INFORMATION TO USERS

This manuscript has been reproduced trom the microfilm master. UMI films the text directly from the original or copy submitted. Thus, sorne thesis and dissertation copies are in typewriter face, while others may be trom any type of computer printer.

The quality of this reproduction is dependent upon the quality of the copy submitted. Broken or indistinct print, colored or poor quality illustrations and photographs, print bleedthrough, substandard margins, and improper alignment can adversely affect reproduction. ln the unlikely event that the author did not send UMI a complete manuscript and there are missing pages, these will be noted. Also, if unauthorized copyright material had to be removed, a note will indicate the deletion.

Oversize matarials (a.g., maps, drawings, charts) are reproduœd by sedioning the original, beginning at the upper left-hand corner and continuing tram left to right in equal sedians with small averlaps. Each original is also photographed in one exposure and is included in reduced form at the back af the book.

Photagraphs included in the original manuscript have been reproduced xeragraphically in this copy. Higher quality sn X 9n black and white photographie prints are available for any photagraphs ar illustrations appearing in this copy far an additional charge. Contact UMI diredly to order.

Bell &Howell Information and Leaming 300 North Zeeb Raad, Ann Arbor, MI 48106-1346 USA 800-521-0600

tvfiCROSATELLITE DNA ANALYSIS OF THE MATING SYSTEM

DURING THE FIRST BREEDING PERIOD Of THE FEMALE SNOW CRAB

CH/ONOECETES OP/LlO (BRACHYURA, MAJIDAE)

Nicola Urbani

Department ofAnimal Science

Macdonald Campus ofMcGill University

Montreal, Canada

June 1998

A thesis submitted to the Faculty of

Graduate Studies and Research

in partial fulfilment ofthe requirements ofthe degree of

Doctor ofPhilosophy

() Nicola Urbani 1998 National Library Bibliothèque nationale 1+1 of Canada du Canada Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

395 Wellington Street 395. rue Wellington Ottawa ON Kl A ON4 Ottawa ON Kl A ON4 canada Canada Your fi,. Votr. reffirencs

Our file Notr. r8fsrMCS

The author has granted a non­ L'auteur a accordé une licence non exclusive licence allowing the exclusive pennettant à la National Library ofCanada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies ofthis thesis in microform, vendre des copies de cette thèse sous paper or electronic fonnats. la fonne de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership ofthe L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts from it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle·ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son penmSSlon. autorisation.

0-612-44613-1

Canad~ Suggested short title:

Microsatellite DNA Analysis ofthe Snow Crab Mating System.

ii ABSTRACT

In order to study sperm competition and mating dynamics in the snow crab Chionoecetes opi/io, a genomic library was established with the goal of identifying highly polymorphic microsatellite markers. Six pairs of DNA primers were designed to amplify markers Cop3-4, Cop4-I, CopS,

Cop 10, Cop24-3 and Cop 111 by the polymerase chain reaction (peR). AlI markers produced patterns as expected from single loci inherited in a mendelian fashion, except for CapS which revealed a multi-Iocus banding pattern. The cross-amplification ofthe six loci in seven additional crabs species revealed DNA polymorphisms at one or more loci for each species. Markers Cop3-4 and Cop24-3 were used to detennine patemity oflarvae ofprimiparous females bath from the wild and from multiple mating experiments under laboratory settings. The two markers were also used to genotype the contents offemale spennathecae in arder ta detennine the number ofmale genotyes present. Spermathecal contents ofwild-caught females were eut into severa! cross-sections and each section genotyped individually. Histological analysis of spennathecae was canied out to complement genetic data in arder ta elucidate patterns ofsperm competition. Single patemity was observed for the progeny of a1l females. The analysis of laboratory females showed that spenn displacement was the mecbanism by which single patemity was obtained by the last males to mate.

The analysis ofwild females revealed that their spermathecae contained on average the spenn of at least 3.7 males. Larvae appeared to he sired by males whose genotypes were found in the spennathecal cross-sections toward the blind-end ofthe spennathecae. This suggested that they were the tirst males to mate with females they guarded until oviposition, and females remated with other males thereafter. Also, a comprehensive account ofthe mating dynamics was carried out in a wild

ili population of the Northwest Gulf of Saint Lawrence (Eastern Canada) and demonstrated the

existence of intricate male mating hierarchies and assortative pairing processes based on the size

and quality ofmates, in a context ofsorne times intense male sexual competition. For the fIlSt time

in brachyurans data suggested that female handicaps and secondary sexual characters also influence

pair formation. In arder to complement the data on the mating behavior, microsatellite analysis at

loci Cop3-4 and Cop24-3 was canied out in five mating pairs involving males grasping primiparous

females with their egg clutches. Genetic analysis showed that females had mated on average with

3.4 males, but none ofthe graspers had fathered their mates' eggs. It appeared that these males had smaller shells or shells in poorer conditions than dominant males mating with recentIy molted pubescent females.

iv RÉsUMÉ

Dans le but d'étudier les stratégies de reproduction et les modalités de competition de spenne chez le crabe des neiges Chionoecetes opi/io, une librairie d'ADN génomique a été élaborée afm d'identifier des marqueurs hypervariables d'ADN microsatellite. Six paires d'amorces ont été construites afin d'amplifier les marqueurs Cop3-4, Cop4-I, Cop5, Cop 10, Cop24-3 et CoplI! par la réaction de polymérisation en chaîne (PCR). Alors que cinq marqueurs révelaient des loci individuels avec des allèles transmis de façon mendel1ienne, le marqueur Cop5 a révelé des patrons multi-Iocus. La présence des six loci a été évaluée chez sept autres espèces de crabe et des polymorphismes ont été détectés à un ou plusieurs loci pour chacune des espèces. Les marqueurs

Cop3-4 et Cop24-3 ont ensuite été utilisés afm de déterminer la paternité des larves provenant de femelles primipares sauvages et de femelles primipares utilisées dans des expériences d'accouplements en laboratoire. Les deux marqueurs ont aussi été utilisés pour analyser le contenu des spennathèques de femelles afm de détenniner le nombre de génotypes mâles qu'elles contenaient. Dans le cas des femelles sauvages, le contenu de chaque spermathèque a été coupé en plusieurs sections et le génotype de chacune d'elles a été détenniné individuellement. De plus, une analyse histologique a été effectuée dans le but de compléter les données génétiques afin d'élucider les modalités de competition de sPenne. L'analyse génétique a démontré qu'il Yavait paternité unique pour la progéniture de toutes les femelles. L'analyse des femelles de laboratoire a démontré que le mécanisme de competition de sperme responsable poW' la paternité unique était le déplacement d'éjaculats précedents par celui du dernier mâle accouplé. L'analyse de femelles sauvages a démontré que leur spermathèques contenaient en moyenne le sperme de 3.1 mâles.

v Cependan4 les larves de femelles sauvages avaient été fertilisées par les mâles dont le génotype apparaissait dans les sections des spennathèques les plus reculées. Ceci suggère qu'ils étaient les premiers a s'accoupler avec des femelles qu'ils auraient défendues jusqu'à oviposition et que les femelles se seraient réaccouplees par la suite. De plus, les dynamiques d'accouplemet chez une population du nord-ouest du Golfe du Saint-Laurent dans l'est du Canada ont été analysées. Les résultats ont démontré l'existance d'une hiérachie d'accouplement chez les mâles, et de processus de formation de couples qui sembleraient se baser sur la taille et la qualité des partenaires dans un contexte de compétition entre mâles parfois intense. L'analyse a également montré pour la premiere fois au sein des Brachyura que des caractères sexuels secondaires chez les femelles peuvent aussi influencer la formation de couples. Afin de complémenter les données sur les dynamiques d'accouplemen4 une analyse génétique à partir des loci Cop3-4 et Cop24..3 a été éffectuée chez cinq couples impliquant des mâles saisissant des femelles primipares avec leur portées d'oeufs. L'analyse a démontré que les femelles s'étaient accouplées en moyenne avec 3.4 mâles et que les mâles saisissant les femelles n'étaient pas les pères de leurs oeufs. Les cinq mâles analysés étaient plus

Petit ou dans des conditions moins bonnes que les mâles dominants s'accouplant avec des femelles pubères ayant reçemment mué.

vi Questa tesi e dedicata a papofiglio Uberto Urbani.

vü ACKNOWLEDGMENTS

There are many people l wish to thank for their help in completing this work. First, l would like to sincerely thank Dr. Urs KuhnIein, my supervisor, for his guidance and patience throughout my studies. l am grateful for the freedom he gave me and the Many opportunities ta go out on croises and ta attend scientific meetings. Many thanks to Ors. Bernard Sainte-Marie, Jean-Marie

Sévigny, Samuel Aggrey and David Zadwomy for their guidance and numerous discussions.

[ wish to thank Ors. Bernard Sainte-Marie and Jean-Marie Sévigny as weil as Éric Parent for their friendship and hospitality during my stays at the Maurice Lamontagne Instltute in Mont-Joli.

Many thanks to the crew ofthe CaJanusII for being so welcoming and so nice when l was sea...sick.

1wish to express my appreciation for being the recipient oftwo Walter M. Stewart Postgraduate

Scholarships in Agriculture that gave me more freedom and the luxury to buy myselfa computer.

Many thanks to Magdalena Volkov for always having available what l needed for my experiments and for consistently remembering my binhday.

Many thanks to Carole Leclerc-Potvin, Éric Parent, Eliane Ubalijoro, Peter KuhnJein, Zhou

Jeng-Feng, Yao Jianbo and Grégoy Bédécarrats for their precious help and encouragement in the labo

l aIso wish to thank my family for their support and assistance. Finally, 1wish to thank my fiancée, Eliane Ubalijoro, for her presence, for her love and for waiting all these years to see me graduate.

vüi THESIS OFFICE STATEMENT

In accordance with the regulations ofthe Faculty ofGraduate and Research concerning thesis preparation" manuscripts submined or accepted for publication have been incorporated inta this thesis. The following is quoted fram "Guidelines for Thesis Preparation"':

Candidates have the option ofincluding, as part oftheir thesis, the text ofone or more papers submitted or to be submittedfor publicationt or the c/ear/y dup/icated text ofone or more published paper. These texts must be boundas an Integral part ofthe thesis.

Ifthis option is chosent connecting texts that provide /ogical bridges between the different papers are mandatory. The thesis must he written in such a way that it is more than a mere collection ofmanuscripts; in other words, resu/ts ofa series ofpapers must he integrated.

The thesis must still con/onn ta al! other requirements ofthe "Guidelines Conceming Thesis

Preparation". The thesis must inc/ude: A Table ofContentst an abstract in English and French an

introduction which clearly states the rationale and objectives ofthe study, a review ofthe literature. afinal conclusion and summaryt and a thorough bib/iography or reference list.

Additional material must be provided where appropriate (i.e. in appendices) andin sufficient deTail ta allow a clear andprecisejudgement ta be made ofthe importance and originality ofthe

research reported in the thesis.

ln the case ofmanuscripts co-authored by the candidate and others. the candidate is required ta malœ an exp/icit statement in the thesis as to who contributed to such work and ta whot extent. Supervisors must anest to the accuracy ofsuch statements at the doctoral oral defence. Since

the task ofthe examiners is made more difficult in these cases, it is in the candidate~ interest to malce perfectly clear the responsibilities ofaIL the aulhors ofco-authoredpapers.

ix TABLE OF CONTENTS

ABSTRACT 111

RÉsuMÉ V

ACKNOWLEDGMENTS ...... viii

TUESIS OFFICE STATEMENT ix

CONTRIBUTIONS TO KNOWLEDGE xiii

CONTRIBUTIONS OF CQ-AUTHORS TO MANUSCRIPTS xv

LIST OF TABLES xvi

LIST OF FIGURES xviii

LIST OF ABBREVIATIONS ...... xix

CRAPTER 1. INTRODUCTION .

CRAPTER 2. LITERATURE REVIEW ...... 5 2.1 Mating bebavior in Bracbyura 5 2.1.1 Female centered competition 5 2. 1. 1. 1Search and defend 5 2.1.1.2 Pattol and defend 6 2.1.1.3 Capture and defend 6 2.1.2 Resource centered competition 7 2.1.2.1 Breeding site defense 7 2.1.2.2 Refuge defense 7 2.1.3 Encounter rate competition 8 2.1.3. 1Neighborhoods ofdominance 8 2.1.3.2 Search and interception 9 2.2 Reproduction in Bracbyura 9 2.2.1 Female anatomy 9 2.2.2 Male anatomy ...... Il 2.2.3 Mating in Brachyura LI 2.2.4 Spenn competition in Majidae 13 2.3 Microsatellites marken 14 2.3.1 Nature ofmicrosatellites 14 2.3.2 Evolution ofmicrosatellites 16 2.3.3 VNTR markers, patemity and identity testing 18

x CHAPTER 3...... 22 Identification of microsatellite markers in the SDOW crab Chionoecetes opilio 22 3.1 Acknowledgements 24

Connecting statemeot 1 27

CHAPTER 4...... 28 Sperm competition and paternity assurance during the first breeding period of female snow crab Chionoecetes opilio (Brachyura: Majidae)•...... 28 4.1 Abstract 29 4.2 Résumé 29 4.3 Introduction 30 4.4 Materials and methods•...... 33 4.4.1 Mating experiments 33 4.4.2 Collection ofprimiparous females in the wild 35 4.4.3 Dissection oflaboratory and wild-caught females 35 4.4.4 DNA extractions. . 36 4.4.5 Microsatdlite analysis 37 4.5 Results. . 38 4.5.1 Sperm segregation and paternity in controlled mating studies 38 4.5.2 Sperm segregation and paternity in wild-caught females 40 4.6 Discussion 42 4.7 Acknowledgmenu 46

Connecting statement fi 55

C~TER5 56 Multiple choice criteria and the dynamies of assortative mating during the fint breeding period offemale snow crab Chionoecetes opilio (Brachyura, Majidae). 56 5.1 Abstract 57 5.2 Introduction 57 5.3 Material and Metbods 60 S.3.1 Study site and sampling 60 S.3.2 Characterization ofsnow crab 61 5.3.3 Genetic analyses 62 S.3.4 Statistical analyses 63 5.4 Results 64 5.4.1 Diver observations 64 5.4.2 Categories ofpaired crabs and characteristics ofgraspees 64 S.4.3 Characteristics ofgrasPers in relation to Pair type 66 5.4.4 Assortative mating 67

Xl 5.4.5 Genetic analysis ofprimiparous pairs 70 5.5 Discussion .-...... 71 5.5. 1 Mating associations - 71 5.5.2 Male competitive ability 72 5.5.3 Assortative mating _ 74 5.6 Acknowledgments 76

CHAPTER 6. GENERAL CONCLUSIONS " 87

APPENDICES 91 Appendix 1. DNA sequence of 16 microsatellite containing loci 91 Appendix 2. Banding patterns obtained from PCR amplification ofsix microsatellite loci ...... 92 Appendix 3. Compared variability at loci Cap3-4 and CaplOin closely related species...... '" ., 93 Appendu 4. AUele frequencies at loci Cop3-4, Cop4, CoplO, Cop24-3 and CopI li, and calculations ofexpected heterozygosities 94 Appendix 5. Copyright waivers for papers presented in chapters 3 and 4 95

REFERENCES...... 96

xii CONTRIBUTIONS TO KNOWLEDGE

Cbapter 3:

1) A total of 186 microsatellite DNA sequences have been isolated for the f1I'St time in Chionoecetes opi/io. Among those, 54 have been sequenced and the repetitive elements have been identified in

16 clones. PCR assays were developed for loci Cop34, Cop4-1, CepS, CoplO, Cop24-3 and

Cop Ill. The six markers are the frrst hypervariable microsatellite loci to be developed in the

Brachyura (aIl true crabs).

