi isolated from different geographical locations in the American continent. Those studies generated vast information about the genetic structure of T. cruzi, but little attention was given to T. rangeli. One of the first approaches to use isoenzyme analysis for T. rangeli in strains isolated in Panama (Kreutzer and Souza, 1981) showed that there is enough polymorphism among the enzymes used to permit a clear differentiation of T. rangeli from T. cruzi. Twelve of 13 isoenzymes of T. cruzi and T. rangeli from the Panama study, and 11 of 13 isoenzymes from strains of both species from Colombia (Saravia et al., 1987) were sufficiently dissimilar to allow a differentiation of the trypanosome species. Table 2 shows a list of some of the enzymes most commonly used in the studies of isoenzyme profiles.
Several authors have analyzed the efficacy of the isoenzyme analysis to distinguish intraspecific variation in T. rangeli (Kreutzer and Souza, 1981; Ebert, 1986;
Holguin et al., 1987; Acosta et al., 1991). A special contribution for the isoenzymatic characterization of T. rangeli was made by Steindel and collaborators (1994), who used
16 T. rangeli strains, eight of which were isolated from R. prolixus and humans in
Honduras, Colombia and Venezuela, and another eight were from Panstrongylus megistus or rodents (Echimys dasythrix) from the island of Santa Catarina in Brazil
(Steindel et al., 1991). These authors found that all the strains from Santa Catarina were identical in terms of isoenzymes. Also, the strains from Honduras, Venezuela and
Colombia formed a homogeneous group. The two clusters showed distinct profiles for 36 each enzyme, except for the malic dehydrogenase enzyme. This evidence supported the hypothesis of the existence of at least two different groups of T. rangeli strains. More recently, in 2005, Grisard and collaborators (2008) used isoenzyme analysis in addition to
DNA molecular tests to identify and differentiate T. cruzi and T. rangeli from samples of triatomines and mammals collected at the site of an outbreak of acute Chagas disease in the State of Santa Catarina (Brazil), showing the efficiency of this method.
DNA analysis
During the last couple of decades, DNA sequences have been used for identification and characterization of trypanosomatids. T. cruzi, T. rangeli, and other parasites are considered to be derived from several clone lineages and they show genetic heterogeneity as a result of proliferation with little or no genetic exchange (Tibayrenc et al., 1993). The intraspecific diversity of T. rangeli has been demonstrated by DNA fingerprinting, random amplified polymorphic DNA, sequences of minicircles of kinetoplastid DNA (kDNA), and analysis of the mini-exon gene (Macedo et al., 1993;
Recinos et al., 1994; Steindel et al., 1994; Vallejo et al., 1994; Grisard et al., 1999a).
Kinetoplast DNA (kDNA) is an extranuclear DNA that forms a compact network within a mitochondrial complex. kDNA represents about 10 to 20% of the parasite’s
DNA, and the network has between 5,000 and 10,000 minicircles whose sizes vary from
0.5 Kb in Trypanosoma vivax to 2.5 Kb in Crithidia fasciculata, and has 25 to 50 37 maxicircle copies that vary between 19 Kb in Bodo caudatus to 39 Kb in Phytomonas davidii (Guhl and Vallejo, 2003). The presence of large quantities of minicircles reflects the ability of the trypanosomatids to check nucleotide sequences of mitochondrial transcripts by RNA editing, in which several uracil residues are inserted or eliminated at specific sites of the sequence (Guhl and Vallejo, 2003).
The digestion of total DNA or kDNA of trypanosomatids with some restriction enzymes allows for the visualization of linearized minicircles (fingerprints). In T. rangeli, total DNA digestion with Hae III results in bands of 1.8 and 1.6 Kb that can be visualized in agarose gels (Vallejo et al., 1993; Vallejo et al., 1994). All minicircles have at least one conserved or minirepeat region that has between 100 and 200 bp. Each trypanosomatid has the same number of conserved regions. There are four copies of the conserved region in T. cruzi, and they are organized as direct repetitions, located at 90° from each other (Guhl et al., 2002). T. rangeli minicircles, on the other hand, may have one, two or four conserved regions (Recinos et al., 1994; Vallejo et al., 1994; Guhl et al.,
2002) (Figure 4).
Comparison of T. cruzi and T. rangeli minicircle conserved regions shows high homology in conserved sequence block sequences (CSB-1, CSB-2 and CSB-3), order and distance (Guhl and Vallejo, 2003). The presence of these blocks allowed the design of primers for detection of T. cruzi and T. rangeli by PCR. Primers S35 and S36 amplify a fragment of 330 bp of T. cruzi DNA with a sensitivity of 0.015 fg of DNA, or 10 parasite minicircles, or one parasite in 20 ml of blood (Sturm et al., 1989). The same primers can 38 be used also to detect T. rangeli minicircles, amplifying a 760 bp fragment (derived from minicircles of 1,600 bp with two conserved regions) and a set of fragments ranging from
300 to 450 bp (derived from minicircles of 1,600 bp with four conserved regions)
(Vallejo et al., 1999).
Vallejo and collaborators (Vallejo et al., 2002; 2003) designed a duplex PCR reaction (primers S35/S36/KP1L) for the amplification of minicircles with one conserved region (named KP1), with two conserved regions (KP2), and with four conserved regions
(KP3). This PCR approach has been used to investigate strains isolated from triatomines.
Vallejo and collaborators (2002), when studying T. rangeli strains from Rhodnius colombiensis, found T. rangeli KP1 (+) and KP1 (-) in the intestine of some specimens, and T. rangeli KP1 (-) in salivary glands of 15 individuals, which indicates that in natural infections, KP1 (+) strains can be in the intestine of the vector R. colombiensis but they do not invade its hemolymph or salivary glands.
Since the seminal papers of Welsh and McClelland (1990) and Williams and collaborators (1990), random amplified polymorphic DNA (RAPD) techniques have been used successfully for differentiation of parasites and triatomines (Steindel et al., 1993;
Steindel et al., 1994; Jaramillo et al., 2001). Steindel and collaborators (1994) used
RAPD with six primers and found out that two strains of T. rangeli from Santa Catarina
State (Brazil) formed a group clearly separated from another group of eight strains from
Honduras, Venezuela and Colombia. 39
Macedo and collaborators (1993) studied nuclear minisatellites of T. rangeli and
T. cruzi nuclear DNA using a probe named 33.15. The band pattern that they obtained allowed for the distinction of T. cruzi from T. rangeli. The dendrogram obtained revealed the existence of two groups of T. rangeli: one formed by strains from Central
America, Venezuela and Colombia, and the other formed by strains of Santa Catarina
State (Southeastern Brazil).
The study of the mini-exon gene of T. rangeli for its use as a genetic marker has proven to be a useful tool for differentiation of strains of distinct geographical regions.
Grisard and collaborators (1999a) designed two pairs of oligonucleotides (TrINT-
1/TrINT-2 and TrINT-3/TrINT-2) directed to the mini-exon gene. PCR assays using these primers were shown to be highly sensitive, specific for T. rangeli, and able to amplify the equivalent DNA content of a single parasite as template. Analysis of oligonucleotide sequences obtained revealed that T. rangeli strain SC-58 from southern
Brazil had a different electrophoretic pattern than other strains isolated from Central
America and northern South America.
Epidemiology
The distribution and prevalence of T. rangeli infections in man, other mammals, and triatomines are not completely known. Indeed, a large amount of knowledge regarding the epidemiology of T. rangeli, especially in those areas where it overlaps with 40
T. cruzi, is much needed. This information is vital for the assessment of the real prevalence of Chagas disease in endemic areas of countries of the Americas
(D'Alessandro and Saravia, 1992; Cuba Cuba, 1998).
Epidemiological studies of T. rangeli should include isolation and identification of the flagellates, and it must be determined if there is anterior transmission by the triatomines. If this is not done, the epidemiological significance of the triatomines caught cannot be properly determined (D'Alessandro and Saravia, 1992; Cuba Cuba, 1998;
D'Alessandro and Saravia, 1999).
Field studies of the transmission of T. cruzi and T. rangeli and their interactions with vectors in all areas where they are present are necessary. A good amount of information about those interactions in R. prolixus, the classical model for T. rangeli- vector studies, is available (Azambuja and Garcia, 2005; Azambuja et al., 2005), but those studies should be expanded to other species and other areas.
41
Specific Aims
Specific aim # 1: to identify, isolate and characterize T. rangeli from samples of naturally infected triatomines in Ecuador.
No previous reports of triatomines naturally infected by T. rangeli are available.
The goal of this part of the study is to detect and identify T. rangeli parasites by molecular approaches in triatomines collected in domestic and sylvatic habitats of rural areas of Ecuador where Chagas disease has been reported.
Specific aim # 2: to describe the epidemiology of the infection of T. rangeli in rural areas of Ecuador.
The distribution and frequency of T. rangeli infections in triatomines and reservoirs from different geographic regions will be assessed. The goal of this part of the study will be to determine the parasite’s preference for specific vectors and the identification of the blood meal source of triatomines by the use of molecular tests.
Specific aim # 3: to assess the interaction and cell invasion strategy of T. rangeli in a mammalian cell line in vitro.
Details about the mechanism of cell invasion of T. rangeli in mammalian cells have not been reported. The goal of this section of the study is to determine if such a mechanism is the same one that T. cruzi uses, which would indicate that the mechanism 42 is conserved although T. rangeli is not pathogenic. Experiments of immunofluorescence will be carried out to accomplish this goal.
43
Materials and Methods
Study areas
The study areas were endemic regions for Chagas disease in Manabí and Loja provinces in Ecuador (Figure 1B). Previous studies carried out by our group have shown human T. cruzi seroprevalence ranging from 5 to 15% in several rural communities of these provinces (Grijalva et al., 2005; Black et al., 2007, 2009). Infestation of human dwellings by Triatominae in these regions has also been documented in several studies
(Abad-Franch et al., 2002; Grijalva et al., 2005). Manabí is located in the western coastal plains of the country (Figure 1B). The average temperature in the study area is 25.3°C, relative humidity of 78%, and annual rainfall precipitation of 500 to 800 mm (INAMHI,
2006). Loja province is located in southern Ecuador, at the border with Peru (Figure 1B).
A variety of climates and geography are found in this region. Inter-Andean valleys in the province have physical characteristics suitable for the establishment of triatomines. The average temperature is 18.2°C, relative humidity of 74%, and annual precipitation of 300 to 700 mm (INAMHI, 2006). Rural communities with an average number of 120 houses per community were selected for the study. The selection was made based on accessibility to the villages and recent reports of presence of Triatominae vectors. The study localities in Manabí were Bejuco, Cruz Alta, La Cienega, La Encantada, Naranjo
Adentro, Pimpiguasi, Quebrada Maconta, and San Gabriel. In Loja province, the 44 communities selected were Algarrobillo, Ashimingo, Cienega, La Extensa, Machay,
Sanambay, Suanamaca, and Tuburo (Table 4).
Informed consent
A signed informed consent was obtained from the head of each household that voluntarily agreed to participate in the investigation prior to proceeding with the search for triatomines inside (domicile) and around the houses (peridomicile). Participants were informed about the purpose of the study, the activities that would be conducted in their households and around them, the potential benefits and risks derived from their participation in the study, and the names and contact information of the people conducting the study. All forms and procedures followed the regulations of the Ohio
University Institutional Review Board for research involving human subjects (Protocol
H99-15).
Insect collection
In each locality, all the dwellings (except for those that were unoccupied at the moment of the visit or those that refused to participate in the study) were inspected for the presence of triatomines according to the methodology described by Grijalva and collaborators (2005). Briefly, each domiciliary unit (including the house itself and its 45 surrounding area within a radius of 20 meters) was searched for one hour by a team of 3-
4 entomology-trained personnel who inspected places such as beds, mattresses, and cracks in the walls inside the houses, and chicken nests, places where domestic animals like cats and dogs sleep, and other places where rodents may hide or nest in the peridomicile. Live kissing bugs found were placed in individual plastic jars, thoroughly labeled, and transported to the Center for Infectious Disease Research (CIDR) in Catholic
University of Ecuador in Quito.
Live-bait traps were set randomly in the vicinity of the houses in an attempt to trap sylvatic triatomines (Noireau et al., 2002). Briefly, a live mouse was placed inside a medium sized plastic container which was in turn wrapped with double-sided tape. The opening of the container was covered with a piece of fine metallic mesh that prevented the mouse from leaving the container and also the triatomines from entering and biting the animal. The traps were distributed in palm trees that are known to serve as resting and nesting sites of mammals and marsupials that can be potential reservoirs of trypanosomes. Traps were left overnight at each location and checked the next morning for presence of triatomines.
Taxonomic identification and entomological indexes
The taxonomic identification of the adult and immature stages of the insects collected was made using available taxonomy keys (Lent and Wygodzinsky, 1979). 46
Whenever possible, the taxonomic identification was made up to the species level in both nymphs and adults. The insects collected were counted and standard entomological parameters [i.e. infestation rate (percentage of triatomine-infested houses from the total number of houses examined in each community), density (average number of collected triatomines in each house of the community), crowding (average number of triatomines in each of the infested houses), and colonization rate (percentage of houses where nymphs of triatomines were collected) were calculated (WHO, 2002; Grijalva et al.,
2005). A significant number of specimens, taken from the total number collected, were dissected to obtain samples for the assessment of feeding habits and parasitological analysis. The rest of the insects were transferred to appropriate containers and transported to the insectary of the Center for Infectious Disease Research at Catholic
University of Ecuador, where the insects were set up to form laboratory colonies for further studies.
Insect samples collection
Samples of intestinal contents, feces, hemolymph, and salivary glands were taken from each insect used in the study whenever it was possible (all the samples could not always be taken from each insect). All the procedures were done in a sterile environment to avoid contamination of the samples. Before dissecting the triatomine to take the samples, the insect was first rinsed with sterile PBS for one minute, washed in White’s 47 solution (0.25 g HgCl2, 6.5 g NaCl, 1.25 ml concentrated HCl, and 250 ml ethanol per liter of double distilled water) for 5 - 10 minutes, and finally rinsed briefly in sterile PBS
(Miles, 1993; Yeo et al., 2007). This procedure sterilizes the external part of the insect.
To begin the collection of samples, hemolymph was first obtained by cutting a leg of the
insect. At least a drop of hemolymph, when possible, was taken from the cut leg. A
small amount (~ 5 - 10 μl) was placed on a glass slide. This preparation was used to assess presence of circulating flagellates (Trypanosoma-like) organisms by microscopy.
The rest of the sample was added to a cryovial containing 20 μl of sterile PBS, properly labeled with the information pertaining to the insect from which the sample was being taken, and stored at - 20°C until further use.
The next sample taken was fecal material. For this purpose, the terminal portion of the insect’s abdomen was squeezed gently with forceps until one or two drops of feces were expelled by the insect. This sample was mixed on a glass slide with a drop of sterile
PBS. Most of this preparation was mixed with 100 ul of sterile PBS in a cryovial, and a small aliquot was left in the slide for observation in the microscope. The sample was stored as described above.
A sample of intestinal contents was taken later. A fine incision using dissecting scissors was made in the cuticle lining the lateral medium/posterior portion of the abdomen. Either a sterile pipette tip or a Pasteur pipette was introduced through the incision and a sample of the intestine was taken. This was mixed with PBS over a glass slide and then placed in a cryovial with 100 μl of sterile PBS, and microscopic 48 observation of the remaining sample in the slide was performed as described above. The intestinal contents of some specimens were quite abundant, and in such cases the sample was divided in two aliquots of 100 μl each. Samples were stored at - 20°C until further analysis.
Finally, the insect’s salivary glands were removed. To do this, forceps were used to move the insect’s head up and down and side to side for a minute in order to break the ligaments that connect it to the body. After this was done, the complete head was pulled out in a rapid movement. When done properly, the salivary glands came out attached to the head and were easily visible. They were rapidly checked for presence of flagellates in the microscope and then transferred to a cryovial containing 20 μl of sterile PBS. The samples were then stored as previously described.
Whenever possible, provided enough quantity was collected, an aliquot of each sample was inoculated into LIT medium (described below under Parasite culture maintenance) in an attempt to isolate parasites in culture media. The aliquot was mixed with 5 ml of LIT in a culture flask and incubated at 29°C. The cultures were checked after a week for presence of flagellates, and fresh culture medium was added to the flasks.
49
Blood source identification
A series of experiments to identify the triatomines’ blood meal source by PCR reactions were carried out in specimens captured in different ecotopes. The DNA of samples from intestinal contents was first isolated using the DNeasy Blood and Tissue
Kit (Qiagen; Valencia, California) following the manufacturer protocols. Concentration of the isolated DNA was quantified spectrophotometrically (OD260), diluted accordingly
to a final stock concentration of 2 μg/μl, and stored at -20°C until further use.
The approach used to determine the blood meal source was a multiplex
cytochrome b (cyt b) PCR. For this purpose, the procedures and protocols described by
Mota and collaborators (2007) were followed. These authors designed the
oligonucleotides for the PCR reaction by comparing the cyt b gene sequence of several
mammal species that are believed to serve as sources of blood meals for triatomines in
rural areas of endemic countries. A set of three primers was used: two primers [DC-cytb-
UP (5’-CRTGAGGMCAAATATCHTTYT-3’) and DC-cytb-DW (5’-
ARTATCATTCWGFGTTTAATRT-3’)] that amplify a conserved sequence region
generated by the alignment of cyt b sequences reported from the genus and species of
domestic and wild animals that could potentially serve as source of blood for the insects
(including, but not limited to, dog, cat, mouse, rat, rabbit, guinea pig, sheep, cow, goat)
which amplify a product of 420 bp. A third primer [H-cytb-DW (5’-
AGGAGAGAAGGAAAGAAGT-3’)] was used in combination with the previous to 50 amplify a shorter region of human cyt b. The product of this latter primer is a band of
315 bp (Mota et al., 2007). All the three primers were used in the multiplex assay in a concentration of 0.5 μM, with 2 μL of sample DNA, 5 μL of Master Mix (Qiagen) containing Taq DNA polymerase, all the dNTPs, and MgCl2. The amplification was
achieved in 35 cycles with the following conditions: initial denaturation at 94°C for 4
minutes, denaturing at 94°C for 30 seconds, annealing at 42.5°C for 30 seconds,
extension at 72°C for 30 seconds, and a final extension at 72°C for 10 minutes. All the
reactions were done in a GeneAmp® PCR System 9700 thermocycler (Perkin Elmer
Applied Biosystems; Norwalk, Connecticut). Products from the reaction were separated
in a 1.5% agarose gel in a 12’ by 8.5’ electrophoresis chamber (Horizon®11•14
Horizontal Gel Electrophoresis System, Gibco BRL Life Technologies; Gaithersburg,
Maryland), stained with ethidium bromide at a final concentration of 0.5 μg/ml, and visualized with a UV imaging and documentation system [Gel Doc XR+ system and
Quantity One 1-D analysis software (Bio-Rad; Hercules, California)]. Those samples that showed amplification of a single band for animal DNA were used on a second PCR reaction in which only the animal primers (DC-cytb-UP and DC-cytb-DW) were used.
