Supporting Information

Electronic Supplementary Material (ESI) for ChemComm. This journal is © The Royal Society of Chemistry 2019

SUPPORTING INFORMATION

Activity-based Protein Profiling Reveals GSTO1 as the Covalent Target of Piperlongumine and a Promising Target for Combination Therapy for Cancer

Li Li, Yue Zhao, Ran Cao, Lin Li, Gaihong Cai, Jiaojiao Li, Xiangbing Qi, She Chen, and Zhiyuan Zhang *

Table of Contents

Contents Page

General Materials S2 Experimental Protocols S3-S6 Supporting Figures and Tables S7-S29 Synthetic Procedures S30-S36 1H and 13C NMR spectra S37-S46 References S47

General Materials

All chemical reagents were used as supplied by Sigma-Aldrich, J&K and Alfa Aesar Chemicals. DCM, DMF, acetonitrile were distilled from calcium hydride; THF was distilled from sodium/benzophenone ketyl prior to use. N-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-5-((3aS,4S,6aR)-2-oxohexahydro- 1H-thieno[3,4-d]imidazol-4-yl)pentanamide were prepared according to the literature reported procedures.[1] S-(4-nitrophenacyl)glutathione (4-NPG) were prepared according to the literature reported procedure.[2] CellTiter-Glo® Luminescent Cell Viability Assay kit (G7570, G7573) was bought from Promega; DCFH-DA (D399) and High Capacity Strepavidin agrose (20361) was bought from Thermo Fisher Scientifc; DMEM Medium, Fetal Bovine Serum (12483-020) and Penicillin- Streptomycin(15140-122) were bought from Life Technology; recombinant GSTO1 protein (enz-434) was bought from Protein Specialists (Prospec); Akt antibody (4691), p-Akt antibody (4060), mTOR (2983), p-mTOR (5536) were bought from Cell Signaling Technology; GSTO1 antibody (GTX105655) were bought from GeneTex; pictilisib (T1994) were bought from TargetMol; siRNA were ordered from Biological Resource Center, National Institute of Biological Sciences, Beijing; LipofectamineTM RNAiMAX (13778030) and LipofectamineTM 3000 (L3000015) were bought from Invitrogen, Thermo Fisher Scientific; Ultimate™ ORF Clone plasmid (OH4381) was provided by Biological Resource Center, National Institute of Biological Sciences, Beijing; pcDNA 3.1 plasmid was given by Dr. Xiaodong Wang lab; anti-cancer agents library was provided by Chemistry Center, National Institute of Biological Sciences, Beijing. 1HNMR spectra were recorded on a Varian 400 MHz spectrometer at ambient temperature with stated solvants. 13C NMR spectra were recorded on a Varian 100 MHz spectrometer (with complete proton decoupling) at ambient temperature. Chemical shifts are reported in parts per million relative to chloroform (1H, δ 7.26; 13C, δ77.00). Data for 1H NMR are reported as follows: chemical shift, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet), integration and coupling constants. High-resolution mass spectra were obtained using Agilent Techmologies 6540 UHD Accurate-Mass Q-TOF LC/MS. Mass spectra was obtained by HPLC/MS on a Waters Auto Purification LC/MS system (3100 Mass Detector, 2545 Binary Gradient Module, 2767 Sample Manager, and 2998

Photodiode Array (PDA) Detector). The system was equipped with a Waters C18 5μm SunFire separation column(150*4.6 mm), equilibrated with HPLC grade water (solvent A) and HPLC grade acetonitrile (solvent B) with a flow rate of 0.3 mL/min.

Experimental Protocols

Cell death assay:

Cells were plated at a density of 3000 cells per well in 96-well plates. 24 h later, indicated compounds were added to cells and incubated for another 24 h. Then, cell viability was determined by measuring the ATP levels using a Cell Titer-Glo kit. Cell survival rate was calculated, and IC50 of tested compounds was calculated by GraphPad Prism software. IC50 values are represented as the mean with the standard error from 3 independent experiments in figures; data points are the mean of duplicates with standard the error from one experiment as a representative in figures.

Testing the reversibility of compound cellular activity:

Cells were plated at a density of 3000 cells per well in 96-well plates. 24 h later, tested compounds were added to cells and incubated for 3h. One subset of these cells was washed free of tested compounds with warmed fresh medium for 3 times; while the other subset of cells were not washed. 24 h after compounds addition, cell viability was determined by measuring the ATP levels using a Cell Titer-Glo kit. Cell survival rate was calculated, and IC50 of tested compounds under wash-off/no wash-off conditions was calculated and compared by GraphPad Prism software. IC50 values are represented as the mean with the standard error from 3 independent experiments in figures; data points are the mean of duplicates with standard the error from one experiment as a representative in figures.

Reaction of PL-1/PL-2 with GSH/NAC:

NAC/GSH (200μM) was added to PL-1/PL-2 (10μM) in medium and incubated for 3 h at 37 °C. The reaction was monitored using LC-MS/MS, and the amount of the remaining compounds was analyzed by Lcquan 2.5 Software. Experiments were repeated three times; data points are the mean of duplicates with standard the error from one experiment as a representative in figures.

Activity-based protein profiling:

NCI-H1975 cells were treated with indicated compounds for 3 h and then lysed. The cell lysate was adjusted to a concentration of 1mg/mL protein, and denatured with 2% SDS for 30min. Click reactions were performed with (N-(2-(2-(2-(2-azidoethoxy)ethoxy)ethoxy)ethyl)-5-((3aS,4S,6aR)-2- oxohexahydro-1H-thieno[3,4-d]imidazol-4-yl) pentanamide) (azido-biotin, 500 μM), CuSO4 (200 μM), TBTA (200μM) and sodium L-ascorbate (1 mM) for 1 hr at 37oC. The whole proteome were then precipitated by 5 volumes of methanol, washed 3 times with methanol, and redissolved with 1mL PBS buffer containing 0.2% SDS. Each sample was incubated with 200uL of streptavidin agrose for 2 h at room temperature, and centrifuged at 3000 rpm for 3 min to collect the agrose. The agrose was washed 3 times with PBS buffer, and eluted with 30ul 1× loading buffer. The eluted components were then subjected to western blot detection or SDS-PAGE and protein MS analysis.

Protein MS/MS:

Protein bands on the SDS-PAGE gel were de-stained, and then reduced in 10 mM DTT at 56 C for 30 min followed by alkylation in 55 mM iodoacetamide at dark for 1 hr. After that the protein bands were in-gel digested with sequencing grade trypsin (10 ng/μL trypsin, 50 mM ammonium bicarbonate, pH 8.0) overnight at 37 C. Peptides were extracted with 5% formic acid/50% acetonitrile and 0.1% formic acid/75% acetonitrile sequentially and then concentrated to ~ 20 μl. The extracted peptides were separated by an analytical capillary column (50 μm  15 cm) packed with 5 μm spherical C18 reversed phase material (YMC, Kyoyo, Japan). A Waters nanoAcquity UPLC system (Waters, Milford, USA) was used to generate the following HPLC gradient: 0-30% B in 40 min, 30-70% B in 15 min (A = 0.1% formic acid in water, B = 0.1% formic acid in acetonitrile). The eluted peptides were sprayed into a LTQ Orbitrap Velos mass spectrometer (ThermoFisher Scientific, San Jose, CA, USA) equipped with a nano-ESI ion source. The mass spectrometer was operated in data-dependent mode with one MS scan followed by four CID (Collision Induced Dissociation) and four HCD (High-energy Collisional Dissociation) MS/MS scans for each cycle. Database searches were performed on an in-house Mascot server (Matrix Science Ltd., London, UK) against the IPI human (International Protein Index) protein sequence database. The search parameters are: 7 ppm mass tolerance for precursor ions; 0.5 Da mass tolerance for product ions; three missed cleavage sites were allowed for trypsin digestion and the following variable modifications were included: (1) for pulldown sample, oxidation on methionine, carbamidomethylation on cysteine, PL-N modification (C5H7NO) on cysteine, PL-5-biotin modification

(C35H47N7O8S) on cysteine; (2) for protein sample, oxidation on methionine, carbamidomethylation on cysteine, PL-N modification (C5H7NO) on cysteine, PL-1 modification (C17H19NO5) on cysteine, PL-5 modification (C17H15NO3) on cysteine. The tandem mass spectra of matched phosphorylated peptides were manually checked for their validity.

Molecular docking simulation:

The X-ray crystal structure of GSTO1 (PDB: 4YQV) was used for docking studies.[3] Before docking simulation, ligands and protein were prepared with the standard protocol using MOE 2015.10 software, including the addition of hydrogens, the assignment of bond order, and assessment of the correct protonation state. All docking calculations were performed using default settings.

GSTO1 enzyme assay:

Cells were incubated with indicated compounds for 3 h, then cells were lysed, and cell lysates were adjusted to protein concentration of 0.5 mg/mL. Enzyme activity tests were performed in 384-well plate. To 50 μL cell lysate was added 1mM S-(4-nitrophenacyl)glutathione (4-NPG) as substrate and 10 mM β-mercaptoethanol as reductant, and the whole enzyme reaction system was incubated at 37oC for 30min[17]. The concentration of 4-NPG was measured and calculated by the absorbance at 305nM. The

relative GSTO1 enzyme activity was calculated based on the mean consumption of 4-NPG during reaction. Experiments were repeated three times; data points are the mean of duplicates with standard the error from one experiment as a representative in figures.