2) Markers Cop3-4, Cop4-1, Cop5, CoplO, Cop24-3 and CopI Il were tested in additional crab species and cross-amplification revealed DNA polymorphisms at one or more loci in Cancer majister, Chionoecetes bairdi, Hyas araneus, Hyas coarctatus, Hyas !yratus, Oregonia gracilis, and

Pugettia graci/is.

Cbapter4:

1) Multiple mating experirnents were perfonned under laboratory settings with males and primiparous females. The genetic analysis at loci Cop3-4 and Cop24-3 of adults, larvae and spennathecae, in concert with histologieal examination ofthe reeeptacles, showed for the frrst rime in C. opi/io that sperm stratification was the predominant sperm competition mechanism leading ta single patemity.

2) A genetic analysis, using loci Cop3-4 and Cop24-3, was canied out for the tirst rime in wiId­ caught primiparous females, their spermathecae and their larvae. The analysis revealed that the

xiü organs contained on average the spenn ofat least 3.7 males, and that the larvae were sired by the

fust males ta mate. This suggested the existence of an important behavioral mechanism also

resulting in single patemity, through insemination and complete control of a virgin female by a

dominant male until oviposition .

Chapter5:

1) In order ta complement the data on the mating behavior in a wild population ofthe Northwest

GulfofSaint Lawrence (Eastern Canada), a genetic analysis was carried out for the frrst time using

loci Cop3-4 and Cop24-3 in mating pairs involving males grasping primiparous females bearing

their egg clutches. The analysis showed that females had mated on average with 3.4 males, but none

ofthe graspers had fathered their mates' eggs. ft appeared that these males had smaller shells or

shells in poorer conditions than dominant males mating with recently molted pubescent females.

1 xiv CONTRIBUTIONS OF CO-AUTHORS TO MANUSCRIPTS

Cbapter 3:

1carried out the elaboration ofa C. opi/io genomic library, the screening for microsatellite sequences, the PCR assays and the evaluation ofmarkers Cop3-4, Cop4-1, CapS, CopIO, Cop24-3 and Cop III in seven additional crab species. Dr. Sévigny supplied the initial DNA samples and Dr.

Sainte-Marie provided crabs species other than C. opi/io. Ors. Kuhnlein, Sévigny, Sainte-Marie and

Zadwomy provided significant help in the design and supervision ofthe work.

Cbapter 4:

1 carried out the DNA extractions and the genotyping at loci Cop3-4 and Cop24-3 of spermathecae and larvae of primiparous females from the wild and from controlled mating experiments. Collection ofcrabs was done in collaboration with Ors. Sainte-Marie and Sévigny. AIl video recordings ofthe laboratory matings were done at the Maurice Lamontagne Institute (Mont­

Joli, Québec, Canada) under the supervision of Ors. Sainte-Marie and Sévigny. The two authors were responsible for the preparation and analysis ofhistological slides. Ors. Sainte-Marie, Sévigny,

Kuhnlein and Zadwomy contributed significantly to the overall design and supervision ofthe work.

Chapter 5:

1carried out the DNA extractions and the genotyping at loci Cop3-4 and Cop24-3 ofwild­ caught mating pairs, female spermathecae and progenies. In addition, 1contributed ta the overall design and analysis ofthe work. Dr. Sainte-Marie was responsible for the diving operations and carried out the statistical analysis. Ors. Sainte-Marie and Hazel were among the main divers. Ors.

Sévigny and Kuhnlein contributed ta the overall design and SUPervision ofthe warka LIST OF TABLES

Table 3.1: Characterization ofsnow crab microsatellite loci. Loci were analysed using the DNA of about 20 unrelated individuals. 25 Table 3.2: Number ofalleles in cross..species amplification. M and .. indicate multilocus banding pattern and absence ofamplification, respectively 26 Table 4.1. Analysis ofpatemity in eleven broods from primiparous females subjected to controlled matings ...... 48 Table 4.2. Alleles observed at locus Cop24-3 in spennathecal cross·sections and embryos ofseven wild-caught primiparous females ...... 49 Table 4.3. Alleles observed at locus Cop3 ..4 in spennatheeal cross-sections and in the embryos of seven wild..caught primiparous females ...... 51 Table 4.4. Genetic and histologieal data on the spennathecae ofseven wild-caught primiparous females ...... 53 Table 5.1. Yearly variation in composition ofpotentially fecund pairs by graspee identity, expressed as a percentage oftotal number of potentially fecund pairs. based on diver collections of paired Chionoecetes opilio in Baie Sainte-Marguerite during March 1991,1992, 1995 and 1996 79 Table 5.2. Yearly variation in the composition of non fecund pairs by graspee identity, as percentage oftotal number ofnon fecund pairs, based on diver collections ofChionoecetes opilio pairs during March 1991, 1992, 1995 and 1996 80 Table 5.3. Yearly variation in Mean carapace width (CW, in mm) of pubescent femates and of primiparous females in potentially fecund pairs, and of graspees (immature females, adolescent males or adult males) in non fecund pairs, for Chionoecetes opi/io collected by divers in Baie Sainte-Marguerite during March 1991, 1992, 1995 and 1996 81 Table 5.4. Yearly variation in the composition by shell condition ofgrasping males in pubescent, primiparous, and non fecund pairs collected by divers in Baie Sainte-Marguerite during March of 1991, 1992, 1995 and 1996, as a percentage ofnumber ofpairs in each category

xvi ofpairs 80 Table 5.S. Yearly variation in the mean carapace width (CW~ in mm) ofmale graspers in pubescent~ primiparous, and non fecund pairs ofChionoecetes api/io collected by divers in Baie Sainte- Marguerite in March of 1991 ~ 1992, 1995 and 1996 81 Table S.6. AUeles at locus Cop3-4 observed in couples BSM-C BSM-II, BSM-rn~ BSM-IV and BSM-V 82 Table S.7. Alleles at locus Cop24-3 observed in couples BSM-I, BSM-II, BSM-ill, BSM-IV and BSM-V 83 Table S.8. Primiparous mating pairs collected by divers in Baie Sainte-Marguerite 84

xvii LIST OF FIGURES

Figure 4.1. Light micrographs and schematics ofmedio-sagittal sections ofthe spennathecae ...... ,, 53 Figure 4.2. Alleles observed at the locus Cop24-3 54 Figure 5.1. Potentially fecund mating pairs collected in Baie Sainte-Marguerite 85 Figure 5.2. AJleles observed at locus Cop24-3 86

xviii LIST OF ABBREVIATIONS

ANOVA analysis ofvariance computer software AW abdomen width bp base pairs oC centigrade CH chela height CW carapace width DNA deoxyribonucleic acid dNTP deoxynucleotide triphosphate liter ln naturallogarithm m meter

MgCl2 Magnesium chloride ,uL microliter (1 O~) ,uM micromolar (10.0)

3 mM millimolar (10. )

,um micrometer (10-6) min minute n number ng nanogram (1 O·~ PCR polymerase chain reaetion RAPD random amplified polymorphie ONA SOS sodium dodecyl sulfate U unit VNTR variable number oftandem rePeats

xix CHAPTER 1. INTRODUCTION

Snow crabs Chionoecetes opilio are common inhabitants of the deep bottoms of the

Northwest Atlantic, the Bering Sea and the Sea ofJapan. As a result oftheir size and abundance they support important fisheries around the world that are dependent on the fluctuations of their populations (Davidson et al. (985). Despite the economic importance of C. opilio, there are still gaps in the knowledge ofits basic biology which could compromise its long tenn sustainability as a resource for fisheries. In particular, concems that the current management regimes may not maintain the reproductive potential of the populations generated considerable interest in the reproductive biology ofsnow crabs. Patterns ofspenn storage and patemity remain unclear in a species where females can mate with several males and store their spenn in paired spennathecae for extended periods (Watson 1970; Beninger et al. (988). Thus, there is a potential for sperm competition to occur within the spennathecae that could he important in the evolution of the behavior and reproduction ofC. opilio.

Parkcr (1970) idcntified sperm competition as an clement ofsexual selection involving the

"competition" between ejaculates of severa! males for the fertilization of the eggs of a fernale capable of storing viable sperme He pointed out that selection may continue between sperm deposition and fertilization, and suggested that in species where mechanisms of last male spenn precedence have evolved, selection would have favored physiological, morphological, and behavioral adaptations allowing males to ensure their paternity. 8uch adaptations include sperm plugs (deposited by males in female genital tracts to prevent further access by male copulatory appendages), prolonged copulations without further sperm transfert and post-copulatory mate

1 guarding (males may remain in physical contact with their mates, or guard them by residing in their vicinity).

Among taxa in which females are polygamous and have spenn storage organs, spenn competition often leads ta single patemity through mechanisms of sperm stratification or spenn removal (Birkhead and Hunter 1990). In mechanisms ofsperm stratification, spenn frOID the last male displaces previous ejaculates toward the blind end ofthe spenn stores, away from efferent ducts leading ta the avaries, with the result that it May he the first ta he used for egg fertilization (e.g

Smith 1979). On the other hand, mechanisms ofspenn removal involve eLimination ofpreviously deposited spenn from the female reproductive tract, either by extraction (e.g. Waage 1979) or by

~'t1ushing out" one ejaculate by a subsequent one (e.g. Rubenstein 1989).

The anatomy and reproductive behavior ofcrustaceans, especially brachyurans, are similar ta those found in invertebrate and vertebrate species where spenn competition mechanisms have been documented. Only a few studies, however, have addressed the question ofspenn competition in Crustacea (Diesel 1990). It appears in the terrestrial isopods Porce/lio scaber (Sassaman 1978) and Venezii/o everg/adensis (Johnson 1982) that polyandry and spenn mixing lead ta muliple patemity. Among the Decapoda, sperm mÎXing and multiple patemity have been docwnented by electrophoretic isozyme analysis in the lobster HomanJS americanus (Nelson and Hedgecock 1977) and in the crab Cancer pagarus (Burfitt 1980). On the other band.. serial maring experiments canied out with nonnal and irradiated males have shown that the last male fertilized a very large proportion ofthe eggs in the craytish Orconectes rusticus (Snedden 1990), and in the crabs lnachus phalangium

(Diesel 1990) and Scopimera globosa (Koga et al. 1993). Also, isozyme analysis revealed single patemity in C. opi/io and supponed the last-male sperm precedence bypothesis (Sévigny and

2 Sainte-Marie 1996). Among the crustacea however, the only documented spenn competition mechanism was elucidated in Inachus pha/angium under laboratory settings, and appeared to involve sperm stratification. In the spermathecae offemale l phalangium the ejaculate ofthe most recent mate occurred close to the oviduct opening and had exclusive access to unfertilized eggs

(Diesel 1989, 1991).

An alternative approach from the technique of inadiated males to study pattern ofspenn usage is the use ofpolymorphie DNA markers. Preference has been given to markers that could he used at early stages oflarvae development, bcfore patterns ofspenn precedence could be distorted by effects of differential survival rates among larvae. In this respect, techniques based on DNA amplification by the polymerase chain reaction (peR) were found highly valuable as minute amounts oftissues are sufficient for analysis and large numbers ofindividuals can be analyzed in a short time. Random amplified polYmorphie DNA markers (RAPD's) have been used to study sperm competition in two Anisoptera (Hadrys et al. 1992, 1993), by pooling DNA ofthe offsprings and using densitometry to detennine patemal contribution of20% or more. RAPD's have aIso been used to study genetic diversity ofstored spenn (Siva-Jothy and Hooper 1995) and sperm precedence

(Hooper and Siva..Jothy 1996) in a zygopteran. However, because RAPD's yield few polymorphisms with dominance-recessive characteristics, they are inappropriate in detennining the number ofmales siring the offspring ofa female when her maring history is unknown (Cooper, 1996). In addition, the detection of non-parental bands in the offspring complicates the analysis of RAPD's and discredits their reliability (Riedy et al. 1992). Another class of molecular markers were recendy developed foUowing the emergence of PCR technology and are the repetitive DNA sequences known as microsatellites. Such markers exhibit stable Mendelian inheritance, have numerous

3 codorninant alleles, high levels ofheterozygosity and have become important tools for the studyof relatedness between individuals (Tautz 1989; Litt and Luty 1989; Weber and May 1989; Fries et al.

1990; Stallings et al. 1991). Although the use of microsatellite markers to study animal mating systems would be ideal (Amos et al. 1993), it has been limited due to the labor intensive work needed ta characterize such markers from the species being studied. Among the Arthopoda, microsatellite analysis ofpatterns ofspenn usage have only been studied in the damselfly lschnura e/egans (Cooper et al. 1996). It was shown from both wild and Iaboratory females that multiple matings were common, that sperm mixing occurred to significant levels but that last-male precedence appeared to be the role due to spenn extraction by the mating males. Among crustaceans, microsatellite loci have only been identified in the lobster Homarus americanus (Tarn and Komfield 1996), and therefore they have not yet been used to study patterns of sperm competition and paternity.

The main objectives ofthis study were to develop locus-specifie microsatellite markers in order to address questions relating to patemity and spenn competition in femate snow crab. The study focused on primiparous femates because their reproductive success in a given year can he related to specific population characteristics without confounding effects ofpast mating history. The work was conducted with multiply-mated femates under laboratory settings, with wild-caught females and with wild-eaught mating couples to verify that patterns observed in the laboratory aIso occur in the wild.

4 CHAPTER 2. LITERATURE REVIEW

2.1 Mating bebavior in Bracb)'ura

The mating behaviors among brachyuran crabs are very diverse and can he classified on the

basis ofhow males compete for mates. Males may (1) defend receptive females from other males

(2) defend the resources that are required for breeding and/or survival by the females associated with these resources (3) not defend females nor resources but compete among themselves in ways that

maximize female encounters (Christy 1987~b). The three categories are generally designated as

female centered competition, resource centered competition and encounter rate competition, respectively. Within these categories, there are significant differences ofmating associations that justify the need for a funher classification.

2.1.1 Female centered competition

2.1.1.1 Search and defend

Males usually search for and defend femaJes for severa! days before a female' s seasonal malt

(or molt to maturity depending on the species) and mating occurs within hours after a female's molto

In Many cases, males may continue to guard their mate for severa! days after mating. Females May keep the sperm obtained from a single mating for long periods, with the purpose offertilizing their seasonal or lifetime production ofeggs. This type ofmating system has been observed in aquatic mobile and aggressive species belonging to the Corystidae (Hartnoll 1968), Portunidae (Ryan 1966;

Fielder and Eales 1972; Eales 1974), Cancridae (Edwards 1966; Elner and Stasko 1978; Elner and

EIDer 1980; Elner etal. 1985). Also, species ofthe genus Chionoecetes appear ta belong to this class s ofmating system since they are highly mobile (Paul and Paul 1996), competition for females may he very intense (Taylor etal. 1985; Sainte-Marie and Hazel 1992; Sainte-Marie etal. 1997)~ and pre­ and post-copulatory guarding has been reported (Watson 1972).

2.1.1.2 Pattol and defend

This kind ofmating association is usually found among crabs that have limited mobility, and where females have a limited home range. Male competitive ability is mainly determined by size since large males have few competitors for a relatively constant resource of sedentary females.

Studies on the spider crab lnachus phalangium (Wirtz and Diesel 1983; Diesel 1986a, 1986b) have provided a clear example ofsuch a mating association. During the eight months ofa female' s adult life, she will produce about six egg clutches, and will ovulate immediately following each hatching.

During this time, large males will pattol (without defending) areas containing two to eight females, and evaluate how readily the clutches are to hatch by probing with their chelae the abdomen of females. Ifthe embryos are one or two days from hatching, the male will copulate repeatedly and aggressively guard the female until the embryos hatch. Males appear to leam the timing of the reproductive cycle and location ofthe females within the area they patral, and have been observed to arrive regularly at each female about a day before ber eggs would hatch. It is believed that other spider crabs such as Libinia emarginata may exhibit similar reproductive behaviors (Hinsch 1968,

Christy 1987a).