The products of this second reaction were cleaned and submitted for sequencing as described below (in DNA sequencing for confirmation of parasite identity). DNA sequences were compared with the published ones from mammals that might serve as potential blood meal sources for the triatomines. 51
This multiplex assay is able to amplify human or animal DNA present in blood meals, and the advantage of using this approach is that the test can also amplify both sources of DNA simultaneously in a given sample (in this case two bands representing the products of 420 bp for animals and 315 bp for humans can be seen). Positive controls used were human and dog DNA, both isolated from blood samples using the DNeasy
Blood and Tissue DNA isolation kit (Qiagen).
In this study, a significant number of triatomines were collected in peridomestic areas (vicinity of the houses) in the majority of the communities visited. The peridomicile is usually populated with domestic birds, generally chickens, as this is a common practice in the rural areas were the study was conducted. Considering that there was a high probability that the triatomines collected had fed on birds, and that the PCR protocol described above is not able to amplify DNA from these animals, another protocol was used in order to test for the presence of avian DNA in the triatomine samples. Walker and collaborators (2004) developed a PCR assay for the identification of class-specific (Aves) DNA, and this was the approach used to test the triatomine samples. DNA isolated from the intestinal contents as described above was used in a
PCR reaction using primers specific for the amplification of avian DNA (Forward 5’-
ATAGAATGGCCTGGGTTGAAAAG-3’ and Reverse 5’-
AAGTTTTTCACACAGAGGGTGGT-3’) (Walker et al., 2004). The conditions of the
PCR reaction were: initial denaturation of one minute at 95°C; 30 cycles of 95°C for 30 seconds, 55°C for 30 seconds, 72°C for 30 seconds; final extension of 72°C for five 52 minutes. Chicken DNA isolated from blood using the DNeasy Blood and Tissue Kit
(Qiagen) was employed as a positive control. A single band of 197 bp was the expected product of this PCR reaction when avian DNA was present in the sample. Amplicons were cleaned and submitted to sequencing as described below.
Parasite controls
Several strains of parasites routinely maintained in the laboratory were used as controls in all the experiments. Three strains of T. rangeli were used as controls for both the PCR assays and for the infections in the cell invasion experiments. These strains were E1Tocuyo of Venezuelan origin (ATCC, Rockville, Maryland), Choachi of
Colombian origin (kindly donated by Dr. Edmundo Grisard from the Laboratorio de
Protozoologia, Departamento de Microbiologia e Parasitologia, Universidade Federal de
Santa Catarina, Brazil), and SC58 of Brazilian origin (donated by Dr. Grisard). The T. cruzi strains used were Brazil and Y (from stocks maintained in Dr. Mario Grijalva’s laboratory at Ohio University), and the SC28 strain (donated by Dr. Grisard). The identity of all the controls was confirmed prior to beginning the experiments.
53
Molecular characterization algorithm
A series of PCR assays were used to characterize the parasites found in the triatomine and mammal samples. Field samples taken directly from animals can be challenging to work with since contamination with other DNA sources (bacteria, viruses, protozoans, etc.) can be expected. An initial screening of all the samples was performed by the use of a PCR with primers S35 (5’-AAATAATGTACGGGTGGAGATGCATGA-
3’) and S36 (5’-GGGTTCGATTGGGGTTGGTGT-3’) which can amplify both T. cruzi and T. rangeli DNA (Sturm et al., 1989; Vargas et al., 2000; Guhl et al., 2002). Those samples that showed amplification of T. rangeli DNA in the initial screening were then used in a second PCR reaction with primers R1 (5’-CGCGGCTCGCACTGCACCTC-3’) and R2 (5’-GGCGCATCCACCGAGCACTG-3’), known to specifically amplify T. rangeli DNA (Vargas et al., 2000), whereas those samples that showed amplification of
T. cruzi DNA in the first reaction were subjected to another PCR with primers D71 and
D72, specific for T. cruzi DNA amplification. With the use of primers D71/D72 it is also possible to determine the genetic lineage (TcI or TcII) of the T. cruzi isolate (Souto et al.,
1996). There were a number of samples that showed a non-defined pattern of amplification for either parasite in the initial screening. These samples were run also with the primers specific for T. cruzi and for T. rangeli. Since primers S35/S36 can amplify DNA from both species of parasites, even in the same sample, any sign of DNA amplification seen in the first reaction was an indication of possible parasite presence, 54 likely a mixed infection with T. cruzi and T. rangeli, and therefore the specific PCR reactions explained above were performed. The samples that gave a positive amplification with the specific primers for each parasite were then utilized in a third confirmatory assay. This was a multiplex PCR approach following the protocol described by Fernandes and collaborators (2001) that was used to double check the identity of the T. cruzi and T. rangeli isolates. This multiplex assay uses five primers:
TC1 (5’-ACACTTTCTGTGGCGCTGATCG-3’),
TC2 (5’-TTGCTCGCACACTCGGCTGCAT-3’),
TC3 (5’-CCGCGWACAACCCCTMATAAAAATG-3’),
TR (5’-CCTATTGTGATCCCCATCTTCG-3’), and
ME (5’-TACCAATATAGTACAGAAACTG-3’).
These primers are directed at the non-transcribed spacer of the mini-exon gene, and allow a differentiation between T. cruzi I, T. cruzi II, T. cruzi zymodeme 3, and T. rangeli.
Three oligonucleotides (TC1, TC2, TC3) derived from a hypervariable region of the T. cruzi mini-exon repeat, and an oligonucleotide (TR) derived from a region of the T. rangeli non-transcribed spacer were used as upstream primers, whereas a common downstream primer (ME) was used as the opposing primer in the PCR reaction. PCR conditions were as follows: initial denaturation at 94°C for five minutes; five cycles of
94°C for one minute, 50°C for one minute, and 72°C for one minute; 25 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds; and, a final extension of
72°C for 5 minutes. The typical fragments expected in this test are a product of 100 bp 55 for T. rangeli, a band of 150 bp for T. cruzi Z3, 200 bp for T. cruzi I, and 250 bp for T. cruzi II. However, additional bands are usually seen in this reaction, especially when products are resolved in polyacrylamide gels. Finally, a duplex PCR from kinetoplast
DNA as described by Vallejo and collaborators (1994) and Recinos and colleagues
(1994) was carried out to type the lineage of the T. rangeli isolates. This assay employs three primers: KP1-L (5’-ATA CAACACTCTCTATATCAGG-3’), S35, and S36. Three possible DNA products can be obtained depending on the organization of the conserved regions of the minicircles in the kinetoplast DNA: a fragment of 760 bp from minicircles with two conserved regions (KP2), a band of 165 bp corresponding to minicircles with only one conserved region (KP1), and a series of bands ranging from 300 to 450 bp that come from minicircles with four conserved regions (KP3). Based on the amplification patterns, the isolates can be placed in the lineage KP1 (+) or in KP1 (-). The PCR conditions for this assay are as follows: initial denaturation at 94°C for 4 minutes; 34 cycles of 94°C for one minute, 65°C for one minute, and 72°C for one minute; and, a final extension of five minutes at 72°C. Appendix 1 shows a simple diagram that explains the working flow of the molecular analysis algorithm, and Table 3 provides a summary of the different primer oligonucleotides used in the PCR assays.
56
DNA sequencing for confirmation of parasite identity
The products from the reactions which amplified T. rangeli DNA were prepared for submission to sequencing. The QIAquick PCR Purification Kit (Qiagen) was used to clean and purify the PCR products following the manufacturer’s protocols. Clean samples were sequenced in a 3130xl Genetic Analyzer (Applied Biosystems Inc.; Foster
City, California) at Ohio University’s Genomics Facility. Sequences were analyzed, edited, and compared with databases using the BLASTN and MEGABLAST functions from the National Center for Biotechnology Information (NCBI, USA) to find sequence similarities with reported DNA sequences of T. rangeli from different geographic locations.
Cell culture maintenance
BALB/c fibroblasts, clone CL7 (ATCC) were used for the cell invasion experiments. The cells were grown in flasks and maintained in Dulbecco’s Modified
Eagle Medium [DMEM (Gibco; Grand Island, New York)] with 10% fetal bovine serum
[FBS (PAA Laboratories Inc.; New Bedford, Massachusetts)] and 1% of penicillin- streptomycin solution (Mediatech Inc.; Herndon, Virginia). The cells were kept in a CO2 incubator at 37°C and 100% humidity. 57
In order to split the cells and initiate new culture flasks, the cells that had reached confluence and/or showed signs of overcrowding were unattached from the plastic flasks by the use of trypsin-EDTA solution [1X, 0.5 g of porcine trypsin and 0.2 g EDTA.4 Na per liter of Hanks’ Balanced Salt Solution (Sigma; St. Louis, Missouri)] and transferred to new flasks. Briefly, supernatant of the culture flasks was discarded, cells were washed with phosphate buffered saline (PBS), and then treated with 2 ml of trypsin-EDTA for one to two minutes. Five hundred microliters of the solution of trypsinized cells were transferred to new flasks that had 5 ml of DMEM.
Parasite culture maintenance
Two species and several strains of trypanosomes were used in different sections of the study. T. cruzi parasites were grown in liver infusion tryptose broth (LIT) with 5%
FBS, 3% hemin solution (Sigma), 1,000 units of penicillin (Sigma), 1 mg of streptomycin
(Sigma), and 1 μg of gentamycin (Sigma) in one liter of solution. Tissue culture flasks
(Becton Dickinson; Franklin Lakes, New Jersey) were used to grow the parasites in an incubator at 29°C.
T. rangeli parasites were maintained in screwcap conical tubes (Becton
Dickinson) with 5 ml of Novy-MacNeal-Nicolle (NNN) defibrinated rabbit blood
(Cleveland Scientific Ltd.; Bath, Ohio) agar slants overlaid with 3 ml of LIT (NNN +
LIT) supplemented with 10% FBS, and penicillin and streptomycin in the same 58 concentrations indicated above. The tubes were kept in an incubator at 29°C and 100% humidity.
Two different approaches were used to obtain a significant number of infective
(trypomastigote) forms of T. cruzi and T. rangeli to be used for the infection experiments.
For T. cruzi, 8-day old culture parasites growing in LIT were collected, washed twice with PBS, resuspended in DMEM medium, and added to a 48-hour BALB/c fibroblast culture in a culture flask and allowed to interact for 4 - 5 days. At day five post infection, the majority of the parasites present in the cell culture medium were trypomastigotes as confirmed by microscopy. Supernatant was collected in 15 ml Falcon polypropylene conical tubes (Becton Dickinson) and centrifuged at 500 x g for 10 minutes. Pelleted parasites were resuspended in DMEM, the concentration was adjusted, and the trypomastigotes were used for the infection experiments.
Production of trypomastigote forms of T. rangeli was achieved by following the protocol described by Koerich and collaborators (2002). Briefly, parasites grown in
NNN + LIT cultures for 8 days were collected in a conical tube, centrifuged at 500 x g for 10 minutes to pellet the parasites, resuspended and transferred to DMEM culture medium (pH 8.0). After 5 - 6 days, it was confirmed by microscopy that the majority of the parasites had converted to the trypomastigote form. These parasites were treated as described for T. cruzi and used for the infection experiments.
59
DNA Polyacrylamide Gel Electrophoresis (PAGE)
Polyacrylamide gels (6%) were used with the purpose of identifying extra DNA bands and having a better visualization of such PCR fragments that could be compared with those produced by DNA amplification of parasite controls to establish common characteristics of isolates and controls. The gels were cast in a Bio-Rad Miniprotean II electrophoresis chamber (Bio-Rad, Hercules, California), and the running time was ~ six hours. Ten microliters of DNA product plus three microliters of running dye (0.025 g bromophenol blue, 0.025 g xylene cyanol, and 1.5 g Ficoll 400 in 10 ml of double distilled water) were loaded directly in the wells of the gel. After electrophoresis, the gels were silver stained and visualized in a transiluminator. The primers and conditions of the assay were set up following the description of Steindel and collaborators (1994). The primers used were 3303 (5’-TCACGATGCA-3’), 3304 (5’-GCACTGTCA-3’), 3306 (5’-
AGCATCTGTT-3’), and 3307 (5’-AGTGCTACGT-3’). The PCR reactions were achieved in a GeneAmp® PCR system 9700 thermocycler (Perkin Elmer Applied
Biosystems) with as follows: initial denaturation at 95°C for 5 minutes; two cycles of
95°C for 30 seconds, 30°C for 2 minutes, 72°C for one minute; 33 cycles of 95°C for 30 seconds, 40°C for 2 minutes, 72°C for 1 minute; and, a final extension at 72°C for five minutes. DNA products were resolved in 8% polyacrylamide gels, silver stained, and visualized in a transiluminator (Bio-Rad).
60
Quantification of parasitemia in mice after infection with different strains of
T. rangeli
A series of experiments were performed with a set of mice to determine the dynamics and levels of parasitemia caused in these animals upon infection by three different strains of T. rangeli. Three mice were infected separately by an intraperitoneal injection with 1 x 107 parasites/ml each of strains SC58, E1Tocuyo, and Choachi of T.
rangeli. Parasitemia in these mice was checked starting at 24 hours post-infection by
obtaining a sample of blood from the tail of each mouse. About 20 μl of that blood were
used to fill up the hemocytometer chamber. Parasites were finally counted following
standard laboratory protocols to determine the concentration of parasites in the sample.
Polyclonal antibody production in mice
Six-week old BALB/c mice (JAX®Mice, The Jackson Laboratory; Bar Harbor,
Maine) were infected with trypomastigote forms of T. rangeli (Choachi strain) in order to generate the polyclonal antibody used in the cell invasion experiments. Five hundred microliters of a solution of 1.5 x 107 parasites/ml were injected intraperitoneally in each
mouse. Starting at 24 hours post-infection, parasitemia was checked daily in peripheral
blood until day eight. A challenge injection was given at day 30 post-infection. Serum
was collected at day 50 post-infection when the mice were supposed to be in a chronic 61 stage of infection. For collection of serum, the mice were first euthanized in a CO2 chamber. Blood was collected by cardiac puncture and transferred to 10 x 75 mm RTU glass culture tubes (Becton-Dickinson; Rutherford, New Jersey) where it was let to clot for 45 minutes. The clot was removed with a wooden applicator from the glass, and the tube was stored overnight at 4°C. The next day the serum was collected and centrifuged at 600 x g for ten minutes at room temperature. The serum was then placed in cryovials and stored at - 20°C until use.
Cell infection
BALB/c fibroblasts were grown in 18 mm circular coverslips (Fisher Scientific,
Pittsburgh, Pennsylvania) placed in 12-well cell culture plates (Corning Inc., Corning,
New York). Cells were grown until they reached confluence (~ 48 hours) and then infected with parasites. Different experiments/treatments were performed with the cells, as described in this section. In the first set of experiments, the cells were infected in separate wells with strains Choachi, SC58, and E1Tocuyo of T. rangeli at a parasite-cell ratio of 5:1 to assess infection rates with each of the three strains. Parasites were allowed to interact with the cells for 24 hours and then the coverslips were retrieved from the culture plates and washed two times with sterile PBS to remove non-adherent cells and extracellular parasites. Cells were then fixed with a solution of 4% paraformaldehyde
(methanol-free) for ten minutes and washed with PBS. The cells were then 62 permeabilized in a solution of 1% Triton-X (Sigma)/PBS for one minute, and then washed with PBS. The coverslips were then incubated for 40 minutes in a solution of primary antibody (mouse anti-T. rangeli serum, 1:700). Extensive washing with PBS for
20 minutes was performed at this point to remove all non-attached primary antibody.
Cells were then incubated for 40 minutes with the secondary antibody [FITC-labeled goat anti-mouse IgG (Southern Biotechnology Associates; Birmingham, Alabama)].
Coverslips were washed twice with PBS, dried at room temperature, and then mounted on a glass slide containing a drop of SlowFade® Gold antifade reagent with DAPI
(Invitrogen; Carlsbad, California). Mounted coverslips were stored in the dark for 24
hours. Cells were visualized and analyzed using a Carl Zeiss LSM510 Axioplan 2 laser scanning fluorescence microscope (Carl Zeiss MicroImaging Inc.; Thornwood, New
York) and the LSM ZEN 2007 software (Carl Zeiss; Jena, Germany). The number of
intracellular parasites per 200 mammalian cells was determined by counting on triplicate
coverslips.
Infection studies
Fluorescent antibodies were used to assess the invasion mechanism of T. rangeli.
These antibodies included rat anti-mouse LAMP-2 [lysosome associated membrane
protein 2 -monoclonal antibody GL2A7- (Developmental Studies Hybridoma Bank,
University of Iowa)], Alexa Fluor-488-labeled goat anti-rat IgG (Molecular Probes Inc.; 63
Eugene, Oregon), and Texas Red®-labeled goat anti-mouse IgG (Molecular Probes Inc.).
The Brazil strain of T. cruzi was used as a control for the first invasion experiment.
The cells used for the fluorescence assays were treated as described before, with
some modifications to follow the procedures used by Woolsey and collaborators (2004).
Briefly, mammalian cells were plated onto glass coverslips in 3.5 cm2 dishes at a density
of ~ 5 x 104 and grown for 48 hrs. Parasites at a rate of 5:1 were added to the cell
cultures and let to interact with the cells for the times determined in each experiement.
At each time point, coverslips were fixed in 4% paraformaldehyde (PFA)/PBS and then
washed with sterile PBS. Cells were incubated with primary antibodies in a humidity
chamber for 40 minutes and washed with PBS for 20 minutes. Incubation with secondary
antibodies was achieved in a humidity chamber for 40 minutes. Finally, cells were
washed again with PBS for 20 minutes, and coverslips were mounted on a glass slide
containing a drop of SlowFade® Gold reagent with DAPI. The slides were stored
overnight in the dark at room temperature, and then visualized using the equipment and software described before. The number of either intracellular parasites per 200 cells or the percentage of LAMP-2 positive vacuoles was counted on triplicate coverslips.
Whenever LAMP-2 was used in the experiments, the cells were fixed with methanol
(instead of paraformaldehyde) and permeabilized with 0.5 % saponin (instead of Triton-
X) for best results, according to the supplier’s recommendations. Drug pretreatments of the cells were as follows: 2 μM cytochalasin D for 10 minutes; 40 nM wortmannin for 30 minutes. Since the infection rate of T. rangeli is lower than that of T. cruzi, the cells were 64 infected with a large amount of trypomastigotes (at a ratio of 5:1 parasites to cells) in order to achieve efficient cell invasion.