GSTO1 knockdown:

Cells are transfected with GSTO1 siRNA (siGSTO1-1, siGSTO1-2) or scrambled control siRNA (siSCRAM) using LipofectamineTM RNAiMAX following the manufacture’s instruction. Western blot of GSTO1 was performed 36 h after siRNA treatment. Cell viability was detected 48 h after siRNA treatment using a Cell Titer-Glo kit. Experiments were repeated three times; data points are the mean of duplicates with standard the error from one experiment as a representative in figures. siGSTO1-1:

Sense: 5’-GCUUGCCAGAAGAUGAUCUUA dTdT-3’

Antisense:5’-UAAGAUCAUCUUCUGGCAAGC dTdT-3’ siGSTO1-2:

Sense: 5’-CAGGCAUGAAGUCAUCAAU UU-3’

Antisense: 5’-AUUGAUGACUUCAUGCCUG UU-3’ siSCRAM:

Sense: 5’- GACCGCUAAUCGUAUGUAAGU dTdT-3’

Antisense: 5’-ACUUACAUACGAUUAGCGGUC dTdT-3’

GSTO1 overexpression:

GSTO1 cDNA was amplified by PCR from the Ultimate™ ORF Clone plasmid (OH4381) using the primers as followes, and then the GSTO1 expression plasmid was constructed in the pcDNA 3.1 vector. Transfections of GSTO1 expression plasmid or empty vector were conducted using LipofectamineTM 3000 following the manufacture’s instruction. Transfected cells were selected using Hygromycin.

GSTO1 primer:

Forward: 5’-AACGCGGATCCATGTCCGGGGAGTCAGCCAG-3’

Reverse: 5’-AATGCTCTAGA TCAGAGCCCATAGTCACAG-3’

Cellular ROS level detection:

NCI-H1975 cells were plated at a density of 10000 cells per well in 96-well optical plate. 24 h later, cells were treated with experimental compounds for 6 h or with indicated siRNA for 24 h. Then cells were washed 3 times with PBS and then incubated in PBS with 2 μM DCFH-DA for 30 min at 37°C. Cells were washed twice with PBS and fluorescence was detected with a PerkinElmer EnSpire

Multimode Plate Reader (λex= 485 nm and λem= 525 nm). Immediately after fluorescence detection, cell viability was determined by measuring the ATP levels using a Cell Titer-Glo kit. Mean ROS levels were recorded as ROS fluorescence/cell viability and ROS increases as compared with the negative control group (DMSO or siSCRAM) were calculated. Experiments were repeated three times; data points are the mean of duplicates with standard the error from one experiment as a representative in figures.

Combination effect screen:

For the first round of screen, cells were plated at a density of 1000 cells per well in 384-well plates. 24 h later, tested compounds alone or with PL-1 were added to cells and incubated for 24hr. Tested compounds were added at the final concentration of 10/1/0.1 μM using a 200X stock solution; for each concentration, two concentration of PL-1 (3/1μM) were added using a 200X stock solution for combination test. For the tested compounds alone groups, the same volume of solvent (DMSO) of PL-1 solution was also added. Experiments were carried out in duplicates. 24 hr later, cell viability was determined by measuring the ATP levels using a Cell Titer-Glo kit and cell survival rate was calculated. Combinational index were calculated using CompuSyn software (version 1.0). All compounds with CI<1.0 were chosen for the second round of screen.

In the second round of screen, cells were plated at a density of 3000 cells per well in 96-well plates. 24 h later, compounds were added at the same concentration as in the first round of screen. Experiments were carried out in duplicates. 24 hr later, cell viability and CI were determined and calculated as in the first round of screen. Compounds with CI<0.9 were picked as hits that have synergistic effect.

Supporting Figures and Tables

Figure S1. LC-MS detection of PL-1 (a), and reaction of PL-1 with NAC (b) or with GSH (c). PL-1: 100μM. NAC: 1mM. GSH: 1mM.

Figure S2. PL-5 functions in an irreversible mode. Cytotoxic activity of PL-5 in wash/no-wash assays was measured: for the wash-off condition, NCI-H1975 cells were incubated with PL-5 for 3 h and then washed with buffer. Cell viability was measured 24hrs after PL-5 administration.

Figure S3. General procedure for probe target identification by click-reaction-assisted ABPP.

Figure S4.Structure of the reported GSTO1 inhibitor KT45.

Figure S5. ABPP probe PL-5 covalently midified GSTO1 at Cys32 in the PL-5 enriched samples from pulldown assay. (a) MS/MS spectra of PL-N(C5H7NO) modified GSTO1 peptide MRFCPFAER. (b) Detailed model of probe-target binding, click reaction with biotinalyted azide, and speculated amide bond break during in-gel digestion and PL-N modification structure.

Figure S6. PL-1 (a) and PL-5 (4) covalently midified recomibinant GSTO1 at Cys32 with a PL-

N(C5H7NO) modification. Recomibinant GSTO1 (1uM) were incubated with β-mercaptoethanol (10uM) for 30min, followed by addition of PL-1 (20uM) or PL-5 (20uM), and incubated for another 2hr. The sulution were then subjected to SDS-PAFE and protein MS/MS detection.

Figure S7. Cellular (NCI-H1975 cells) incubation of PL-1 and PL-5 inhibited GSTO1 catalyzed 4- nitrophenacyl glutathione reduction activity. DMSO and KT45 were applied as negative and positive controls, respectively.

Figure S8. Relative cellular ROS level after PL-1 treatment (left) and GSTO1 knockdown (right) on NCI-H1975 cells. PL-1 treatment: 10μM for 6 h. siRNA treatment: 10 nM for 16 h. *:P value<0.05; **: P value < 0.01; ***: P value < 0.001.

Figure S9. ROS scavenger NAC doesn’t rescue cell death caused by PL-1/KT45 (a) or GSTO1 knockdown (b).

Figure S10. PL-1 synergized with pictilisib in the cell death induction (a) and in the inhibition of Akt phosphorylation (b) of Jurkat cells.

Figure S11. PL-1 has no effect on the phosphorylation of Akt and mTOR on NCI-H1975 (a) and Jurkat (b) cells.

Figure S12. Knockdown of GSTO1 synergized with pictilisib in the inhibition of Akt phosphorylation of NCI-H1975 cells (a) and Jurkat cells (b).

Table S1. IC50 of PL-1/2/3 on different cell lines.

Cell line PL-1 (μM) PL-2 (μM) PL-3 (μM)

NCI-H1975 2.9±0.14 >50 >50

BT474 4.1±0.98 >50 >50

PNAC-1 4.0±0.87 >50 >50

Jurkat 3.2±0.43 >50 >50

U2OS 3.1±0.14 >50 >50

MCF-7 3.7±0.62 >50 >50

Hela 1.9±0.24 >50 >50

Molt-4 2.3±0.36 >50 >50

HCT-116 6.0±1.0 >50 >50

A549 4.6±0.3 >50 >50

Table S2. Structure-Activity Relationship of PL-1 analogues.

Cmpd Structure IC50 on H1975 Cmpd Structure IC50 on H1975

cell (μM) cell (μM)

PL-1 2.9±0.14 PL-9 1.7±0.18

PL-2 >50 PL-10 2.0±0.08

PL-3 >50 PL-11 7.6±0.38

PL-4 23.0±0.39 PL-12 3.6±0.25

PL-5 3.1±0.31 PL-13 2.6±0.23

PL-6 3.8±0.74 PL-14 3.6±0.35

PL-7 2.5±0.42 PL-15 5.2±0.33

PL-8 3.8±0.08

Table S3. IC50 of PL-5 on different cell lines.

Cell line IC50 (μM)

NCI-H1975 3.1±0.31

Jurkat 1.4±0.18

U2OS 4.3±0.32

MCF-7 4.3±0.54

Hela 3.2±0.33

Molt-4 4.2±0.21

HCT-116 8.8±2.58

A549 5.7±0.35

Table S4. Identification of PL-1 covalent targets in four individual tests.

