The Supplementary Experimental Procedures

THE SUPPLEMENTARY EXPERIMENTAL PROCEDURES

RNA extraction and PRL-3 mRNA expression analysis in AML patients

Bone marrow samples of all patients were obtained at the time of diagnosis or after treatment, with the standard informed consent from individual patient. Mononuclear cell of bone marrow were isolated by Ficoll desnsity-gradient centrifugation. The total

RNA was extracted with ultrapure RNA Kit (CW Biotech, China) and RNA concentration was measured by using Nano Drop spectrophotomer (ND-1000,

Thermo Scientific, USA). Two microgram total RNA of each sample was reverse transcribed to synthesize cDNA with SuperScript Ⅲ Reverse transcriptase （ Invitrogen, USA ） . The quantitative real-time PCR (QT-PCR) was performed by using a SYBR Green reaction kit (Takara, Japan) in CFX 96 real time

PCR instrument（Bio Rad，USA）, according to the suppliers’ protocol. To quantify the PRL-3 expression level, a pair of primers (Forward primer, 5′-

ACTTCATCCCGCTCTCAATAAGCG -3′; Reverse primer, 5′-

AGAAGGATGGCATCACCGTTG -3′) was used. Meanwhile, another pair of primers for β-actin (Forward primer, 5′- AGTGGGGTGGCTTTTAGGATG-3′, Reverse primer: 5′- ATGTGGCCGAGGACTTTGATT-3′) were used as internal loading control. Each 20 µl of reaction mixture contained 2 µl of cDNA in 1:10 dilution, 10 µl of 2×SYBR Premix Ex Taq (Takara, Japan), and 0.4µl (0.2μM) of the indicated primers described above. The cycling parameters are denaturing at 95°C for 30 seconds, followed by 40 cycles of amplification (95°C, 5s; 60°C, 30s). All tests were performed at 3 different times. PRL3 expression level was relatively normalized to that of the β-actin gene transcript in each sample. The data were analyzed using the comparative threshold cycle (2−ΔΔCT) method, where the ΔΔCT is the difference between normalized target gene and internal control (ΔCT sample – ΔCT control =

ΔΔCT). Of 112 AML samples, the least normalized PRL-3 expression level was defined as ‘1’; the PRL-3 mRNA level in other AML and healthy samples were indicated as folds of this control.

Cell lines and cell culture

Human leukemia cells lines HL60 (CCL-240™), U937 (CRL-1593.2™), MV4-

11（CRL-9591™) were obtained from the ATCC. MOLM-13 (ACC 554), ML-1 (No.

464) cells were obtained from DSMZ. All cells were cultured in RPMI

1640（Gibco，USA）supplemented with 10% heat-inactivated fetal bovine serum

(FBS) (PAA, Austria）. 293T cells were cultured in 90% DMEM (Dulbecco modified

Eagle medium) with high glucose (4.5 g/L) and 10% tetracycline-free fetal bovine serum (Clontech). All cells were incubated at 37°C in a humidified incubator containing 5% CO2 .

Plasmid construction, lentivirus assembly and transduction

The coding regions of GFP-PRL-3 fusion protein and its phosphatase-dead mutant

EGFP-PRL3 (C104S) were respectively amplified from pEGFP-PRL3 and pEGFP-

PRL3 (C104S) plasmids1 with a pair of primers (Forward: 5' –

GGACTAGTATGGTGAGCAAGGGCGAGGAGC-3'; Reverse: 5'-

CGCGGATCCCTACATAACGCAGCACCGGGTC-3'). The amplified PCR fragments were inserted into the correspondingly doubly digested sites of pLVX-puro vector (Clontech, USA) by Spe I and BamHI. The final pLVX-puro - EGFP-PRL-3 wt and EGFP-PRL-3 (C104S) expression constructs were confirmed by restriction enzyme digestion and sequencing. 293T cells were co-transfected with vectors, packaging mix and x fect polymer (Lenti-X HTX Packaging Systems, Clontech), according to the supplier’s instruction. The assembled lentivirus were harvested from medium at 48 h after 293T cell transfection, following by filtering through a 0.45 μm filter to remove cellular debris, and then concentrated by ultracentrifugation (50000 g), for 90minutes at 4°C. Leukemic cells were incubated with lentivirus in the presence of 8µg/ml of polybrene (Sigma) in 96 well plates for 12h, and then the medium was changed with fresh one. To establish the stable cell pools, the cells were selected in 4μg/ml puromycin for two weeks. EGFP-positive cells were sorted and collected with a fluorescence-activated cell sorter (Influx, BD, USA).

Stable cell lines for RNA interference of PRL-3

Knockdown of endogenous PRL-3 was accomplished with Sureslencing TM shRNA plasmid for human PRL3 (KH09221P, Super Array, USA). The two sequences targeting PRL3 were 5′-TTCTCGGCACCTTAAATTATT-3′ (ShPRL3-1) and 5′-

GAAGTTCAATGCACTGGAA-3′ (ShPRL3-2) and the non-targeting scrambled shRNA sequence was 5′-GGAATCTCATTCGATGCATAC-3′ (ctrl ShRNA). ML-1 cells were transfected with the plasmids by electrotransfection using Nucleofector

TM2b device (Amaxa biosystems, Germany) according to the manufacturer's protocol.