Statistical analysis
Data were analyzed and compared using one-way analysis of variance (ANOVA).
Tukey and Scheffe post-hoc tests were used to compare means. Differences were considered significant when p < 0.05. The statistical software package SPSS® 16.0 for
Windows (SPSS Inc.; Chicago, Illinois) was used to run the test.
65
Results
Collection of triatomines and their samples
Specimens of Rhodnius ecuadoriensis and Panstrongylus howardi were collected in Manabí province, whereas Triatoma carrioni and R. ecuadoriensis were found in Loja.
Localities in Manabí showed infestation rates ranging from 10% to 30% infested houses per community, whereas in Loja the range was from 5 to 34%. The insect density found in Manabí ranged from 1 to 19 insects per house, and in Loja from 1 to 28. Crowding was calculated in a range from 6 to 79 insects per infested house in Manabí, and 8 to 152 in Loja. Evidence of colonization was found in all but one of the study communities, and ranged from 40% to 90% of infested houses with presence of nymphs in Manabí, and 0% to 100% in Loja (Table 5). Individuals of R. ecuadoriensis and P. howardi were collected mainly in peridomestic habitats, whereas specimens of T. carrioni were collected mainly in the domestic environment (Table 6). Sylvatic individuals of R. ecuadoriensis were found in one community in Manabí and in one community in Loja, and sylvatic P. howardi were found only in one community in Manabí (Table 6). No sylvatic individuals of T. carrioni were collected. A sample of 191 immature stages
(nymphs II, III, IV, and V) as well as adults from three species (R. ecuadoriensis, P. howardi, and T. carrioni) were selected for the study (Table 7). A total of 500 samples
(including hemolymph, intestinal contents, feces, and salivary glands) from 191 66 triatomines were analyzed from Loja and Manabí (83 and 108 insects, respectively) provinces of Ecuador during the summers of 2004, 2005, and 2006 (Table 8). Two hundred seventy two samples came from Manabí and 228 from Loja. Fifty samples came from T. carrioni in Loja province; 119 samples from P. howardi in Manabí; 178 from R. ecuadoriensis in Loja; and, 153 from R. ecuadoriensis in Manabí (Table 8).
Initial screening showed amplification of DNA from trypanosomes
The initial screening of the samples using a PCR reaction with primers S35/S36 revealed that T. cruzi DNA amplification was achieved in 10.1 % of all the samples analyzed [16.8 % of all the R. ecuadoriensis samples (taken from 23.8 % of the insects analyzed), 18.5 % of T. carrioni samples (from 35.7 % of insects), and 38.9 % of P. howardi samples (from 30.8 % of the insects)], whereas T. rangeli amplification was evidenced in 3.5 % of the total number of samples [8.4 % in samples from R. ecuadoriensis (from 11.5 % of the insects analyzed), 3.7 % in those from T. carrioni
(from 21.4 % of the insects), and 4 % in samples from P. howardi (from 12.8 % of insects analyzed)]. Mixed infections with both parasites were found in 2.2 % of all the samples [5.6 % of the samples from R. ecuadoriensis (coming from 6.1 % of the insects analyzed), 4 % of the samples from T. carrioni (coming from 28.6 % of insects), and 4.9
% of the samples from P. howardi (from 15.3 % of insects)] (Table 9).
67
Presence of T. cruzi DNA in the triatomine samples was confirmed in a PCR reaction with primers that amplify the 24Sα rDNA gene
The samples that showed amplification of a single band of 330 bp with primers
S35 and S36 were used in a second reaction with primers D71 and D72, which specifically amplify T. cruzi DNA (Figure 6). Amplification was seen in all these samples that originally amplified with primers S35 and S36. Additionally, primers D71 and D72 allowed for the identification of the two major genetic lineages of T. cruzi (T. cruzi I and T. cruzi II). The majority of the samples amplified a single band of 110 bp, indicative of T. cruzi I genetic lineage. Two samples however amplified the expected band of 125 bp characteristic of T. cruzi II. These two samples corresponded to specimens of intestinal contents of T. carrioni (nymphs) collected in the bedroom (under the mattress) of a house in the locality of Sanambay in Loja province.
Specific PCR reactions for T. rangeli confirmed the molecular identity of this parasite
All the samples that originally amplified two distinctive DNA bands (300-450 bp and 760 bp) in the initial screening PCR assay with primers S35 and S36 were tested specifically for T. rangeli to confirm the identity of the parasites present in the sample.
The samples were analyzed in a second PCR reaction with primers R1 and R2 (Figure 7). 68
In this second run all the samples showed the 450 bp band characteristic of the amplification of the P542 nuclear repetitive element of T. rangeli.
Occurrence of mixed infections with T. cruzi and T. rangeli was confirmed in samples of triatomines
Those samples in which amplification of either a single band of 330 bp (T. cruzi) or two bands of 300-450 bp and 760 bp (T. rangeli) was not completely clear and rather a diffuse pattern was observed were also submitted to a second PCR reaction with the sets of primers specific for each parasite. Amplification of DNA from both parasites was achieved separately using the specific primers for each one, and therefore occurrence of mixed infections in samples of intestinal contents and feces from six individuals (15.3 % of the insects analyzed) of P. howardi in the localities of San Gabriel and Naranjo
Adentro (Manabí province), and in intestinal contents from seven specimens (6.1 % of insects analyzed) of R. ecuadoriensis from Naranjo Adentro (Manabí) and from the locality of Algarrobillo in Loja province was confirmed. In the same fashion, mixed infections were detected in intestinal material from four (28.6 %) T. carrioni insects collected in Sanambay and Machay, in the province of Loja (Table 9).
69
The analysis of the genetic variability of the T. rangeli isolates revealed the presence of genotype KP1 (-)
Each of the DNA samples for which identity was confirmed as T. rangeli in the reaction with primers R1 and R2 were used in a PCR reaction to determine the genetic group [KP1 (+) or KP1 (-)] to which they corresponded according to the distribution of the conserved regions in their minicircles. All the samples tested (including intestinal contents, hemolymph, and salivary glands from R. ecuadoriensis, P. howardi, and T. carrioni) revealed that the isolates from Loja and Manabí represented the lineage KP1 (-), characterized by the amplification of only two DNA fragments (represented as a band of
760 bp and a series of bands of 300 - 450 bp) (Figure 8). No sample tested revealed the presence of the lineage KP1 (+).
DNA automated sequencing of DNA products from T. rangeli isolates confirmed the molecular identity of the parasite
Clean products from the PCR reaction with primers R1 and R2 were submitted for automated sequencing at Ohio University Genomics Facility. Nucleotide sequences were received and entered as a nucleotide query in the programs MEGABLAST and
BLASTN (NCBI) to search for nucleotide databases and find highly similar sequences among those already published of the T. rangeli genome. BLAST hits with a maximum 70 identity of at least 90% were explored further. The isolates from Ecuador (Manabí and
Loja) showed similarity with sequences of T. rangeli from Colombia and Venezuela.
The products of the multiplex PCR confirmed the identity of the isolates
The mini-exon gene multiplex PCR (primers TC1, TC2, TC3, TR, and ME) proved to be a useful tool for the confirmation of the identity of the isolates of T. cruzi and/or T. rangeli previously tested by another approach, and for the amplification and genotyping of DNA samples that have been isolated from vectors or reservoirs. In this study, all the samples (16.8 % from the total number of samples originally screened) that were tested positive with primers D71 and D72 (for T. cruzi) and 8.4 % of samples (from the total number originally screened) that amplified with primers R1/R2 (T. rangeli) were confirmed as such in the multiplex PCR (Figure 9). The multiplex PCR confirmed the presence of the lineage TcII in two samples of T. carrioni from Loja province.
Moreover, this assays determined the absence of T. cruzi zymodeme 3 in the samples analyzed.
71
The blood meal source of the triatomines was determined by molecular analysis of their intestinal contents.
Several species of animals were identified as the blood meal source of triatomines collected in Manabí and Loja provinces (Table 10). Two percent of the total number of intestinal contents samples of R. ecuadoriensis insects were found to have taken blood meals from mice, Mus musculus; whereas 4.4% had taken blood from the common rat,
Rattus rattus, and 4.4% had fed on Guinea pig, Cavia porcellus. A single sample (1.1%) had blood from the domestic cat, Felis catus, in its intestine, and 25.6% fed on chicken,
Gallus gallus. P. howardi insects from Manabí province had fed on M. musculus (4.9%),
R. rattus (26.8%), and domestic dog, Canis familiaris (2.4%). In Loja province, the blood meal sources identified for T. carrioni were G. gallus (35.7%), goat, Capra hircus
(7.1%), R. rattus (7.1%), and human, Homo sapiens (14.3%) (Figure 10).
The products obtained in the polyacrylamide gel electrophoresis by the use of random primers allowed for a better comparison of the isolates
Polyacrylamide gels can be of great help when DNA fragments produced by a
PCR reaction are not very well resolved in agarose, and therefore hard to see and use for comparisons and confirmation of the identity of an organism. In this study we selected four random primers to achieve amplification of DNA bands from the isolates from Loja 72 and Manabí provinces in Ecuador. The primers yielded several bands of different molecular weight that were easily identifiable and comparisons between patterns of similar bands were possible. A total of 22 fragments that could be identified with confidence based on their intensity and separation from other products in the gel were considered for the comparisons. Through this method it was determined that isolates from the two provinces do not differ much in terms of number of shared bands and that they appear to share more fragments with the strain Choachi than with the strain SC58, both used as positive controls. Fragments ranged from 200 to 1,200 bp approximately
(Figure 11).
The infection by trypomastigote forms of T. rangeli to mice is transient and declines rapidly over time
The quantification of the parasitemia in BALB/c mice infected with strains SC58,
E1Tocuyo, and Choachi of T. rangeli revealed that the number of parasites circulating in the blood of these animals decreased very rapidly after the initial infection (Figure 12).
The initial infection was achieved with an inoculation of a suspension of 1 x 107 parasites/ml of each T. rangeli strain in three different mice. At 24 hours post-infection, parasitemia in the mouse infected with the SC58 strain was 3 x 106 parasites/ml; 2 x 106 in the mouse infected with the E1Tocuyo strain; and, 6 x 106 in the mouse inoculated
with the Choachi strain. At 48 hours after infection, the number of parasites decreased. 73
The SC58-infected mouse had 2 x 105 parasites/ml, the mouse infected with E1Tocuyo
had 1 x 105 parasites, and the mouse inoculated with Choachi showed 3 x 105 parasites.
At 72 hours, numbers continued to decrease. The mouse infected with SC58 had 2 x 103 parasites, the one infected with E1Tocuyo had 1 x 103 parasites, and the mouse
inoculated with Choachi showed 3 x 103 parasites. By day four (96 hours post-infection),
none of the animals showed detectable levels of parasitemia when examined by
microscopy.
Three different strains of T. rangeli were used to assess infectivity in
mammalian cells in culture
Strains Choachi, SC58, and E1Tocuyo were used in a first experiment to infect a
cell culture of mouse fibroblasts (BALB/c, clone CL7) and determine the infection
capacity of T. rangeli in general and of each of the strains in particular. The number of
intracellular parasites per 200 cells and the number of parasites per cell were counted in
triplicate and the average numbers were calculated (Figure 13). In cells infected with the
SC58 strain, the average number of parasites was 25.3 ± 3.8 (mean and standard
deviation) per 100 cells and the number of parasites per cell was 2.4 ± 0.1. In cells
infected with E1Tocuyo, the numbers were 24.3 ± 2.0 intracellular parasites per 200
cells, and the number of parasites per cell was 2.28 ± 0.1. Cells infected with the
Choachi strain showed 33.0 ± 3.5 parasites per 100 cells, and 2.8 ± 0.3 parasites per cell. 74
There was a statistically significance difference (p < 0.05) between the infection rate of the E1Tocuyo strain and the infection rate of the Choachi strain (Figure 13).
There was no difference between the infection rates of the Choachi and SC58 strains, and neither was there a difference between the SC58 and the E1Tocuyo. Given the fact that infection of T. rangeli is intrinsically much lower than that of T. cruzi, the Choachi strain was used in the subsequent experiments.
The infection by T. rangeli is achieved early in the cell-parasite interaction process
These experiments were performed to assess how fast T. rangeli was able to begin the infection procees after initial interaction of the parasites with mammal cells in culture.
Similarly to what is known about T. cruzi, T. rangeli parasites were able to infect cells relatively early in the process, although at lower rates. For the experiment, BALB/c fibroblasts growing in coverslips were incubated with T. rangeli Choachi strain and let to interact for specific periods of time (7.5, 10. 15, 30, and 45 minutes). At each time point, coverslips were removed, parasites washed away, and cells stained and infection rate calculated as number of intracellular parasites per 200 cells. The procedure was done in triplicate and mean and standard deviation were calculated. At 7.5 minutes, it was observed that 9.7 parasites per 200 cells were already inside the cells. At 10 minutes, 11 parasites were seen inside the cells. At 15 minutes post-infection, 19.3 parasites were 75 infecting the cells; 24.7 parasites at 30 minutes; and, 33 parasites at 60 minutes (Figures
14 and 15).
Treatment of cells with the actin inhibitor cytochalasin D decreases the infection rate of T. rangeli
In order to assess the cell infection mechanism used for T. rangeli as compared with that known for T. cruzi, culture cells received a treatment with 2 μM cytochalasin D for ten minutes. Cytochalasin D is a compound that inhibits actin polymerization. The treatment of the host cells with this metabolite resulted in a decrease in the infection by T. rangeli. There was a lack of detectable parasites in the cells at 7.5 minutes post- infection. At 10 minutes, only 2.1 parasites per 200 cells were seen, whereas at 15 minutes there were 6.7 parasites inside the cells, and 13.3 parasites were present at 30 minutes. At 60 minutes post-infection, 19.3 parasites were detected in the cells (Figure
16).
Wortmannin pre-treatment of cells reduced the infection rate of T. rangeli
Wortmannin, a fungal derivative, is a potent inhibitor of Phosphoinositide-3- kinases (PI-3). Woolsey and collaborators (2003) found that PI-3 activity is required for lysosome association with invading trypomastigotes and for vacuole maturation during 76 the cell invasion process of T. cruzi. In comparison with non-treated control cells, it was observed in this experiment that the infection by T. rangeli was reduced in cells that were pre-treated with a solution of 40 nM of wortmannin for 30 minutes. At 7.5 minutes, only
3.6 parasites per 200 cells were seen in the preparation. At 10 minutes, 4.7 parasites were detected. At 15 minutes, 10.7 parasites were counted, whereas 13.7 were seen at 30 minutes, and 20 parasites were observed at 60 minutes (Figure 17).
Lysosome-associated membrane proteins are present early in the infection process of T. rangeli
BALB/c fibroblasts grown in cell culture were assessed for their ability to generate early lysosomes that could fuse with the membrane surrounding an invading T. rangeli trypomastigote. A specific membrane protein marker was targeted for this purpose. The rat-anti mouse lamp-2 (lysosome associated membrane protein 2, monoclonal antibody GL2A7) antibody was used in this experiment. This antibody is able to label presumptive lysosomes (and late endosomes) in fixed and permeabilized cells. In our experiments, the presence of the lysosomes was detected as early as 7.5 minutes post-infection (Figure 18), and remained detectable through all the time points until 60 minutes when the experiment was finished (Figure 19).
77
Discussion
T. rangeli is the second most important trypanosome able to infect humans in the
American continent. As a laboratory model organism, T. rangeli is very interesting to study for several reasons. One of the most important is that in many countries in Central and South America, the geographical distribution of T. rangeli overlaps with that of T. cruzi, the pathogenic protozoan parasite known to cause Chagas disease. Moreover, these two parasites are able to infect the same invertebrate and vertebrate hosts, including humans. As a result of this, detection of false seropositive cases of infection with T. cruzi is not uncommon due to a cross-reactivity of the immune response against the two parasites (Guhl et al., 1985, 1987; Saldaña and Sousa, 1996; Zuñiga et al, 2007). To date, no specific pathogenicity has been confirmed upon infection with T. rangeli in a vertebrate, including humans, although several reports have confirmed the pathogenicity of this parasite to the invertebrate vector (mostly insects of the subfamily Reduviidae)
(Garcia et al., 1994; Cuba Cuba, 1998; Meirelles et al., 2005). Nevertheless, the importance of the study of T. rangeli resides in the fact that the serological diagnosis of
T. cruzi infection/Chagas disease is compromised by the presence of T. rangeli.
No previous studies have been carried out to elucidate the presence and distribution of T. rangeli in Ecuador; therefore, the present study is the first to report the occurrence of T. rangeli in naturally infected vectors of Chagas disease in endemic regions of Ecuador. Cuba Cuba (1973), who erroneously referred to R. ecuadoriensis as 78 a species of Peruvian origin, is one of the first authors to describe natural infection by T. rangeli in this triatomine species, which is one of the main vectors of Chagas disease in
Ecuador (Aguilar et al., 1999; Abad-Franch et al., 2001, 2002). Based on this report and due probably to a misinterpretation of the seminal work by Cuba Cuba (1975), data in later papers report the presence of T. rangeli and T. rangeli-like organisms in Ecuador in vectors such as R. ecuadoriensis, R. pictipes, R. robustus, and R. prolixus (D'Alessandro and Saravia, 1999; Guhl and Vallejo, 2003). Again, a lack of credibility becomes evident in these reports as R. prolixus is a species of Triatominae that does not even occur in
Ecuador (Abad-Franch et al., 2001; Abad-Franch and Aguilar, 2002). Preliminary data about the finding of T. rangeli infecting sylvatic mammals is reported in a manuscript published elsewhere (Pinto et al., 2006), where the authors mention this interesting finding when looking at mixed infections with T. cruzi and T. lewisi in mammals collected in rural areas of Ecuador. To date, the report by Pinto et al. is the only one that confirms the presence of T. rangeli in Ecuador.
R. ecuadoriensis, P. howardi, and T. carrioni are the triatomines identified in this study as the vectors naturally infected by T. rangeli in the study areas. R. ecuadoriensis is the second most important vector of Chagas disease in Ecuador (Abad-Franch et al.,
2002; Grijalva et al., 2005); thus, this finding is of utmost importance if we consider that both T. cruzi and T. rangeli are able to infect humans, which can lead to a wrong diagnosis of Chagas disease as explained above. The concern that T. rangeli infection in humans can be a confounding factor for diagnosis of T. cruzi has been recognized by 79 several authors (Guhl et al., 1987; Coura et al., 1996; Vasquez et al., 1997; Saldaña et al.,
2005) who also note the need for diagnostic techniques that clearly differentiate one species of parasite from the other. A reliable estimation of the burden of human T. rangeli infection will be possible only when adequate specific laboratory tests are used in endemic countries.