Test1

Accession protein Mascot score Mascot score score ratio of P/C a b number in sample P in sample C

IPI00019755 GSTO1 Glutathione S-transferase omega-1 2730 152 17.96

IPI00848226 GNB2L1 Guanine nucleotide-binding protein 2324 176 13.20 subunit beta-2-like 1

IPI00025512 HSPB1 Heat shock protein beta-1 1873 459 4.08

IPI00964515 GNB2L1 Protein 1731 152 11.39

IPI00299573 RPL7A;SNORD24 60S ribosomal protein L7a 1697 292 5.81

IPI00025329 RPL19 60S ribosomal protein L19 1607 484 3.32

IPI00018146 YWHAQ 14-3-3 protein theta 1547 179 8.64

IPI00000816 YWHAE Isoform 1 of 14-3-3 protein epsilon 1505 122 12.34

IPI00010896 CLIC1 Chloride intracellular channel protein 1 1142 57 20.04

IPI00895865 ETFA electron transfer flavoprotein subunit alpha, 1128 321 3.51 mitochondrial isoform b

IPI00012772 RPL8 60S ribosomal protein L8 1122 287 3.91

IPI01025580 - Possible J 56 gene segment (Fragment) 1038 233 4.45

IPI00291006 MDH2 Malate dehydrogenase, mitochondrial 974 76 12.82

IPI00888712 POTEKP Putative beta-actin-like protein 3 955 54 17.69

IPI00465248 ENO1 Isoform alpha-enolase of Alpha-enolase 954 80 11.93

IPI00219018 GAPDH Glyceraldehyde-3-phosphate 943 46 20.50 dehydrogenase

IPI00013485 RPS2 40S ribosomal protein S2 858 78 11.00

IPI00908876 ALB cDNA FLJ50830, highly similar to Serum 553 135 4.10 albumin

IPI00218474 ENO3 Isoform 1 of Beta-enolase 399 22 18.14

Test2

Accession protein Mascot score Mascot score score ratio of P/C a b number in sample P in sample C

IPI00010740 SFPQ Isoform Long of Splicing factor, proline- and 2889 361 8.00 glutamine-rich

IPI00438229 TRIM28 Isoform 1 of Transcription intermediary 2714 806 3.37 factor 1-beta

IPI00302927 CCT4 T-complex protein 1 subunit delta 2483 509 4.88

IPI00019755 GSTO1 Glutathione S-transferase omega-1 2318 516 4.49

IPI00215687 GLS Isoform 3 of Glutaminase kidney isoform, 2120 591 3.59 mitochondrial

IPI00021812 AHNAK Neuroblast differentiation-associated 2047 126 16.25 protein AHNAK

IPI00301154 PABPC3 Polyadenylate-binding protein 3 1722 325 5.30

IPI00644712 XRCC6 X-ray repair cross-complementing protein 1711 511 3.35 6

IPI00179964 PTBP1 Isoform 1 of Polypyrimidine tract-binding 1686 476 3.54 protein 1

IPI00031522 HADHA Trifunctional enzyme subunit alpha, 1684 541 3.11 mitochondrial

IPI00304925 HSPA1B;HSPA1A Heat shock 70 kDa protein 1663 380 4.38 1A/1B

IPI00026781 FASN Fatty acid synthase 1606 430 3.73

IPI00295400 WARS Isoform 1 of Tryptophanyl-tRNA 1538 74 20.78 synthetase, cytoplasmic

IPI00465248 ENO1 Isoform alpha-enolase of Alpha-enolase 1442 216 6.68

IPI00215637 DDX3X ATP-dependent RNA helicase DDX3X 1257 315 3.99

IPI00291510 IMPDH2 Inosine-5'-monophosphate dehydrogenase 1247 261 4.78 2

IPI00012726 PABPC4 Isoform 1 of Polyadenylate-binding 1077 97 11.10 protein 4

IPI00015911 DLD Dihydrolipoyl dehydrogenase, mitochondrial 1014 51 19.88

IPI00012442 G3BP1 Ras GTPase-activating protein-binding 972 236 4.12 protein 1

IPI00171903 HNRNPM Isoform 1 of Heterogeneous nuclear 913 46 19.85 ribonucleoprotein M

IPI00002520 SHMT2 Serine hydroxymethyltransferase, 827 262 3.16 mitochondrial

IPI00008943 DDX19B Isoform 1 of ATP-dependent RNA 761 92 8.27 helicase DDX19B

IPI00168184 PPP2R1A cDNA FLJ56053, highly similar to 672 39 17.23 Serine/threonine-protein phosphatase 2A 65 kDa regulatory subunit A alpha isoform

IPI00026781 FASN Fatty acid synthase 576 47 12.26

IPI00221354 FUS Isoform Short of RNA-binding protein FUS 561 127 4.42

IPI00025874 RPN1 Dolichyl-diphosphooligosaccharide--protein 501 103 4.86 glycosyltransferase subunit 1 precursor

IPI00171199 PSMA3 Isoform 2 of Proteasome subunit alpha 484 161 3.01 type-3

IPI00018272 PNPO Pyridoxine-5'-phosphate oxidase 463 76 6.09

IPI00218342 MTHFD1 C-1-tetrahydrofolate synthase, 302 66 4.58 cytoplasmic

Test3

Accession protein Mascot score Mascot score score ratio of P/C a b number in sample P in sample C

IPI00217966 LDHA Isoform 1 of L-lactate dehydrogenase A 1612 0 - chain

IPI00019755 GSTO1 Glutathione S-transferase omega-1 1131 0 -

IPI00440493 ATP5A1 ATP synthase subunit alpha, 956 270 3.54 mitochondrial

IPI00169383 PGK1 Phosphoglycerate kinase 1 488 51 9.57

IPI01026065 AHSA1 23 kDa protein 388 30 12.93

IPI00444262 NCL cDNA FLJ45706 fis, clone FEBRA2028457, 334 30 11.13 highly similar to Nucleolin

IPI00014424 EEF1A2 Elongation factor 1-alpha 2 317 0 -

IPI00479217 HNRNPU Isoform Short of Heterogeneous nuclear 311 0 - ribonucleoprotein U

IPI00217469 HIST1H1A Histone H1.1 301 96 3.14

IPI00179964 PTBP1 Isoform 1 of Polypyrimidine tract-binding 297 62 4.79 protein 1

IPI00744115 PCCA Isoform 1 of Propionyl-CoA carboxylase 246 49 5.02 alpha chain, mitochondrial

Test4

Accession protein Mascot score Mascot score score ratio of P/C a b number in sample P in sample C

IPI00019755 GSTO1 Glutathione S-transferase omega-1 2840 493 5.76

IPI00009104 RUVBL2 RuvB-like 2 1222 358 3.41

IPI00420108 DLST;DLSTP1 Dihydrolipoyllysine-residue 1108 100 11.08 succinyltransferase component of 2-oxoglutarate dehydrogenase complex, mitochondrial

IPI00250153 YBX2 Y-box-binding protein 2 771 220 3.50

IPI00013933 DSP Isoform DPI of Desmoplakin 588 70 8.40

IPI00023860 NAP1L1 Nucleosome assembly protein 1-like 1 472 150 3.15

IPI00032449 ASPH Isoform Junctate of Aspartyl/asparaginyl 466 150 3.11 beta-hydroxylase

IPI01012993 EIF4A1 cDNA FLJ58012, moderately similar to 443 122 3.63 Eukaryotic initiation factor 4A-I

IPI00022974 PIP Prolactin-inducible protein 400 30 13.33

IPI00025753 DSG1 Desmoglein-1 306 30 10.20

IPI00014263 EIF4H Isoform Long of Eukaryotic translation 301 50 6.02 initiation factor 4H

IPI00411680 PCMT1 Isoform 1 of Protein-L-isoaspartate(D- 274 27 10.15 aspartate) O-methyltransferase

Note: a, sample P means the sample in which cells are treated with probe PL-5; b, sample C means the sample in which cells are treated with probe PL-5 and competitor molecule PL-1. All hits that have Mascot score above 200 in sample P and have the P/C score ratio over 3 are listed.

Table S5. IC50 of KT45 on different cell lines.

Cell line IC50 (μM)

NCI-H1975 1.3±0.08

Jurkat 0.62±0.05

U2OS 1.4±0.10

MCF-7 4.0±0.29

Hela 1.0±0.13

Molt-4 0.6±0.15

HCT-116 5.3±0.74

A549 7.06±1.27

Table S6. Screen library for synergism effect.

Cmpd Target Cmpd Target Cmpd Target

Finasteride 5-alpha Reductase Mdivi-1 Dynamin JSH-23 NF-κB

Dutasteride 5-alpha Reductase ID-8 DYRK Andrographolide NF-κB

Lamotrigine 5-HT Receptor BAY 11-7082 E2 conjugating,IκB/IKK Curcumin NF-κB,Histone Acetyltransferase, Nrf2

Mirabegron Adrenergic Receptor Nutlin-3 E3 Ligase ,Mdm2 Oltipraz Nrf2

Epinephrine bitartrate Adrenergic Receptor RITA E3 Ligase ,p53 Naloxone HCl Opioid Receptor

StemRegenin 1 AhR Tenovin-1 E3 Ligase ,p53 (+)-Matrine Opioid Receptor

Triciribine Akt JNJ-26854165 E3 Ligase ,p53 Mesna Others

Uprosertib Akt Thalidomide E3 Ligase ,TNF-alpha Procodazole Others

Afuresertib Akt Erlotinib HCl EGFR Carbazochrome Others sodium sulfonate

MK-2206 2HCl Akt Gefitinib EGFR Uracil Others

GSK690693 Akt Pelitinib EGFR Mitotane Others

CCT128930 Akt Varlitinib EGFR Noscapine HCl Others

TIC10 Analogue Akt Olmutinib EGFR Pimecrolimus Others

Ceritinib ALK Erlotinib EGFR TH-302 Others

ALK-IN-1 ALK Osimertinib EGFR Bindarit Others

AZD3463 ALK Rociletinib EGFR CB1954 Others

Crizotinib ALK,c-Met Dacomitinib EGFR Silibinin Others

Phenformin HCl AMPK Poziotinib EGFR Urethane Others

A-769662 AMPK WZ4002 EGFR Leucovorin Calcium Others Pentahydrate

AICAR AMPK OSI-420 EGFR Febuxostat Others

Flutamide Androgen Receptor AG-1478 EGFR Dimesna Others

Enzalutamide Androgen Receptor CUDC-101 EGFR,HDAC,HER2 Ezetimibe Others

Bicalutamide Androgen Receptor Afatinib EGFR,HER2 Lonidamine Others

MK-2866 Androgen Receptor Lapatinib Ditosylate EGFR,HER2 Alendronate sodium Others trihydrate