Briefly, 5 × 105 cells were washed with cold serum-free RPMI. ML-1 cells were resuspended in 180μl Nucleofector Solution, stored on ice in 0.4 cm electroporation cuvette. Then 10 μg plasmid DNA was added in cuvette. The optimized program T-

109 was selected to transfect the cells in the Nucelofector device. After transfection, cells were immediately resuspended and transferred into pre-warmed fresh medium.

Positive clones were obtained by 2μg/ml puromycin selection for two weeks.

Western blot

Total protein was isolated with lysis buffer (10 mM Tris-HCl, pH 7.4, 150 mM NaCl,

0.5% NP-40, 1 mM EDTA, 2 μg/ml leupeptin, 2 μg/ml aprotinin, 4 mM Prefabloc SC, and protein inhibitor cocktail) from patients’ bone marrow or from AML cells, and determined the amount using the BCA Protein Assay kit (CW BIO, China). Total protein (20-30 μg) of each sample was loaded and separated on 12% SDS polyacrylamide gel electrophoresis and then electrotransferred onto 0.45-μm pore- sized PVDF membranes (BioRad, USA). After the transfer, membranes were blocked with 5% non-fat milk in PBS with 0.5% Tween 20 (PBST) for 1 h at room temperature. The transferred membranes were incubated with appropriate primary antibodies overnight at 4 °C, followed by incubation with horseradish peroxidase- conjugated secondary antibody for 60 minutes at room temperature. After three times washing with PBST, the protein was visualized using an enhanced chemiluminescence system (ECL, CW Biotech, China). Protein band intensity was measure and calculated as previously reported2. PRL-3 monoclonal antibodies (clones

318) were used as previously3. β-actin antibodies was purchased from CW Biotech

(China), other antibodies including caspase 9, caspase 3, PARP, Cyclin D1, P21, CDK

2, p-STAT5, STAT5, p-AKT473, AKT, p-4E-BP1, p-p70S6K, Ki67, Bax, Bak, BCL-2 and MCL1 were purchased from Cell Signaling Technology (USA).

Immunofluorescence and confocal microscopy

ML-1 cells were cytospun on the slide, fixed with 4% paraformaldehyde for 10 minutes, washed 3 times with PBS, and then permeabilized with 0.5% Triton X-100 for 15 minutes. For checking the infiltrated leukemia cells into mice’s spleen, the dissected spleens were embedded with OCT compound (Tissue-Tek, Miles Inc. USA) and sliced with Microtome-cryostat (Leica, Germany) into 10 micron thick sections and fixed as above. Samples were blocked with 1% BSA for 30 minutes at room temperature. The cells grown on glass slide or tissue sections were stained with mouse anti-PRL3 monoclonal antibody (clones 318) or anti-GFP rabbit polycolonal antibody

(Santa Cruz Biotechnology, USA) for 2 hours at room temperature. After subsequent washing, fluorescein (FITC)-conjugated goat anti-mouse or anti-rabbit secondary antibody (Santa Cruz Biotechnology, USA) were applied for 60 minutes at room temperature in the dark. The samples was then washed with PBS, and mounted with

Antifade reagent with DAPI (Invitrogen，USA). Imaging was conducted with a Zeiss confocal microscope (LSM 710, Carl Zeiss Meditec, Germany) or fluorescence microscope (Nikon, Japan).

Cell proliferation and cytotoxicity assay

The growth rate and cytotoxicity of cells were evaluated by using the CCK-8 cell proliferation kit (Dojindo Laboratories, Japan), according to the manufacturers' instructions. Briefly, AML cells were seeded in 96-well plate at a density of 1×103 per well and grew for 96 h at 37°C for cell proliferation assays. The absorbance at 450 nm was measured with Microplate Reader (Thermo Fisher, USA). The cell growth rate is directly indicated by the absorbance. For cytotoxicity assay, cells were seeded into a

96-well plate at 5×103cells per well with 100 µl complete medium, or treated with the indicated concentration of cytarabine (Ara-C, sigma, USA) for 72 h at 37°C, 10 µl

CCK-8 solution was added into each well at 2h before analysis, and the survived cell viability was indicated based on the absorbance at 450nm as previously reported4. All experiments were carried out in triplicate each time, and three independent experiments were performed.

Colony formation assay

A total of 1×103 cells were seeded into each well of a 24-well plate. The cells were maintained in semisolid culture medium containing 0.9% methylcellulose (Sigma,

USA) and 20% FBS. After one week culture of the plates at 37 °C with 5% CO, the grown colonies (>50 cells) were counted with an inverted microscope (Leica S6E, Germany). All experiments were done in triplicate and three independent experiments were performed.