2.1.1.3 Capture and defend

In this system, males obtain mates by aggressively conquering passing fema1es and carrying

6 them into burrows they may guard until mating. This behavior has been observed in semi-terrestrial

species among the Xanthidae (Hazlett 1975; Hazleu et al. 1977; Swartz 1978; Engstrom an Lucenti

1984) and Ocypodidae (Crane 1957; Yamaguchi and Noguchi 1979; Zucker 1983). Male Scopimera globosa have even be seen attempting to capture juvenile and adult individuals of either sex

irrespective oftheir sizes and even crabs ofother species (Yamaguchi and Noguchi 1979).

2.1.2 Resource centered competition

2.1.2.1 Breeding site defense

Male defense ofbreeding sites is thought to have evolved in species where females require access ta specifie micro-environments ta suc.cessfully breed. In such systems, females are usually unable ta create such sites themselves given that they have to actively forage and move extensively in order to he in prime conditions for reproduction (Christy 1980, 1983; Christy and Salmon 1984).

Males will dig burrows on open sand beaches and fight to defend them from other males. Receptive females will "test" severa! maies by responding sequentially to visual and acoustic courtship signais before they choose their mates. Once a cnoice is made, they will crawl in the chosen burrow and will he guarded by their males for one to severa! days until oviposition. It appears that femaIe choice is mainly based on the quality of the burrows males defend. Such mating systems have been observed extensively in terrestrial and semi-terrestrial species ofGecarcinidae (Gifford 1962; Abele et al. 1973; Bliss et al. 1978; Hicks 1985) and the Ocypodidae (Salmon 1965; Yamaguchi 1971;

Hyatt 1977; Greenspan 1980; Muller 1983).

2.1.2.2 Refuge defense

7 This type of mating association is thought to have evolved in species living in extreme environmental conditions and under constant pressure by predators. Consequently, females tend to be continuously receptive to males, have relatively Httle mobility, and appear clumped in refuges.

In such a system, males will usually maintain territories including refuges used by several females, and large individuals are capable ofexcluding other males from areas containing females. Females may aggressively resist mating attempts by sorne males and will actively he involved in selecting their mates. Female mate choice is conditional upon quality ofrefuges, such that ifa male is capable ofmaintaining a territory with favorable refuges, he will increase his chances offinding mates. This mating strategy has been observed in semi...terrestrial species among the Xanthidae (Cheung 1968;

Savage 1971; Sinclair 1977; Huber 1985) and Grapsidae (Seiple and Salmon 1982; Abele et al.

1986). Perhaps the best study on this type ofmating association was provided by Abele et al. (1986) on the breeding ecology and behavior of Pachygraphus transversus (Grapsidae). This species shelters itself in cracks ofintertidal rocks during high tides in order to avoid predators and during low tides to avoid heat and lack ofwater. Their main activities occur white they are wet during intertidal hours.

2.1.3 Encounter rate competition

2.1.3.1 Neighborboods ofdominance

This mating association is often round in species having low mobilities but high population densities evenly distributed throughout a particular habitat. Males interact aggressively with the result ofshifting male dominance over particular areas or "neighborboods". However, males do not appear to compete for definite resources and dominance over an area is temponry. Males will

8 engage in courtship given the opportunity, but do not appear to actively search for females. Females are receptive to males only for brief periods and May aggressively resist attempted copulations by males, thus exhibiting mate selection based on male courtship tactics. Such a mating system has been observed in semi-terrestrial and terrestrial species among the Grapsidae (Beer 1959; Schone and Schone 1963; Wamer 1967, 1970; Nye 1977) and Ocypodidae (Griffm 1968; Nakasone et al.

1983; Salmon 1984, 1987).

2.1.3.2 Search and interception

In this system, males appear ta actively seek mates and begin courtship as soon as they encounter one without paying much attention to other males. This strategy appears to have evolved in mobile species with low population densities and even distribution throughout a particular habitat. Females do not usually advertize their limited sexual receptivity, and exercice mate choice as they may end courtship sequences by fleeÎDg or resisting aggressively. It appears therefore that the best strategy males have found to maximize their mating success is to search and sample actively for mates. Mating success is therefore detennined by differences in search efficiencies and not through aggressive interactions between males. Species that were found ta display such behavior are among terrestrial and semi-terrestrial Grapsidae (Bovbjerg 1960; Lindberg 1980; Seiple and

Salmon 1982) and the Ocypodidae (Beer 1959; Silas and Sankarankuny 1967).

1.% Reproduction in Brachyura

2.2.1 Fema/e anatomy

The Brachyura possess sperm storage organs that can he divided into !Wo classes depending

9 on their morphology, position in relation ta the avaries, and function during spawning. (1) The thyleca ofthe Podotremata Guinot 1977, and (2) the dorsal-and ventral-type seminal receptacles or spennathecae ofthe Thoracotremata Guinot 1977 and Heterotremata Guinot 1977 (includes the

Majidae). While egg fertilization in the Podotremata is external, it is internaI in the Thoracotremata and Heterotremata . The thelyca are usually paired sternal invaginations, with no connection ta the ovary, that open on the coxa ofthe third pereiopod (Gordon, 1963). On the other hand the seminal receptacles of Thoracotremata and Heterotremata represent enlargements of the paired female genital tracts. They are typically pouchlike in form with a dorsal part that is an expansion of the ovary and a ventral part that opens via the vagina and vulva on the sixth thoracic sternite (Ryan

1967; Hartnoll 1968; Hinsch 1986; Adiyodi and Anilkumar 1988; Beninger et ai. 1998; Diesel

1989).

ln the Thoracotremata and Heterotremata, the paired vaginas are typically deflated tubes with latera! muscles that run to the sternites. When they are contracted, these muscles open the vaginas and vulvas during spawning and for the male's pleopods during mating. The dorsal parts ofthe seminal receptacles consist ofan outer flexible and highly elastic connective tissue that can accomodate large amounts ofejaculate. Each ovary is connected to the seminal receptacle by an oviduct. There is a fair amount ofvariation in the way seminal receptaeles are organized within the reproductive tracts ofThoracottemata and Heterotremata. They are referred to as dorsal-type and ventral-type depending on the location ofthe oviduct oPellÎDgs in relation 10 the vaginas. The dorsal­ types are found in the Portunidae and look like enlarged tubes in which the oviduet OpeDîngs are rather dorsal, and the vaginas lie ventrally. The ventral-types, on the other band, are sac-like shaped, the oviduct openings and vaginas are in close proximity and lie ventrally with respect to the

10 receptacles. Ventral-types are found in the Calappidae, Geryonidae, Leucsiidae, Parthenopidae,

Parathelphusidae, Corystidae, Ocypodidae, and in aIl spider crab species (Maj idae) for which

reports are available, Le., Pisa armada, Inachus dorsettensis (Cano 1891), Hyas araneus, Hyas

coarctatus (Hartnoll 1968), Chionoecetes opi/io (Beninger et al. 1988), lnachus phalangium (Diesel

1989), Pisa tetraodon, Maja squinado, lnachus communissimus, and Macropodia rostrata (Diesel

1991).

2.2.2 Maie anatomy

The male reproductive systems in Braehuyra are paired and consist oftestis, vas deferentia,

and ejaculatory duets that open in smaIl genital papilla. Ejaculates are composed ofa mixture of

nonmotile spennatozoa and seminal plasma. Spermatozoa are encapsulated in numerous hollow

chitinous spermatophores that vary in numbers from twelve to severa! hundreds. Spennatophores

are formed and stored in the anterior vas deferens, while the posterior vas deferens produces and

stores the seminal plasma. Given the broad spectrum of female reproductive anatomy within the

Braehyura, complex penises have evolved from the fust and second pleopods for ejacu!ate transfer

(Diesel 1991). In the Majidae and some other brachyurans, the posterior vas deferens is particularly

enJarged and is capable ofproducing and sorting large amounts ofseminal plasma.

2.2.3 Mating in Brac1ryura

In female crabs, mating is possible ooly when the morphological mature condition is attained. This process consists of a number of changes in size and shape of the abdomen, the pleopods and genital openings (Hartnoll, 1963). Ina few species, such changes occur gradually over

Il several molts, but in most, including aIl majid crabs, they occur at a single molt termed the puberty molt.

In brachyurans, there are two types of matings that are based on the state of a female's carapace. In one type, mating occurs shortly after the fernale has molted and is tenned "soft-shell mating". This mating is characterized by prolonged precopulatory and post-copulatory male­ guarding. In the other, mating occurs while females are in the fully ..hardened intennoit condition and is termed ''hard-shell mating". While there may be a short courtship, post..copulatory guarding is generally absent. Crabs engaging in soft-shell mating are usually aquatic species, such as the

Cancridae, Portunidae, Geryonidae and Calappidae, and the basis oftheir sexual communication has been shown to be mainly chemical (Ryan 1966; Eales 1974; Pearson and Oila 1977; Gleeson

1980). In contrast, hard-shell mating is predominant among semi-terrestrial and terrestrial crabs such as the Ocypodidae, Gecarcinidae and Grapsidae, where the basis oftheir sexual communication rely on visual and acoustic signais (Crane 1957; Salmon and Atsaides 1968; Salmon 1971; Christy 1980;

Christy and Salmon 1984).

In the majority ofspecies, females continue to molt after their puberty molt. For species engaging in soft-shell matings, females can mate at their puberty molt and at each subsequent malt while soft-shelled. Although the same is true for species engaging in hard-shell matings, females will he receptive only when the hard shell condition is reached (Jones and Hartnoll 1997). In contrast to most species, spider crabs (Majidae) will engage in bath types of mating. In majid species, there is a tenninal molt to maturity for both sexes (Hartnoll 1963; Watson 1972; Diesel

1988a), and the puberty molt for females corresponds to their final molt. Tberefore, ooly one soft­ shell mating is possible at the puberty mol~ and any subsequent matings occur in the hard-shell

12 condition. Females engaged in the soft-shell matings are usually called pubescent-primiparous while those in hard-shell matings are termed multiparous (Elner and Beninger 1995).

2.2.4 Sperm competition in Majidae

Among crustaceans, sperm competition mechanisms have only been elucidated in the ghost spider crab Inachus phalangium. Iiowever, such mechanisms may he common to all tvlajidae as they appear ta share analogous mating behaviors and reproductive organs. During mating, males 1. phalangium transfer their ejaculate by shalIowly inserting the tips oftheir gonopods into female vaginae. They first introduce a volume ofseminal plasma followed by a number oftightly packed spermatophores. The seminal plasma fUis the ventral part ofspermathecae and displaces dorsally previously stored ejaculate(s) into the blind-end ofthe organs. After ejaculate transfer, the seminal plasma hardens and fonns the spenn gel which seals predecessors' sperm deposits in a dorsal position away from the ventral oviduct and vagina (Diesel 1990). During spawning, the spenn gel prevents Iiberation of rivais' spenn, and only the sperm of the last male is released to fertilize oocytes passing from the oviduct to the vagina. Similarly to L pha/angium, a11 spider crab species for which histological cross sections of the spennathecae are available, including Chionoecetes opi/io (Taylor et al. 1985) and Chionoecetes Baird; (paul 1984), appear ta have spermatophores and spenn gels stratified in a similar fashioD. As in l pha/angium, male gooopods appear to he inserted ooly shallowly into the female vaginae during ejaculate transfer in C. bairdi (Adams 1982) and C. opilio (Sainte-Marie et al. 1997). Therefore, it appears in spider crabs that the common spenn competition mechanism May involve sperm stratification. However, the first gODOpods of some majid crabs have been hypothesized 10 function as sperm extraction tools to ensure last-male sperm

13 precedence (Beninger et al. 1991; Elner and Beninger 1992; Elner and Beninger 1995) similariy ta

the male intromittent organs of the dragonfly Calopteryx maculata (Waage 1979). Futw'e work will

be necessary to elucidate whether last-male sperm precedence is a common pattern among aIl

Majidae, and to detennine the mechanisms involved in last male spenn precedence for species other

than 1. phalangium.

2.3 Microsatellites markers

2.3.1 Nature ofmicrosate/lites

Among eukaryotes, and ta a lesser extent in prokaryotes, the number ofgenes that code for

proteins varies by about 40- foid, while the total amount ofgenomic DNA varies more than 80,000­

foid. Furthennore, coding genes and intron DNA do not increase proportionaUy with genome size,

and non-coding sequences account for such a variation in genome sizes (Cavalier-Smith 1985). The

lack ofcorrelation between genome size and either coding DNA sequences or genome complexity

has become known as the C-value paradox (C-value being the amount ofDNA in picograms per cell per haploid genome). The portions of the genome responsible for this C-value paradox are the repetitive DNA sequences (Cavalier-Smith 1985; Tautz 1989). These are found either as tandemly repeated DNA sequences or as interspersed transposable elements (Charlesworth et al. 1994).

Transposable elements are DNA sequences which are able to move ("transpose") from one region ofthe genome to another. Upon insertion, they usually create a short target site duplication.

When they excise, this duplication can be conserved, or the original situation can he restored.

Therefore, in a way, transposable elements cao be an initial source ofrepetitive DNA themselves.

The copy number oftransposable elements in a genome can range from a single copy to severa!

14 hundred thousand (Charlesworth et al. 1994).

Tandemly repeated DNA sequences are ubiquitous in a11 eukaryotic genomes. This type of

repetitive DNA was tirst identified by DNA re-association kinetic analysis (eg. Sueoka and Cheng

1962; Smith 1963). When the DNA ofan eukaryotic organism is sheared into small pieces, heat

denature~ and re-association is monitored as the temperature is decreased, several classes ofDNA

fragments with different re-association rates can be distinguished. It was suggested that the class

with the high re-association rates consisted ofrepetitive DNA. Further analysis ofgenomic DNA

by centrifugation on cesium chloride density gradients have shown the presences ofa "satellite band

" of lower density from the main DNA band representing about 10% to 30% of the total DNA, depending on the organism analysed. Upon isolation, such satellite DNA was found to consist of

multiple tandem repeats ofshort nucleotide sequences that ditTered in average G+C content from the rest ofthe DNA (Sueoka and Cheng 1962; Smith 1963). When probes were prepared from such simple-sequence DNA and used in chromosomal in situ labelling experiments, the great bulk of satellite DNA was found to reside in the heterochromatic regions flanking the centomeres (Pardue and Gall 1970).

Three different classes oftandemly repeated DNA sequences have been defined. (1) Satellite

DNA, which is characterized by very long arrays (up to 100 Mbp) of5 to >100 bp repeats and is found in the heterochromatic portions ofthe chromosomes (near centromeres and telomeres). (2)

Minisatellite sequences, which are composed of15 to 100 nucleotide repeats with an average array size of 0.3 to 30 Kbp (Jeffieys et al. 1985a; Nakamura et al. 1987; Wong et al. 1987). (3)

Microsatellite sequences, which are mays ofabout a 100 bp in length with 1·6 bp repeat units. In contrast to satellite DNA, minisatellite and microsatellite sequences are highly polymorphic and

IS tend to he located in euchromatic regions ofthe genome (Charlesworth etal. 1994). The frequencies with which changes in array size accur at micro- and minisatellite loci are much higher than nonnaI mutation rate, sometimes being as high as a few percent per generation (Di Rienzo et al. 1994;

Jeffreys et al. 1994). Such loci are usually characterized by numerous alleles and high levels of heterozygosities. As a consequence, mini- and microsatellite loci are often referred to as VNTR-Ioci

(variable number oftandem repeats) (Nakamura 1987; Wright 1994) or hypervariable loci (Kirby

1990).