Andarine Androgen Receptor Afatinib Dimaleate EGFR,HER2 Calcium Levofolinate Others

Galeterone Androgen Receptor,P450 Neratinib EGFR,HER2 PFK15 Others

Moroxydine HCl Antifection Genistein EGFR,Topoisomerase DDR1-IN-1 Others

Lincomycin HCl Antifection Zibotentan Endothelin Receptor DASA-58 Others

Clorsulon Antifection I-BET-762 Epigenetic Reader Domain GSK650394 Others

Artemether Antifection UNC1215 Epigenetic Reader Domain Danthron Others

Famciclovir Antifection (+)-JQ1 Epigenetic Reader Domain 4E1RCat Others

Tolnaftate Antifection GSK2801 Epigenetic Reader Domain 10-Deacetylbaccatin- Others III

Sitafloxacin Hydrate Antifection Ulixertinib ERK SRPIN340 Others

Methacycline HCl Antifection XMD8-92 ERK RI-1 Others

Sulfabenzamide Antifection ERK5-IN-1 ERK PTC-209 Others

Oleanolic Acid Antifection FR 180204 ERK Malotilate Others

Formestane Aromatase Tamoxifen Estrogen/progestogen CB1954 Others Receptor

Anastrozole Aromatase Clomifene citrate Estrogen/progestogen Cytidine Others Receptor

Exemestane Aromatase Diethylstilbestrol Estrogen/progestogen Formononetin Others Receptor

KU-55933 ATM/ATR Fulvestrant Estrogen/progestogen Oridonin Others Receptor

KU-60019 ATM/ATR Toremifene Citrate Estrogen/progestogen Isoliquiritigenin Others Receptor

VE-822 ATM/ATR Raloxifene HCl Estrogen/progestogen Ursolic Acid Others Receptor

CGK 733 ATM/ATR Estrone Estrogen/progestogen Hesperidin Others Receptor

AZ20 ATM/ATR Estradiol Estrogen/progestogen Orotic acid Others Receptor

Esomeprazole sodium ATPase Defactinib FAK LY2228820 p38 MAPK

BTB06584 ATPase PF-00562271 FAK SB203580 p38 MAPK

Tozasertib Aurora Kinase TAE226 FAK SB202190 p38 MAPK

Alisertib Aurora Kinase PF-573228 FAK Doramapimod p38 MAPK

Barasertib Aurora Kinase Erastin Ferroptosis Pexmetinib p38 MAPK,Tie-2

MLN8054 Aurora Kinase SSR128129E FGFR Itraconazole P450 (e.g. CYP17)

ZM 447439 Aurora Kinase AZD4547 FGFR TAK-700 P450 (e.g. CYP17)

Danusertib Aurora Kinase,Bcr-Abl,c- Orantinib FGFR,PDGFR,VEGFR Cobicistat P450 (e.g. CYP17) RET,FGFR

Azithromycin Autophagy Brivanib FGFR,VEGFR Piperine P450 (e.g. CYP17)

Spautin-1 Autophagy Quizartinib FLT3 NSC 319726 p53

ABT-737 Bcl-2 G-749 FLT3 NMS-873 p97

Navitoclax Bcl-2 TCS 359 FLT3 IPA-3 PAK

Venetoclax Bcl-2 Dovitinib Lactate FLT3,c- PF-3758309 PAK Kit,FGFR,PDGFR,VEGFR

HA14-1 Bcl-2 Pacritinib FLT3,JAK Olaparib PARP

Gambogic Acid Bcl-2,Caspase GW4064 FXR Veliparib PARP

Nilotinib Bcr-Abl Valproic acid sodium GABA Iniparib PARP salt Receptor,HDAC,Autophagy

Radotinib Bcr-Abl Cortisone acetate Glucocorticoid Receptor Rucaparib phosphate PARP

Bafetinib Bcr-Abl Prednisone Glucocorticoid Receptor Anagrelide HCl PDE

Rebastinib Bcr-Abl Triamcinolone Glucocorticoid Receptor Crenolanib PDGFR Acetonide

GNF-2 Bcr-Abl Meprednisone Glucocorticoid Receptor Imatinib PDGFR

Imatinib Mesylate Bcr-Abl,c-Kit,PDGFR STF-31 GLUT1 CP-673451 PDGFR

Dasatinib Bcr-Abl,c-Kit,Src SB216763 GSK-3 Sunitinib PDGFR,c-Kit,VEGFR

Ponatinib Bcr- Indirubin GSK-3 Sorafenib Tosylate PDGFR,Raf,VEGFR Abl,FGFR,PDGFR,VEGFR

Saracatinib Bcr-Abl,Src CHIR-99021 HCl GSK-3 BX-912 PDK

Avagacestat Beta Amyloid, Gamma- TDZD-8 GSK-3 GSK2334470 PDK secretase

Ibrutinib BTK Daclatasvir HCV Protease Zosuquidar 3HCl P-gp

CC-292 BTK Vorinostat HDAC Elacridar P-gp

CNX-774 BTK Sodium HDAC Sal003 Phosphatase Phenylbutyrate

Nilvadipine Calcium Channel Pracinostat HDAC Quinacrine 2HCl Phospholipase

Flunarizine 2HCl Calcium Channel Belinostat HDAC Tanshinone I Phospholipase

SKF96365 Calcium Channel Panobinostat HDAC LY294002 PI3K

Bithionol cAMP Mocetinostat HDAC 3-Methyladenine PI3K

ESI-09 cAMP Ricolinostat HDAC Pictilisib PI3K

Silmitasertib Casein Kinase Entinostat HDAC Idelalisib PI3K

D 4476 Casein Kinase Abexinostat HDAC Alpelisib PI3K

IC261 Casein kinase Quisinostat 2HCl HDAC Duvelisib PI3K

Tasisulam Caspase Resminostat HDAC Pilaralisib PI3K

Apoptosis Activator 2 Caspase Dacinostat HDAC YM201636 PI3K

Maraviroc CCR MC1568 HDAC TG100-115 PI3K

Flavopiridol CDK Mocetinostat HDAC AZD6482 PI3K

abemaciclib CDK Taladegib Hedgehog,Hedgehog/Smoot Idelalisib PI3K hened

Palbociclib HCl CDK Erismodegib Hedgehog/Smoothened GSK2636771 PI3K

Dinaciclib CDK Vismodegib Hedgehog/Smoothened SGI-1776 free base Pim

Roscovitine CDK BMS-833923 Hedgehog/Smoothened CX-6258 HCl Pim

Ribociclib CDK Mubritinib HER2 AZD1208 Pim

Palbociclib CDK 2-Methoxyestradiol HIF Enzastaurin PKC Isethionate

SNS-032 CDK Roxadustat HIF Sotrastaurin PKC

Milciclib CDK Bepotastine Besilate Histamine Receptor Rigosertib PLK

abemaciclib CDK Cimetidine Histamine Receptor Volasertib PLK

Evacetrapib CETP C646 Histone Acetyltransferase BI 2536 PLK

VX-661 CFTR SP2509 Histone Demethylase GSK461364 PLK

AZD7762 Chk Tazemetostat Histone Methyltransferase HMN-214 PLK

LY2603618 Chk Atazanavir Sulfate HIV Protease Tolbutamide Potassium Channel

CHIR-124 Chk Limonin HIV Protease Pioglitazone PPAR

Dovitinib c- Fluvastatin Sodium HMG-CoA Reductase Rosiglitazone PPAR Kit,FGFR,FLT3,PDGFR,V EGFR

Dovitinib Dilactic c- Simvastatin HMG-CoA Reductase Ciprofibrate PPAR Acid Kit,FGFR,FLT3,PDGFR,V EGFR

Amuvatinib c-Kit,FLT3,PDGFR Mevastatin HMG-CoA Reductase FH535 PPAR,Wnt/beta-catenin

Masitinib c-Kit,PDGFR Tanespimycin HSP (e.g. HSP90) Ixazomib Proteasome

Axitinib c-Kit,PDGFR,VEGFR Ganetespib HSP (e.g. HSP90) Delanzomib Proteasome

Pazopanib HCl c-Kit,PDGFR,VEGFR Onalespib HSP (e.g. HSP90) Carfilzomib Proteasome