Equally important is the finding of natural infection by T. rangeli in the vector P. howardi. Although this species has been reported in Manabí province (Abad-Franch et al., 2002; Abad-Franch and Aguilar, 2003), characteristics of its biology and population dynamics are not completely known. Given the fact that infection with T. cruzi and with
T. rangeli and even mixed infections with both parasites were reported in this species, additional studies should be carried out in order to determine basic aspects of the life cycle, feeding behavior, and vectorial capacity of this insect for the transmission of trypanosomes. To add to the list of research priorities in regards of P. howardi, it is important to note that, in a previous investigation carried out in 2002 by our research group, T. dimidiata (another important vector of Chagas disease) was found in the same area (Grijalva, unpublished data), but only specimens of P. howardi were collected in
2004. A possible explanation for this would be that P. howardi may have competitively displaced T. dimidiata in the last years in this area. If this is the case, it could have serious implications in the epidemiology of Chagas disease if P. howardi has a different vectorial capacity than that of T. dimidiata. This in turn would be of great concern because of the occurrence of false-positive results for Chagas disease due to the cross- 80 reactivity in serological tests of T. rangeli and T. cruzi, the causative agent of Chagas
(Gurgel-Goncalves et al., 2004). Current seroprevalence figures for Chagas disease infection in Ecuador could change as investigation about human T. rangeli progresses, and hence the importance of the present study.
The finding of R. ecuadoriensis mainly in peridomestic areas in Manabí and Loja reveals the habitat preferences of this vector. Nonetheless, some individuals were also found inside the houses. Grijalva et al. (2005) found specimens of R. ecuadoriensis in the domestic and peridomestic areas in communities of Loja province. Although reports of vectors sporadically found in houses support the hypothesis that they are only attracted by lights at night and do not represent domiciliated specimens (Abad-Franch et al., 2001), the situation in some of the studied communities is different due to the fact that wingless immature stages (nymphs) were found in places like beds, which can be a clear indication that those vectors are undergoing a domiciliation process. Considering that significant numbers of peridomestic insects were found in places such as chicken nests, which usually are located relatively close to the houses if not directly attached to them, it is predictable that once the meal source in the nest is no longer available, those insects can migrate inside the houses and feed on people. However, chicken nests can have a dual effect on the population dynamics of triatomines and therefore in the epidemiology of the infection by trypanosomes. On one hand, chicken nests can serve as a filter or barrier that would prevent sylvatic triatomines to enter and establish themselves inside the households. A continuous presence of chickens in the peridomicile would guarantee a 81 safe and constant blood meal source for the triatomines and these would not have the need to explore and colonize new habitats. Among these new environments, the interior of the house would be the next in the list given the proximity to the chicken nests and the availability of new meal sources. On the other hand, having the nests very close to the houses would mean that, when chickens are not around or the population of triatomines grows very large, those insects will eventually make their way inside the houses, find new meal sources (domestic animals that are kept inside the houses and humans) and start a process of colonization. Hence, the need for the implementation of strategies to avoid or reduce the contact between insects and humans.
Infection of T. carrioni by T. rangeli is reported for the first time in this study.
The geographical distribution of T. carrioni is restricted to the interandean valleys of
Ecuador, especially in the southern provinces of Azuay and Loja, and in northern Peru
(Abad-Franch et al., 2002; Abad-Franch and Aguilar, 2003). This triatomine seems to be rather common in Loja province, and can be found in domestic, peridomestic, and sylvatic areas (Abad-Franch and Aguilar, 2003; Grijalva et al., 2005). Its presence in domestic environments has been associated with high human infection rates by T. cruzi
(Abad-Franch and Aguilar, 2003). The specimens collected for this study were found in the peridomicile (in chicken nests) and inside the houses (in cracks of walls located close to beds and underneath mattresses or any other type of bedding). The finding of T. carrioni naturally infected by T. rangeli in Loja province is of great interest given the habitat preferences of this species and its potential to harbor and most likely transmit T. 82 rangeli to animals and humans. The finding of T. rangeli in samples of intestinal contents and also salivary glands of T. carrioni supports the possibility that this triatomine would be a potential vector of T. rangeli. However, as mentioned before, additional specific studies on the vectorial capacity of T. carrioni should be performed before stating that this species is indeed a vector of T. rangeli.
If we compare the numbers of samples in which infection was detected by microscopy and the number of samples in which a PCR reaction gave a positive result, we can see that the numbers detected by the first method were lower than those detected by the second method. In this study, microscopy proved to be a not very reliable method to detect trypanosomes in fresh samples from triatomines. Not only did it miss positive samples that later were identified by PCR, but it is also not accurate enough when trying to determine the identity of the trypanosomes found in the sample. Epimastigote and trypomastigote forms of T. cruzi and T. rangeli are quite similar in morphology, and not even a much trained technician can tell them apart with complete confidence
(D’Alessandro and Saravia, 1992, 1999; Vargas et al, 2000).
The occurrence of T. rangeli naturally infecting R. ecuadoriensis and P. howardi in Manabí and T. carrioni in Loja, Ecuador, provides further knowledge about the vector preferences of the parasite and expands the information of the geographical distribution of the parasite in South America. Additional studies that include a greater number of triatomines, collected in several endemic areas of Ecuador, and analyzed with other molecular markers are needed to fully understand the distribution of T. rangeli in the 83 country and the interaction of the two hemoflagellates with their vectors. An investigation of the genetic proximity among different T. rangeli strains isolated from several geographical regions will help to elucidate hypothetical migratory routes that led to the establishment of the parasite in these regions in Ecuador.
T. cruzi, the parasite that causes Chagas disease, was detected in samples analyzed in this study. Chagas is a complex zoonosis that affects approximately 5 - 6 million people in the American continent. Although the main focus of this study was T. rangeli, given the fact that the two parasites interact in the same vectors and mammal reservoirs, it was considered important to evaluate the presence and genetic makeup of the T. cruzi isolates found in the samples analyzed. Not only did we aim at the identification of T. cruzi in the samples, but we were interested in the genetic lineage detection of this parasite as well. T. cruzi has traditionally been classified in two main phylogenetic lineages, namely T. cruzi I (TcI) and T. cruzi II (TcII) (Anonymous, 1999).
It has been noticed that T. cruzi I is predominantly associated with the sylvatic cycle and
T. cruzi II is mainly found within the domestic cycle and sometimes connected to severe human cases of Chagas disease in countries of southern South America, such as Brazil,
Chile, and Argentina (Souto et al., 1996; Zingales et al., 1998). On the other hand, in countries like Mexico, Panama, Central America, Colombia, and Peru, T. cruzi I is the predominant lineage isolated from vectors and related to cases of Chagas disease although there have been reports of T. cruzi II being isolated from specimens of
Triatominae in these areas (Cuervo et al., 2002; Montilla et al., 2002; Higo et al., 2004; 84
Triana et al., 2006). In the present study, according to the results of the 24Sα ribosomal
DNA PCR, all but two T. cruzi positive samples of intestinal contents from different individuals of T. carrioni collected in Loja province were identified as belonging to the T. cruzi I lineage. This finding adds to the information available about the natural trend seen about T. cruzi I being the primary lineage present in northern South America and in
Central America. However, it was quite interesting to find out that T. cruzi II was also present in samples of triatomines. The samples came from two T. carrioni (a nymph III and an adult) found in a domestic environment (inside a house, in the bedroom, underneath the mattress in the bed) in Loja. Considering that the identification was made directly from a sample of intestinal contents from the insects, it is valid to assume that the
T. cruzi II lineage may be circulating in this region of Ecuador. It has been noticed that a strain selection effect can operate when T. cruzi parasites have been isolated in laboratory culture or subjected to another form of expansion (inoculation in mice, xenoculture, etc.) prior to the identification of their genetic lineage (Macedo and Pena, 1998; Steindel et al.,
2008), which may lead to an underestimation of the parasite diversity in natural infections. The fact that T. carrioni specimens were found both in domicile and peridomicile areas in the communities of Loja province can have an important epidemiological significance if this species is indeed a competent vector of T. cruzi II.
Nevertheless, a statement of whether the T. cruzi II isolates found are exclusively associated with T. carrioni in Loja could not be made at this point. Additional investigation that involves comprehensive studies and confirmatory molecular assays will 85 be required to elucidate and clarify the situation of the natural infection by T. cruzi II in vectors, reservoirs, and people in southern Ecuador.
Two groups of T. rangeli with different molecular characteristics have been identified in Latin America. One group, called KP1 (+), presents three types of minicircles of DNA called KP1, KP2, and KP3, whereas the other group, KP1 (-), presents only two kinds of minicircles, KP2 and KP3 (Grisard et al., 1999; Vallejo et al.,
1999, 2002, 2003, 2007; Guhl et al., 2002; Urrea et al., 2005). In the present study, all the T. rangeli isolates analyzed by PCR (primers S35/S36/KP1-L) were identified as KP1
(-). Isolates were obtained from salivary glands, hemolymph, and intestinal contents of
R. ecuadoriensis, P. howardi, and T. carrioni. T. rangeli has been traditionally associated with a preference to infect vectors of the genus Rhodnius, and to present strong relationships of adaptability with local vectors. For instance, it was demonstrated experimentally that T. rangeli strains isolated from R. colombiensis or R. pallescens did not invade the salivary glands of R. prolixus, and isolates from this last vector were not able to invade salivary glands of R. colombiensis or R. pallescens (Guhl et al., 2002). In the same way, it is hypothesized that specific molecular lineages [KP1 (+) or KP1 (-)] of
T. rangeli would also be associated to specific species of vectors in different geographic regions (Azambuja et al., 2005; Vallejo et al., 2007). Our finding further expands the knowledge about the molecular lineage of the strains of T. rangeli that occur in South
America, and it is in concordance with reports that identify strains isolated from R. ecuadoriensis (from Peru), R. colombiensis, and R. pallescens as KP1 (-), whereas strains 86 isolated from R. prolixus are KP1 (+) (Grisard et al., 1999; Vallejo et al., 2002, 2003;
Urrea et al., 2005; Cabrine-Santos et al., 2009). The finding of T. rangeli KP1 (-) strains in Ecuador also supports the idea of a co-evolutionary adaptation between the KP1 (-) strains, which circulate mainly in the Andes corridor, with vectors of the “pallescens” group of Rhodnius (R. pallescens, R. colombiensis, and R. ecuadoriensis) and the co- evolution of KP1 (+) strains, which circulate to the east of the Andes, with vectors of the
“prolixus” group (R. prolixus and R. neglectus) (Urrea et al., 2005). The natural infection of P. howardi and T. carrioni by T. rangeli KP1 (-) strains is reported for the first time in this study. The epidemiologic importance of these two vectors has yet to be studied more in detail since they appear to be able to harbor T. cruzi and T. rangeli, and even mixed infections.
The multiplex PCR (primers TC1, TC2, TC3, TR, and ME) described by
Fernandes and collaborators (2001) confirmed to be an efficient alternative tool for the identification of T. cruzi and T. rangeli, and for the typing of the T. cruzi lineage in samples taken directly from field specimens. This assay recognized all the samples previously identified as positive in the specific tests for T. cruzi (24Sα rDNA gene) and for T. rangeli (P542 nuclear repetitive element). The advantage of using this multiplex assay is that in just one run it is possible to detect the presence of T. cruzi DNA and, if present, type the molecular lineage of that isolate (either T. cruzi I, T. cruzi II, or T. cruzi
Z3), and also to amplify T. rangeli DNA. The disadvantage of using this approach could be that it requires the use of polyacrylamide gels (usually 6 to 8 %) if one wants to 87 visualize the PCR products clearly since the DNA fragments are relatively close in size
(ranging from 100 to 250 bp). Agarose gels can still be used to resolve the products, but they must be at least 2 % and the length of the electrophoresis run must be longer than usual.
In an effort to contribute to the current knowledge about the epidemiology of the vectors involved in T. cruzi and T. rangeli in rural areas of Ecuador, a section of this study focused on the identification of the blood meal sources of the triatomines analyzed.
The use of techniques such as dot-ELISA has been reported previously as a tool to investigate the blood meal origin of blood-feeding arthropods (Gomez et al., 1998;
Agrela et al., 2002; Feliciangeli et al., 2004). The dot-ELISA technique can have limitations in regards to the spectrum of potential sources that can be analyzed and the time and reagents needed for the procedures. With this in mind, a different approach was explored for this study. Molecular techniques based on PCR analyses have been developed lately to investigate the blood meal origin in triatomines particularly (Freitas et al., 2005; Bosseno et al., 2006). These techniques have the advantage of demanding less time to get the results and the ability to look for several potential vectors at the same time. However, these techniques have yet to be improved and standardized for specific types of samples. Variables such as the physical quality of the collected insects, the amount of intestinal sample, biological contamination, and the time since the last blood meal can have a detrimental effect on the results obtained with the molecular techniques.
Two PCR approaches were used in this study: a multiplex cytochrome b (Mota et al., 88
2007) and an assay to identify the presence of avian DNA (Walker et al., 2004). These approaches proved to be useful for the investigation of the blood meal source of triatomines as several mammal species were identified in Loja and Manabí provinces:
Mus musculus, Rattus rattus, Cavia porcellus, Felis catus, Canis familiaris, Capra hircus, and Homo sapiens, as well as an avian species, Gallus gallus. The results obtained unfortunately do not allow for a precise description of possible host preference patterns and the dynamics of the feeding of the triatomines in Ecuador, but are important in describing specific mammal species that may have a key role in the maintenance of the triatomines and their associated trypanosomes in the peridomestic and domestic cycles of transmission in the studied areas. Despite the relatively low number of insects found to have a sample of intestinal contents of good quality to allow the identification of the blood meal source by the technique used in the study, chicken blood (Gallus gallus) was the most prevalent bloodmeal source for R. ecuadoriensis and T. carrioni. However, this affirmation could be biased because of the fact that most of the insects of these two species were captured in peridomicile habitats associated with chickens. Chickens and chicken coops placed very close to the houses are a common practice in rural areas of
Ecuador. Sylvatic triatomines attracted to domestic habitats find chicken coops as a comfortable environment with a continuous source of food. No samples with evidence of chicken blood with another species’ blood were found. However, a sample from an adult T. carrioni collected in a chicken coop had fed on goat but not chicken. This is just an example of the need for more detailed studies to understand how triatomines substitute 89 hosts across habitats. Only one insect was found to have fed on dog. This may seem unusual if we consider that dogs are common domestic animals in most, if not all, the houses visited, and that these animals have been implied as key reservoirs for the domestic cycle of T. cruzi (Cohen and Gurtler, 2001). The identification of only one insect that had fed on dog blood among all the insects analyzed could be attributed to either the relatively low number of insects collected or to the fact that most of the peridomiciliary insects are associated with chicken coops and do not have the need to select other hosts in this environment. A similar situation happens with domestic cats as blood meal source. Only one insect found in the peridomicile of a house in Loja province was found to have fed on cat blood. Cats are also very common in the studied communities and might represent a preferred triatomine host. However, this was not the case in this study. The common rat, on the other hand, seems to be a preferred host for the triatomines in the localities studied as it was identified as a the only blood meal source common to samples of R. ecuadoriensis, P. howardi, and T. carrioni. Moreover, the only evidence of a mixed blood meal came from a specimen of T. carrioni that had fed on rat and on human. This finding is interesting not only because of the epidemiological significance in terms of host preference of this species of triatomine, but also because of the potential for inter-specific disease transmission between species involved in the feeding habitats of triatomines. Only two specimens that were found in a bed had fed on humans, and specimens that were collected in a guinea pig pen did also show a blood meal that corresponded to guinea pig. All these findings confirm the need 90 of more studies on the subject of blood meal identification, especially directed at insects collected in sylvatic and peridomestic environments, which will contribute a great amount of knowledge to the understanding of the dynamics of the movement of triatomines across different ecological niches. Additionally, alternative sample collection and analysis methods should be explored. An approach that seems appropriate in the effort to overcome the diffulty of the analysis of the blood meals would be to develop a rapid PCR-based assay that would allow the direct analysis of the blood found in the intestine of the triatomines. This approach would eliminate various sources of degradation of the material, such as transport of the material from the field to the laboratory and lengthy DNA isolation.
The rapidly declining parasitemia experienced by BALB/c mice infected with trypomastigote forms of T. rangeli confirms the characteristic trend of the vertebrate infection by this parasite. Although very little is know about the life cycle of T. rangeli in the mammal host, there have been reports that suggest that parasitemia can be long although the numbers are low (D’Alessandro and Saravia, 1992; 1999). In this study, detectable levels of parasites by microscopy were seen only until day three post-infection, which contrasts greatly with the parasitemia levels seen in experimental infections with
T. cruzi, where high levels of parasite numbers are seen in the microscope by day four or five post-infection (Toma et al., 2000). One of the reasons for this difference could be related to the fact that culture forms that had been maintained in the laboratory for several months were used in the study. Tanoura and collaborators (1999) reported a similar 91 situation when they used parasite cultures of two long-maintained stock strains of T. rangeli (San Agustin and Perija) to inoculate ICR (imprinting control region) and SCID
(severe combined immune deficiency) mice. The authors state that no circulating trypanosomes were seen after day two post-infection with the long-maintained stocks, whereas high levels of parasitemia were observed when the mice were infected with fresh isolates of T. rangeli from the blood of two human cases in Guatemala. Two things are important to consider in regards to the parasitemia in mice. First, in addition to the features derived from the maintenance in culture, the parasite strains used in this study differ from strains used in other studies, and it is possible that there is a strain-associated effect that accounts for the levels of parasitemia. Second, the parasitological methods utilized to confirm the parasite persistence of up to two years in experimentally infected mammals (Cuba Cuba, 1998) differ from simple microscopy used in this study. It has been suggested that even biochemical characteristics unique to each strain of T. rangeli can play a role in the survival of the parasite in the vertebrate host (Mejia et al., 2004).
Previous reports of cell infection by T. rangeli failed to investigate how early during the interaction between cell and trypanosome the parasite begins the process of cell invasion. Osorio et al. (1995) and Eger-Mangrich et al. (2001) report the results of experiments of cell infection with different strains of T. rangeli and several cell lines.