2.3.2 Evolution ofmicrosatellites

There is much speculation conceming the mechanism(s) responsible for the generation of arrays at microsatellite loci. While it was suggested that unequal crossing-over could be an important mechanism (Jannan and Wells 1989) it is probably limited to larger classes ofrepetitive

DNA, such as minisatellite loci and satellite DNA, or to long arrays ofmicrosatellite loci (Levinson and Gutman 1987). In vitro studies suggested that strand slippage during DNA replication was the major cause ofthe observed length polymorphism ofmicrosatellites within populations (Schlotterer and Tautz 1992). ln accordance with the latter model, defective DNA repair mechanisms increase the mutation rate at microsatellite loci since errors resulting from slippage replication remain unrepaired (Strand et al. 1993; Lindahl 1994).

The ftequency distributions of alleles at more than 100 microsatellite loci in human populations generally fit a stepwise mutation model. In such a model, arrays increase or decrease in repeat numbers by one or two repeats, with ooly occasional increases by larger steps (Edwards et al. 1992; Valdes et al. 1993; Di Rienzo et al. 1994). Although the mechanisms responsible for

16 the variability at microsatellite loci are becoming clearer, those involved in the initial formation of microsatellite loci remain obscure. Generally, loci with fewer than about 5 to 8 repeat units are aImost never polymorphie in humans (Valdes et al. 1993; Armour et al. 1994) and it appears that a minimum number ofrepeat units are necessary before the initial expansion ofa locus May take place. Analysis of the ll-globin pseudogene of primates indicates that the evolution of a microsatellite locus having enough repeats as ta become susceptible ofexpansion is a slow process spanning several million years (Messier et al. 1996).

As microsatellites are expanded, they become more and more susceptible to replication slippage and the mechanism can be self-accelerating (Levinson and Gutman 1987). However, ifthe mechanism was truly length independen4 arrays of repetitive DNA would expand indefmitely leading to continuously increasing genomes. The presence of very long stretches of repetitive satellite DNA near the centromeres and telomeres ofmany eukaryotic genomes has been attributed to the very low recombination rates and weak selective constraints on array lengths in those regions of the genomes (Charlesworth et al. 1994; Stephan and Cha 1994). On the other hand, the hypervariable mini- and microsatellites are found in the euchromatic regions ofthe chromosomes where crossing-over is frequent and where there may he selective constraints on array length.

Substantial differences in anay size are often ohserved between isolated populations and in closely related species, indicating that processes causing expansion and contraction ofarrays must accur at a significant rate on an evolutionary timescale (Charlesworth et al. 1994).

As other classes ofrepetitive DNA, microsatellites are likely to evolve under the forces of molecular drive that can shape their presence and length within genomes. Inherent to the concept ofmolecular drive is the idea of'selfisbness', and is seen as an outc:ome ofmecbanisms oftumover

17 in the genome that foster the fIXation of DNA sequences irrespective of their copy..number,

dispersion patterns or function. Such mechanisms include unequal crossing..over, gene conversion,

transposition and replication slippage. The joint effect ofsuch various mechanisms together with

random genetic drift results in DNA sequences evolving in concert over time, thus 'evading' control

by natura! selection (Dover 1982, 1986). However, the nature ofthe forces controlling array size of

microsatellites requires further research, and progress in this area will probably come from a better

understanding ofthe molecular basis ofexpansion and contraction ofarrays within genomes.

2.3.3 VNTR markers, paternity and identity testing

Patterns of sperm usage can only be detennined reliably by analyzing the patemity of

offspring. As tools to investigate identity, techniques ofDNA diagnosis have proven ideal as they

take advantage ofthe unique hereditary makeup of individuals. The most infonnative molecular

markers for DNA diagnosis have been found to he the highly polymorphie VNTR..loci as they have

numerous alleles and the likelihood that unrelated individuals share particular allele combinations

is very low. The tirst VNTR Marker was discovered by Jeffreys et al. (1985a) in a human myoglobin

intr'on and was used to develop a molecular technique that was termed 'DNA tingerprinting'. The procedure entails standard Southem hybridizations (Southem 1975) using probes hybridizing to

families ofVNTR-loci scattered throughout the genome. In briet: the technique involves digesting genomie DNA with specifie restriction enzymes, separating the fragments obtained by electrophoresis and hybridizing with a probe containing the core sequence ofa minisatellite family.

Complex banding profiles were obtained after hybridization with the VNTR-probes isolated by

Jeffieys et al. (198Sa) and the profiles appeared unique ta each individual. The presence offamilies

18 ofVNTR- loci, each locus having its own array ofalleles, scattered about the genome resulted in

multilocus profiles typically consisting ofsorne 20 or more bands per individual. The multilocus nature ofthe data and the complexity ofthe bands obtained from DNA fingerprint profiles provided a convenient tool for establishing genetic identity, as well as for assessing parentage (since each band in an individual's fmgerprint is derived from its biological mother or father). The technique was employed in the investigation of kinship relationships and was ftrSt applied to problems of human tbrensics (Dodd 1985; Gill et al. 1985; Jeffreys et al. 1985b, 1985c).

The probes developed by Jeffreys et al. (1985a) were later found to cross-hybridize to the

DNA ofa multitude ofspecies and revealed DNA banding profiles in mammals (Hill 1987; Jeffreys and Morton 1987; Jeffreys etal. 1987), birds (Burke and Broford 1987; Meng et al. 1990; Brock and

White 1991; Hanotte et ai. 1992), fishes (Baker et al. 1992), and even sorne invertebrates such as snails and coral (Jarne et ai. 1990; Coffioth et al. 1992). Additional probes detecting different families ofhypervariable minisatellites have later been identified and used for DNA fmgerprinting in vertebrates (Georges et al. 1987; Vassart et al. 1987; Longmire et al. 1990), invertebrates (Zeh et al. 1992), plants (Rogstad et al. 1988), and microbes (Ryskov et al. 1988). Efficient multilocus

DNA fmgerprints have also been obtained using oligonucleotide probes hybridizing ta the core repeats ofmicrosatellites (Ali et al. 1986).

Despite its usefulness, there are several limitations associated with multilocus DNA fmgerprinting. Considerable amounts of quality DNA are necessary ta test individuals. As a consequence, individuals can not be analyzed in their early embryonic stages as they contain small amounts ofDNA. In additio~ it generally remains unknown which bands in a tingerprint belong to which locus since a VNTR probe hybridizes to severa! loci simultaneously. Tbus, whether

19 individuals are homozygous or heterozygous at particular loci can seldom he definec1 nor can allele

or genotype frequencies he determined.

An alternative technique has become available in recent years with the development ofthe

PCR technology. Sets ofDNA primers ofabout 20 nucleotides can be designed on the basis ofthe

DNA sequences tlanking microsatellite loci and he used to amplify loci individually. One ofthe

main advantages over conventional multilocus DNA fingerprinting is that minute amounts ofDNA

(even partially degraded) are sufficient to genotype numerous individuals. As a consequence, DNA typing can he done on early stages of larvaI development. In addition, individual alleles can be

identified and heterozygote and homozygote genotypes can he detennined. As a consequence, allele and genotype frequencies can be computed. The drawback of using single microsatellite loci as genetic markers, is the necessity to characterize the DNA primers flanking individual loci to allow peR amplification, a process which is labor intensive. In addition, severa! individualloci have to typed in order to have the same discriminating power as obtained by multilocus DNA tingerprinting

(Kirby, 1990).

Both multi-Iocus DNA fingerprinting and single-locus peR microsatellite analysis have been used to study patterns ofspenn competition. The oligonucleotide (GATA). was used as a probe for

DNA fingerprinting in the bushcricket Poecilimon ve/uchianus and successfully revealed last-male precedence in five females (Achmann et al. 1992). However, the number ofoffspring analyzed was limited ta about 16 offspring per female, as larvae had ta be reared up ta the subadult malt ta aHow sufticient DNA ta be extraeted for probing. On the other band, in a study ofthe damselfly lschnura e/egans 2780 newly hatched larvae from 20 females were quicldy genotyped by PCR analysis of single microsatellite loci. The analysis successfully revealed last-male precedence in 8 females for

20 which the mating history was known. However, it was often necessary to analyze individuals al two loci to reliably detennine the patemity ofoffspring (Cooper et al. 1996).

21 CHAPTER3

Identification ofmicrosatellite markers in the snow crab Chionoecetes opilio.

N. Urbani·, J.-M. Sévignyt, B. Sainte-Mariet, D. Zadwomy· and U. Kuhnlein·

·Department ofAnimal Science, McGill University, Macdonald Campus, Sainte-Anne-de..

Bellevue, Québec, Canada H9X 3V9, tOivision des învertebrés et de la biologie expérimentale,

Institut Maurice-Lamontagne, Ministère des Pêches et des Océans, 850 route de la Mer, C.P.

1000, Mont-Joli, Québec, Canada GSH 3Z4

Accepted for publication as a primer note in Molecular Ecology.

22 We have developed primers for detecting allelic variation at severa! microsatellite loci using the polymerase chain reaction (peR) in the snow crab Chionoecetes opilio and we evaluated their utility in other crab species. A size-selected genomic library was constructed using a DNA mix extracted from the pereopods of 20 unrelated C. opilio females following a standard lysis and proteolysis with SOS (sodium dodecyl sulfate) and proteinase K (Sambrook et al., 1989). Pooled

DNA was digested with MboI, subjected to agarose electrophoresis and fragments ranging from 300 to 1000 bp were isolated using the GENECLEAN II kit (Bio/Cao Scientific). These fragments were cloned into the Bamill site ofpue 18 using 400 ng ofsize selected DNA and 200 ng ofplasmid

DNA in a total volume of20 .uL following a standard ligation reaction according to Sambrook et al. (1989). Five .uL of the ligation mixture were used to transform Escherichia coli DH5°c by electroporation according to Dower et al. (1988). Approximately 5 x lot recombinant clones were obtained and screened for microsatellites using (CA)IO' (CAC)!, and (GACA)4 probes.

Hybridizations were carried out according to Ali et al. (1986). A total of 186 positive clones were isolated, ofwhich S4 were analyzed by sequencing reactions on alkaline denatured plasmid DNA by the dideoxynucleotide chain termination method (Sanger et al., 1977) with T7 polymerase

(Pharmacia).

Primers were designed for six loci using OLIGOTEST V-2.0 (Beroud et al., 1990) and are summarized in Table 3.1. PCR reactions were canied out in a Perkin·Elmer/Cetus DNA thennal cycler (model NU N801-01S0) with one ofthe primers end-Iabelled with [y)2p]-dCTP and using 5­

100 ng ofgenomic DNA in 12.5 ,uL total volume (Bowcock et al., 1993), 1.6,uM ofeach primer,

0.25 U ofTaq DNA polymerase (Pharmacia), 200 ,uM ofeach dNTP, and lOx PCR butTer supplied with the Taq DNA polymerase. The PCR conditions were: denaturation for 1 min at 94 oC,

23 annealing for 1min at the temperatures specified in Table 3.1 , and extension for 1min at 72 0 C for

25-30 cycles. PCR products were resolved by electrophoresis on 6-8% denaturing polyacrylamide gels. The gels were dried and exposed at room temperature for 1-3 days. Loci Cop3-4, Cop5, and

Cap 10 consisted ofa mixture ofmono-, di-, tri- or tetranucleotide repeats. Among the six primer pairs, five produced patterns as expected from single loci inherited in a mendelian fashion.

However, primers designed for locus CopS yielded a multiple banding pattern with a variable number ofhands per individual ranging from nine to two in 55 individuals with an average of5.7

(data not shown).

The amplification ofthe six loci in 8 crab species revealed DNA polymorphisms at one or more loci for every species (Table 3.2). The variability at microsatellite loci observed in C. opi/io compared ta that observed in other species was generally higher or about equal. However, locus

Cop10 was not very polymorphic in C. opi/io, but highly variable in its close relative C. bairdi.

3.1 Aclmowledgements

We thank C. Leclerc-Potvin for helping with the electroporation procedures, E. Parent for his advice and help in the lab, Dr. J.E. Munk for providing samples ofH. lyratus, O. gracilis, P. graci/is and DrA.J. Paul for samples ofC. ba;rdi. The study was supPOrted by the National Sciences and Engineering Research Council ofCanada.

24 Table 3.1: Characterization ofsnow crab microsatellite loci. Loci were analysed using the DNA ofabout 20 unrelated individuals. ' 438 unrelated individuals were used to assess variability.J\ =observed heterozygosity.

locus N" of sequence ofthe primers PCR repeal motif in the clone size in the clone 1CCe11on "n alleles (S' to 3') annealing T' (bp) rn.mbeI'

Cap3'" 0.94 22 AACCOTOCTOOTGAGOCAAOG 7' (CMA~ T(A),(TAAh1TOGCITCT(CA),CTC 254 lA9021 ~TCTTTGCCCAATGTCOOAG A~A~TTOOGAAOCAAAATTATGAA GTOOAAA(GACA)...

C0p4-' 0.88 20 CACTCCAAACCCCAACTGTT 63 (OA):19 140 AF0066IJ GTCAOTOrrrCTATCTGTCTC

Cop5 - - GTTATATCTATOTCTATCTGC 62 (CTOT),CTGCCTGTCTATCTOCClTCCTA 142 lA9031 GA1UG~AAAATATTOATAG TCTGTC' 1•CTOT(C1h(CTGT),

'CopIO 0.16 4 ACTACCACCOTAGCCTGCCT 72 (CA)6TA(CA),CGCA(CA),(CGCA),(CA).. 14. lA902J GTATTAAGTGCCCAGCTCTGG (TGCA).

Cop24.3 0.90 13 GAGACATACAGACTGACA 55 (OACA)u 190 AF006612 CGGGTATCTGAATTTTCC

Copi' 1 0.53 9 CGGCCGOAGTAGGCOCTCA 66 (TAk 120 lA9024 GGTGGTTGCAGCCCAGATTGT

25 e e • Table 3.2= Number ofalleles in cross-species amplification. M and - indicate multilocus banding pattern and absence ofamplification, respectively.

Locus n Cop3-4 Cop4-1 Cop5 CoplO Cop24-3 Copi t 1 Cancridae

Cancer 2 3 magister Majidae

Chionoeceles 10 14 9 M 8 10 5 bairdi

Hyas 5 2 7 1 1 1 1 araneus

Hyas 5 10 6 1 1 1 1 coarctailis

Hyas 8 7 5 1 1 lyratus Oregonia 4 6 4 1 - - 1 graci!is

&9sil.isPuget/ia 4 - 3 1 - 1 _

26 • • • CoaDectîag statement 1

In chapter 3, we have described six C. opi/io polymorphie microsatellite loci~ and their usefulness in other brachyuran crabs. In order to elucidate patterns of patemity and sperm competition in primiparous females, loci Cop3-4 and Cop24-] were used in the following study ta genotype adults~ larvae and spennathecae. We examined wild eaught primiparous females carrying their broad as weIl as primiparous females multiply-mated under laboratory settings with tagged males.

27 CHAPTER4

Sperm competition and paternity assurance during the first breeding period offemale snow

crab Chionoecetes opi/io (Brachyura: Majidae).

Nicola Urbani*, Bernard Sainte-Mariet, Jean-Marie Sévignyt, David Zadwomy*,

and Urs Kuhnlein*

*Department ofAnimal Science, McGill University, Macdonald Campus, Sainte-Anne-de­

Bellewe, Québec, Canada H9X 3V9, toivision des învertebrés et de la biologie expérimentale,

Institut Maurice-Lamontagne, Ministère des Pêches et des Océans, 850 route de la Mer, C.P.

1000, Mont-Joli, Québec, Canada G5H 3Z4

Accepted for publication in Canadian Journal ofFisheries and Aquatic Sciences.