Sunitinib Malate c-Kit,PDGFR,VEGFR Isotretinoin Hydroxylase Temocapril HCl RAAS

Tivozanib c-Kit,PDGFR,VEGFR DMOG Hydroxylase Sorafenib Raf

Vatalanib 2HCl c-Kit,VEGFR Birinapant IAP Dabrafenib Raf

Tivantinib c-Met LCL161 IAP Vemurafenib Raf

Tepotinib c-Met Birinapant IAP GW5074 Raf

PHA-665752 c-Met Epacadostat IDO MLN2480 Raf

SU11274 c-Met INCB024360 IDO Tamibarotene Retinoid Receptor analogue

Foretinib c-Met,VEGFR Linsitinib IGF-1R Tretinoin Retinoid Receptor

Golvatinib c-Met,VEGFR BMS-536924 IGF-1R Bexarotene Retinoid Receptor

10058-F4 c-Myc GSK1904529A IGF-1R Salirasib Rho

Sulindac COX Dexamethasone IL Receptor Azathioprine Rho

Aspirin COX Dexamethasone IL Receptor,Autophagy ZCL278 Rho Acetate

Phenylbutazone COX Imiquimod Immunology & EHop-016 Rho Inflammation related

Celecoxib COX Geniposidic acid Immunology & Y-27632 2HCl ROCK Inflammation related

Vitamin E COX,VEGFR Cilengitide Integrin Fasudil HCl ROCK trifluoroacetate

TG101209 c-RET,FLT3,JAK TPCA-1 IκB/IKK GSK429286A ROCK

Regorafenib c-RET,VEGFR IMD 0354 IκB/IKK RKI-1447 ROCK

Selinexor CRM1 SC-514 IκB/IKK Thiazovivin ROCK

BLZ945 CSF-1R BX-795 IκB/IKK,PDK SKI II S1P Receptor

Pexidartinib CSF-1R,c-Kit Gandotinib JAK PF-543 S1P Receptor

Linifanib CSF-1R,PDGFR,VEGFR S-Ruxolitinib JAK PF-4708671 S6 Kinase

CEP-32496 CSF-1R,Raf Tofacitinib Citrate JAK BI-D1870 S6 Kinase

Disulfiram Dehydrogenase Ruxolitinib JAK LY2584702 Tosylate S6 Kinase

Gimeracil Dehydrogenase Fedratinib JAK Canagliflozin SGLT

Leflunomide Dehydrogenase AZD1480 JAK Dapagliflozin SGLT

Mycophenolate Dehydrogenase Momelotinib JAK Phloretin SGLT Mofetil

Enasidenib Dehydrogenase SP600125 JNK SRT1720 HCl Sirtuin

Emodin Dehydrogenase JNK-IN-8 JNK Selisistat Sirtuin

Methotrexate DHFR JNK Inhibitor IX JNK Bosutinib Src

Pemetrexed Disodium DHFR Ispinesib Kinesin KX2-391 Src Hydrate

Pralatrexate DHFR SB743921 HCl Kinesin PP2 Src

Pemetrexed DHFR,DNA/RNA Zileuton Lipoxygenase PP1 Src Synthesis

Altretamine DNA alkylator MI-2 MALT Dasatinib Src,c-Kit,Bcr-Abl Monohydrate

Cyclophosphamide DNA alkylator Idasanutlin Mdm2 Napabucasin STAT Monohydrate

Streptozotocin DNA alkylator Selumetinib MEK S3I-201 STAT

Busulfan DNA alkylator Pimasertib MEK Aprepitant Substance P

Azacitidine DNA Methyltransferase Trametinib MEK YM155 Survivin

Azacitidine DNA Methyltransferase Cobimetinib MEK Entospletinib Syk

Decitabine DNA Methyltransferase Binimetinib MEK R406 Syk

SGI-1027 DNA Methyltransferase PD184352 MEK Piceatannol Syk

Gemcitabine HCl DNA/RNA Synthesis PD0325901 MEK Cabozantinib TAM Receptor,c-Kit,c- Met,FLT3,Tie-2,VEGFR

Gemcitabine DNA/RNA Synthesis SL-327 MEK BMS-777607 TAM Receptor,c-Met

Mercaptopurine DNA/RNA Synthesis Vincristine sulfate Microtubule Associated Cabozantinib malate TAM Receptor,VEGFR

Clofarabine DNA/RNA Synthesis Paclitaxel Microtubule Associated BIBR 1532 Telomerase

Capecitabine DNA/RNA Synthesis Docetaxel Trihydrate Microtubule Associated Galunisertib TGF-beta/Smad

Oxaliplatin DNA/RNA Synthesis Docetaxel Microtubule Associated GW788388 TGF-beta/Smad

Procarbazine HCl DNA/RNA Synthesis Vinorelbine Tartrate Microtubule Associated SB431542 TGF-beta/Smad

Cytarabine DNA/RNA Synthesis Patupilone Microtubule Associated PX-12 Thioredoxin

Temozolomide DNA/RNA Synthesis Fosbretabulin Microtubule Associated Eltrombopag Olamine Thrombin Disodium

Lomustine DNA/RNA Synthesis ABT-751 Microtubule Associated Tie2 kinase inhibitor Tie-2

Floxuridine DNA/RNA Synthesis Lexibulin Microtubule Associated Motolimod TLR

Carmofur DNA/RNA Synthesis Cabazitaxel Microtubule Associated Pomalidomide TNF-alpha

Ifosfamide DNA/RNA Synthesis Vinblastine sulfate Microtubule Lenalidomide TNF-alpha Associated,AChR

Carboplatin DNA/RNA Synthesis Batimastat MMP Necrostatin-1 TNF-alpha

Hydroxyurea DNA/RNA Synthesis Marimastat MMP Doxorubicin HCl Topoisomerase

Fluorouracil DNA/RNA Synthesis Ilomastat MMP Topotecan HCl Topoisomerase

Chloroambucil DNA/RNA Synthesis SB-3CT MMP Etoposide Topoisomerase

Bleomycin Sulfate DNA/RNA Synthesis Nobiletin MMP Epirubicin HCl Topoisomerase

Bendamustine HCl DNA/RNA Synthesis Ramelteon MT Receptor Daunorubicin HCl Topoisomerase

Tegafur DNA/RNA Synthesis TH588 MTH1 Irinotecan Topoisomerase

Nelarabine DNA/RNA Synthesis TH287 MTH1 Teniposide Topoisomerase

Fludarabine DNA/RNA Synthesis Torkinib mTOR Amonafide Topoisomerase Phosphate

Dacarbazine DNA/RNA Synthesis Rapamycin mTOR Ellagic acid Topoisomerase

Raltitrexed DNA/RNA Synthesis Temsirolimus mTOR Lonafarnib Transferase

Cladribine DNA/RNA Synthesis Everolimus mTOR GW441756 Trk receptor

6-Mercaptopurine DNA/RNA Synthesis Tacrolimus mTOR Entrectinib Trk receptor,ALK Monohydrate

Nedaplatin DNA/RNA Synthesis Ridaforolimus mTOR Plinabulin VDA

Fludarabine DNA/RNA Synthesis,STAT KU-0063794 mTOR Vandetanib VEGFR

PP121 DNA-PK,mTOR,PDGFR WYE-354 mTOR Cediranib VEGFR

PI-103 DNA-PK,mTOR,PI3K Voxtalisib Analogue mTOR,PI3K Apatinib VEGFR

PIK-75 HCl DNA-PK,PI3K Voxtalisib mTOR,PI3K Lenvatinib VEGFR

NU7441 DNA-PK,PI3K Omipalisib mTOR,PI3K Doxercalciferol Vitamin

Amisulpride Dopamine Receptor Apitolisib mTOR,PI3K Vitamin D3 Vitamin

Linagliptin DPP-4 GMX1778 NAMPT MK-1775 Wee1

b-AP15 DUB Triptolide NF-κB XAV-939 Wnt/beta-catenin

PR-619 DUB

Table S7. Synergistic effects of PL-1 on different cell lines.

Cell line NCI-H1975 Jurkat HCT-116

Tested cmpds[a] 540 540 540

Active cmpds 86 164 52

Combination mode[b] number % of active number % of active cmpds number % of active cmpds cmpds

strong synergism 10 12.2 25 15.2 0 0

synergism 32 36.6 34 21.7 13 25

Moderate synergism 2 2.4 7 4.3 2 3.5

Slight synergism 1 1.2 2 1.2 5 9.6

Total synergism 45 52.3 68 41.5 20 38.4

[a] cmpds is short for compounds. [b] Combination mode was based on CI values, which were calculated using CompuSyn software. Strong synergism: CI<0.3; synergism: 0.3

Table S8. Detailed list of screen hits that have synergism effect with PL-1 in NCI-H1975 cell line.