Their experiments were aimed at confirming the invasion of cells by T. rangeli and the fate of those internalized parasites. The experiments described in their reports indicate that evaluation of cell invasion and counting of intracellular forms started no earlier than 92 one hour post-infection. There is no data presented about what happens with the parasites during the initial hour of interaction with the cells. Unlike those reports, in our study we found that the process of cell invasion by T. rangeli occurs relatively early (at least no later than 7.5 minutes) during the cell-parasite interaction, resembling what is known about the T. cruzi invasion process (Woolsey et al., 2003; Woolsey and Burleigh,
2004). The number of intracellular parasites in T. rangeli infected cells increased over the course of the invasion experiments which were done in an hour span. The Choachi strain, compared to strains SC58 and E1Tocuyo, appeared to be the most effective at invading BALB/c mouse fibroblasts, an observation that agrees with that made by Eger-
Mangrich et al. (2001) in experiments of invasion of murine peritoneal macrophages and
Vero cells by three different strains of T. rangeli. In our observations the rate of infection of the Choachi strain was a little higher than that reported in the previous study, a fact that could be attributed to the different techniques used. Eger-Mangrich and collaborators (2001) used Giemsa staining and light microscopy for their experiments, whereas immunofluorescence was used in our assays. It could be argued that the sensitivity of the fluorescence assays is higher than that of Giensa staining and that accounts for the difference in infection rates between the two reports. It is important to mention that in this study the T. rangeli-infected BALB/c fibroblasts were observed up to
288 hours post-infection and there were no signs of parasite egression from the infected cells. Intracellular parasite forms resembling amastigotes were observed within the first hour of the experiments, and they underwent small changes in shape as the time of 93 infection progressed, but no signs of intracellular division were evident. These results are in agreement with the observations made by Osorio et al. (1995) and Eger-Mangrich
(2001) when they reported an absence of intracellular multiplication of T. rangeli in vitro.
Even though our observation of a lack of intracellular multiplication agrees with previous studies, it is important to mention that the type of cell line and the strain of T. rangeli used in invasion experiments clearly can have an effect on the outcome of the experiments and this factor has to be taken into account when performing this type of study. In the same way, researchers must be completely positive about the purity of the parasite strain being used. Contamination with T. cruzi, even in small amounts, can definitely have a huge impact on the results because T. cruzi is much more prolific than
T. rangeli at invading cells and multiplying inside them.
One of the main goals of this study was to determine the route that T. rangeli uses to invade non-professional phagocytic cells in vitro. This process has been studied extensively in T. cruzi (Tardieux et al., 1992; Kima et al., 2000; Andrews, 2002; Burleigh and Woolsey, 2002; Woolsey et al., 2003; Kjeken et al., 2004; Woolsey and Burleigh,
2004) but there are no reports on the study of the cell invasion mechanism by T. rangeli as compared to that of T. cruzi; therefore, this is the first description using immunofluorescence to investigate the cell invasion mechanism of T. rangeli. T. cruzi trypomastigotes are able to invade non-professional phagocytic cells by two methods: a lysosome-dependent mechanism or a lysosome-independent pathway (Woolsey and
Burleigh, 2004). The first one involves active exocytosis of lysosomes and lysosomal 94 markers to the site of parasite entry, and the second one, recently recognized, involves formation of a plasma membrane-derived vacuole that initially lacks lysosomal markers.
The development of markers specific for lysosomes has provided a reliable tool to follow the course of the cell invasion and distinguish between the two modes of entry (Woolsey et al., 2003; Woolsey and Burleigh, 2004). According to the results of several experiments in our study, we could argue that the process of cell invasion by T. rangeli does not necessarily have the same characteristics utilized by T. cruzi. In a series of control (no pre-treated cells) experiments in our study, early lysosome-associated membrane proteins were detected as early as 7.5 minutes in BALB/c fibroblasts infected with the Choachi strains of T. rangeli. These lysosomes were labeled with a monoclonal antibody (GL2A7) which targets a specific membrane protein called lamp-2 (lysosome associated membrane protein 2) present on the surface of lysosomes and late endosomes.
The presumptive lysosomes were seen around internalized parasites during the duration of the experiment (60 minutes). When the cells were pre-treated with a solution of cytochalasin D for 10 minutes before their exposure to T. rangeli, the results were different. Cytochalasin D is a mycotoxin that has been described as a potent inhibitor of actin polymerization (Wakatsuki et al., 2001). It disrupts actin microfilaments and therefore has an effect on the mechanical properties of cells. Recruitment of lysosomes to the site of trypanosome entry in a cell has been linked to the action of actin microfilaments (Woolsey and Burleigh, 2004). In an interesting observation of cells treated with cytochalasin D, Woolsey and Burleigh (2004) saw that the rate of T. cruzi 95 invasion surprisingly increased in these cells. This was one of the key points that led the description of the alternative lysosome-independent pathway of cell invasion used by T. cruzi. In our experiments with T. rangeli, the treatment of the cells with cytochalasin D prevented the parasites from invading the cells at first. Intracellular parasites were absent at 7.5 minutes post-infection, and a few were only visible at 10 minutes post-infection.
This contrasts with the observed pattern in T. cruzi and might be an indication of the inability of T. rangeli to circumvent the lysosome-dependent pathway of invasion and use the alternative lysosome-independent pathway that T. cruzi exploits. It is known that the effect of cytochalasin D can be reversed by the cells. This might be the reason why in our experiments a few intracellular parasites were seen at 10 minutes post-infection and later. Therefore, it seems like polymerization of cellular actin is a requirement for lysosome fusion with internalized T. rangeli. Woolsey and collaborators (2003) demonstrated that host cell phosphoinositide 3-kinases (PI-3) activity is required for early lysosome association with invading T. cruzi. The family of PI-3 has been seen to be involved in a variety of cell functions including, but not limited to, cell growth, signal transduction, intracellular trafficking, and receptor-mediated endocytosis
(Vanhaesebroeck et al., 2001). In order to investigate if PI-3 inhibition prevents cell invasion of T. rangeli, cells were pre-treated with wortmannin before exposure to the parasites. Wortmannin, a derivative from Penicillium funiculosum, is known to be a potent inhibitor of PI-3 (Vanhaesebroeck et al., 2001). A significant reduction in the cell invasion by T. rangeli was observed in cells treated with wortmannin. Invasion in these 96 cells however was not diminished to the extent it was in the case of the cells treated with cytochalasin D. In the wortmannin-treated cells, it was possible to see intracellular forms at 7.5 minutes post-infection, and later, although the number of internalized parasites decreased significantly compared with the no-treatment controls. Thus, it is tempting to suggest that a) unlike T. cruzi, T. rangeli invasion of mammalian cells seems to depend to a great extent on the actin polymerization process that takes place in the host cell upon contact with the parasite; b) T. rangeli does not seem to utilize, at least very efficiently, the alternative lysosome-independent pathway proposed for cell invasion by T. cruzi; and, c) PI-3 kinase activity plays an important role in promoting an efficient cell invasion process by T. rangeli. This first attempt at studying the mechanism that T. rangeli uses to invade mammalian cells has given interesting results that should be investigated more profoundly in the future to look for possible clues as to why T. rangeli and T. cruzi, despite being very similar in many ways, have marked differences in pathogenicity to the vertebrate and invertebrate hosts. It is important to mention that even though the findings of this study provide evidence of what seems to be the preferred mechanism (lysosome- dependent) that T. rangeli uses to invade mammalian host cells, we should be aware of the fact that more detailed and extensive studies are needed if one wants to strongly argue that the mechanism of invasion by T. rangeli has marked differences with that of T. cruzi.
These additional studies should include, but not limited to, longer treatments and reapplication of the drugs used (cytochalasin D and wortmannin), use of different cell 97 types to investigate any possible effect of the host cell in the mechanism of invasion, and new or different markers to track the internalization process of the parasites.
In summary, the findings of this study provide strong evidence of the occurrence of natural infection by T. rangeli in triatomines from Ecuador, reporting infection in a species of the genus Rhodnius, which has been typically regarded as the main vector of T. rangeli, and additionally reporting natural infection in two other species of Triatominae not previously known to be able to harbor the parasite (P. howardi and T. carrioni).
However, further studies will be required in order to determine the capacity of P. howardi and T. carrioni to efficiently transmit T. rangeli to mammals through the anterior (bite) route. It is important to mention that only KP1 (-) strains of T. rangeli were identified in this study, and also the presence of T. cruzi II, both findings that are of significance in regards to the epidemiology of Chagas disease and the infection by T. rangeli in rural areas of Ecuador. Again, additional and more detailed studies should be performed to advance in the investigation of the transmission dynamics of different strains and genetic lineages of T. cruzi and T. rangeli in Ecuador.
98
Bibliography
Abad-Franch F, Paucar A, Carpio C, Cuba CA, Aguilar HM, Miles MA. 2001. Biogeography of Triatominae (Hemiptera: Reduviidae) in Ecuador: implications for the design of control strategies. Memorias do Instituto Oswaldo Cruz 96(5):611-620.
Abad-Franch F, Aguilar HM, Paucar AC, Lorosa ES, Noireau F. 2002. Observations on the domestic ecology of Rhodnius ecuadoriensis (Triatominae). Memorias do Instituto Oswaldo Cruz 97(2):199-202.
Abad-Franch F, Aguilar HM. 2003. Control de la enfermedad de Chagas en Ecuador. Special publication. International NGO’s Medicines Forum, PAHO/WHO, Ministry of Public Health of Ecuador.
Acosta L, Romanha AJ, Cosenza H, Krettli AU. 1991. Trypanosomatid isolates from Honduras: differentiation between Trypanosoma cruzi and Trypanosoma rangeli. The American Journal of Tropical Medicine and Hygiene 44(6):676-683.
Afchain D, Le Ray, D., Fruit, J., Capron, A. 1979. Antigenic make up of Trypanosoma cruzi culture forms: identification of a specific component. Journal of Parasitology 65:507-514.
Agrela I, Sanchez E, Gomez B, Feliciangeli MD. 2002. Feeding behavior of Lutzomyia pseudolongipalpis (Diptera: Psychodidae), a putative vector of visceral leishmaniasis in Venezuela. Journal of Medical Entomology 39:440-445.
99
Aguilar VHM, Abad-Franch F, Racines VJ, Paucar CA. 1999. Epidemiology of Chagas disease in Ecuador. A brief review. Memorias do Instituto Oswaldo Cruz 94 (Supl. 1):387-393.
Andrews NW. 2002. Lysosomes and the plasma membrane: trypanosomes reveal a secret relationship. Journal of Cell Biology 158:389-394.
Anonymous. 1999. Recommendations from a Satellite Meeting. Memorias do Instituto Oswaldo Cruz 94:429-432.
Añez N. 1981. Studies on Trypanosoma rangeli Tejera, 1920, 1. Deposition, migration and growth of T. rangeli in two mammals. In: Canning EU, editor. Parasitological topics: Special Publication of the Society of Protozoologists, Kansas. p 19-25.
Añez N. 1982. Studies on Trypanosoma rangeli Tejera, 1920. IV--A reconsideration of its systematic position. Memorias do Instituto Oswaldo Cruz 77(4):405-415.
Añez N. 1983. Studies on Trypanosoma rangeli Tejera, 1920. V. Developmental pattern in the alimentary canal of Rhodnius prolixus. Memorias do Instituto Oswaldo Cruz 78:183-191.
Añez N, Nieves E, Cazorla D. 1987. Studies on Trypanosoma rangeli Tejera, 1920. IX. Course of infection in different stages of Rhodnius prolixus. Memorias do Instituto Oswaldo Cruz 82(1):1-6.
Anthony RL, Cody TS, Constantine NT. 1981. Antigenic differentiation of Trypanosoma cruzi and Trypanosoma rangeli by means of monoclonal-hybridoma antibodies. The American Journal of Tropical Medicine and Hygiene 30(6):1192-1197. 100
Anthony RL, Johnson CM, Sousa OE. 1979. Use of micro-ELISA for quantitating antibody to Trypanosoma cruzi and Trypanosoma rangeli. The American Journal of Tropical Medicine and Hygiene 28(6):969-973.
Azambuja P, Garcia ES. 2005. Trypanosoma rangeli interactions within the vector Rhodnius prolixus: a mini review. Memorias do Instituto Oswaldo Cruz 100(5):567-572.
Azambuja P, Ratcliffe NA, Garcia ES. 2005. Towards an understanding of the interactions of Trypanosoma cruzi and Trypanosoma rangeli within the reduviid insect host Rhodnius prolixus. Anais da Academia Brasileira de Ciencias 77(3):397-404.
Basso B, Moretti ER, Vottero-Cima E. 1991. Immune response and Trypanosoma cruzi infection in Trypanosoma rangeli-immunized mice. The American Journal of Tropical Medicine and Hygiene 44(4):413-419.
Black CL, Ocaña-Mayorga S, Riner DK, Costales JA, Lascano MS, Arcos-Terán L, Preisser JS, Seed JR, Grijalva MJ. 2009. Seroprevalence of Trypanosoma cruzi in rural Ecuador and clustering of seropositivity within households. The American Journal of Tropical Medicine and Hygiene. In Press.
Bosseno MF, Garcia LS, Baunaure F, Gastelum EM, Soto M, Kasten FL, Dumonteil E, Breniere SF. 2006. Identification in triatomine vectors of feeding sources and Trypanosoma cruzi variants by heteroduplex assay and a multiplex miniexon polymerase chain reaction. The American Journal of Tropical Medicine and Hygiene 74:303-305.
101
Burleigh BA, Woolsey AM. 2002. Cell signaling and Trypanosoma cruzi invasion. Cell Microbiology 4:701-711.
Cabrine-Santos M, Ferreira KAM, Tosi LRO, Lages-Silva E, Ramírez LE, Pedrosa AL. 2009. Karyotype variability in KP1(+) and KP1(−) strains of Trypanosoma rangeli isolated in Brazil and Colombia. Acta Tropica 110:57-64.
Cohen JE, Gürtler RE. 2001. Modeling household transmission of American trypanosomiasis. Science 293:694-698.
Coura JR, Fernandes O, Arboleda M, Barrett TV, Carrara N, Degravel W, Campbell DA. 1996. Human infection by Trypanosoma rangeli in the Brazilian Amazon. Transactions of the Royal Society of Tropical Medicine and Hygiene 90:278-279.
Cuba Cuba AC. 1975. A Peruvian strain of Trypanosoma rangeli. III. Observations on the experimental infection of Panstrongylus herreri Wygodzinsky, 1948. Revista do Instituto de Medicina Tropical de Sao Paulo 17(4):211-217.
Cuba Cuba CA. 1998. Revisión de los aspectos biológicos y diagnósticos del Trypanosoma (Herpetosoma) rangeli. Revista da Sociedade Brasileira de Medicina Tropical 31(2):207-220.
D'Alessandro A, Saravia NG. 1992. Trypanosoma rangeli. In: Kreier J, Baker J, editors. Parasitic Protozoa. 2nd ed. San Diego, California: Academic Press, Inc. p 1-54.
D'Alessandro A, Saravia N. 1999. Trypanosoma rangeli. In: Gilles HM, editor. Protozoal diseases: Oxford University Press, Oxford. p 398-412.
102
Davila AMR, Lorenzini DM, Mendes PN, Satake TS, Sousa GR, Campos LM, Mazzoni CJ, Wagner G, Pires PF, Grisard EC, Cavalcanti MCR, Campos MLM. 2005. GARSA: genomic analysis resources for sequence annotation. Bioinformatics 21(23):4302-4303.
Ebert F. 1986. Isoenzymes of Trypanosoma rangeli stocks and their relation to other trypanosomes transmitted by triatomine bugs. Tropical Medicine and Parasitology : Official Organ of Deutsche Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ) 37(3):251-254.
Feliciangeli MD, Carrasco H, Patterson JS, Suarez B, Martínez C, Medina M. 2004. Mixed domestic infestation by Rhodnius prolixus Stäl, 1859 and Panstrongylus geniculatus Latreille, 1811, vector incrimination, and seroprevalence for Trypanosoma cruzi among inhabitants in El Guamito, Lara State, Venezuela. The American Journal of Tropical Medicine and Hygiene 71(4):501-505.
Fernandes O, Santos SS, Cupolillo E, Mendonça B, Derre R, Junqueira ACV, Santos LC, Sturm NR, Naiff RD, Barret TV, Campbell DA, Coura JR. 2001. A mini-exon multiplex polymerase chain reaction to distinguish the major groups of Trypanosoma cruzi and Trypanosoma rangeli in the Brazilian Amazon. Transactions of the Royal Society of Tropical Medicine and Hygiene 95:97-99.
Freitas SP, Lorosa ES, Rodrigues DC, Freitas AL, Gonçalves TC. 2005. Fontes alimentares de Triatoma pseudomaculata no Estado do Ceará, Brasil. Revista de Saude Publica 39(1):27-32
103
Garcia ES, Mello CB, Azambuja P, Ribeiro JM. 1994. Rhodnius prolixus: salivary antihemostatic components decrease with Trypanosoma rangeli infection. Experimental Parasitology 78(3):287-293.
Gomez B, Sanchez E, Feliciangeli MD. 1998. Man-vector contact of phlebotomine sandflies (Diptera: Psychodidae) in northcentral Venezuela, as assessed by bloodmeal identification using a dot-ELISA. Journal of the American Mosquito Control Association 14:28-32.
Grijalva MJ, Palomeque FS, Costales JA, Davila S, Arcos-Teran L. 2005. High household infestation rates by synanthropic vectors of Chagas disease in Southern Ecuador. Journal of Medical Entomology 42(1):68-74.
Grisard EC. 2002. Salivaria or Stercoraria? The Trypanosoma rangeli dilemma. Kinetoplastid Biology and Disease 1(5):1-2.
Grisard EC, Campbell DA, Romanha AJ. 1999a. Mini-exon gene sequence polymorphism among Trypanosoma rangeli strains isolated from distinct geographical regions. Parasitology 118 ( Pt 4):375-382.
Grisard EC, Steindel M, Guarneri AA, Eger-Mangrich I, Campbell DA, Romanha AJ. 1999b. Characterization of Trypanosoma rangeli strains isolated in Central and South America: an overview. Memorias do Instituto Oswaldo Cruz 94(2):203- 209.
Grogl M, Kuhn RE. 1984. Identification of antigens of culture forms of Trypanosoma cruzi and Trypanosoma rangeli recognized by sera from patients with chronic Chagas' disease. The Journal of Parasitology 70(5):822-824. 104
Guhl F, Marinkelle, C. 1982. Antibodies against Trypanosoma cruzi in mice infected with Trypanosoma rangeli. Annals of Tropical Medicine and Parasitology 76:361.
Guhl F, Hudson L, Marinkelle CJ, Morgan SJ, Jaramillo C. 1985. Antibody response to experimental Trypanosoma rangeli infection and its implications for immunodiagnosis of South American trypanosomiasis. Acta Tropica 42(4):311- 318.