28 4.1 Abstnct.

Two highly polymorphie mierosatellite DNA loci were used to determine patemity oflarvae of primiparous Chionoecetes opilio females. In addition, female spermatheeal contents were genotyped at the two loci and histological analysis ofthe organs was carried out to elucidate patterns of spenn competition. Females carrying their frrst brood from controlled laboratory matings and fram matings in the wild were examined. Spennatheeal contents from wild-caught females were cut into several cross-sections and each section genotyped individually. Both wild and laboratory females commonly mated with several males whose ejaeulates were stored and stratified in the spennathecae. Genetic typing ofthe offspring oflaboratory-mated females revealed single patemity and indicated that the last mate ta inseminate a femaJe before oviposition gained paternity ofthe clutch. The predominant mechanism ensuring single paternity appeared to he spenn stratification.

In wild-eaught females, the microsatellite typing ofthe offspring aIso revealed single paternity, but larvae appeared ta he sired by males whose genotypes were found in the spennathecaJ cross-sections towards the dorsal end (blind end) ofthe spennathecae. This suggested that they were the tirst males to mate with females they guarded until oviposition, and females remated with other males thereafter.

4.2 Résumé

Deux loci d'ADN microsatellite hautement variables ont été utilisés pour déterminer la paternité des larves de femelles primipares de Chionoecetes opilio. De plus, la détermination des génotypes du contenu des spermathèques des femelles a été faite à partir de ces deux loci et l'analyse de coupes histologiques des organes a été réalisée dans le but d'élucider les modalités de

29 compétition du spenne. Des femelles avec leur premières portées d'oeufs obtenues à partir d'accouplemets contrôlés en laboratoire et d'accouplement en nature ont été examinées. Les spermathèques des femelles sauvages ont été coupées en plusieurs sections transversales et le génotype de chacune des sections a été détenniné. Les femelles sauvages ainsi que celles de laboratoire se sont accouplées avec plusieurs mâles dont le spenne était accumulé de façon stratifiée dans les spennathèques. La détennination du génotype de la progéniture des femelles accouplées en laboratoire a révélé qu'il y avait paternité unique et que le dernier mâle à inséminer une femelle avant la ponte des oeufs était le père. Le mécanisme prédominant assurant la paternité unique semble être la stratification des éjacuiats. Chez les femelles sauvages, la détennination du génotype des larves a également démontré qu'il y avait paternité unique. Cependant, les oeufs semblaient avoir été fécondés par les mâles dont les génotypes apparaissaient dans les sections des spennathèques les plus éloignées de l'ouverture des organes. Ceci suggère qu'ils étaient les premiers

à s'accoupler avec les femelles et qu'ils les auraient ensuite protégées jusqu'à ce qu'eUes pondent.

Les femelles se seraient donc ré-accouplées avec d'autres mâles après la ponte.

4.3 Introduction

Spenn competition is an important feature ofthe reproductive biology ofnumerous species, that may explain Many gamete and behavioral traits and is critical to the reproductive success of males (parker 1970). Arnong taxa in which fema1es are polygamous and have spenn storage organs, mechanisms ofsperm competition often result in single patemity and rall iota two broad categories, called sperm stratification and spenn removal (Birkhead and Hunter 1990). In the former, spenn from the last male displaces previous ejaculates towards the blind end ofthe spermatheca, away

30 from efferent ducts which lead from the ovary, 50 that this sperm May be the first to fertilize the eggs (e.g. Smith 1979). The latter eategory involves the elimination ofpreviously deposited spenn from the female reproductive trac~ either by extraction (c.g. Waage 1979) or by "flushing out" one ejaeulate by a subsequent one (e.g. Rubenstein 1989).

While paternity bas been studied in severa! terrestrial and freshwater arthropods with spenn storage organs, there is ooly limited information for marine forms wmch are principally crustaeeans.

It has been shown that impregnation by irradiated males (and therefore unfertile) of previously inseminated females resulted in the extrusion ofunfertilized eggs in the erabs lnachus phalangium

(Diesel 1990) and Scopimera globosa (Koga et ai. 1993), indicating that the last mate fertilizes aIl or a very large fraction ofthe eggs. However, ooly in 1 phalangium has the underlying mechanism ensuring single patemity been studied. Histologieal examination showed that putative ejaculates were segregated within the spermatheca and suggested that spenn stratification was the mechanism at play in /. phalangium, sueh that the ejaculate of the most recent mate occurred close to the oviduct opening and therefore had exclusive aecess to unfertilized eggs (Diesel 1989, 1991).

The snow crab, Chionoecetes opiJio (Brachyura, Majidae) May represent an ideal model speeies for the study ofspenn competition and patemity assurance in marine crustaeean decapods, by virtue of extensive information on anatomieal, physiologieal and behavioral aspects of its reproduction (Elner and Beninger 1992, 1995). The reproductive system ofthe female snow crab is bilaterally symmetrieal, comprising two avaries, each connected by an oviduct to separate expandable spermathecae. Eaeh spennatheca is composed ofa vast dorsal chamber and a small intennediate sac-shaPed structure which eonnects into a ventral vagina (Beninger et al. 1988). The spermatheca is of the ventral type (Diesel 1991), because the oviduct opens near its base, at

31 proximity ta the vagina. Mixing of female and male gametes is presumed ta occor in the intermediate sac-shaped structure (Beninger et al. 1993).

Female snow crab undergo a terminal molt to maturity and copulate for the fust time while they are still soft-shelled (Watson 1972). Females in their fust breeding period are called primiparous. In the laboratory, recently-molted females often copulate serially with a single male

Of, provided the opportunity, with several different males (Sainte-Marie el al. 1997). After any number ofcopulations, and sometimes before the series ofsuccessive copulations has ended, eggs are extruded and attached beneath the abdomen where they are incubated (Sainte-Marie et al. 1997).

Sperm stored in females of the genus Chionoecetes May not ail survive between successive ovipositions. However, in some cases spenn remaining from a previous mating period May be sufficiently abundant for partial or complete fertilization ofa second egg clutch (Adams and Paul

1983; Sainte-Marie and Carrière 1995). To renew or supplement sperm stores, adult female snow crab May re-mate prior ta extruding a new clutch ofeggs (Taylor et ai. 1985; Conan and Corneau

1986). Hence, in snow crab there exists the possibility ofcompetition between fresh sperm from different males at the frrst breeding period, and between recent and old spenn in subsequent breeding periods. The former situation may he more conducive to intense spenn competition, as all spenn is recently deposited and thus may he equally viable.

It bas been hypothesized for Chionoecetes species that the last male to inseminate a female before oviposition bas precedence in fertilizing the eggs (paul et al. 1983). Patemity for multiply­ mated female Chionoecetes bas been investigated only once, using isozymes as genetic markers. The

Iimited data suggested that only the most recent SPerDl acquired after the second oftwo successive breeding periods was used ta fertilize eggs, but no inference on the underlying mechanism was

32 possible (Sévigny and Sainte-Marie 1996). The proposed mechanisms ta ensure last-male sperm precedence in Chionoecetes species are (i) sperm stratification (Paul et al. 1983) or (ii) removal of rival sperm by the male's hook-shaped gonopods (Beninger et al. 1991).

In this study, two polymorphie microsatellite markers were used to determine the patemity ofthe embryos ofprimiparous females from controlled mating experiments and from the wilde In addition fcmale spermathecae were used for histological and genetic analysis to assess patterns of spenn storage. We demonstrate that progenies were fathered mainly or exclusively by a single male, even though ejaculates from several males were present in the spennathecae. The predominant or sole mechanism ensuring single patemity appears to he sperm stratification.

4.4 Materials and methods.

4.4./ Mating experiments.

Maturing females of40-60 mm carapace width (CW) and adult males of65-132 mm CW were captured by beam trawl in the northwest Gulf ofSaint Lawrence in eastem Canada (5ff06'N,

66035'W), during October 1995. The crabs were held in laboratory tanks supplied with fresh flowing

seawater subject to natura! changes in temperature (-1.1 0 to 3.2 ClC) and salinity (28 ta 31960).

Photoperiod was controUed to retlect natural tight regimes. Females and males were kept in separate tanks with independent water supplies. Crabs were fcd previously ftozen-shrlmp (Pandalus borealis) or hening (Clupea harengus) semi-weeldy. Tanks were checked for molting female crabs at least twice daily starting in January 1996.

Prior to experimentation, all captive males were individually tagged and had a mandibular palp excised for microsatellite genotyping (see below). This was done to ensure that experimental

33 males had different genotypes at the loci studied. Females used in mating experiments were virgin

and had either begun their maturity molt or completed their maturity molt less than 12 h before

d introducing a male. Mating experiments were conducted from Febrnary sm to 28 \ 1996, in tanks

with running fresh seawater at -0.5° to 0.3°C, following either one oftwo methods. In the fIrSt

method (n=8), a molting female was placed in a 500-1 tank containing 1,2, 3 or 4 tagged males and

monitored for 24 h using a ceiling-mounted low-light video camera (panasonic Lunar Lite) and rime­

lapse veR recorder (Panasonic AG-6720A) at one image per second. Video recordings were subsequently analyzed to detennine the copulating sequence, identity of mates and duration of copulations. However, the rime ofoviposition could not be determined from video recordings. In the second method (n=9), a recently molted femate was placed in a 50-1 tank containing a single tagged male until copulation occurred and postcopulatory guarding was initiated by the male. She was then separated from ber mate and transferred to another tagged male so that she might copulate anew. The rime ofoviposition was detennined by direct examination ofthe females at each transfer.

The values for duration of copulations for individuaI females obtained in this second set of experiments are less accurate, since video recordings were not taken and the observer was not always present at the start or end ofcopulatory bouts. Females from both types ofexperiments were individually tagged, then transferred and held in a communal holding tank for females UDtil they were killed on Aprillsc, 1996. Females and eg clutches were then processed for histological and genetic analyses as described below. The tinte delay between oviposition and processing was necessary to ensure tbat the developing embryos (approx. 256·1024 ceUs stage) yielded enough

DNA for reliable peR analysis.

34 4.4.2 Collection ofprimiparousftmales in the wi/d

A total of 20 primiparous females carrying recently extruded, brilliant orange eggs was collected between April 2,m and May 5 ~ 1996, with the same equipment and at the same geographic site as above. These females had a clean, iridescent and soft or brittle exoskeleton, indicating that they had molted to maturity in the past few weeks. They were immediately processed on board ship for the histological and genetic analyses.

4.4.3 Dissection oflaboratory and wi/d-caughtfemales.

Females were killed and one pereopod and the egg clutch were removed and preserved separately in 1000/0 ethanol for genetic analyses. An incision was then made along the posterior suture between carapace and stemites and the carapace was raised to reveal the internaI organs. The two spermathecae and attached vagina were dissected out without perturbing their contents.

Because sperm delivery to paired spennathecae is usually balanced (Sainte-Marie and Lovrich

1994), the two spermathecae ofan individual tèmale were considered replicates and were used to assess complementary aspects ofthe reproductive process. In this study, the left spermatheca was used for genetic anaJysis while the right spermatheca was reserved for histological analysis.

The left spermatheca was prefixed for about 5 minutes in 1OOO~ çthanol in arder to solidify the receptacle's waIl and contents, after which the wall was carefully peeled away from the cohesive content. The content ofthe vagina and adjoining small intennediate sac-shaped structure could not he isolated and was therefore not included in the genetic analysis. When the spermatheca was small, as occurred in the laboratory-mated females, its content was preserved whole in 100% ethanol.

However, when the spermatheca was large, as occurred in most wild-caugbt primiparous females,

35 sorne more or less distinct masses (putatively, different ejaculates) were apparent in the spennathecaI content. Using a scalpel, we attempted to isolate these masses by cross-sectioning the spermathecal content more or less perpendicularly to its sagittal plane. The scalpel was carefully cleaned between each eut. Resulting cross-sections were numbered sequentially from the dorsal to the most ventral (Le. closest to the oviduct) location and preserved individually in 100% ethanol.

The right spennathecae of laboratory-mated and wild-caught primiparous females were, respectively, fixed in Bouin for 48 h and then stored in 70% ethanol at 4°C for 4 months or flXed in Bouin added with 1.5% acetic and 1.5% trichloroacetic acids for 48 h and then stored in 70% ethanol at 4oC for 4 months. Spermathecae were embedded in paraffm and eut in medio-sagittal sections 7 ,'.lm thick. Sections were stained using the technique ofDominici (Langeron 1949) and analyzed by light microscopy by an independent investigator (G. Sainte-Marie, Département de pathologie et biologie cellulaire, Université de Montréal) with no knowledge ofthe mating history oflaboratory females or the results ofgenetic analyses.

4.4.4 DNA extractions.

DNA for microsatellite analysis was extracted from male mandibuJar palps, female pereopods, spermathecal contents and egg clutches. Because embryo development is very slow at the cold temPeratures preferred by snow crabs, embryos from wild-eaught primiparous females had undergone ooly 7 to 9 cell divisions when they were caught in the late April ta early May sampling period (8. Sainte-Marie unpublished data). Consequently, for large clutehes DNA was extracted from a pool ofapproximately 10 000 embryos from each female. For each ofthese clutches, care was taken to sample embryos from each ofthe carrier pereopods. However, when the clutch was

36 small (-< 10000 embryos) the whole clutch was used to extract DNA.

Tissues preserved in 100% ethanol were vacuum dried't the dry weight of spennathecal contents was detennined, and samples were crushed with a plastic pestIe and resuspended in water.

Total DNA was then isolated by SDS/proteinase K digestion followed by a phenol:chlorofonn:isoamyl extraction (Sambrook et ai. 1989).

4.4.5 Microsatellite analysis.

The two hypervariable loci used in this study, Cop3-4 and Cop24-3, are from a collection ofmicrosatellites identified from a C. opi/io genomic library (Urbani et al. 1998). They were chosen for having numerous alleles (22 and 13 in 20 unrelated individuals, respectively) and high levels of observed heterozygosity (94% and 90%, respectively) giving an average probability of4.5xl()'5 for two individuals to share a particular allelic combination by chance (Avise 1994). A test for deviation from Hardy..Weinberg equilibrium was carried out for both loci according ta Verheyen et al. (1994). x2-tests between observed and expected heterozygosities were not significant for locus Cop3-4

0.99) and Cop24-3 (i=4.3x 10·s, d.f.=I, P>0.99).

The two loci are composed ofrepeats ofthe tetranucleotide-GACA motif and lead ta low

DNA polymerase slippage during PCR amplification compared to dinucleotide and ninucleotide repeats. However, locus Cop3-4 aIso contains short mononucleotide repeats ofthe (C)n and (A)n type, sa that its aIlelic variability is the result of the combined variability of its mono and tetranucleotide repeats. The low amount ofslippage facilitated the scoring ofbands, especially when analyzing cross-sections ofspennathecal contents where more than two alleles were present. The sequence (S' to 3') of the primers used for PCR for locus Cop3-4 were

37 AACCGTGCTGGTGAGGCAAGG (forward) and GCTICTITGCCCAATGTCGGAG (reverse) and for locus Cop24-3 were GAGACATACAGACTGACA (forward) and CGGGTATCTGAATITrCC

(reverse).

PCR was carried out in volumes of 12.5,uL according to Bowcock et al. (1993). Reactions for locus Cop34 were perfonned with 0.25 ,uM of each primer, using 0.25 units of Taq DNA

ofcL~TP, polymerase (Pharmacia), 200,uM each dCTP, dGTP and dTTP and 1.5 mM MgCI2 • The forward primer was end-Iabelled with (y-32p]dCTP. Samples were overlaid with mineraI oil, denatured for 2 min at 94°C and amplified for 25-30 cycles of 1 min at 94°C, 1 min at an annealing temperature of71°C, and l min at 72°C. Reactions for locus Cop24-3 were identical except that the primer concentrations were 0.5 ,uM'I the MgC~ concentration 2.0 mM and the annealing temperature

54°C. PCR products were resolved by electrophoresis on 6% denaturing polyacrylamide gels. The gels were dried and autoradiography was canied out at room temperature for 1-3 days.

