
<p> Table S1: Insilco analysis of selected variants.</p><p>Result of F SNP</p><p>Genetic Variation Functional Category Prediction Prediction FS score Tool Result CD44 rs13347 C>T Transcriptional regulation TFSearch Changed 0.176</p><p>CD44 rs353639 A>C Transcriptional TFSearch Changed 0.176 regulation CD44 rs187116 G>A Transcriptional regulation TFSearch Not Changed 0</p><p>CD44 rs187115 T>C Transcriptional regulation TFSearch Changed 0.176</p><p>Table S2. Genotypic methodology of selected variants </p><p>S.No Gene/rs number Genotyping Primer Sequence Method 1. CD44 rs13347 Taqman allele Custom designed C>T discrimination 2. CD44 rs353639 Taqman allele Custom designed A>C discrimination 3. CD44 rs187116 PCR-RFLP F 5’- AGGTGGTTGGAGATCACCTG -3’ G>A R 5’- CTTTCGCAAGAACCACTTCC -3’ 4. CD44 rs187115 ARMS-PCR Fo- 5’GTAAGCTTTCCTCTTTATCCAG-3’ T>C Ro 5’ GAAGCAACATGACAATAGAGA-3’ Fi 5’-AT AGGTGGTTGGAGATCACCTG -3’ Ri 5’- TCCTTTCGCAAGAACCACTTCC -3’ Table S3: Frequency distribution of haplotypes CD44 rs13347 C>T, rs353639 A>C,</p><p> rs187116 G>A, rs187115 T>C Polymorphisms in GBC patients and controls after</p><p> stratification based on co-existing gallstones </p><p>Haplotype Analysis of CD44 in Gallbladder cancer with Haplotype Analysis of CD44 in Gallbladder cancer without stones and healthy Controls stones and healthy Controls</p><p>Frequency Frequency</p><p>HC GBC OR p- Haplotypes HC GBC OR p- Haplotypes (200) (185) (95%CI) value (230) (206) (95%CI) value</p><p>CAGT 0.3297 0.3173 1 --- CAGT 0.3183 0.3173 1 ---</p><p>CAAT 0.1987 0.2081 0.53 (0.30 - 0.92) 0.026# CAAT 0.2117 0.2081 1.06 (0.59 - 1.90) 0.84</p><p>CCGT 0.0854 0.0853 0.40 (0.16 - 1.01) 0.053 CCGT 0.0927 0.0943 1.91 (0.84 - 4.30) 0.12</p><p>CAGC 0.082 0.0943 0.42 (0.17 - 1.05) 0.065 CAGC 0.0824 0.0853 1.27 (0.48 - 3.38) 0.63</p><p>CAAC 0.0689 0.0741 0.77 (0.32 - 1.82) 0.55 CAAC 0.0634 0.0741 0.50 (0.17 - 1.47) 0.21</p><p>TAGT 0.0661 0.0684 0.51 (0.23 - 1.12) 0.096 CCAT 0.0526 0.0684 0.35 (0.11 - 1.11) 0.075</p><p>CCAT 0.05 0.0533 0.43 (0.14 - 1.34) 0.15 TAGT 0.0381 0.0533 0.60 (0.10 - 3.58) 0.57</p><p>TCGT 0.0271 0.0225 2.40 (0.47 - 12.3) 0.3 TAAT 0.0326 0.0166 1.90 (0.44 - 8.21) 0.39</p><p>TAAT 0.0256 0.0196 1.68 (0.37 - 7.66) 0.5 CCGC 0.0228 0.0225 0.78 (0.21 - 2.87) 0.7</p><p>CCGC 0.0218 0.0166 1.61 (0.38 - 6.76) 0.52 TCGT 0.0209 0.0196 0.46 (0.05 - 4.34) 0.5</p><p>TAGC 0.012 0.0051 1.57 (0.16 - 15.3) 0.7 TAGC 0.0201 0.0153 0.60 (0.10 - 3.70) 0.58</p><p>CCAC 0.0105 - 0.98 (0.11 - 8.73) 0.98 CCAC 0.0137 0.0051 4.67 (0.44 - 50.07) 0.2</p><p>Global haplotype association p-value: : 0.41 Global haplotype association p-value: 0.17</p><p>GBC-Gallbladder cancer, HC-Healthy controls, OR-Odds Ratio, CI-Confidence Interval. Significant Values are given in bold. #Significance lost after multiple corrections, Table S4: Frequency distribution of CD44rs13347 C>T, CD44 rs353639 A>C, CD44 rs187116 G>A, CD44 rs187115 T>C, polymorphisms after subdividing on the basis of tobacco status (Case only analysis)</p><p>Genotype GBC (stone) GBC (No stone) Frequency n (%) p -value OR (95%CI) Frequency n(%) p-value OR (95%CI) CD44 rs13347 genotypes (age and sex adjusted) CC 154(77.0) 134(74.4) - ref 154(77.0) 159(70.7) - ref CT 42(21.0) 43(23.9) .950 .981(.544-1.77) 42(21.0) 61(27.1) .464 1.255(.683-2.304) TT 4(2.0) 3(1.7) .588 1.54(.318-7.52) 4(2.0) 5(2.2) .235 .287(.037-2.250) CT+TT 46(23.0) 66(29.3) .661 1.141(.632-2.060) 46(23.0) 46(25.6) .929 1.026(.582-1.809) CD44 rs353639 genotypes (age and sex adjusted) AA 120(60.0) 109(60.0) - ref 120(60.0) 144(64.0) - ref AC 68(34.0) 63(35.0) .544 .854(.513-1.42) 68(34.0) 67(29.8) .516 .834(.482-1.443) CC 12(6.0) 8(4.4) .903 .931(.296-2.93) 12(6.0) 14(6.2) .159 2.233(.729-6.839) AC+CC 80(40.0) 81(36.0) .875 .959(.570-1.614) 80(40.0) 71(39.4) .555 .863(.528-1.409)</p><p>CD44 rs187116 G>A genotypes (age and sex adjusted) Control (200) GBC( 180) Control (200) GBC (225) GG 82(41.0) 76(42.2) - ref 82(41.0) 82(36.4) - ref GA 80(40.0) 72(40.0) .544 .848 (.497-1.445) 80(40.0) 98(43.6) .699 1.122 (.626-2.010) AA 38(19.0) 32(17.8) .106 .566 (.284-1.12) 38(19.0) 45(20.0) .757 .896 (.447-1.795) GA+AA 118(59.0) 143(63.6) .892 1.038(.609-1.767) 118(59.0) 104(57.8) .252 .750(.458-1.227) CD44 rs187115 T>C genotypes (age and sex adjusted) TT 125(62.5) 110(61.1) - ref 125(62.5) 138(61.3) - ref TC 61(30.5) 57(31.7) .952 1.016(.600-1.722) 61(30.5) 69(30.7) .828 .939 (.530-1.66) CC 14(7.0) 13(7.2) .602 .772 (.291-2.04) 14(7.0) 18(8.0) .902 .940 (.353-2.50) TC+CC 75(37.5) 87(38.7) .816 .939(.553-1.595) 75(37.5) 70(38.9) .895 .967(.590-1.586) GBC-Gallbladder cancer, OR -Odds Ratio, CI-Confidence Interval. </p>
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages3 Page
-
File Size-