Guhl F, Hudson L, Marinkelle CJ, Jaramillo CA, Bridge D. 1987. Clinical Trypanosoma rangeli infection as a complication of Chagas’ disease. Parasitology 94:475-484.
Guhl F, Jaramillo C, Carranza JC, Vallejo GA. 2002. Molecular characterization and diagnosis of Trypanosoma cruzi and T. rangeli. Archives of Medical Research 33:362-370.
Guhl F, Vallejo GA. 2003. Trypanosoma (Herpetosoma) rangeli Tejera, 1920: an updated review. Memorias Do Instituto Oswaldo Cruz 98(4):435-442.
Hoare C. 1972. Herpetosoma from man and other mammals. In "The Trypanosomes of Mammals: A zoological monograph". Blackwell Scientific Publications, Oxford. p 288-314.
Holguin AF, Saravia NG, D'Alessandro A. 1987. Lack of enzyme polymorphism in Trypanosoma rangeli stocks from sylvatic and domiciliary transmission cycles in Colombia. The American Journal of Tropical Medicine and Hygiene 36(1):53-58.
105
INAMHI. 2006. Anuario Meteorológico N°. 46. Edición Especial. República del Ecuador, Ministerio de Minas y Petróleos, Instituto Nacional de Meteorología e Hidrología. Quito, Ecuador. 121 pp.
Jaramillo C, Montana MF, Castro LR, Vallejo GA, Guhl F. 2001. Differentiation and genetic analysis of Rhodnius prolixus and Rhodnius colombiensis by rDNA and RAPD amplification. Memorias do Instituto Oswaldo Cruz 96(8):1043-1048.
Kima PE, Burleigh B, Andrews NW. 2000. Surface-targeted lysosomal membrane glycoprotein-1 (Lamp-1) enhances lysosome exocytosis and cell invasion by Trypanosoma cruzi. Cell Microbiology 2:477-486.
Kjeken R, Egeberg M, Habermann A, Kuehnel M, Peyron P, Floetenmeyer M, Walther P, Jahraus A, Defacque H, Kuznetsov SA, Griffiths G. 2004. Fusion between phagosomes, early and late endosomes: a role for actin in fusion between late, but not early endocytic organelles. Molecular Biology of the Cell 15:345-358.
Koerich LB, Emmanuelle-Machado P, Santos K, Grisard EC, Steindel M. 2002. Differentiation of Trypanosoma rangeli: high production of infective trypomastigote forms in vitro. Parasitology research 88: 21-25.
Kreutzer RD, Souza OE. 1981. Biochemical characterization of Trypanosoma spp. by isoenzyme electrophoresis. The American Journal of Tropical Medicine and Hygiene 30:308-317.
Lent H, Wygodzinsky P. 1979. Revision of the Triatominae (Hemiptera, Reduviidae) and their significance as vectors of Chagas disease. Bulletin of the American Museum of Natural History 163:127-520. 106
Leon LA. 1976. Tripanosomiasis a Trypanosoma rangeli en el Ecuador. Resumen. Trabajos Libres, IV Congreso Latinoamericano. Parasitology 12.
Luna KP, Jaramillo CL, Hernández J, Angulo VM. 2007. Variabilidad genética de aislados de Trypanosoma cruzi I por medio de ITS-RFLP en Santander, Colombia. Boletín de Malariologia y Salud Ambiental 47:139.
Macedo AM, Vallejo GA, Chiari E, Peña SD. 1993. DNA fingerprinting reveals relationships between strains of Trypanosoma rangeli and Trypanosoma cruzi. EXS 67:321-329.
Macedo AM, Peña SDJ. 1998. Genetic variability of Trypanosoma cruzi: implications for the pathogenesis of Chagas disease. Parasitology Today 14:119-123
Machado EM, Alvarenga NJ, Romanha AJ, Grisard EC. 2000. A simplified method for sample collection and DNA isolation for polymerase chain reaction detection of Trypanosoma rangeli and Trypanosoma cruzi in triatomine vectors. Memorias do Instituto Oswaldo Cruz 95(6):863-866.
Machado PE, Eger-Mangrich I, Rosa G, Koerich LB, Grisard EC, Steindel M. 2001. Differential susceptibility of triatomines of the genus Rhodnius to Trypanosoma rangeli strains from different geographical origins. International Journal for Parasitology 31(5-6):632-634.
107
Madeira MF, Sousa MA, Barros JH. Figueiredo S, Fagundes A, Schubach A, De Paula CC, Faissal BNS, Fonseca TS, Thoma HK, Marzochi MCA. 2009. Trypanosoma caninum n. sp. (Protozoa: Kinetoplastida) isolated from intact skin of a domestic dog (Canis familiaris) captured in Rio de Janeiro, Brazil. Parasitology 136(4):411-423.
Maia da Silva F, Rodrigues AC, Campaner M, Takata CSA, Brigido MC, Junqueira ACV, Coura JR, Takeda GF, Shaw JJ, Teixeira MMG. 2004. Randomly amplified polymorphic DNA analysis of Trypanosoma rangeli and allied species from human, monkeys and other sylvatic mammals of the Brazilian Amazon disclosed a new group and a species-specific marker. Parasitology 128(3):283-294.
Maia da Silva F, Noyes H, Campaner M, Junqueira ACV, Coura JR, Añez N, Shaw JJ, Stevens JR, Teixeira MMG. 2004. Phylogeny, taxonomy and grouping of Trypanosoma rangeli isolates from man, triatomines and sylvatic mammals from widespread geographical origin based on SSU and ITS ribosomal sequences. Parasitology 129(5):549-561.
Marinkelle CJ. 1968. Triatoma dimidiata capitata, a natural vector of Trypanosoma rangeli in Colombia. Rev Biol Trop 15:203-205.
Marinkelle CJ, Vallejo GA, Schottelius J, Guhl F, de Sanchez N. 1986. The affinity of the lectins Ricinus communis and Glycine maxima to carbohydrates on the cell surface of various forms of Trypanosoma cruzi and Trypanosoma rangeli, and the application of these lectins for the identification of T. cruzi in the feces of Rhodnius prolixus. Acta Tropica 43(3):215-223.
108
Mejía AJ, Palau MT, Zúñiga CA. 2004. Trypanosoma rangeli: Lo que se conoce y el impacto de su presencia. MedUNAB 7(21):166-171.
Miles MA, Arias JR, Valente SA, Naiff RD, de Souza AA, Povoa MM, Lima JA, Cedillos RA. 1983. Vertebrate hosts and vectors of Trypanosoma rangeli in the Amazon Basin of Brazil. The American Journal of Tropical Medicine and Hygiene 32(6):1251-1259.
Miles MA. 1993. Culturing and biological cloning of Trypanosoma cruzi. In: Hyde, J.E. (Ed.), Protocols in Molecular Parasitology. Humana Press, Manchester, UK.
Miranda Santos IKF, Pereira ME. 1984. Lectin discriminates between pathogenic and non-pathogenic South American trypanosomes. The American Journal of Tropical Medicine and Hygiene 33:839-844.
Mota J, Chacon JC, Gutierrez-Cabrera AE, Sanchez-Cordero V, Wirtz A, Ordoñez R, Panzera F, Ramsey J. 2007. Identification of blood meal source and infection with Trypanosoma cruzi of Chagas disease vectors using a multiplex cytochrome b polymerase chain reaction assay. Vector-borne and Zoonotic diseases 7 (4):617- 627.
Mukabana WR, Takken W, Knols BGJ. 2002. Analysis of arthropod bloodmeals using molecular genetic markers. Trends in Parasitology 18(11):505-509.
Nogueira N, Bianco C, Cohn Z. 1975. Studies on the selective lysis and purification of Trypanosoma cruzi. Journal of Experimental Medicine 142:224-229.
109
Noireau F, Flores R, Vargas F. 1999. Trapping sylvatic Triatominae (Reduviidae) in hollow trees. Transactions of the Royal Society of Tropical Medicine and Hygiene 93:13-14.
O'Daly JA, Carrasco H, Fernandez V, Rodriguez MB. 1994. Comparison of chagasic and non-chagasic myocardiopathies by ELISA and immunoblotting with antigens of Trypanosoma cruzi and Trypanosoma rangeli. Acta Tropica 56(4):265-287.
Osorio Y, Travi BL, Palma GI, Saravia NG. 1995. Infectivity of Trypanosoma rangeli in a promonocytic mammalian cell line. The Journal of Parasitology 81(5):687-693.
Owens CB, Szalanski AL. 2005. Filter paper for preservation, storage, and distribution of insect and pathogen DNA samples. Journal of Medical Entomology 42(4):709- 711.
Pereira ME, Moss D. 1985. Neuraminidase activity in Trypanosoma rangeli. Molecular and Biochemical Parasitology 15(1):95-103.
Pinto CM, Ocana-Mayorga S, Lascano MS, Grijalva MJ. 2006. Infection by trypanosomes in marsupials and rodents associated with human dwellings in Ecuador. Journal of Parasitology 92(6):1251-1255.
Prioli RP, Rosenberg I, Pereira ME. 1987. Specific inhibition of Trypanosoma cruzi neuraminidase by the human plasma glycoprotein "cruzin". Proceedings of the National Academy of Sciences of the United States of America 84(10):3097-3101.
110
Ratcliffe NA, Nigam Y, Mello CB, Garcia ES, Azambuja P. 1996. Trypanosoma cruzi and erythrocyte agglutinins: a comparative study of occurrence and properties in the gut and hemolymph of Rhodnius prolixus. Experimental Parasitology 83(1):83-93.
Recinos RF, Kirchhoff LV, Donelson JE. 1994. Characterization of kinetoplast DNA minicircles in Trypanosoma rangeli. Molecular and Biochemical Parasitology 63(1):59-67.
Saldaña A, Sousa OE. 1996. Trypanosoma rangeli and Trypanosoma cruzi: cross- reaction among their immunogenic components. Memorias do Instituto Oswaldo Cruz 91(1):81-82.
Saldaña A, Sousa OE, Orn A. 1995. Immunoparasitological studies of Trypanosoma cruzi low virulence clones from Panama: humoral immune responses and antigenic cross-reactions with Trypanosoma rangeli in experimentally infected mice. Scandinavian Journal of Immunology 42(6):644-650.
Saldaña A, Samudio F, Miranda A, Herrera LM, Saavedra SP, Cáceres L, Bayard V, Calzada JE. 2005. Predominance of Trypanosoma rangeli infection in children from a Chagas disease endemic area in the west-shore of the Panama canal. Memorias do Instituto Oswaldo Cruz 100(7):729-731.
Saravia NG, Holguin AC, Cibulskis RE, D'Alessandro A. 1987. Divergent isoenzyme profiles of sylvatic and domiciliary Trypanosoma cruzi in the eastern plains, piedmont, and highlands of Colombia. The American Journal of Tropical Medicine and Hygiene 36:59-69.
111
Schaub GA. 1992. The effects of Trypanosomatids on insects. In: Dawes B, editor. Advances in Parasitology: Academic Press, London. p 255-319.
Schottelius J. 1984. Differentiation between Trypanosoma cruzi and Trypanosoma rangeli on the basis of their sialic acid content. Tropenmedizin Und Parasitologie 35(3):160-162.
Schottelius J. 1987. Neuraminidase fluorescence test for the differentiation of Trypanosoma cruzi and Trypanosoma rangeli. Tropical Medicine and Parasitology : Official Organ of Deutsche Tropenmedizinische Gesellschaft and of Deutsche Gesellschaft Fur Technische Zusammenarbeit (GTZ) 38(4):323-327.
Schottelius J, Muller V. 1984. Interspecific differentiation of Trypanosoma cruzi, Trypanosoma conorhini and Trypanosoma rangeli by lectins in combination with complement lysis. Acta Tropica 41(1):29-38.
Scorza CA, Urdaneta-Morales S, Tejero F. 1986. Trypanosoma (Herpetosoma) rangeli Tejera, 1920: Preliminary report on histopathology in experimentally infected mice. Revista do Instituto de Medicina Tropical de Sao Paulo 28:371-378.
Souto RP, Fernandes O, Macedo AM, Campbell DA, Zingales B. 1996. DNA markers define two major phylogenetic lineages of Trypanosoma cruzi. Molecular and Biochemical Parasitology 3:141–152.
112
Steindel M, Pinto JC, Toma HK, Mangia RH, Ribeiro-Rodrigues R, Romanha AJ. 1991. Trypanosoma rangeli (Tejera, 1920) isolated from a sylvatic rodent (Echimys dasythrix) in Santa Catarina Island, Santa Catarina State: first report of this trypanosome in southern Brazil. Memorias do Instituto Oswaldo Cruz 86(1):73- 79.
Steindel M, Dias Neto E, Menezes CL, Romanha AJ, Simpson AJ. 1993. Random amplified polymorphic DNA analysis of Trypanosoma cruzi strains. Molecular and Biochemical Parasitology 60:71-80.
Steindel M, Dias Neto E, Pinto CJ, Grisard EC, Menezes CL, Murta SM, Simpson AJ, Romanha AJ. 1994. Randomly amplified polymorphic DNA (RAPD) and isoenzyme analysis of Trypanosoma rangeli strains. The Journal of Eukaryotic Microbiology 41(3):261-267.
Steindel M, Pacheco LK, Scholl D, Soares M, de Moraes MH, Eger I, Kosmann C, Sincero TCM, Stoco PH, Murta SMF, de Carvalho-Pinto CJ, Grisard EC. 2008. Characterization of Trypanosoma cruzi isolated from humans, vectors, and animal reservoirs following an outbreak of acute human Chagas disease in Santa Catarina State, Brazil. Diagnostic Microbiology and Infectious Disease 60:25-32.
Stevens JR, Teixeira MM, Bingle LE, Gibson WC. 1999. The taxonomic position and evolutionary relationships of Trypanosoma rangeli. International Journal for Parasitology 29(5):749-757.
113
Sturm NR, Degrave W, Morel CM, Simpson L. 1989. Sensitive detection and schizodeme classification of Trypanosoma cruzi cells by amplification of kinetoplast minicircle DNA sequences: use in diagnosis of Chagas' disease. Molecular and Biochemical Parasitology 33:205-214.
Tanoura K, Yanagi T, de Garcia VM, Kanbara H. 1999. Trypanosoma rangeli – In vitro metacyclogenesis and fate of metacyclic trypomastigotes after infection to mice ad fibroblast cultures. Journal of Eukaryotic Microbiology 46(1):43-48.
Tardieux I, Webster P, Ravesloot J, Boron W, Lunn JA, Heuser JE, Andrews NW. 1992. Lysosome recruitment and fusion are early events required for trypanosome invasion of mammalian cells. Cell 71:1117-1130.
Tibayrenc M, Neubauer K, Barnabe C, Guerrini F, Skarecky D, Ayala FJ. 1993. Genetic characterization of six parasitic protozoa: parity between random-primer DNA typing and multilocus enzyme electrophoresis. Proceedings of the National Academy of Sciences of the United States of America 90(4):1335-1339.
Tobie EJ. 1965. Biological factors influencing transmission of Trypanosoma rangeli by Rhodnius prolixus. The Journal of Parasitology 51(5):837-841.
Toma HK, Ceravolo IP, Guerra HL, Steindel M, Romanha AJ. 2000. Trypanosoma cruzi: parasitemia produced in mice does not seem to be related to in vitro parasite-cell interaction. International Journal for Parasitology 30(5):593-597.
Triana O, Ortiz S, Dujardin JC, Solari A. 2006. Trypanosoma cruzi determined by molecular karyotype and minicircle Southern blot analysis. Experimental Parasitology 113:62-66. 114
Urdaneta-Morales S, Tejero F. 1986. Trypanosoma (Herpetosoma) rangeli Tejera, 1920, intracellular amastigote stages of reproduction in white mice. Revista do Instituto de Medicina Tropical de Sao Paulo 28:166-169.
Urrea DA, Carranza JC, Cuba CA, Gurgel-Gonçalves R, Gulh F, Schofield CJ, Triana O, Vallejo GA. 2005. Molecular characterization of Trypanosoma rangeli strains isolated from R. ecuadoriensis in Peru, R. colombiensis in Colombia and R. pallescens in Panama supports a co-evolutionary association between parasites and vectors. Infection, Genetics, and Evolution 5:123-129.
Vallejo GA, Marinkelle CJ, Guhl F, Sanchez N. 1988. Comportamiento de la infeccion y diferenciacion morfologica entre Trypanosoma cruzi y T. rangeli en el intestino del vector Rhodnius prolixus. Revista Brasileira de Biología 48:577-587.
Vallejo GA, Chiari E, Macedo AM, Pena SD. 1993. A simple laboratory method for distinguishing between Trypanosoma cruzi and Trypanosoma rangeli. Transactions of the Royal Society of Tropical Medicine and Hygiene 87(2):165- 166.
Vallejo GA, Macedo AM, Chiari E, Pena SD. 1994. Kinetoplast DNA from Trypanosoma rangeli contains two distinct classes of minicircles with different size and molecular organization. Molecular and Biochemical Parasitology 67(2):245-253.
Vallejo GA, Guhl F, Chiari E, Macedo AM. 1999. Species specific detection of Trypanosoma cruzi and Trypanosoma rangeli in vector and mammalian hosts by polymerase chain reaction amplification of kinetoplast minicircle DNA. Acta Tropica 72(2):203-212. 115
Vallejo GA, Guhl F, Carranza JC, Lozano LE, Sanchez JL, Jaramillo JC, Gualtero D, Castaneda N, Silva JC, Steindel M. 2002. kDNA markers define two major Trypanosoma rangeli lineages in Latin-America. Acta Tropica 81(1):77-82.
Vallejo GA, Guhl F, Carranza JC, Moreno J, Triana O, Grisard EC. 2003. Parity between kinetoplast DNA and mini-exon gene sequences supports either clonal evolution or speciation in Trypanosoma rangeli strains isolated from Rhodnius colombiensis, R. pallescens and R. prolixus in Colombia. Infection, Genetics and Evolution : Journal of Molecular Epidemiology and Evolutionary Genetics in Infectious Diseases 3(1):39-45.
Vallejo GA, Guhl F, Carranza JC, Triana O, Pérez G, Ortiz PA, Marín DH, Villa LM, Suárez J, Sánchez IP, Pulido X, Rodríguez IB, Lozano LE, Urrea DA, Rivera FA, Cuba CC, Clavijo JA. 2007. Interacción tripanosoma-vector-vertebrado y su relación con la sistemática y la epidemiología de la tripanosomiasis americana. Biomedica 27:110-118.
Vanhaesebroeck B, Leevers S, Ahmadi K, Timms J, Katso R, Driscoll P, Woscholski R, Parker P, Waterfield M. 2001. Synthesis and function of 3-phosphorylated inositol lipids. Annual Review of Biochemistry 70:535-602.