4.5 Results.

4.5.1 Sperm segregation andpaternity in contro/led mating studies.

In the laboratory, females copulated between 1 and 4 tintes (mean=2) with up to 3 different males. Total copuJatory time for individual females varied from about 5 to 72 min and correlated positively with spermathecal dry weight (r=O.52, P=O.039). In ten females, histological examination ofthe right spermatheca-vagina complex revealed the presence of2 rather discrete structural units, arranged sequentially along the longitudinal axis ofthe organs (e.g., Fig. 4.1a). The seven remaining females had a single unit in their spermatheca. Each unit was usually composed ofa concentration ofspermatophores dorsally capped bya relatively large amorphous matter. ln 13 of17 cases (76.5%)

38 the nwnber ofstructural units in the spennatheca coincided with the number ofcopulations realized by the female, and there was no significant difference between number of structural units and number ofcopulations (Wilcoxon signed-ranks test, P=O.68).

The results of the genetic analysis of the spennathecae of the eleven laboratory mated­ females is shown in Table 4.1. Two females (976 and 980) which each mated with a single male, had a single male genotype in their spennatheca identicaI ta the genotype oftheir mate. Females

961. 962, 965, 970, 973, 975 and 977 mated with multiple males and the genotypes ofall the males involved in the matings were present in the spermatheca. Exceptions were female 966 and 979 where only the genotype ofthe flI'St oftheir two mates was present in the spermatheca. In the case offemale 966, the video recording showed that the copulation by the second mate (male P6) was tenninated prematurely bya sudden aggression initiated by male P3. Histology ofthe contents of her right spennatheca-vagina complex revealed that the spermatophore aggregate ofone ofthe two distinct structural units was small and lodged in the intennediate sac-shaped structure near the vagina, possibly due to the last matels precipitous withdrawal. This aggregate was not included in our genetic analysis since ooly the spermathecal content was sampled. In the case of female 979, a long copulation with male P8 was followed by one rather short copulation with male P6. Only one structural unit was evident in the spennatheca suggesting that little spe~ ifany, was passed by the second male. An example ofgenetic analysis at locus Cop24-3 ofspennathecal content is shown for female 977 in Fig. 4.28, where the alleles ofher two mates were represented in ber spennatheca.

Analysis of multiply-mated females indicated tbat one male fathered MOst or all of the embryos (Fig. 4.2a, Table 4.1). Two patterns ofpatemity with respect to male copulating sequence were apparent. In females 961, 966 and 979 it was the first oftwo successive mates that sired the

39 progeny. In these cases there was a long time lapse between matings (8-20.5 h) and extended female guarding by the tirst mate before copulation with the second male occurred. In females 962, 965,

970, 973, 975 and 977 it was the last ofsuccessive mates that fathered the progeny, coincident with a shorter time lapse of :s 4 h between copulations and interrupted female guarding (either by experimental manipulation or aggression by a rival male) before the following copulation.

Oviposition occurred after the tirst copulation in female 979, and after the last copulation in females

965, 970, 973, 975 and 977, but was not observed for females 961, 966 and 962. For females for which oviposition was observed, the last male to inseminate a female before oviposition gained paternity ofthe offsprings.

4.5.2 Sperm segregation andpaternity in wi/d.caughtfemaJes.

Histological examination of the right spermathecae of seven wild primiparous females revealed the presence of 2 to 6 (mean=4.2) more or less discrete structural units arranged sequentially along the longitudinal axis ofthe organs (e.g. Fig. 4.lb). The oudine ofthe units was often irregular. As was the case for laboratory mated females, each unit was composed of an aggregate ofspennatophores, usually capped bya larger volume ofamorphous matter. Each ofthese units presumably represented individual ejaculates.

The genetic analysis of the spennathecal cross-sections of seven primiparous females revealed the presence of more than two alleles at each locus for every spennatheca. The total number ofmale alleles was determined as the number ofnon-matemaJ alleles present in the cross­ sections (Tables 4.2 and 4.3). Since each male contributes one (homozygosity) or two alleles

(heterozygosity), the least number of males which must have contributed to sperm content of a

40 particular spermatheca is given by halfthe number ofmale alleles (rounded to the next integer in the case of an uneven number of alleles). The least number of males contributing ta the spenn present in a spermatheca was detennined tram the locus that revealed the highest number ofalleles.

The actual number of males contributing ta the sperm present in a spermatheca might have been higher, since males could have shared certain alIeies due to random allele sharing. The least number ofmale genotypes found in the seven spennathecae ranged tram 3 to 5 (mean= 3.7). The number of structural units detennined from histology relative ta the least number of mates estimated by genetic analysis was greater in the spennathecae of females Al, AS, A9 and A13; and lesser in female A7 and Al7 (Table 4.4). Overall, the number ofstructural units was in agreement with the estimated least number ofmale genotypes.

Individual cross-sections of spermathecae often reveaied more than one male genotype, indicating that we were unsuccessful in fully separating individual UDits (Tables 4.2 and 4.3).

Nonetheless, different combinations of alleIes occurred in successive cross-sections of the spennathecae ofindividual females, demonstrating that spenn deposits trom different males were ta sorne extent stratified within the spennathecae.

Paternity ofpooled embryos was analysed using both microsatellite loci. In each ofthe seven clutches ooly three or four alleles were observed. Maternai alleles (usua1ly two) were always observed in the progeny while the remaining one or two alleles represented paternal genotypes

(Tables 4.2 and 4.3). The results suggested that each brood had been sired by a single male. In each case, the patemal alleles seen in the offsprings were aIso present in one or several sections ofthe spermatheca The only exception was observed for female AS at locus Cop24-3, where the 190 bp patemal allele seen in the progeny was absent from the spermathecal cross-sections. The analysis

41 at locus Cop3-4 revealed that the paternal genotype (homozygote for the 254 bp aIlele) was present in spennathecal cross-sections 1 and 2 but weakly amplified. This indicated that little spenn ofthe father was left in the spermatheca and suggested that the PCR failed to amplify the patemal genoytpe at locus Cop24-3. Instead, it must have amplified more abundant genotypes that shared at random the 174 bp allele with the patemal genotype. Altematively, the presence ofaIlele 190 bp at locus Cop24-3 in the progeny of femate A5 could be the result of a maternaI mutation due to strand-slippage during DNA replication, leading to the addition ofone GACA-repeat to the 186 bp maternaI allele. In such a case, the father ofthe progeny would have been homozygote for the 174 bp allele.

The distribution ofthe patemal aileles within the spermathecae showed that the genotypes of the fathers of the embryos were often present in more than one cross-section. However, the patemal aJleles were represented mostly in the cross-sections towards the dorsal end (blind end) of the spennathecae (Le. pt and zad). This pattern cao he seen in Fig. 4.Zb with female A17, where alleles 218bp, 202bp, and 174bp observed in the embryos are shared with those of the mother

(ZOZbp and 174bp) and those in cross-section 1ofthe spennatheca (218bp and 202bp). Ooly three alleles were present in the progeny since allele 202bp was shared between the parental genotyPes.

4.6 Discussion

Histology revealed that spermathecal contents ofprimiparous females were composed of more or less diserete units ordered sequentially along the longitudinal axis ofthe spermatheca. The agreement between the number ofsuch units and the number ofcopulations recorded for individual

42 laboratory-mated females strongly suggests that they represented individual ejaculates. Furthennore, each individual unit was organized into a cluster of spennatophores usually capped dorsaUy by amorphous matter. This observation is consistent with reports stating that during ejaculation, male brachyurans frrst pass a relatively large volume of seminal plasma (i.e., the amorphous matter) followed by a relatively small volume of spermatophores (Ryan 1967; Diesel 1991). The units observed in the spennathecae ofsnow crab are similar to those seen in the majiid J. phalangium, which were also interpreted to be individual ejaculates (Diesel 1989, 1990).

Our results conflIll1 the polyandrous nature of female snow crab during the flI'St breeding periode As was the case in the study by Sainte-Marie et al. (1997), laboratory-mated females copulated several times with the same or different males (Table 4.1). Wild-caught primiparous females had also copulated with at least 3-5 different mates (Table 4.4) which demonstrates that polyandry is not a laboratory artifact. There were sorne discrepaneies between the number of ejaculates determined by histology and the number ofmale genotypes determined by mierosatellite analysis (Tables 4.1 and 4.4). At least two natura! causes could account for these differences.

Delivery ofspenn ta left and right spennathecae can exceptionally he unbalanced (Sainte-Marie and

Lovrieh 1994; Sainte-Marie et al. 1997), which could give rise to different estimates ofthe number ofspenn deposits based on histologieal and genetic analyses using alternative sPermatheeae. In the specifie case offour wild-caught primiparous females, there were more ejaculates than genotypes, which might reflect rePeated copulations with a same mate as often occurs in the laboratory

(Sainte-Marie et al. 1997). However, the differenees between genetic and histological data could also retlect some methodologicallimitations. First, sorne diffieulties were encountered in resolving small ejaculates by histology. Second, the sperm used for genetic analysis was that obtained solely

43 from the spermathecae. Any sperm present elsewhere in the female reproductive organs would not

have been included in the genetic analysis. Third, our calculation of the least number of male

genotypes per spermatheca could underestimate the real number ofgenotypes, depending on the

degree ofrandorn allele sharing between males.

From the genetic analysis ofthe embryos ofbath laboratory and wild..caught primiparous

females, it cao he inferred that a single mate (ofat least 2) fathered most or all ofthe progeny of each primiparous female. Because we analysed pooled embryos from each clutch~ we cannat exclude the possibility that a minor fraction ofthe eggs ofeach female was fertilized by the spenn ofcompeting mates. However, this seems unlikely for two reasons. First, PCR detected maternaI aIleles in sorne spermathecal cross-sections, possibly due to the occurrence of desquamated epithelial cells originating from the spennatheca wall (Beninger et al. 1993). Since we carefully peeled away the spermathecal wall, the maternai signal was probably caused by smaIl quantities of tissues which suggests that our PCR detection procedure was very sensitive. Second, the analysis of20 individual eggs containing weil developed embryos (Le., about a year older than the eggs used in this study) from each of 5 multiply-inseminated wild primiparous femaies aise reveaied single patemity (Urbani, unpublished data). Thus, the patemity contribution ofanother male would he less than 5%.

The controlled laboratory experiments indicated that the last male to inseminate a femaie before oviposition gains patemity of the cluteh. Considering (i) that the mass of spermathecal contents was positively correlated to total female copulatory time (also see Sainte..Marie et al.

1997), (ü) that ejaculates were sequentially ordered within the spermatheca, such that only one ejaculate was located close to the oviduct opening, and (ili) that the spermathecae contained sperm

44 from every unsuccessful male predecessor, the most parsimonious mechanism to explain last-male

spenn precedence in primiparous females is spenn stratification, Le. displacement ofrival sperm

towards the blind end ofthe spennatheca where there is no access to unfertilized eggs. Seminal

plasma is indeed thought to act as an internaI sperm plug (Christy 1987a; Diesel 1990) and in the short term at least it may be effective in sealing offsperm from rival males. Although we cannot completely exclude the possibility that males can extract sorne previously deposited sperm using their gonopods, as proposed by Beninger et al. (1991), that possibility seems quite remote considering evidence above. Moreover, male gonopods appear to he only shallo"'·ly inserted into the female vagina and there is no perceptible rocking motion ofthe maIe's abdomen (Sainte-Marie et al. 1997), as occurs for example in male odonates that extract rival sperm (Miller 1995). Since sperm from competing males obviously persisted in the spennatheca of female snow crab in relatively large amounts, the failsafe mechanism leading to last-male precedence must he rival spenn stratification and positional advantage oflast spenn.

The observation for wild-caught females that patemal sperm occurred in the most dorsal cross-section(s) ofspennathecal contents suggests that females re-mated after extruding their eggs.

Such a behavior often occurs in the laboratory (Sainte-Marie et al. 1997) and bas been observed directly in the field (B. Sainte-Marie unpublished data). In nature, males are attracted to females by as much as 8-13 days prior to their maturity molt by semiocbemicals released in the water

(Bouchard et al. 1996). Over this period oftime, male competition for females can he very intense and dominant males may gradually displace subordinate males (Sainte-Marie and Hazel 1992). In

Chionoecetes, male dominance is a complex function of maturity, body size, chela size, shell condition, and time elapsed since last molt (Stevens et al. 1993; Paul et al. 1995; Elner and Beninger

45 1995; Sainte-Marie et al. 1997). A dominant male May assist a female in molring, promptly inseminate ber, and then guard ber until she extrudes her eggs. Females are then released, and since they May remain attractive and receptive to males for several days after the maturity molt (Watson

1972), they May mate again. We hypothesize that these ulterior matings occur with subordinate males. While these males would have no immediate reward, their spenn might be mobilized to fertilize a second egg clutch in the event that females do not re-mate.

In conclusion, two mechanisms can lead to single patemity in primiparous female snow crab.

The fU'St is behavioral, through insemination and complete control ofa virgin female by a dominant male until oviposition is completed. The second, which can operate to ensure single paternity in previously inseminated females, is mechanical and consists in stratification (displacement) ofrival sperm, resulting in a positional advantage ofthe most recentIy deposited spenn.

4.7 Acknowledgments

This research was supported by a grant from the National Sciences and Engineering

Research Council of Canada to U. Kuhnlein. The authors wish to thank G. Sainte-Marie for the preparation and interpretation of histological slides, P. Kuhnlein for helping with the DNA extractions, É. Parent for useful technical advice, and Ors. S. Aggrey, P.G. Beninger and F. Hayes and an anonymous referee for helpful comments on the manuscript.

46 Table 4.1. Analysis ofpatemity in eleven broods from primiparous females subjected to conttolled matings. v indicates matings that were video-tape~ while in the other matings females were observed directly and transferred between matings (see Materials and Methods). n.d. stands for not determined. + and - stand for presence and absence ofgenotype, respectively.

Female Mate Presence of Durationof Time (h) Structural identity identity male genotype copulations between units in and (min) copulations receptaele arder Spennatheca Embryos v976 P5 + + 14 1 v980 P2 + + Il 1 v961 Pl + + 22 20.5 2 P3 + 17 v966 P3 + + 9 9.0 2 P6 14 979 P8 + + 60 8.0 P6 ==12 v962 P6 + 13 4.0 2 P8 + 22 4.0 P8 + 23 3.75 P5 + + 5 965 P6 + 18 0.25 2 P4 + + ::9 970 P3 + 12 1.0 2 P4 + + 13 973 PS + =20 2.5 P8 + + =21 975 PlO + 19 0.75 P7 + + 6 977 P9 + n.d. 3.0 2 Pi + + 29

47 Table 4.2. Alleles observed at locus Cop24-3 in spennathecal cross-sections and embryos ofseven wild-caught primiparous females. The length of the alleles is indicated in base pairs. No amplification is abbreviated by n.a. Alleles shared by females, their embryos and spennathecal cross-sections are indicated in italics. In the case ofheterozygote femates, alleles in spermathecal cross-sections were considered to belong to the maternal genotypes only when both maternaI alleles were observed. Non-maternaJ aIleles shared by embryos and cross-sections are indicated in bold and

indicate patemity. Alleles in parenthesis indicate weak peR amplifications. Left spennathecae of females A7, A9, and Al3 were eut into three cross-sections, white those ofthe other females were cut into four cross-sections. Cross-sections 1 were located at the dorsal end (blind end) of the receptacle, while cross-sections 4 (cross-sections 3 for females A7, A9, and A13) were located at the base ofthe organs, close to the vaginal opening. •Allele not observed in the spennathecal cross- sections.

