Table S1: Insilco Analysis of Selected Variants

Table S1: Insilco analysis of selected variants.

Result of F SNP

Genetic Variation Functional Category Prediction Prediction FS score Tool Result CD44 rs13347 C>T Transcriptional regulation TFSearch Changed 0.176

CD44 rs353639 A>C Transcriptional TFSearch Changed 0.176 regulation CD44 rs187116 G>A Transcriptional regulation TFSearch Not Changed 0

CD44 rs187115 T>C Transcriptional regulation TFSearch Changed 0.176

Table S2. Genotypic methodology of selected variants

S.No Gene/rs number Genotyping Primer Sequence Method 1. CD44 rs13347 Taqman allele Custom designed C>T discrimination 2. CD44 rs353639 Taqman allele Custom designed A>C discrimination 3. CD44 rs187116 PCR-RFLP F 5’- AGGTGGTTGGAGATCACCTG -3’ G>A R 5’- CTTTCGCAAGAACCACTTCC -3’ 4. CD44 rs187115 ARMS-PCR Fo- 5’GTAAGCTTTCCTCTTTATCCAG-3’ T>C Ro 5’ GAAGCAACATGACAATAGAGA-3’ Fi 5’-AT AGGTGGTTGGAGATCACCTG -3’ Ri 5’- TCCTTTCGCAAGAACCACTTCC -3’ Table S3: Frequency distribution of haplotypes CD44 rs13347 C>T, rs353639 A>C,

rs187116 G>A, rs187115 T>C Polymorphisms in GBC patients and controls after

stratification based on co-existing gallstones

Haplotype Analysis of CD44 in Gallbladder cancer with Haplotype Analysis of CD44 in Gallbladder cancer without stones and healthy Controls stones and healthy Controls

Frequency Frequency

HC GBC OR p- Haplotypes HC GBC OR p- Haplotypes (200) (185) (95%CI) value (230) (206) (95%CI) value

CAGT 0.3297 0.3173 1 --- CAGT 0.3183 0.3173 1 ---

CAAT 0.1987 0.2081 0.53 (0.30 - 0.92) 0.026# CAAT 0.2117 0.2081 1.06 (0.59 - 1.90) 0.84

CCGT 0.0854 0.0853 0.40 (0.16 - 1.01) 0.053 CCGT 0.0927 0.0943 1.91 (0.84 - 4.30) 0.12

CAGC 0.082 0.0943 0.42 (0.17 - 1.05) 0.065 CAGC 0.0824 0.0853 1.27 (0.48 - 3.38) 0.63

CAAC 0.0689 0.0741 0.77 (0.32 - 1.82) 0.55 CAAC 0.0634 0.0741 0.50 (0.17 - 1.47) 0.21

TAGT 0.0661 0.0684 0.51 (0.23 - 1.12) 0.096 CCAT 0.0526 0.0684 0.35 (0.11 - 1.11) 0.075

CCAT 0.05 0.0533 0.43 (0.14 - 1.34) 0.15 TAGT 0.0381 0.0533 0.60 (0.10 - 3.58) 0.57

TCGT 0.0271 0.0225 2.40 (0.47 - 12.3) 0.3 TAAT 0.0326 0.0166 1.90 (0.44 - 8.21) 0.39

TAAT 0.0256 0.0196 1.68 (0.37 - 7.66) 0.5 CCGC 0.0228 0.0225 0.78 (0.21 - 2.87) 0.7

CCGC 0.0218 0.0166 1.61 (0.38 - 6.76) 0.52 TCGT 0.0209 0.0196 0.46 (0.05 - 4.34) 0.5

TAGC 0.012 0.0051 1.57 (0.16 - 15.3) 0.7 TAGC 0.0201 0.0153 0.60 (0.10 - 3.70) 0.58

CCAC 0.0105 - 0.98 (0.11 - 8.73) 0.98 CCAC 0.0137 0.0051 4.67 (0.44 - 50.07) 0.2

Global haplotype association p-value: : 0.41 Global haplotype association p-value: 0.17

GBC-Gallbladder cancer, HC-Healthy controls, OR-Odds Ratio, CI-Confidence Interval. Significant Values are given in bold. #Significance lost after multiple corrections, Table S4: Frequency distribution of CD44rs13347 C>T, CD44 rs353639 A>C, CD44 rs187116 G>A, CD44 rs187115 T>C, polymorphisms after subdividing on the basis of tobacco status (Case only analysis)

Genotype GBC (stone) GBC (No stone) Frequency n (%) p -value OR (95%CI) Frequency n(%) p-value OR (95%CI) CD44 rs13347 genotypes (age and sex adjusted) CC 154(77.0) 134(74.4) - ref 154(77.0) 159(70.7) - ref CT 42(21.0) 43(23.9) .950 .981(.544-1.77) 42(21.0) 61(27.1) .464 1.255(.683-2.304) TT 4(2.0) 3(1.7) .588 1.54(.318-7.52) 4(2.0) 5(2.2) .235 .287(.037-2.250) CT+TT 46(23.0) 66(29.3) .661 1.141(.632-2.060) 46(23.0) 46(25.6) .929 1.026(.582-1.809) CD44 rs353639 genotypes (age and sex adjusted) AA 120(60.0) 109(60.0) - ref 120(60.0) 144(64.0) - ref AC 68(34.0) 63(35.0) .544 .854(.513-1.42) 68(34.0) 67(29.8) .516 .834(.482-1.443) CC 12(6.0) 8(4.4) .903 .931(.296-2.93) 12(6.0) 14(6.2) .159 2.233(.729-6.839) AC+CC 80(40.0) 81(36.0) .875 .959(.570-1.614) 80(40.0) 71(39.4) .555 .863(.528-1.409)

CD44 rs187116 G>A genotypes (age and sex adjusted) Control (200) GBC( 180) Control (200) GBC (225) GG 82(41.0) 76(42.2) - ref 82(41.0) 82(36.4) - ref GA 80(40.0) 72(40.0) .544 .848 (.497-1.445) 80(40.0) 98(43.6) .699 1.122 (.626-2.010) AA 38(19.0) 32(17.8) .106 .566 (.284-1.12) 38(19.0) 45(20.0) .757 .896 (.447-1.795) GA+AA 118(59.0) 143(63.6) .892 1.038(.609-1.767) 118(59.0) 104(57.8) .252 .750(.458-1.227) CD44 rs187115 T>C genotypes (age and sex adjusted) TT 125(62.5) 110(61.1) - ref 125(62.5) 138(61.3) - ref TC 61(30.5) 57(31.7) .952 1.016(.600-1.722) 61(30.5) 69(30.7) .828 .939 (.530-1.66) CC 14(7.0) 13(7.2) .602 .772 (.291-2.04) 14(7.0) 18(8.0) .902 .940 (.353-2.50) TC+CC 75(37.5) 87(38.7) .816 .939(.553-1.595) 75(37.5) 70(38.9) .895 .967(.590-1.586) GBC-Gallbladder cancer, OR -Odds Ratio, CI-Confidence Interval.