Vargas N, Souto RP, Carranza JC, Vallejo GA, Zingales B. 2000. Amplification of a specific repetitive DNA sequence for Trypanosoma rangeli identification and its potential application in epidemiological investigations. Experimental Parasitology 96(3):147-159.
116
Vasquez JE, Krusnell J, Orn A, Sousa OE, Harris RA. 1997. Serological diagnosis of Trypanosoma rangeli infected patients. A comparison of different methods and its implications for the diagnosis of Chagas’ disease. Scandinavian Journal of Immunology 45:322-330.
Vasquez AM, Samudio FE, Saldaña A, Paz HM, Calzada JE. 2004. Eco-epidemiological aspects of Trypanosoma cruzi, Trypanosoma rangeli, and their vector (Rhodnius pallescens) in Panama. Revista do Instituto de Medicina Tropical de São Paulo 46:217-222.
Wakatsuki T, Schwab B, Thompson NC, Elson EL. 2001. Effects of cytochalasin D and latrunculin B on mechanical properties of cells. Journal of Cell Science 114(5):1025-1036.
Walker JA, Hughes DA, Hedges DJ, Anders BA, Laborde ME, Shewale J, Sinha SK, Batzer MA. 2004. Quantitative PCR for DNA identification based on genome- specific interspersed repetitive elements. Genomics 83:518–527
Watkins R. 1971. Histology of Rhodnius prolixus infected with Trypanosoma rangeli. Journal of Invertebrate Pathology 17(1):59-66.
Welsh J, McClelland M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18(24):7213-7218.
WHO. 2002. Control of Chagas Disease : second report of the WHO expert committee. WHO technical report series 905. World Health Organization, Geneva.
117
Williams JGK, Kubelik AR, Livak J, Rafalski JA, Tingey SV. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18(22):6531-6535.
Woolsey AM, Sunwoo L, Petersen CA, Brachmann SM, Cantley LC, Burleigh BA. 2003. Novel PI 3-kinase-dependent mechanisms of trypanosome invasion and vacuole maturation. Journal of Cell Science 116(17):3611-3622.
Woolsey AM, Burleigh BA. 2004. Host cell actin polymerization is required for cellular retention of Trypanosoma cruzi and early association with endosomal/lysosomal compartments. Cellular Microbiology 6(9):829-838.
Yeo M, Lewis MD, Carrasco HJ, Acosta N, Llewellyn M, da Silva-Valente SA, de Costa- Valente V, de Arias AR, Miles MA. 2007. Resolution of multiclonal infections of Trypanosoma cruzi from naturally infected triatomine bugs and from experimentally infected mice by direct plating on a sensitive solid medium. International Journal for Parasitology 37:111-120. 118
Table 1
Geographical Distribution of Rhodnius species showing T. rangeli in their salivary glands (Modified from D’Alessandro and Saravia, 1992, 1999; Guhl and Vallejo, 2003; Vallejo et al., 2009)
Rhodnius species COUNTRY bre col dal dom ecu nas neg nei pal pic pro ro Mexico + Guatemala + Belize + Honduras + El Salvador + Nicaragua + Costa Rica + Panama + + Colombia + + + + + + + Peru + + + Bolivia + + + + Brazil + + + + + + Fr. Guiana + + + Surinam + + Guyana + + Venezuela + + + + Trinidad +
bre: brethesi; col: colombiensis; dal: dalessandroi; dom: domesticus; ecu: ecuadoriensis; neg: neglectus; nas: nasutus; nei: neivai; pal: pallescens; pic: pictipes; pro: prolixus; ro: robustus; mil: milesi; par: paraensis; stal: stali
119
Table 2
T. cruzi and T. rangeli enzymes showing electrophoretic mobility polymorphisms (Adapted from D’Alessandro and Saravia, 1992)
ENZYME E.C. T. ran T. cru GOT Glutamate oxaloacetate transaminase 2.6.1.1 + + HK Hexokinase 2.7.1.1 _ + PGI Phosphoglucoisomerase 5.3.1.9 _ _ FK Fructokinase 2.7.1.11 + + ACP Acid phosphatase 3.1.3.2 _ _ MPI Mannose phosphate isomerase 5.4.1.8 _ + LDH Lactic dehydrogenase 1.1.1.27 + / - _ PGK Phosphoglycerate kinase 2.7.2.3 _ _ MDH Malic dehydrogenase 1.1.1.37 _ + ICD Isocitrate dehydrogenase 1.1.1.42 + + 6PGD 6-phosphogluconate dehydrogenase 1.1.1.44 _ _ ASAT Aspartate aminotransferase 2.6.1.1 _ + ALAT Alanine aminotransferase 2.6.1.2 + + PGM Phosphoglucomutase 2.7.5.1 _ + PEP Peptidase 3.4.11.1 + + ACON Aconitate hydratase 4.2.1.3 _ + GPI Glucose phosphate isomerase 5.3.1.9 _ +
E.C. = Enzyme Commission code
120
Table 3
Primer oligonucleotides used in the PCR reactions
Target Primers Parasite Sequence (5’ to 3’) Reference Kinetoplast S35 T. cruzi / T. rangeli AAATAATGTACGGGTGGAGATGCAT Sturm et al., 1989 Minicircles DNA S36 GGGTTCGATTGGGGTTGGTGT
24Sα rRNA D71 T. cruzi (TcI / TcII) AAGGTGCGTCGACAGTGTGG Souto et al., 1996 D72 TTTTCAGAATGGCCGAACAGT
P542 nuclear R1 T. rangeli CGCGGCTCGCACTGCACCTC Vargas et al., 2000 repetitive element R2 GGCGCATCCACCGAGCACTG
Mini-exon gene TC1 T. cruzi (TcI / TcII) / ACACTTTCTGTGGCGCTGATCG Fernandes et al., 2001 multiplex T. rangeli TC2 TTGCTCGCACACTCGGCTGCAT TC3 CCGCGWACAACCCCTMATAAAAATG TR CCTATTGTGATCCCCATCTTCG ME TACCAATATAGTACAGAAACTG kDNA KP1-L T. rangeli ATA CAACACTCTCTATATCAGG Vallejo et al., 2002
121
Table 4
Coordinates and altitude of the localities where triatomines were collected in Manabí and Loja provinces of Ecuador
Coordinates Locality County Province Latitude Longitude Altitude (m.a.s.l.)
Bejuco Portoviejo Manabí -00.9495 -80.3314 65 – 400 Cruz Alta Portoviejo Manabí -00.9950 -80.2776 105 – 250 La Cienega Portoviejo Manabí -01.0133 -80.2139 52
La Encantada Portoviejo Manabí -00.9922 -80.3518 19 – 290 Naranjo Adentro Portoviejo Manabí -01.0066 -80,2261 50 Pimpiguasi Portoviejo Manabí -01.0158 -80.3714 24 – 70
Quebrada Maconta Portoviejo Manabí -01.0355 -80,2177 157 San Gabriel Portoviejo Manabí -01.0069 -80,2264 47 Algarrobillo Celica Loja -04.1600 -80.0800 730 – 850 Ashimingo Paltas Loja -04.0300 -79.7300 870 – 850 Cienega Celica Loja -04.1960 -80.1040 580 – 870 La Extensa Catamayo Loja -04.0210 -79.3705 1207 – 1295 Machay Espindola Loja -04.6100 -79.4590 1700 – 2500 Sanambay Espindola Loja -04.5870 -79.4560 1750 – 1960 Suanamaca Calvas Loja -04.3200 -79.6530 1860 – 2050 Tuburo Quilanga Loja -04.3690 -79.2470 1180 – 1285
122
Table 5
Entomological indexes, species, and total number of insects collected in each of the study communities
Entomological Indexes* Locality # houses # insects Infestation Colonization Density Crowding Species (M/L) inspected collected (%) (%) Bejuco (M) 72 64 10.2 0.6 6.4 70 R. ecuadoriensis P. howardi Cruz Alta (M) 114 95 13.16 0.8 6.3 66.7 R. ecuadoriensis
La Cienega (M) 84 193 14.3 2.3 16.0 58.3 R. ecuadoriensis P. howardi La Encantada (M) 123 374 30.0 3.0 10.11 40.5 R. ecuadoriensis P. howardi Naranjo Adentro 17** R. ecuadoriensis (M) Pimpiguasi (M) 116 230 18.1 1.9 10.9 52.4 R. ecuadoriensis P. howardi Quebrada Maconta 125 2384 24 19.0 79.5 90 R. ecuadoriensis (M) P. howardi San Gabriel (M) 93 565 21.5 6.0 28 55 R. ecuadoriensis P. howardi Algarrobillo (L) 45 385 22.2 8.6 38.5 80 R. ecuadoriensis
Ashimingo (L) 29 235 34.5 8.7 29.4 0 R. ecuadoriensis
Cienega (L) 42 710 21.4 16.9 78.9 100 R. ecuadoriensis
123
La Extensa (L) 45 402 20 8.9 44.7 44.4 R. ecuadoriensis
Machay (L) 42 86 19.0 2.0 10.8 87.5 T. carrioni
Table 5 (contd.)
Sanambay (L) 72 97 16.7 1.4 8.1 66.7 T. carrioni
Suanamaca (L) 40 74 5.0 1.9 37 100 T. carrioni
Tuburo (L) 27 750 18.5 28.1 152 100 R. ecuadoriensis
(M/L) = Manabí province / Loja province * = entomological indexes calculated: Infestation = (number of infested houses / number of searched houses) x 100 Density = number of triatomines collected / number of searched house Crowding = number of triatomines collected / number of infested houses Colonization = (number of houses with triatomine nymphs / number of infested houses) x 100 ** = insects collected by community members, handed to the research team, and kept in the insectary before analysis
124
Table 6
Numbers and species of Triatomine collected in each community and the habitats where they were found
R. ecuadoriensis P. howardi T. carrioni Locality Intra Peri Sylv Intra Peri Sylv Intra Peri Sylv Bejuco - 47 244 - 17 5 - - - Cruz Alta 39 52 ------La Cienega 4 87 - 1 101 - - - - La Encantada 22 281 - 12 59 - - - - Naranjo Adentro - 17 ------Pimpiguasi 3 144 - 2 81 - - - - Quebrada Maconta 15 2315 - 12 42 - - - - San Gabriel 7 466 - 2 90 - - - - Algarrobillo 1 291 ------Ashimingo 17 211 ------Cienega 7 655 63 ------La Extensa - 388 ------Machay ------73 13 - Sanambay ------49 48 - Suanamaca ------74 0 - Tuburo 17 733 ------
Intra = intradomicile; Peri = peridomicile; Sylv = sylvatic
125
Table 7
Number of triatomines (R. ecuadoriensis, P. howardi, T. carrioni) analyzed in the study according to their developmental stage.
Species Nymphs R. ecuadoriensis* R. ecuadoriensis** P. howardi T. carrioni I - - - - II - 1 1 1 III 7 8 8 2 (1) IV 7 3 9 3 V 15 21 (1) 19 7 (2) Adults Female 24 14 (6) 1 1 (1) Male 10 3 1 (1) - Total 63 50 39 14
* = Manabí province ** = Loja province ( ) = number of domestic individuals analyzed within the sample
126
Table 8
Total number of samples (hemolymph, feces, intestinal contents, and salivary glands) taken from the triatomines analyzed in the study.
SAMPLES Triatominae HE FE IC SG R. ecuadoriensis 82 38 90 121
P. howardi 24 19 41 35 T. carrioni 13 7 14 16
HE = hemolymph FE = fecal material IC = intestinal contents SG = salivary glands
127
Table 9
Species of Triatominae found in Ecuador, total number of samples collected from each species, and percentages of natural infection by T. cruzi and T. rangeli
# of insects # of samples % T. cruzi (+) % T. rangeli (+) % of samples w/ Species analyzed analyzed samples (%) samples (%) mixed infections (%) R. ecuadoriensis 113 331 16.8 (23.8) 8.4 (11.5) 5.6 (6.1) P. howardi 39 119 38.9 (30.8) 4 (12.8) 4.9 (15.3) T. carrioni 14 50 18.5 (35.7) 3.7 (21.4) 4 (28.6)
(%) = the numbers in parentheses indicate the percentage of insects analyzed from which the positive samples were taken
128
Table 10
Mammal and avian species serving as blood meal source for triatomines. Several species of mammals and an avian species were identified by PCR assays as the source of blood meal for triatomines
R. ecuadoriensis P. howardi T. carrioni Species % (+/total) (M/L) (I/P) % (+/total) (I/P) % (+/total) (I/P) Mus musculus 2.2 2/90 1/1 0/2 4.9 2/41 0/2 - - - Rattus rattus 4.4 4a/90 3/1 0/4 26.8 11c/41 0/11 7.1 1/14 1*/0 Felis catus 1.1 1/90 0/1 0/1 ------Canis familiaris - - - - 2.4 1/41 0/1 - - - Cavia porcellus 4.4 4/90 0/4 4/0 ------Capra hircus ------7.1 1/14 0/1 Homo sapiens ------14.3 2/14 2/0 Gallus gallus 25.6 23b/90 10/13 0/23 - - - 35.7 5/14 0/5
(M/L) = Manabí/Loja (I/P) = intradomiciliary/peridomiciliary * = sample mixed with human blood a = one of these samples was infected with T. cruzi (one in Manabí) b = four of these samples were infected with T. cruzi (three in Loja and one in Manabí) and three with T. rangeli (two in Manabí and one in Loja) c = one of these samples was infected with T. cruzi and one with T. rangeli
129
A B
Figure 1. A) Reported distribution of T. cruzi (grey shadows) and T. rangeli (♦) in the American continent (Adapted from WHO Technical Report Series # 811, 1999. Control of Chagas disease). B) Study area. Eight rural communities of Manabí Province (western lowlands, average altitude of 90 m.a.s.l.) and eight communities of Loja Province (southern highland valleys, average altitude of 1,500 m.a.s.l.) in Ecuador were selected for the study. The average number of households in each community was 120.
130
Figure 2. Schematic representation of the life cycle of T. rangeli. The triatomine ingests non-dividing trypomastigotes during probing. After ingestion, the forms found in the midgut are epimastigotes and trypomastigotes. Some epimastigotes escape the midgut and enter the hemocoel; others go to the rectum and are expelled with the feces. In the hemolymph, parasites divide freely or invade the hemocytes and multiply inside them. Extracellular dividing parasites can infect the salivary glands. Metacyclic trypomastigotes formed in the salivary glands are injected into the vertebrate during the feeding process (Modified from Grisard et al, 1999).
131
F
D G
A H B C E
Figure 3. Different forms of T. rangeli. A) Trypomastigote in hindgut of triatomine; B) Epimastigote in hindgut; C) Epimastigote in hemolymph; D) Epimastigote in salivary gland; E) Blood trypanosome from mammal; F) Epimastigote in midgut of triatomine; G) Spheromastigote inside hemocyte of triatomine; H) Metacyclic trypomastigote in salivary glands (Modified from Hoare [1972] and Cuba [1998]).
132
Figure 4. Position of the conserved regions of the minicircles of T. rangeli, and amplification of their respective fragments in 6% polyacrylamide gels. The amplicons are obtained with primers S35, S36, and KP1L (760 bp with S35/S36; 300-450 bp with S35/S36; and 165 bp with KP1L/S36). (Modified from Guhl et al., 2002)
133
Tr NC Tc 1 2 3 4 LM HM
760 bp -
450 bp - 330 bp -
Figure 5. Representative gel (1.5% agarose) showing the product obtained with a PCR that amplifies both T. cruzi and T. rangeli DNA (primers S35-S36). T. cruzi DNA is amplified as a typical band of 330 bp. Additional bands can usually be seen as well. T. rangeli DNA on the other hand shows two amplified regions: a band of 760 bp and a series of bands ranging from 300 to 450 bp. HM = High molecular markers; LM = Low molecular markers; Tr = T. rangeli positive control (Choachi strain); NC = Negative control; Tc = T. cruzi positive control (Y strain); Lanes 1 – 4 = Samples from Triatominae vectors; 1 = Feces sample from P. howardi (CN266); 2 = Intestinal contents sample from P. howardi (QM270); 3 = Feces sample from R. ecuadoriensis (NA251); 4 = Hemolymph sample from P. howardi (CN264).
134
TcII 1 TcI 2 Tr
125 bp –
110 bp –
Figure 6. Representative gel (1.5% agarose) showing the amplified DNA fragments for the 24Sα rDNA of T. cruzi with primers D71/D72. These primers yield products of 110 bpp for T. cruzi I and 125 bp for T. cruzi II. TcII = positive control, T. cruzi Y strain; 1 = Intestinal contents sample from T. carrioni (SY201); TcI = positive control, T. cruzi SC28 strain; 2 = Intestinal contents sample from R. ecuadoriensis (QM267); Tr = control, T. rangeli Choachi strain.
135
Re Ph
MM NC PC SG HE FE IC SG FE IC HE MM 1,000 – 750 –
500 –
300 –
150 – 50 –
Figure 7. Representative gel (1.5% agarose) showing the product obtained with a PCR assay that amplifies a specific repetitive nuclear element (P542) in the T. rangeli DNA sequence. MM = molecular markeers; Re = R. ecuadoriensis (CA300-17); Ph = P. howardi (LE307-7-4); NC = negative control; PC = T. rangeli positive control (Choachi strain); SG = salivary glands; HE = hemolymph; FE = feces; IC = intestinal contents.
136
Figure 8. Representative gel (1.5% agarose) showing the amplification of the conserved regions in T. rangeli minicircles (primers S35/S36/KP1-L). T. rangeli isolates from Loja (lanes 2 - 5) and Manabí (6 - 9) are shown. MW = molecular weight markers; 1 = negative control; 2 = sample of salivary glands of T. carrioni (SY203); 3 = sample of feces from R. ecuadoriensis (SML04); 4 = sample of salivary glands from R. ecuadoriensis (CG208); 5 = sample of intestinal contents from T. carrioni (SY201); 6 = sample of intestinal contents from R. ecuadoriensis (SML06); 7 = sample of intestinal contents from R. ecuadoriensis (SML22); 8 = sample of intestinal contents from R. ecuadoriensis (SML24); 9 = of intestinal contents from R. ecuadoriensis (QM267); 10 = positive control (T. rangeli E1 Tocuyo).
137
MW 1 2 3 4 5 6
250 bp –
200 bp –
100 bp –
Figure 9. Representative gel (8% polyacrylamide, ethidium bromide stained) showing the pattern of products obtained with a multiplex PCR (primers TC1, TC2, TC3, TR and ME) used to differentiate T. cruzi I, T. cruzi II, and T. rangeli. The diagnostic bands for each species and lineage are 250 bp for T. cruzi I, 200 bp for T. cruzi II, and 100 bp for T. rangeli. MW = molecular weight markers; 1 = negative control; 2 = TcII control, T. cruzi strain Y; 3 = TcI control, T. cruzi SC28 strain; 4 = Tr control, T. rangeli strain Choachi; 5 = sample of intestinal contents from T. carrioni (SY201); 6 = sample of intestinal contents of T. carrioni (SY202).