Alleles in spermatbecal cross-sections

Female Female Embryos 1 2 3 4 alleles alleles AI 190 190 182 182 (218) 166 166 174 174 (210) 182 170 170 n.a. (202) 166 166 (174) 170

AS 214 214 198 178 186 218 186 186 178 (174) 174 174 ·190 174 174

48 A7 190 190 (222) 194 218 174 174 186 178 194 222 164 (190) 186 178 174

A9 210 210 186 (186) 198 198 198 174 (174) 186 186 162 162 164 174 162

AI3 186 186 214 186 194 174 174 202 182 182 214 186 174 202 174 170 170

A14 210 210 (210) (210) (210) (210) 166 166 (202) 202 202 206 202 (166) (166) (166) (202) 198 199 186 (166)

AI7 _12 202 218 198 170 (210) 174 174 292 (l70) (206) 218 (198) 166 (198) (166) (186) (174) 'Z9

49 Table 4.3. Alleles observed at locus Cop3-4 in spermathecal cross-sections and in the embryos of seven wild-caught primiparous feroales. The length of the alleles is indicated in base pairs. No amplification is abbreviated by o.a. Alleles shared by femaIes, their embryos and spennathecal cross-sections are indicated in italics. In the case ofheterozygote femaIes, aIleles in spennathecal cross-sections were considered to belong to the maternaI genotypes only when both maternaI alleles were observed. Non-maternaI aIleles shared by embryos and cross-sections are indicated in bold and indicate patemity. Alleles in parenthesis indicate weak PCR amplifications. Left spennathecae of females A7, A9, and A13 were eut into three cross-sections, while those ofthe other females were eut mto four cross-sections. Cross-sections 1 were located at the dorsal end (blind end) of the receptacle, while cross-sections 4 (cross-sections 3 for femaJes A7, A9, and A13) were located at the base ofthe organs, close to the vaginal opening.

Alleles in spermathecal cross-sections Female Female .Embryos l 2 3 4 aileles alleles AI 276 276 (282) (266) 266 270 270 270 (274) 254 250 258 154 (266) 250 246 250 154 238 250

AS 279 279 (276) 276 (279) (279) 260 260 266 (260) 266 266 254 258 (254) (263) (263) (254) 251 (260) (260) (251) 253 253

50 A7 262 262 (262) 287 (278) 256 256 259 250 (262) 259 (256) 259 251 251 (256) 250

A9 268 n.a. 267 n.a. 266 263 260 252 252 236 236

Al3 289 289 292 (292) 279 273 273 (289) (289) 266 292 (282) 282 279 279 279 (273) (273) (266) 266 254 254 251 251

Al4 272 272 (279) 279 279 (279) 264 264 (272) (272) 260 266 279 (264) (264) (260) 260 (260) 260 250

Al7 244 244 (283) 283 263 283 264 (270) 270 252 269 261 264 263 263 'tU 252 252

51 Table 4.4. Genetic and histological data on the spermathecae ofseven wild-caught primiparous females. The least number ofmale genotypes per organ was determined from the highest number ofnon-maternai aIleles seen either at locus Cop3-4 or at locus Cop-24-3. A structural unit consists ofa patch ofspennatophores capped dorsally by amorphous matter and corresponds to one ejaculate observed in the histological slides. n.d. stands for not detennined. * indicates incomplete data.

Spermatheca

Female Number ofaIleles Number ofalleles Least number of Numberof at locus Cop24-3 at locus Cop3-4 male genotypes structural uoits Al *7 9 5 6 AS S 8 4 5 A7 6 5 3 2 A9 5 *5 3 4 Al3 5 6 3 4 Al4 5 4 3 n.d. Al7 9 7 5 4

52 Figure 4.1. Light micrographs and schematics ofmedio-sagittal sections ofthe spennathecae ofa) female 977 from controlled matings; and b) female Al7 from the wild. The spermathecae contain several ejaculates (EJ) each with Many spermatophores capped by an amorphous matter.

Spermatophores in the light migrographs are small circular structures either black or grey. RW stands for receptacle wall. BS indicates the base ofthe spennatheca. Cl, C2, and C3 indicate the approximate cutting sites yielding spennathecal cross-sections 1,2,3, and 4.

53 •

• •

... ;~.~ , •

• Figure 4.2. Alleles observed at the locus Cop24-3 in a) female 977 sequent1ally mated with males

P9 and P2, its left spermathecal content (Sp.), and its embryos; and b) female A17, four cross­ sections ofits left spermatheca, and its embryos. Spennathecal cross-section 1 is at the dorsal end

(blind-end) ofthe receptacle while cross-section 4 is close to the vagina. Allele sizes are indicated.

S4 •

a)

~ - 218 .. ..- - 214 • el - 210 • r a t&a - 206 • - 202 - 198 • - 194

• • b) spermatheca ~ ----~ ~43215

• - 218 - 214 ...... - 210 - 206 -~- - 202

• aIII' 1 - - 198 - 194 • • - 190 - 186

- 182

- 178

- 174

• - 170

- 166 • Connecting statement n

In chapter 4, we have shown from laboratory experiments that spenn stratification was the main spenn competition mechanism responsible for single patemity in primiparous femaJes. The analysis ofwild-caught primiparous females have shown that multiple matings were common in the wild and that male guarding behavioral was also an important mechanism leading ta single patemity. The next study further investigates the mating dynamics of C. opi/io in the wild by analysing mating pairs collected by divers in a wild population from eastem Canada. In arder ta complement field observations loci Cop3-4 and Cop24-3 were used to genotype five mating pairs involving males and primiparous females having extruded their eggs.

ss CHAPTER5

Multiple cboice criteria and the dyoamies ofassortative matiDg during the tint breeding

period offemale snow crab Chionoecetes opi/io (Bracbyura, Majidae).

2 1 Bernard Sainte-Marie!, Nicola Urbani , François Hazel , Jean-Marie Sévignyl,

and Urs Kuhnlein1

1 Division des invertébrés et de la biologie expérimentale, Institut Maurice-Lamontagne,

Ministère des Pêches et des Océans, 850 route de la Mer, C.P. 1000, Mont-Joli, Québec, Canada

G5H 3Z4. 2 Department ofAnimal Science, McGill University, Macdonald Campus,

Sainte-Anne-de-Bellevue, Québec, Canada H9X 3V9

56 5.1 Abstract

A population of snow crab Chionoecetes opi/io from the northwestem Gulf of Saint

Lawrence, eastem Canada, was examined to assess the criteria for assortative mating during the female's flI'St breeding period. Mating pairs were collected in 1991 ..92 and in 1995-96 by divers.

Three types ofmating associations having increasing reproductive values for male graspers were

identified and involved (i) males grasping either an immature female, an adolescent male~ an adult male, or a Hyas araneus female, (ii) males grasping a primiparous female with her eggs, and (Hi) males grasping a pubescent female close to her terminal molt. We show the existence of male mating hierarchies and assortative pairing processes which are based on the size and quality of mates. In addition, genetic analysis at microsatellite loci Cop3-4 and Cop24-3 offive mating pairs involving males and primiparous females with their progenies complemented this account ofmating dynamics. Genetic analysis showed that females carrying eggs had mated on average with 3.4 males, but none ofthe graspers had fathered their mates' eggs. It appeared that these unsuccessful males had on average smaller shells or shells in poorer conditions than more dominant males maring with recentIy molted pubescent females.

5.2 Introduction

Assortative mating based on size or other criteria of appearance May occur in many arthropod taxa, including the Brachyura that have prolonged pair-bounds and carrying behavior

(Huber 1987; Wilber 1989; Jivoff 1997). In brachyuran species with "female centered competition"

(Christy 1987a) large males are usually more successful than small males in accessing receptive females, in removing tbem from rival males, and in preventing takeover by competing males

57 (Edwards 1966; Berril and Arsenault 1982; Van der Meeren 1994). However, competitive ability oflarge males may be diminished by senescence (Paul et al. 1995) or handicaps such as missing chelae (Juanes and Smith 1995). In Many species, there is a positive correlation between the size offemales and males in mating pairs, known as size assortative mating. This mating pattern may arise when there is mate choice, size advantage in sexual competition, and benefits to pairing with a larger mate (Ridley 1983).

The snow crab, Chionoecetes opilio, is an interesting species for the study ofpatterns and causes of assortative mating in the Brachyura because: (i) there is a large sexual size/age dimorphism, (H) both sexes are polygamous and the mating behaviors are flexible and complex, and

(iii) populations exhibit cyclic interannual changes in size structure and sex ratio for breeding individuals. Both sexes ofthe snow crab undergo a tenninal malt. In the female the tenninal malt is a pubertal malt that marks the onset ofadulthood and reproductive life (Watson 1972; Alunno­

Bruscia and Sainte-Marie 1998). Adult females copulate for the first time in the soft-shell condition after the tenninal malt (i.e. pubescent-primiparous mating), but may re-mate one or more years later in life when they are in the hard-shell condition (i.e. multiparous mating). By contrast, the emergence ofreproductive capability for male snow crab is not completely dependent on tenninal malt. Males undergo a puberty malt to an adolescent stage, after which they begin to produce spenn but still continue to grow. However, it is not until the terminal molt ta adulthood that the chelae of males become fully enlarged and differentiated (Carneau and Conan 1992; Sainte-Marie et al.

1995), procuring the males with added reacb, leverage and strength for exercising reproductive activity (Claxton et al. 1994). Minimum size at adulthood is slighdy less in females than in males and in any given yeu the size range ofaduIt females is considerably less than that ofadult males

58 (B. Sainte-Marie, unpubl. data). After terminal molt and an initial period of shell hardening and tissue growth, both sexes exhibit a progressive deterioration in shell condition and become senescent and die over a period ofabout 5-6 years (Sainte-Marie and Dufour 1995; Alunno-Broscia and Sainte­

Marie 1998).

Pubescent-primiparous mating in sorne respects offers more interesting perspectives than multiparous mating for the study ofreproductive biology in snow crab, because female behavior and reproductive success in a given year can he related to specifie population characteristics without confounding effects ofpast mating history. Pubescent-primîparous female snow crab May initiate male precopulatory guarding several days prior to their puberty malt by releasing chemical cues ioto the water (Watson 1972; Bouchard et ai. 1996). Attended females usually copulate for the fust time within minutes or hours ofthe puberty malt, while oviposition typically occurs within a day ofthe puberty malt and May be preceded or followed shortly by additional copulations with the same or different males (Sainte-Marie et ai. 1997; Urbani et ai. in press). The females store excess sperm in their spermathecae, where it May remain viable for several years and he used in fertilizing subsequent egg clutches (Elner and Beninger 1992, 1995). For their p~ adult males are also highly polygamous (Watson 1972) and competition for pubescent females May he very intense, even though there is ta date no evidence ofassortative mating patterns (Sainte-Marie and Hazel 1992;

Sainte-Marie et al. 1997). Female guarding is an important aspect of male reproductive success

(Sainte-Marie et al. 1997) and dominant males May displace subordinate males to take over the pubescent females (Sainte-Marie and Hazel 1992). Females May mate again after oviposition

(Taylor et al. 1985; Conan and Comeau 1986) and it was proposed by Urbani et al. (in press) that post-oviposition copulations may occur with subordinate males that are competitively excluded &cm

59 mating with the virgin, pubescent females.

The present study examines the mating associations of snow crab in a population ofthe northwest GulfofSaint Lawrence, eastem Cana~ to assert the causes for assortative mating during the female's fust breeding period. Mating couples were sampled in 1991-92 and in 1995-96, and microsatellite DNA analysis ofselected primiparous mating pairs was conducted to complete this account of the mating dynamics. We demonstrate the existence of male mating hierarchies and assortative pairing processes which are based on the size and quality ofmates.

5.3 Material and Methods

5.3.1 Study site and sampling

The study site was Baie Sainte-Marguerite, in the northwest GulfofSaint Lawrence, Canada

(ca. 50006~, 66°35'W). Throughout eastem Canada, the pubertal-terminal molt and associated mating offeroale snow crab occurs during the winter (Watson 1972; Moriyasu and Conan 1988) and bas limited in situ observation due to the difficulty to carry out diving operations under harsb environmental conditions (Sainte-Marie and Hazel 1992). In the present study, divers (including B.

Sainte-Marie and F. Hazel) observed and collected snow crab mating pairs from 19-27 March of

1991 and 1992, from 21·26 March 1995, and from 19-25 Mareh 1997. Prospected bottoms were mostly ofsand and occasionally ofrock, at average depths of20-25 m (maximum 43 m), and were bathed by waters ranging in temperature from -1 to -1.SoC. During regular dives, ail paired crabs were collected irregardless ofidentity ofmates. Pairs were placed individually in mesh bags on which we recorded lime and depth ofcollection, and for each dive, we calculated a gross index of

60 pair density as the number ofpairs collected per diver-hour.

5.3.2 Characterization ofsnow crab

Diver-collected crabs were characterized according to a variety ofestablished criteria. Crabs were sexed according ta the shape ofthe abdomen. Shell condition was rated for aU individuals according to a previously described arbitrary scale that reflects time elapsed since last molt: clean-soft (1), clean-hard (2), intermediate (3), dirty-hard (4) and dirty-soft (5) (Sainte-Marie 1993;

Sainte-Marie et al. 1995). The number and position ofmissing limbs was recorded for both females and males. To eliminate bias of damage to crabs from divers, we recorded as missing only those limbs where the position ofthe missing limb was marked by a dark or at least partiaUy hardened scar. We measured to the nearest 0.1 mm the carapace width (CW) of aU crabs, the width ofthe abdomen across the fifth stemite (AW) for females (except in 1995), and the height ofthe right chela (CH) for males.

Females were separated ioto various categories ofmaturity based on abdomen allometry and presence ofeggs. The term immature female herein designates indiscriminately aU females with a relatively narrow abdomen and that were not committed to the pubertal-tenninal molt. Pubescent females have a relatively narrow abdomen but are committed and temporally close to the pubertal-terminal molt. Separation ofimmature and pubescent females can he done visually because the weil developed, bright onnge avaries usually show through the tirst abdominal tergites, but we also resorted ta dissection ta confinn uncertain cases as per Sainte-Marie and Hazel (1992). Adult females ail had performed their pubertal-tenninal malt and were characterized by relatively broad abdomens having setose pleopods. The tenninology used for the types ofadult females comes from

61 Alunno-Bruscia and Sainte-Marie (1998). Primiparous females have a clean shell and have extruded their frrst clutch ofeggs while multiparous females range in shell condition from intermediate to dirty-soft and May be carrying their second or subsequent egg clutch.

Males were categorized as adolescent or adult based on the relative size oftheir chelae, using the discriminant function from Sainte-Marie and Hazel (1992). Shell hardness was determined for individual males ofshell conditions 2 ta 5 using a durometer: readings range from 0 (softest) to 100

(hardest) (Foyle et al. 1989). We recorded wbether or not adolescent males were molting, as seen by raising ofthe old carapace. In this study, pubescent, primiparous, multiparous and non-fecund mating pairs were tenned according ta the state ofthe female (or the nature ofthe graspee in non­ fecund pairs) involved with a mature or an adolescent male.

5.3.3 Genetic analyses

In arder ta investigate whether males grasPers in primiparous pairs fathered their mate's embryos and ta verify patterns ofspenn storage, five mating pairs colleeted on 24-25 March 1996 were subjected to genetic analyses. Females in these pairs had soft shel1s, indicating that they had molted to maturity no more than a clay or two prior to collection. For each mating pair, a samplee of leg muscle from the mating partners, the whole egg clutcit, and the contents of the left spermatheca were isolated and preserved in 100% ethanol following methods described in Urbani et al. (in press).