Synergism mode Target Compound Best CI

EGFR,HER2 Lapatinib Ditosylate 0.16

STAT Napabucasin 0.16

Microtubule Associated Vinorelbine Tartrate 0.2

Histone Demethylase SP2509 0.2

CRM1 Selinexor 0.21 strong synergism Autophagy,Bcl-2 ABT-737 0.24

Microtubule Associated Lexibulin 0.25

PI3K Pictilisib 0.26

c-Kit,FGFR,FLT3,PDGFR,VEGFR Dovitinib 0.27

Casein Kinase D 4476 0.3

EGFR Poziotinib 0.33 Synergism PI3K Duvelisib 0.34

Akt MK-2206 2HCl 0.34

HER2 Mubritinib 0.37

Autophagy,DNA-PK,mTOR,PI3K PI-103 0.38

Akt Uprosertib 0.4

Autophagy,mTOR Rapamycin 0.4

c-Met SU11274 0.42

DNA-PK,PI3K NU7441 0.42

EGFR,Topoisomerase Genistein 0.44

Bcl-2 Venetoclax 0.45

Casein Kinase Silmitasertib 0.47

DNA alkylator Busulfan 0.48

IGF-1R BMS-536924 0.48

Phospholipase (e.g. PLA) Tanshinone I 0.49

Autophagy,HDAC Vorinostat 0.5

PI3K Alpelisib 0.5

Bcr-Abl,Src Saracatinib 0.53

PI3K YM201636 0.53

E3 Ligase ,Mdm2 Nutlin-3 0.55

HDAC Quisinostat 2HCl 0.55

EGFR Erlotinib 0.58

p97 NMS-873 0.59

Microtubule Associated Vinblastine sulfate 0.6

mTOR Tacrolimus 0.6

Estrogen/progestogen Receptor Fulvestrant 0.61

c-Met PHA-665752 0.61

HMG-CoA Reductase Mevastatin 0.64

c-Met,VEGFR Golvatinib 0.65

DUB b-AP15 0.65

PLK BI 2536 0.66

Kinesin Ispinesib 0.69

E3 Ligase ,p53 RITA 0.73 moderate synergism mTOR WYE-354 0.78

slight synergism Hedgehog/Smoothened BMS-833923 0.86

Note: compounds synergism effect are tested with PL concentration at 3 and 1 μM and compound concentration at 10, 1 and 0.1μM.

Table S9. Detailed list of screen hits that have synergism effect with PL-1 in Jurkat cell line.

Synergism mode Target Compound Best CI

mTOR,PI3K Omipalisib 0.05

DNA-PK,PI3K NU7441 0.06

Akt GSK690693 0.08

Autophagy,mTOR Rapamycin 0.09

Epigenetic Reader Domain (+)-JQ1 0.12

Pim AZD1208 0.13

Autophagy,DNA-PK,mTOR,PI3K PI-103 0.14

Ferroptosis Erastin 0.14

ATM/ATR AZ20 0.16

mTOR WYE-354 0.16

Autophagy,Bcl-2 ABT-737 0.17

strong synergism PI3K YM201636 0.17

Raf GW5074 0.17

MALT MI-2 0.18

PI3K Pictilisib 0.18

Autophagy,ROCK Y-27632 2HCl 0.19

DNA/RNA Synthesis Lomustine 0.2

p97 NMS-873 0.22

PAK PF-3758309 0.24

p38 MAPK,Tie-2 Pexmetinib 0.25

CDK Milciclib 0.26

CDK Roscovitine 0.28

mTOR Tacrolimus 0.28

Autophagy,mTOR Torkinib 0.29

Topoisomerase Teniposide 0.29

DNA/RNA Synthesis Fludarabine Phosphate 0.32

Dehydrogenase Enasidenib 0.34

PDK GSK2334470 0.34

Akt Uprosertib 0.36

P-gp Zosuquidar 3HCl 0.36

Survivin YM155 0.36

ERK XMD8-92 0.38

Chk LY2603618 0.39

PPAR Pioglitazone 0.39

CDK SNS-032 0.4

CDK Flavopiridol 0.4

Topoisomerase Etoposide 0.41

Bcl-2 Navitoclax 0.42

Autophagy,Topoisomerase Doxorubicin HCl 0.44 Synergism Akt CCT128930 0.45

Bcl-2 Venetoclax 0.46

Bcr-Abl Rebastinib 0.46

Aurora Kinase,Bcr-Abl,c-RET,FGFR Danusertib 0.47

Nrf2 Oltipraz 0.47

Casein Kinase Silmitasertib 0.49

STAT Napabucasin 0.51

mTOR Everolimus 0.52

Autophagy,ROCK Fasudil HCl 0.54

FAK PF-00562271 0.54

HDAC Abexinostat 0.54

JAK Gandotinib 0.55

JAK Fedratinib 0.55

ATM/ATR KU-60019 0.57

Proteasome Ixazomib 0.57

BTK CC-292 0.6

S6 Kinase BI-D1870 0.61

EGFR,HER2 Neratinib 0.63

HDAC Resminostat 0.64

Hedgehog,Hedgehog/Smoothened Taladegib 0.7

EGFR,HDAC,HER2 CUDC-101 0.71

GSK-3 CHIR-99021 HCl 0.74

PLK Volasertib 0.74 moderate EGFR Pelitinib 0.79 synergism Estrogen/progestogen Receptor Tamoxifen 0.79

HDAC Mocetinostat 0.79

ATM/ATR KU-55933 0.8

S6 Kinase LY2584702 Tosylate 0.85 slight synergism DNA/RNA Synthesis Cladribine 0.9

note: compounds synergism effect are tested with PL concentration at 3 and 1 μM and compound concentration at 10, 1 and 0.1μM.

Table S10. Detailed list of screen hits that have synergism effect with PL-1 in HCT-116 cell line.

Synergism mode Target compound best CI

Proteasome Delanzomib 0.41

Epigenetic Reader Domain I-BET-762 0.48

HSP (e.g. HSP90) Ganetespib 0.49

PI3K Pictilisib 0.49

Casein Kinase Silmitasertib 0.5 Synergism p38 MAPK SB202190 0.53

Autophagy,EGFR Erlotinib HCl 0.56

Bcl-2 Venetoclax 0.56

TNF-alpha Lenalidomide 0.56

Akt Triciribine 0.62

HSP (e.g. HSP90) Tanespimycin 0.62

PI3K YM201636 0.66

p53 NSC 319726 0.67

CRM1 Selinexor 0.75 moderate synergism DNA Methyltransferase Decitabine 0.78

Histone Demethylase SP2509 0.83

Autophagy,Bcl-2 ABT-737 0.86

slight synergism Proteasome Carfilzomib 0.88

Autophagy,mTOR Torkinib 0.89

HDAC Dacinostat 0.89

note: compounds synergism effect are tested with PL concentration at 3 and 1 μM and compound concentration at 10, 1 and 0.1μM.

Synthetic Procedures

Scheme S1. Synthesis route for PL-2 and PL-3. Reagents and conditions: (a) (COCl)2, DMF, DCM, 0℃ to room temperature (rt), 0.5 hr; (b) TEA, THF, R-H, 0℃ to rt, 3 hr.

(E)-1-(3-(3,4,5-trimethoxyphenyl)acryloyl)pyridin-2(1H)-one (PL-2)

To a solution of (E)-3-(3,4,5-trimethoxyphenyl)acrylic acid (100mg,

0.42mmol) in anhydrous DCM was added (COCl)2 (212mg, 1.68mmol) dropwise and catalytic amount of DMF (0.3mg, 0.004mmol), and the reaction mixture was stirred at 0℃ to rt for 30min. The organic solvent was evaporated in vacuo, and the residue was redissolved in anhydrous THF for further usage without purification. Then TEA (78mg, 0.76mmol) and pyridin-2(1H)-one (38mg, 0.38mmol) were added to the THF solution at 0℃ and the reaction mixture was stirred for another 3hr. The reaction mixture was quenched by NH4Cl (aq), extracted by EtOAc/H2O (30mL/30mL) for three times. The EtOAc layer was combined, washed with brine, dried over Na2SO4, concentrated and further purified by silica gel column chromatography (PE/EA=2/1), to give (E)-1-(3-(3,4,5-trimethoxyphenyl)acryloyl)pyridin-2(1H)-one (PL-2) as a white 1 solid in 53% yield. H NMR (400 MHz, CDCl3-d6): δ 8.45(d, J=4.04Hz, 1H), 7.84(d, J=15.88Hz, 1H), 7.81-7.86(m, 1H), 7.24-7.28(m, 1H), 7.21(d, J=4.34Hz, 1H), 6.82(s, 2H), 6.55(d, J=15.88Hz, 1H), 13 3.91(s, 6H), 3.90(s, 3H). C NMR (400 MHz, CDCl3-d6): δ 164.89, 158.20, 153.69, 148.78, 147.39, 140.73, 139.70, 129.61, 122.21, 116.64, 116.24, 105.61, 61.14, 56.37.

(E)-1-(3-(3,4,5-trimethoxyphenyl)acryloyl)piperidin-2-one (PL-3)

The titled compound was prepared in 59% yield as a white solid from (E)- 3-(3,4,5-trimethoxyphenyl)acrylic acid (100mg, 0.42mmol) and piperidin- 2-one (38mg, 0.38mmol) according to the procedure for PL-2. 1H NMR

(400 MHz, CDCl3-d6): δ 7.64(d, J=15.52Hz, 1H), 7.36(d, J=15.52Hz, 1H),

6.79(s, 2H), 3.89(s, 6H), 3.88(s, 3H), 3.79-3.83(m, 2H), 2.59-2.61(m, 2H), 1.87-1.91(m, 4H). 13C NMR

(400 MHz, CDCl3-d6): δ 174.06, 169.83, 153.40, 143.68, 140.13, 130.87, 121.48, 105.58, 61.19, 56.36,

44.89, 35.14, 22.78, 20.85. HRMS (ESI): calculated for [C17H22NO5+], 320.14925, found 320.15094.