138
1 2 3 4 5 MW - 1,000
- 750
420 bp - - 500
315 bp - - 300
- 150
Figure 10. Representative gel (1.5% agarose) showing the products obtained with a multiplex cyt b PCR for the amplification of animal and human DNA. A 420 bp band corresponding to animal DNA can be seen in lanes 3-5, whereas an additional band of 315 bp, specific for human DNA, is seen in lane 2. 1 = negative control; 2 = sample from intestinal contents of T. carrioni (SY201); 3 - 5 = samples from intestinal contents of R. ecuadoriensis (SML16, SML17, SML18); MW = molecular weight markers.
139
MW 1 2 3 4 5 6 7 8 9 10 11 1,300
1,000
750
500
300
150
Figure 11. Polyacryalmide gel (8%) silver stained showing the products of DNA amplification with primer 3303. This is a representative gel of the results obtained when a PCR assay was performed with random primers (3303, 3304, 3306, 3307) to generate several amplified DNA fragments that allow the comparison of samples from different geographic origins in Ecuador. MW = molecular weight markers; 2 = sample of intestinal contents (QM254); 3 = intestinal contents (QM267); 4 = intestinal contents (CN264); 5 = intestinal contents (QM269); 6 = intestinal contents (SG227); 7 = intestinal contents (MY228); 8 = negative control; 9 = T. cruzi Y strain; 10 = T. rangeli Choachi strain; 11 = T. rangeli SC58 strain.
140
700
600
10,000) 500
(x 400
300
200
Parasites/mL 100
0 24 h48 h72 h Choachi SC58 E1Tocuyo
Figure 12. Parasitemia of BALB/c mice infected with three different strains of T. rangeli.
BALB/c mice were inoculated intra-peritonealy with 1 x 107 parasites of strains Choachi (solid line, diamonds), SC58 (dotted line, squares), and E1Tocuyo (broken line, triangles) of T. rangeli. One mouse was used for each parasite strain. Parasitemia in each mouse was evaluated every 24 hours after the initial infection.
141
40
30 * *
20
10 # intracellular# parasites 200 cells /
0 Choachi SC58 E1Tocuyo # parasites / 200 cells 33.0 ± 3.5 25.3 ± 3.8 24.3 ± 2.0 # parasites / inf. cell 2.8 ± 0.3 2.4 ± 0.1 2.28 ± 0.1
Figure 13. Quantification of infection by T. rangeli parasites in BALB/c mouse fibroblasts.
In the first section of the invasion assays, experiments to assess the infection rates of three different strains of T. rangeli were carried out with strains Choachi, SC58, and E1Tocuyo. All three strains were able to infect mammalian cells, but at different rates. T. rangeli invasion of mammalian cells is intrinsically low, and therefore the strain that showed the best invading capability was used for the rest of the experiments.
Error bars represent the standard deviation. * indicates statistical significant difference relative to the Choachi strain, p < 0.05, n = 3.
142
40
35
30
25
20
15
# intracellular parasites / 200 cells / 200 parasites # intracellular 10
5 0 10203040506070 Time (minutes)
Figure 14. T. rangeli invasion of cells in culture occurs early during the cell-parasite interaction.
T. rangeli parasites (Choachi strain) were added to a layer of BALB/c fibroblasts and incubated for specific periods of time (7.5, 10, 15, 30, and 60 minutes). At each time point, extracellular parasites were washed away, cells were stained for immunofluorescence assays, and the number of intracellular parasites per 200 cells was counted in triplicate.
Error bars represent the standard deviation, n = 3
143
A B C
D E F
Figure 15. T. rangeli parasites are able to invade mammalian cells.
BALB/c fibroblasts were fixed at 24 hours post-infection and stained with anti-T. rangeli antibodies. A. Nuclei are stained with the DNA labeling dye DAPI. B. Anti-T. rangeli primary antibody and FITC-labeled secondary antibody. C. Overlay. Arrow indicates an internalized amastigote form. Horizontal bar = 5 μm D. DAPI staining of BALB/c cells and parasite nuclei. E. T. rangeli trypomastigote stained with FITC-labeled secondary antibody. F. Overlay. Arrow shows the kinetoplast of the trypanosome, and arrow head indicates its nucleus. Horizontal bar = 5 μm. Magnification = 400 X.
144
40
Control 30 Cytochalasin D
* 20
*
10 *
# intracellular parasites / 200 cells / 200 parasites intracellular # * 0 7.5 10 15 30 60 Time (minutes)
Figure 16. Treatment of cells with cytochalasin D reduced the infection by T. rangeli.
BALB/c fibroblasts pre-treated with a 2 μM solution of cytochalasin D for 10 minutes showed a marked reduction in the number of intracellular T. rangeli parasites seen at 15 minutes post-infection.
Error bars represent the standard deviation. * indicates statistical significant difference in relation with the control, p < 0.05, n = 3.
145
40
Control 30 Wortmannin
* 20 * * 10
# intracellular parasites / 200 cells * *
0 7.5 10 15 30 60 Time (minutes)
Figure 17. Pre-treatment of cells with wortmannin resulted in a decrease in the infection rate of T. rangeli.
BALB/c fibroblasts were treated with a 40 nM solution of wortmannin for 30 minutes. A reduction in the infection rate of T. rangeli was observed at the different time points post- infection.
Error bars represent the standard deviation. * indicates statistical significant difference relative to the control, p < 0.05, n = 3.
146
A B
Figure 18. Lysosome-associated membrane 2 (LAMP-2) is seen surrounding an internalized trypomastigote of T. rangeli.
BALB/c fibroblasts were fixed at 7.5 minutes post-infection and stained with anti- LAMP-2 antibodies. A. Anti-LAMP-2 primary antibody and Alexa Fluor-488 labeled secondary antibody. B. Overlay of anti-LAMP-2 and DAPI. Magnification = 400 X. Arrow indicates the lysosome surrounding an internalized amastigote form of the parasite. Horizontal bar = 5 μm
147
30 Control Cyt D 25
20
* 15
10 *
* 5 *
Percentagevacuoles of LAMP-2 positive * 0 7.5 10 15 30 60 Time (minutes)
Figure 19. Pre-treatment of cells with cytochalasin D resulted in a decrease of the number of LAMP-2 positive vacuoles containing internalized parasites.
BALB/c fibroblasts were treated with cytochalasin D for 10 minutes before parasites were added to the cell monolayer. The percentage of LAMP-2 positive vacuoles was calculated at different time points. The treatment reduced the number of positive vacuoles.
Error bars represent the standard deviation. * indicates statistical significant difference relative to the control, p < 0.05, n = 3.
148
APPENDIX
Appendix 1: Working algorithm of PCR reactions carried out with the samples of intestinal contents, feces, hemolymph, and salivary glands obtained from triatomines collected in Manabí and Loja provinces of Ecuador.
Initial Screening Primers S35/S36
T. cruzi specific PCR and lineage typing T. rangeli specific PCR Primers D71/D72 Primers R1/R2
Confirmatory multiplex PCR Confirmatory multiplex PCR Primers TC1, TC2, TC3, TR, ME Primers TC1, TC2, TC3, TR, ME
T. rangeli lineage typing Primers S35/S36/KP1-L
149
Appendix 2: List of triatomines collected in Manabí and Loja provinces in Ecuador and used in the analyses in this study.
Code Species Stage Locality Province Habitat PI207-2-3 R. ecuadoriensis V Pimpiguasi Manabi Chicken nest PI207-2-1 R. ecuadoriensis V Pimpiguasi Manabi Chicken nest PI207-2-2 P. howardi III Pimpiguasi Manabi Pile of bricks PI207-2-7 P. howardi ♀ Pimpiguasi Manabi Pile of bricks PI207-2-5 P. howardi III Pimpiguasi Manabi Pile of bricks PI207-2-12 P. howardi ♂ Pimpiguasi Manabi Living room LE307-7-4 P. howardi V La Encantada Manabi Pile of bricks LE307-7-6 R. ecuadoriensis IV La Encantada Manabi Chicken nest LE307-7-23 R. ecuadoriensis III La Encantada Manabi Chicken nest LE307-7-22 P. howardi V La Encantada Manabi Pile of rocks LE307-7-20 P. howardi V La Encantada Manabi Pile of bricks LE3C-13 P. howardi III La Encantada Manabi Pile of fire wood LE3C-14 P. howardi III La Encantada Manabi Pile of bricks CA300-17 R. ecuadoriensis V Cruz Alta Manabi Chicken nest LE2C-15 R. ecuadoriensis V La Encantada Manabi Pile of fire wood LE2C-7 P. howardi III La Encantada Manabi Pile of bricks 4 P. howardi V La Encantada Manabi Pile of bricks SY201 T. carrioni V Sanambay Loja Bed/mattress SY202 T. carrioni V Sanambay Loja Bed/mattress SY203 T. carrioni V Sanambay Loja Chicken nest SY203 T. carrioni V Sanambay Loja Chicken nest SY204 T. carrioni V Sanambay Loja Chicken nest SY205 T. carrioni IV Sanambay Loja Chicken nest SY206 T. carrioni V Sanambay Loja Chicken nest SY207 T. carrioni IV Sanambay Loja Chicken nest
150
CG208 R. ecuadoriensis V Cienega Loja Chicken nest CG209 R. ecuadoriensis V Cienega Loja Chicken nest CG210 R. ecuadoriensis V Cienega Loja Chicken nest CG211 R. ecuadoriensis III Cienega Loja Chicken nest CG212 R. ecuadoriensis III Cienega Loja Chicken nest AB213 R. ecuadoriensis V Algarrobillo Loja Chicken nest AB214 R. ecuadoriensis V Algarrobillo Loja Chicken nest AB215 R. ecuadoriensis V Algarrobillo Loja Chicken nest AB216 R. ecuadoriensis IV Algarrobillo Loja Chicken nest AB217 R. ecuadoriensis III Algarrobillo Loja Chicken nest CG218 R. ecuadoriensis V Cienega Loja Chicken nest CG219 R. ecuadoriensis V Cienega Loja Chicken nest CG220 R. ecuadoriensis V Cienega Loja Chicken nest CG221 R. ecuadoriensis IV Cienega Loja Chicken nest CG222 R. ecuadoriensis IV Cienega Loja Chicken nest CG223 R. ecuadoriensis ♀ Cienega Loja Chicken nest CG224 R. ecuadoriensis V Cienega Loja Pigeon nest CG225 R. ecuadoriensis V Cienega Loja Pigeon nest CG226 R. ecuadoriensis III Cienega Loja Pigeon nest CG227 R. ecuadoriensis II Cienega Loja Pigeon nest MY228 T. carrioni V Machay Loja Chicken nest TR229 R. ecuadoriensis V Tuburo Loja Bedroom TR230 R. ecuadoriensis V Tuburo Loja Chicken nest TR231 R. ecuadoriensis V Tuburo Loja Chicken nest TR232 R. ecuadoriensis V Tuburo Loja Chicken nest TR233 R. ecuadoriensis ♂ Tuburo Loja Chicken nest TR234 R. ecuadoriensis V Tuburo Loja Chicken nest TR235 R. ecuadoriensis V Tuburo Loja Chicken nest TR236 R. ecuadoriensis V Tuburo Loja Chicken nest
151
TR237 R. ecuadoriensis V Tuburo Loja Chicken nest TR238 R. ecuadoriensis V Tuburo Loja Chicken nest TR239 R. ecuadoriensis ♀ Tuburo Loja Chicken and cat nest TR240 R. ecuadoriensis III Tuburo Loja Chicken nest TR241 R. ecuadoriensis III Tuburo Loja Chicken nest TR242 R. ecuadoriensis III Tuburo Loja Chicken nest TR243 R. ecuadoriensis ♀ Tuburo Loja Bedroom CN101 P. howardi V La Ciénega Manabí Pile of bricks CN102 P. howardi IV La Ciénega Manabí Pile of bricks CN103 P. howardi II La Ciénega Manabí Pile of bricks CN104 P. howardi III La Ciénega Manabí Pile of bricks CN105 P. howardi III La Ciénega Manabí Pile of bricks QM106 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest CN107 P. howardi IV La Ciénega Manabí Pile of bricks CN108 P. howardi IV La Ciénega Manabí Pile of bricks CN109 P. howardi IV La Ciénega Manabí Pile of bricks CN110 P. howardi V La Ciénega Manabí Pile of bricks QM111 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM112 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM113 R. ecuadoriensis IV Quebrada de Maconta Manabí Chicken nest CN114 P. howardi IV La Ciénega Manabí Pile of bricks CN115 P. howardi V La Ciénega Manabí Pile of bricks QM116 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM117 R. ecuadoriensis ♂ Quebrada de Maconta Manabí Chicken nest QM118 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM119 R. ecuadoriensis ♂ Quebrada de Maconta Manabí Chicken nest QM120 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM121 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM122 R. ecuadoriensis ♂ Quebrada de Maconta Manabí Chicken nest
152
QM123 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest SG124 R. ecuadoriensis V San Gabriel Manabí Chicken nest SG125 R. ecuadoriensis IV San Gabriel Manabí Chicken nest SG126 R. ecuadoriensis IV San Gabriel Manabí Chicken nest SG127 R. ecuadoriensis III San Gabriel Manabí Chicken nest SG128 R. ecuadoriensis V San Gabriel Manabí Chicken nest SG129 R. ecuadoriensis III San Gabriel Manabí Chicken nest SG130 R. ecuadoriensis V San Gabriel Manabí Chicken nest QM131 R. ecuadoriensis V Quebrada de Maconta Manabí Chicken nest QM132 R. ecuadoriensis V Quebrada de Maconta Manabí Chicken nest QM133 R. ecuadoriensis IV Quebrada de Maconta Manabí Chicken nest QM134 R. ecuadoriensis IV Quebrada de Maconta Manabí Chicken nest QM135 R. ecuadoriensis III Quebrada de Maconta Manabí Chicken nest QM136 R. ecuadoriensis III Quebrada de Maconta Manabí Chicken nest QM137 R. ecuadoriensis III Quebrada de Maconta Manabí Chicken nest CN138 P. howardi IV La Ciénega Manabí Pile of bricks CN139 P. howardi IV La Ciénega Manabí Pile of bricks CN140 P. howardi V La Ciénega Manabí Pile of bricks CN141 P. howardi III La Ciénega Manabí Pile of bricks CN142 P. howardi V La Ciénega Manabí Pile of bricks QM143 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM144 R. ecuadoriensis ♀ Quebrada de Maconta Manabí Chicken nest QM145 R. ecuadoriensis V Quebrada de Maconta Manabí Chicken nest QM146 R. ecuadoriensis V Quebrada de Maconta Manabí Chicken nest QM147 R. ecuadoriensis V Quebrada de Maconta Manabí Chicken nest NA250 R. ecuadoriensis ♂ Naranjo Adentro Manabi Chicken nest NA251 R. ecuadoriensis ♂ Naranjo Adentro Manabi Chicken nest NA252 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest NA253 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest
153
QM254 R. ecuadoriensis ♀ Quebrada de Maconta Manabi Chicken nest QM255 R. ecuadoriensis IV Quebrada de Maconta Manabi Chicken nest QM256 R. ecuadoriensis V Quebrada de Maconta Manabi Chicken nest SG257 P. howardi V San Gabriel Manabi Pile of bricks and dirt SG258 P. howardi V San Gabriel Manabi Pile of bricks and dirt CN259 P. howardi IV La Cienega Manabi Pile of bricks CN260 P. howardi V La Cienega Manabi Pile of bricks CN261 P. howardi V La Cienega Manabi Bromeliad plants* CN262 P. howardi V La Cienega Manabi Bromeliad plants CN263 P. howardi V La Cienega Manabi Pile of bricks CN264 P. howardi IV La Cienega Manabi Pile of bricks CN265 P. howardi V La Cienega Manabi Pile of bricks CN266 P. howardi V La Cienega Manabi Bromeliad plants QM267 R. ecuadoriensis ♀ Quebrada de Maconta Manabi Chicken nest QM268 R. ecuadoriensis V Quebrada de Maconta Manabi Chicken nest QM269 P. howardi V Quebrada de Maconta Manabi Bromeliad plants QM270 P. howardi V Quebrada de Maconta Manabi Bromeliad plants SML01 T. carrioni III Suanamaca Loja Bedroom SML02 T. carrioni ♀ Suanamaca Loja Bedroom SML03 R. ecuadoriensis ♀ Ashimingo Loja Chicken nest SML04 R. ecuadoriensis ♀ Ashimingo Loja Chicken nest SML05 R. ecuadoriensis ♂ Naranjo Adentro Manabi Chicken nest SML06 R. ecuadoriensis ♂ Naranjo Adentro Manabi Chicken nest SML07 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML08 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML09 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML10 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML11 R. ecuadoriensis ♂ Naranjo Adentro Manabi Chicken nest SML12 R. ecuadoriensis ♂ Naranjo Adentro Manabi Chicken nest
154
SML13 R. ecuadoriensis ♂ Tuburo Loja Chicken nest SML14 R. ecuadoriensis ♂ Tuburo Loja Chicken nest SML15 R. ecuadoriensis ♀ Tuburo Loja Chicken nest SML16 R. ecuadoriensis ♀ La Extensa Loja Guinea pig pen SML17 R. ecuadoriensis ♀ La Extensa Loja Guinea pig pen SML18 R. ecuadoriensis ♀ La Extensa Loja Guinea pig pen SML19 R. ecuadoriensis ♀ La Extensa Loja Guinea pig pen SML20 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML21 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML22 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML23 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SML24 R. ecuadoriensis ♀ Naranjo Adentro Manabi Chicken nest SY244 T. carrioni IV Sanambay Loja Chicken nest SY245 T. carrioni III Sanambay Loja Chicken nest SY246 T. carrioni II Sanambay Loja Chicken nest TR247 R. ecuadoriensis ♀ Tuburo Loja Chicken nest TR248 R. ecuadoriensis III Tuburo Loja Chicken nest TR249 R. ecuadoriensis ♀ Tuburo Loja Chicken nest TR250 R. ecuadoriensis ♀ Tuburo Loja Chicken nest TR251 R. ecuadoriensis ♀ Tuburo Loja Chicken nest TR252 R. ecuadoriensis ♀ Tuburo Loja Chicken nest
♀ = female adult ♂ = male adult I, II, III, IV, V = Nymphs I, II, III, IV, or V * = locally known as “piñuela”