Cell cycle and apoptosis assays

For cell cycle progression analysis, the cultured cells were harvested and washed by

PBS twice following 72 h incubation, and then fixed with 75% cold ethanol at 4°C overnight. RNA was removed by 100 g/ml RNase (Sigma) digestion for 30 minutes at

37 °C. The cells were labeled with 400µl Propidium iodide for 30 minutes at 4°C in the dark. Cell-cycle analysis was carried out by flow cytometry with a flow cytometer

(Beckman, USA) after propidium iodide staining. Cell apoptosis was analyzed using the Annexin V/7-AAD Apoptosis Detection kit (Keygen Biotech, China), according to the manufacturer’s instructions.

For cell apoptosis analysis, the drug-treated cells as indicated were washed twice with

PBS, resuspended in 500 µl of binding buffer and stained with 5 µl Annexin V-APC and 5 µl 7-AAD for 15 minutes at room temperature in the dark and immediately analyzed by flow cytometry accordingly. All experiments were performed in triplicate and the standard deviations (SD) were indicated.

Tumor models in immunodeficient mice

Four-week old nude mice were purchased from the Experimental Animal Center of Sun Yat-sen University and utilized for the experiments. Each mouse was injected subcutaneously or via the tail vein with 5X105-

1X106 of experimental cells. The subcutaneous tumor growth was measured from the third day after the cell inoculation, and the growth curve was drawn as previously reported5. Mice were sacrificed on the 14th to 20th day when the mice had the restricted tumor burden. The dissected tumor net weight was measured. For metastasis evaluation, all organs and tissues of the assayed mice were examined. Tissues with metastases were either photographed for gross morphology or for immunohistofluorescence analysis with the frozen sections of the dissected organs to discriminate the infiltrated GFP-labeled human leukemia cells from those of mice.

Statistical analysis

Statistical analysis of PRL-3 mRNA expression level was performed with the SPSS

16.0 software (SPSS, Chicago, USA). The data are expressed as mean ±SD or mean ± SEM. Comparisons between groups were analyzed using Student's t-test. The correlation between PRL-3 expression and the clinical features was performed using

χ2 tests. Disease-free survival (DFS) curves were calculated with the Kaplan-Meier method and were compared with the log-rank test. Univariate and multivariate analyses comprising common prognostic factors for DFS were performed using the

Cox regression analysis. Differences were considered to be statistically significant at p<0.05. Student’s t test was also used to compare the difference between groups of experiments unless indicated elsewhere.

SUPPLEMENTARY REFERENCES

1. Wang H, Quah SY, Dong JM, Manser E, Tang JP, Zeng Q. PRL-3 down-regulates PTEN expression and signals through PI3K to promote epithelial-mesenchymal transition. Cancer Res 2007;67(7): 2922- 6. 2. Wang HH, Wong SM. Significance of the 3'-terminal region in minus-strand RNA synthesis of Hibiscus chlorotic ringspot virus. The Journal of general virology 2004;85(Pt 6): 1763-76. 3. Li J, Guo K, Koh VW, et al. Generation of PRL-3- and PRL-1-specific monoclonal antibodies as potential diagnostic markers for cancer metastases. Clin Cancer Res 2005;11(6): 2195-204. 4. Zhang JY, Liang YJ, Chen HB, et al. Structure identification of Euphorbia factor L3 and its induction of apoptosis through the mitochondrial pathway. Molecules 2011;16(4): 3222-31. 5. Naito S, von Eschenbach AC, Giavazzi R, Fidler IJ. Growth and metastasis of tumor cells isolated from a human renal cell carcinoma implanted into different organs of nude mice. Cancer research 1986;46(8): 4109-15.

Supplementary Figure Legends:

Fig. S1. The plotted curves of tumor growth in nude mice after subcutaneous inoculation of AML cells.

A-B. Tumor growth induced by ML-1 cells stably transfected with either scrambled

ShRNAs (Ctrl shRNA) or with PRL-3-specific RNAs (ShPRL-3) (A), or with empty vector (Vector) or PRL-3 (PRL-3) (B) in nude mice after subcutaneous cell inoculation. Tumor diameter was measured on the indicated day post-inoculation and the tumor volumes were calculated. *p<0.05; **p<0.01; n=5 (paired student’s t-test).

C. Tumor growth induced by the stably transfected U937 cells in nude mice and analyzed as in B *p<0.05; **p<0.01; n=5 (paired student’s t-test).

Fig.S2. Western blots of cell proliferation-related Ki67 in the parental ML-1 cells, and the cells stably transfected with either control ShRNA and or two PRL-

3-specific shRNAs. The cells were harvested and lyzed for immunoblotting.

Fig.S3. Western blots of apoptosis or anti-apoptosis-related proteins as indicated in the ML-1 cells stably transfected with either control ShRNA or the two PRL-

3-specific shRNAs. The cells were harvested and lyzed for immunoblotting.