Scheme S2. General synthesis route for PL-1, PL-4~6, and PL-8~15. Reagents and conditions: (a) n-

BuLi, CH3OCH2Cl, THF, 0℃, 3 hr. (b) LDA, PhSSPh, HMPA, THF, -78℃, overnight. (c) HCl, EtOH,

80℃, 6 hr. (d) mCPBA, DCM, 0℃ to rt, 2 hr. (e) toluene, 120℃, 1 hr. (f) R-OH, (COCl)2, DMF, DCM, 0℃ to room temperature (rt), 0.5 hr; TEA, THF, 0℃ to rt, 3 hr.

1-(methoxymethyl)piperidin-2-one (IM-1)

To a solution of piperidin-2-one (2g, 20.1mmol) in anhydrous THF was added n-BuLi (DCM solution, 2.4M, 9.2mL) dropwise at 0℃. The reaction mixture was stirred at 0℃ for

30 min, followed by the addition of CH3OCH2Cl (1.9g, 22.1mmol) dropwise. The reaction mixture was stirred for another 3hr, and then extracted by hexane/H2O (300mL/300mL) for three times. The hexane layer was combined, washed with brine, dried over Na2SO4, concentrated and further purified by silica gel column chromatography (DCM/MeOH=20/1), to give 1-(methoxymethyl)piperidin-2-one as a light 1 yellow oil in 95% yield. H NMR (400 MHz, CDCl3-d6): δ 4.18(s, 2H), 3.82-3.85(m, 2H), 3.27(s, 3H), 2.39-2.42(m, 2H), 1.77-1.81(m, 4H).

1-(methoxymethyl)-3-(phenylthio)piperidin-2-one (IM-2)

To a solution of IM-1 (3g, 20mmol) in anhydrous THF (50mL) under N2 atmosphere at -78℃ was added LDA (THF solution, 2M, 20mmol) dropwise and the reaction mixture was stirred for 45min, followed by the addition of PhSSPh

(4.6g, 21mmol) and HMPA (3.8g, 21mmol) portion-wise. The reaction mixture was stirred at -78℃ to rt overnight. The reaction mixture was extracted by Et2O/H2O (300mL/300mL) for three times. The

Et2O layer was combined, washed with 3M NaOH, brine, dried over Na2SO4, concentrated and further purified by silica gel column chromatography (PE/EA=4/1), to give 1-(methoxymethyl)-3- 1 (phenylthio)piperidin-2-one as a light yellow oil in 40% yield. H NMR (400 MHz, CDCl3-d6): δ 7.54- 7.57 (m, 2H), 7.28-7.38 (m, 3H), 4.86(d, J=9.92Hz, 1H), 4.81(d, J=9.92Hz, 1H), 3.89-3.92(m, 1H), 3.35-3.44(m, 2H), 3.31(s, 3H), 2.07-2.20(m, 2H), 1.98-2.04(m, 1H), 1.78-1.85(m, 1H).

3-(phenylthio)piperidin-2-one (IM-3)

To a solution of IM-2 (2.1g, 8.37mmol) in EtOH (50mL) was added HCl (10mL, conc.) dropwise and the reaction mixture was stirred and refluxed for 6 hr. The

organic solvent was evaporated in vacuo, and extracted by DCM/NaHCO3 (aq)

(50mL/50mL) for three times. The DCM layer was combined, washed with brine, dried over Na2SO4, concentrated and further purified by silica gel column chromatography (PE/EA=1/1), to give 3- 1 (phenylthio)piperidin-2-one as a light yellow oil in 50% yield. H NMR (400 MHz, CDCl3-d6): δ 7.54- 7.57(m, 2H), 7.27-7.34(m, 3H), 3.83(t, J=6Hz, 1H), 3.31-3.35(m, 2H), 1.94-2.18(m, 3H), 1.72-1.81(m, 1H).

5,6-dihydropyridin-2(1H)-one (IM-4)

To a solution of IM-3 (700mg, 3.38mmol) in DCM (20mL) was added mCPBA (723mg, 3.38mmol) at 0℃ and the reaction mixture was stirred for 2 hr at 0℃ to rt. The organic solvent was evaporated in vacuo, and extracted by DCM/NaHCO3 (aq) (20mL/20mL) for three times.

The DCM layer was combined, washed with brine, dried over Na2SO4, and concentrated. The residue was redissolved in toluene, stirred and refluxed for another 1 hr. The reaction mixture was concentrated and purified by (PE/EA=1/1), to give 5,6-dihydropyridin-2(1H)-one as a yellow oil in 80% 1 yield. H NMR (400 MHz, CDCl3-d6): δ 6.69-6.73(m, 1H), 5.93(d, J=10.28Hz, 1H), 3.45-3.54(m, 2H), 2.36-2.44(m, 2H).

(E)-1-(3-(3,4,5-trimethoxyphenyl)acryloyl)-5,6-dihydropyridin-2(1H)- one (PL-1, also known as piperlongumine)

The titled compound was prepared in 30% yield as a colorless oil from (E)- 3-(3,4,5-trimethoxyphenyl)acrylic acid (150mg, 0.74mmol) and IM-4 1 (60mg, 0.61mmol) according to the procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 7.68(d, J=15.56Hz, 1H), 7.42(d, J=15.56Hz, 1H), 6.92-6.98(m, 1H), 6.81(s, 2H), 6.05(dt, J=9.72, 1.8Hz, 1H), 13 4.05(t, J=8.56Hz, 2H), 3.89(s, 6H), 3.88(s, 3H), 2.46-2.51(m, 2H). C NMR (400 MHz, CDCl3-d6): 169.01, 166.03, 153.51, 145.77, 143.99, 139.98, 130.85, 125.92, 121.17,

105.60, 61.17, 56.34, 41.84, 25.00. HRMS (ESI): calculated for [C17H20NO5+], 318.13360, found 318.13565.

1-(3-(3,4,5-trimethoxyphenyl)propanoyl)-5,6-dihydropyridin-2(1H)-one (PL-4)

The titled compound was prepared in 25% yield as a colorless oil from 3-(3,4,5- trimethoxyphenyl)propanoic acid (88mg, 0.37mmol) and IM-4 (30mg, 0.31mmol) according to the 1 procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 6.89(dt, J=9.72, 4.16Hz, 1H), 6.47(s, 2H), 5.99(dt, J=9.72, 1.84Hz, 1H), 3.97(t, J=6.52Hz, 2H), 3.85(s, 6H), 3.81(s, 3H), 3.25(t, J=7.72Hz, 2H), 13 2.93(t, J=7.72Hz, 2H), 2.36-2.42(m, 2H). C NMR (400 MHz, CDCl3-d6): δ 175.67, 165.56, 153.23, 145.48, 137.12, 136.33, 125.90, 105.43, 60.89, 56.21, 41.19, 41.10, 31.73, 24.80.

(E)-1-(3-(4-(prop-2-yn-1-yloxy)phenyl)acryloyl)-5,6-dihydropyridin- 2(1H)-one (PL-5)

The titled compound was prepared in 37% yield as a colorless oil from (E)- 3-(4-(prop-2-yn-1-yloxy)phenyl)acrylic acid (75mg, 0.37mmol) and IM-4 (30mg, 0.31mmol) according 1 to the procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 7.73(d, J=15.6Hz, 1H), 7.53-7.57(m,2H), 7.42(d, J=15.6Hz, 1H), 6.96-7.04(m, 3H), 6.04(dt, J=1.84, 9.72Hz, 1H), 4.72(d, J=2.4Hz, 2H), 4.04(t, 13 J=6.48Hz, 2H), 2.54(t, J=2.4Hz, 1H), 2.43-2.55(m, 2H). C NMR (400 MHz, CDCl3-d6): δ 169.13, 166.00, 159.21, 145.59, 143.44, 131.10, 130.12, 128.84, 126.04, 120.11, 115.26, 78.26, 75.95, 55.96,

41.79, 24.98. HRMS (ESI): calculated for [C17H16NO3+], 282.11247, found 282.11383.

(E)-1-(3-(4-methoxyphenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (PL-6)

The titled compound was prepared in 38% yield as a yellow solid from (E)-3-(4-methoxyphenyl)acrylic acid (66mg, 0.37mmol) and IM-4 (30mg, 0.31mmol) according to the 1 procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 7.73(d, J=15.6Hz, 1H), 7.51-7.56(m, 2H), 7.42(d, J=15.6Hz, 1H), 6.91-6.95(m, 1H), 6.86-6.91(m, 2H), 6.04(dt, J=9.72, 1.88Hz, 1H), 4.04(t,

J=6.4Hz, 2H), 3.34(s, 3H), 2.44-2.49(m, 2H). HRMS (ESI): calculated for [C15H16NO3+], 258.11247, found 258.11388.

(E)-1-(3-(4-fluorophenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (PL-8)

The titled compound was prepared in 33% yield as a white solid from (E)-3- (4-fluorophenyl)acrylic acid (31mg, 0.186mmol) and IM-4 (15mg, 0.155mmol) according to the procedure for PL-2. 1H NMR (400 MHz,

CDCl3-d6): δ 7.70(d, J=5.68Hz, 1H), 7.54-7.59(m, 2H), 7.43(d, J=15.68Hz, 1H), 7.03-7.09(m, 2H), 6.95(dt, J=9.56, 4.12Hz, 1H), 6.05(dt, J=9.56, 1.84Hz), 4.04(t, J=6.68Hz, 2H), 2.45-2.51(m, 2H).

HRMS (ESI): calculated for [C14H13FNO2+], 246.09248, found 246.09309.

(E)-1-(3-(4-nitrophenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one (PL- 9)

The titled compound was prepared in 33% yield as a white solid from (E)- 3-(4-nitrophenyl)acrylic acid (31mg, 0.186mmol) and IM-4 (15mg, 1 0.155mmol) according to the procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 8.21-8.25(m, 2H), 7.69-7.73(m, 3H), 7.59(d, J=15.92Hz, 1H), 6.98(dt, J=9.72, 4.24Hz, 1H), 6.06(dt, J=9.72, 1.84Hz),

4.06(t, J=6.52Hz, 2H), 2.48-2.53(m, 2H). HRMS (ESI): calculated for [C14H13N2O4+], 273.08698, found 273.08788.

(E)-1-(3-(4-((1H-imidazol-1-yl)methyl)phenyl)acryloyl)-5,6- dihydropyridin-2(1H)-one (PL-10)

The titled compound was prepared in 12% yield as a white solid from (E)- 3-(4-((1H-imidazol-1-yl)methyl)phenyl)acrylic acid (52mg, 0.227mmol) and IM-4 (20mg, 0.206mmol) according to the procedure for PL-2. 1H

NMR (400 MHz, CDCl3-d6): δ 7.89(s,1H), 7.70(d, J=15.6Hz, 1H), 7.59(s, 1H), 7.57(s, 1H), 7.49(dd, J=1.24, 15.6Hz, 1H), 7.16-7.20(m, 3H), 6.93-6.99(m, 2H), 6.03-6.06(m, 1H), 5.19(s, 2H), 4.04(t,

J=6.36Hzz, 2H), 2.46-2.51(m, 2H). HRMS (ESI): calculated for [C18H18N3O3+], 308.13935, found 308.13986.

1-cinnamoyl-5,6-dihydropyridin-2(1H)-one (PL-11)

The titled compound was prepared in 19% yield as a white solid from cinnamic acid (31mg, 0.206mmol) and IM-4 (20mg, 0.206mmol) according to the 1 procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 7.75(d, J=15.64Hz, 1H), 7.57-7.60(m, 2H), 7.51(d, J=15.64Hz, 1H), 7.34-7.39(m, 3H), 6.94(dt, J=9.72, 4.2Hz, 1H), 6.05(dt, J=9.72, 1.84Hz, 1H),

4.05(t, J=6.48Hz, 2H), 2.45-2.51(m, 2H). HRMS (ESI): calculated for [C14H14NO2+], 228.10191, found 228.10233.

(E)-1-(3-(pyridin-2-yl)acryloyl)-5,6-dihydropyridin-2(1H)-one (PL-12)

The titled compound was prepared in 17% yield as a light yellow solid from (E)- 3-(pyridin-2-yl)acrylic acid (31mg, 0.206mmol) and IM-4 (20mg, 0.206mmol) 1 according to the procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 8.80(s, 1H), 8.63(s, 1H), 8.04(d, J=7.64Hz, 1H), 7.69(d, J=15.72Hz, 1H), 7.58(d, J=15.72Hz, 1H), 7.42-7.48(m, 1H), 6.95-7.00(m, 1H), 6.06(dt, J=9.72, 1.84Hz, 1H), 4.058(t, J=6.44Hz, 2H), 2.48-2.53(m, 2H). HRMS (ESI): calculated for

[C13H13N2O2+], 229.09715, found 229.09867.

Methyl E)-5-(3-oxo-3-(6-oxo-3,6-dihydropyridin-1(2H)-yl)prop-1-en-1- yl)thiophene-3-carboxylate (PL-13)

The titled compound was prepared in 12% yield as a light yellow oil from (E)-3-(4- (methoxycarbonyl)thiophen-2-yl)acrylic acid (53mg, 0.25mmol) and IM-4 (20mg, 0.206mmol) 1 according to the procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 8.06(t, J=1.04Hz, 1H), 7.80(dt, J=0.56, 15.44Hz, 1H), 7.66(t, J=0.56Hz, 1H), 7.36(d, J=15.44Hz, 1H), 6.94(dt, J=9.72, 4.16Hz, 1H), 6.05(dt, J=9.72, 1.88Hz, 1H), 4.03(t, J=6.48Hz, 2H), 3.87(s, 3H), 2.45-2.51(m, 2H). HRMS (ESI): calculated for [C14H14NO4S+], 292.06381, found 292.06476.

(E)-1-(3-(5-nitrothiophen-2-yl)acryloyl)-5,6-dihydropyridin-2(1H)-one (PL-14)

The titled compound was prepared in 4% yield as a light yellow oil from (E)-3- (5-nitrothiophen-2-yl)acrylic acid (28mg, 0.14mmol) and IM-4 (14mg, 1 0.14mmol) according to the procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 7.83-7.85(m, 1H), 7.67(dd, J=0.56, 15.44Hz, 1H), 7.47(d, J=15.44Hz, 1H), 7.19(d, J=4.28Hz, 1H), 6.98(dt, J=9.72, 4.28Hz, 1H), 6.06(dt, J=9.72, 1.84Hz, 1H), 4.04(t, J=6.48Hz, 2H), 2.47-2.53(m, 2H). HRMS (ESI): calculated for [C12H11N2O4S+], 279.04340, found 279.04400.

(E)-1-(6-oxo-3,6-dihydropyridin-1(2H)-yl)-4-(p-tolyl)but-2-ene-1,4- dione (PL-15)

The titled compound was prepared in 4% yield as a white solid from (E)-4- oxo-4-(p-tolyl)but-2-enoic acid (47mg, 0.247mmol) and IM-4 (20mg, 0.21mmol) according to the 1 procedure for PL-2. H NMR (400 MHz, CDCl3-d6): δ 7.91-7.95(m, 2H), 7.74(d, J=15.28Hz, 1H), 7.66(m, J=15.28Hz, 1H), 7.28-7.32(m, 2H), 6.98(dt, J=9.8, 4.16Hz, 1H), 6.05(dt, J=9.8, 1.88Hz, 1H),

4.04(t, J=6.52Hz, 2H), 2.48-2.54(m, 2H), 2.43(s, 3H). HRMS (ESI): calculated for [C16H16NO3+], 270.11247, found 270.11263.

Scheme S3. Synthesis route for PL-7. Reagents and conditions: AlCl3, DCM, rt, 30min.

(E)-1-(3-(4-hydroxy-3,5-dimethoxyphenyl)acryloyl)-5,6- dihydropyridin-2(1H)-one (PL-7)

To a solution of PL-1 (30mg, 0.11mmol) in anhydrous DCM was added

AlCl3 (117mg, 0.88mmol) portion-wise. The reaction mixture was stirred at rt for 30 min, and then quenched by icy NH4Cl solution. The quenched mixture was extracted by

DCM/ NH4Cl(aq) (20mL/20mL) 3 times. The DCM layer was combined, washed with brine, dried over

Na2SO4, concentrated and further purified by silica gel column chromatography (PE/EA=2/1), to give

(E)-1-(3-(4-hydroxy-3,5-dimethoxyphenyl)acryloyl)-5,6-dihydropyridin-2(1H)-one as a yellow solid in 1 42% yield. H NMR (400 MHz, CDCl3-d6): δ 7.69(d, J=15.52Hz, 1H), 7.40(d, J=15.52Hz, 1H), 6.94(dt, J=9.64, 4.16Hz, 1H), 6.82(s, 2H), 6.05(dt, J=9.64, 1.84Hz, 1H), 5.74(s, 1H), 4.04(t, J=6.4Hz, 2H),

3.93(s, 6H), 2.45-2.50(m, 2H). HRMS (ESI): calculated for [C16H18NO5+], 304.11795, found 304.11912.

1H and 13C NMR spectra

References

[1] a) T. Mayer, M. E. Maier, European Journal of Organic Chemistry 2007, 2007, 4711-4720; b) m M. Tantama, W.- C. Lin, S. Licht, Journal of the American Chemical Society 2008, 130, 15766-15767. [2] P. G. Board, M. Coggan, J. Cappello, H. Zhou, A. J. Oakley, M. W. Anders, Anal. Biochem. 2008, 374, 25-30. [3] K. Ramkumar, S. Samanta, A. Kyani, S. Yang, S. Tamura, E. Ziemke, J. A. Stuckey, S. Li, K. Chinnaswamy, H. Otake, Nature communications 2016, 7, 13084.