PCR was carried out in volumes of12.5 ,!lI according to Bowcock et al. (1993). Reactions for locus Cop34 were perfonned with 0.2S ,uM of each primer, using 0.25 units of Taq DNA polymerase (pharmacia), 200 ,uM each ofdATP, dCTP, dGTP and dTTP and 1.5 mM Mgel2• The

62 forward primer was end·labelled with ('Y.32P]dCTP. Samples were overlaid with minerai oil,

denatured for 2 min at 94°C and amplified for 25-30 cycles of1 min at 94°C, 1 min at an annealing

temperature of71oC, and 1 min at 72°C. Reactions for locus Cop24-3 were identical except that the

concentrations were 0.5,uM for primer and 2.0 mM for MgC~, and the annealing temperature was

54°C. PCR products were resolved by electrophoresis on 6% denaturing polyacrylamide gels. The

gels were dried and autoradiography was camed out at room temperature for 1-3 days.

5.3.4 Statistica/ anaiyses

Depending on type of variable and distribution of data, we used simple parametric or

nonparametric statistics to describe and compare data. In most studies ofsize assortative mating,

male body size is treated as the independent variable and relationships to female body size are

described by model l regression. However, this procedure is questionable since females may also

be indirectly or directly implicated in mate choice (see below). Model II geometric mean regression

(Laws and Archie 1981; Ricker 1984) May he more appropriate for the analysis ofsize assortative mating because the ordinate and abscissa values are mutually variable and the resulting regression

line is symmetrical regardless ofthe variable that is used on the ordinate. Single- or multiple·factor analysis ofvariance (ANOVA) with covariates were used to investigate effects ofyear and size of female and male body, or bodyparts, and ofnumber ofmissing limbs on mating associations. In perfonning these analyses, we also considered the possibility that both the female or the male played seme part in the mating proc:ess and therefore that either's characteristics might represent dependent variables.

63 5.4 Resulu

5.4.1 Diver observations

Based on the diver surveys, snow crab pairs were dispersed or occurred in loose, large-scale aggregations. We did nat observe any pods ofpubescent and/or multiparous females ofother majid species Ce.g. Carlisle 1957; DeGourseyand Auster 1992; Stevens et al. 1994; and see general discussion in Orensanz and Galluci 1988). The abundance ofpaired crabs as measured by diver collection rate was lower in 1991 and 1992 than in 1995 and 1996, but differences among years were not significant (Table 5.1). However, ifthe data for two successive years was pooled there was a significant difference (4.6±2.7 crab pairs per diver-hour in 1991-92 and 7.6±4.l in 1995-96. t=-2.158, P=O.042). In aIl years, divers reported the occurrence ofsingle males, frequent bouts of fighting between single males in the presence ofa pubescent female, or between single and paired males, or between two paired males. Both single and paired males appeared to he highly mobile.

5.4.2 Categories ofpaired crabs and characteristics ofgraspees

Paired crabs feU into two broad categories based on the identity ofthe graspee. "Potentially fecund" pairs were represented by males grasping female snow crab that were either pubescent, primiparous, or multiparous (Table 5.1). Most potentially fecund pairs were coUected in a pre- or post-copulatory embrace, although a few were sampled during copulation. "Non-fecund" pairs were composed ofmales grasping immature females, adolescent or adult male snow crabs, or a female

Hyas araneus (Table 5.2). The overall proportion ofcombined pubescent and primiparous pairs relative to all crab pairs was 85.1% but tbere was significant interannual variation (i=20.56, df=3,

P

64 Pubescent females predominated in potentially fecund patrs (88.2%), followed by primiparous females (11.6%) and by a single multiparous female. However, there was significant interannual variation in the proponion of pubescent pairs relative to total number of potentially fecund pairs (;(=14.18, df=3, P=O.003), the proportion being lower in 1995 (78.6%) than in other years (87.1 ..94.2%, excluding the one multiparous females) (Table 5.1).

The size of pubescent and of primiparous females in crab pairs varied considerably but coherendy across the years (Table 5.3). Mean CW increased for both groups offemales from 1991 to 1992, and then declined in 1995 and 1996. The interannual variability in size was significant for both pubescent and primiparous females (Kroskal-Wallis test on each female group, P

Mean CW ofpubescent females, once augmented for predicted growth at tenninal molt according to the equations ofAlunno-Bruscia and Sainte-Marie (1998), was significantly less (1991 and 1992) or greater (1995) than Mean CW ofprimiparous females in respective years (Mann-Whitney test,

P

The number oflimbs that paired pubescent females were missing was variable over the years

(Kroskal-Wallis test, P=O.043). In 1991 and 1992 pubescent females were missing an average of0.9 limbs each, while the average was 1.1 in 1996 and 1.4 in 1995. The maximum number ofmissing limbs was 5 in each year except 1995, when the number reached 7.

For the period 1991-96, the types ofgraspees represented in non fecund pairs were, in arder ofdecreasing importance, adolescent males (60.5%), immature females (23.7%) and adult males

(14.5%). Immature females and adult males occurring in greater ftequencies in 1991-92 than in

1995-96, and conversely for adolescent males (Table 5.2; i=6.43, df=2, P=O.040 for frequencies

65 pooled by pairs ofyears).

5.4.3 Characteristics ofgraspers in relation to pair type

Ali graspers were males, and ofthese 93.8% were adult and the remainder were adolescent.

The proportion ofadult males grasping any given category offemales not vary significantly over the years and hence the data were pooled for analysis. Adult males grasped 96.1 % ofpubescent females,

90.2% ofprimiparous females, and 83.8% ofnon fecund partners (r=18.01, df=2, P

Overall, the majority ofmales that grasped pubescent and primiparous females had shells in the intennediate condition (58.1 % and 35.3%, respectively) or in the dirty-hard condition (37.7% and 54.9%, respectively). No males with clean-soft shells were grasping either type offemale, and the proportions of males with clean-hard and dirty-soft shells grasping pubescent females was slightly lower (0.80/0 and 3.4%, respectively) than those grasping primiparous females (3.9% and

5.9%, respectively). The condition ofgrasping males in non fecund pairs was more diversitied: 9.20/0 had a clean-soft shell. ~.6% had a clean-hard shell, 23.7% had an intennediate shell, 54.0% bad a dirty-hard shell, and 10.5% had a dirty-soft shell. Shell condition ofgraspers showed some inter­ annual variability (Table 5.4). Males with clean or intennediate shells predominated in pubescent pairs in 1991, 1992 and 1995, while males with dirty sheDs predominated in pubescent pairs in 1996

(i=28.21, df=3, P

The relationship ofshell hardness, as measured by the durometer, to shell conditions 3-5

(intennediate to dirty-soft) for males graspers in all mating pairs was investigated by ANOVA using the naturallogarithm (In) ofCH as the covariate. Shell hardness varied as a function ofooth inCH

66 (F=290.38, P

(P

A consistent and significant pattern in the size ofmales involved in the various types ofpairs emerged over the years (Table 5.5). In any given year, the Mean CW ofgrasping males was aIways largest in pubescent pairs and smaIIest in non fecund pairs, the greatest difference betv:een the extremes occunlng in 1996 (26.5 mm) and the smallest in 1995 (14.4 mm). There was interannual variation in the Mean size of grasping males in pubescent and non fecund pairs, but not in primiparous pairs (Table 5.5). However, the pattern for males in pubescent pairs was inverse ta that observed for females: males were larger in 1995-96 than in 1991-92.

The Mean number ofmissing limbs (usually walking legs) per grasping male did not vary significantly among the categories of pairs for any given year (Kruskal-Wallis test, P>O.lS).

Depending on the year, males were missing an average of 0.7 to 1.0 limbs each when grasping pubescent females, of0.7 to 1.4 limbs eacb when grasping primiparous females, and of0.6 to 1.3 limbs each in non fecund pairs. The maximum number ofmissing limbs for males in pubescent pairs was 5.

5.4.4 Assortative mating

FocusÎDg on the predominant pubescent pairs, we tirst examined to what degree interannual

67 variability and male characteristics could explain overall variation in CW of paired females.

ANOVA indicated that only year (F=112.53, P

P

(CW data graphed in Sainte-Marie and Hazel 1992). Nonetheless, the total amount ofyariation in femaie CW explained by male CH was small (3.8 to 11.2%, depending on year). The siope ofthe model II regression offernaie CW on male CH did not differ from one except in 1992, when it was substantially higher (P

1996 ta a high of0.65 in 1992 (Kruskal-Wallis test, P

Turning the problem around, we examined to what degree inter-annual variability and charaeteristics ofpubescent females couid explain overall variation in either male CW or male CH.

As might he expected from the foregoing, female characteristics explained a greater proportion of variation ofmale CH than ofmale CW, 50 we present ooly results ofthe former analyses. SÎnce female AW data were not available for 1995 and AW varied independently ofnumber ofmissing limbs in other years, we performed two different ANOVA's on male CH to verify the etTects ofAW and number ofmissing limbs offema1es independendy while maximizing data included in analyses on male CH. In the first ANOVA (1995 excluded), a significant proponion ofvariation in male CH

68 was explained byyear(F=31.52, P

AW (F=6.73, P=O.OIO). In each year for which data were available, partial correlation analysis gave a positive coefficient between male CH and female CW (r=O.21 to 0.25 depending on year) and a negative coefficient between male CH and female AW (r=-O.12 to -0.19). This implies that larger

femaIes were paired with males with larger chelae for a constant female AW, and that females with relatively narrower abdomens were paired with males with larger chelae than females with relatively

larger abdomens. In the second ANOVA (1995 included), a significant proportion ofvariation in male CH was explained by year (F=35.67, P

(F=2.47, P=O.024), and by the covariate female CW (F=29.14, P

limbs (r,=-0.93, P=O.023). For a constant CW, females missing more limbs were therefore paired with males with smaller chelae. The amount of variation in male CH that could be explained by female CW, AW and number ofmissing limbs together ranged from 10.8 to 21.1 %, depending on year. This represented at least twice the amount ofvariation in female CW that was explained by male CH alone.

There was no positive correlation between CW ofprimiparous females and CH (or CW) of males in pairs, albeit data were few in each year (Fig. 5.1). The Mean ratio ofgraspee CW ta grasper

CW for primiparous pairs varied significantly among the years (Kruskal-Wallis test, P

69 primiparous pairs.

5.4.5 Genetic ana/ysis ofprimiparous pairs

The fmding that male graspers in primiparous pairs were on average smaller and tended to have shells in poorer conditions than those in pubescent pairs suggested that males mating with pubescent females were dominant compared to those mating with primiparous females. To test this idea, we genotyped 5 primiparous mating pairs collected by divers in 1996. An example of the electrophoretic allele patterns is shown in Fig. 5.2. Allele were examined from adults, spermathecae and embryos at loci Cop34 (Table 5.6) and Cop24-3 (Table 5.7). The results indicated that Ïemales bad on average been inseminated by at least 3.4 males at the rime of collection (Table 5.8).

However, none of the male graspers had fathered their mate's eggs, and in one case only (pair

BSM-I) had the grasping male already inseminated the female. Interestingly, this had occurred in the primiparous pair with the smallest male and highest ratio of female CW to male CW. It is noteworthy that in 3 cases (pairs BSM-II, -li and -IV), there was apparently no parental spenn left over in the spermatheca.

In 1996, there was a strong positive correlation between spermathecal load and number of

male genotypes represented in the spennatheca (r5=O.95, P=O.OSS). If 1996 data are pooled with

1995 data from the same site (from Urbani et al. in press), the correlation between spermathecal load and number ofmale genotypes is significant (r,=O.68, N=12, P=O.02S). These observations indicate a functional relationship between the number ofmatings a female obtains and the size of her ejaculate (sperm) stores, as demonstrated previously in the laboratory (Sainte-Marie et al. 1997).

70 5.5 Discussion

5.5.1 k/ating associations

Based on our present and previous laboratory and field observations, mating ofpubescent

female snow crab appears to conform to Christy's (1987a) female-centered competition scheme in

which males search and defend mobile, pheromone..emitting females. In each year, three categories

of snow crab pairs occurred on the Baie Sainte-Marguerite grounds, which can be ranked by

increasing reproductive value ofthe graspee to the grasper. (i) In non fecund pairs, the graspee was

ofno reproductive value to the grasper. (ii) In primiparous pairs, the female had aiready layed and

fel1ilized her eggs and therefore May have been ofno immediate value ta the male. Postcopulatory

guarding by males typically does not extend past oviposition in snow crab (Sainte-Marie et al.

1997), and indeed males that held primiparous females did not sire their eggs (Table 5.8). However,

ifa male inseminates a primiparous female there is a more or less rernote chance that bis spenn May

he used for the fertilization ofthe next egg clutch. (üi) Finally, in pubescent pairs, the female was

still virgin and was ofhigh value to the male.

The occurrence of non fecund snow crab pairs was common in our diving surveys and

appears to he unique to the pubescent-primiparous mating period. Non-fecund pairs have never been

observed during the snow crab multiparous mating period which occurs later in the year (M.

Corneau, Department of Fisheries and Oceans, Maritimes Region, Moncton, New Brunswick,

Canada, pers. comm.). Considering that graspees in non fecund pairs were frequently pre- and post-malt crabs and that crostecdysone and/or its metabolites may he implicated in pair formation

(Bouchard et al. 1996), a possible explanation for the existence of non fecund pairs during the

pubescent mating period, and lack thereof during the multiparous mating peri~ is that they

71 represent cases ofmistaken identity. Similar arguments have been put forth to explain homosexual pairs in the box crab Calappa lophos (Kazmi and Tinnizi 1987) and in the paddle crab Ova/ipes catharus (Haddon 1994).

5.5.2 Maie competitive ability

The overriding factors in competitive ability ofadult males appeared to he shell condition and degree ofhandicap, followed by chela/body size. As reported before for snow crab (Conan and

Carneau 1986), as for the majids Chionoecetes bairdi (Stevens et al. 1993; Paul et ai. 1995) and

Libinia emarginata (Homola et al. 1991; Ahl et al. 1996), recently molted males (dean-soft and dean-hard) are excluded from or participate only marginally in mating. An increase in reproductive success ofmales with time elapsed since molt has been established in a varlety ofspecies, notably the shore crab Carcinus maenas (Reid et ai. 1997) and the mud crab Scylla serrata (Knuckey 1996), and has been linked to increasing shell hardness and chela strength. Consistent with this interpretation, Dufour et ai. (1997) showed for male snow crab that claw muscle (i.e., strength) and shell hardness increase from the clean-soft ta the intennediate shell condition. The postmolt age of males in the prime intennediate shell condition for reproduction ranges ftom 1 to 3 years and shelI hardness progressively decreases thereafter in males in the intermediate, dirty-bard and dirty-soft conditions (Sainte-Marie and Dufour 1995; Dufour et ai. 1997). At the opposite end ofthe spectrum of shell condition for snow crab, dirty-soft males and to a smaller degree dirty-hard males also occurred in snow crab pubescent mating pairs in lesser proportions than would he expected if pairing occurred independently of shell condition. These males may have been more or less excluded from mating because of overall poorer condition. Dirty-soft males are senescing and

72 although they are capable ofgrasping and inseminating pubescent-primiparous females, they are

poorly mobile and May be easily displaced even by smaller males with intermediate shells

(Sainte-Marie, unpubl. data).

There is ample evidence for a variety ofbraehyurans that loss ofone or bath chelae seriously

impedes male ability to aceess and/or defend females from rivaIs (Sekkelsten 1988; Smith 1992;

Abe116 et al. 1994; Wilber 1995). In addition

may be at serious disadvantage eompared ta other males in competition for females. Based on our

field observations, males must search for females and when they possess one they often evade the challenge of another male by fleeing, as seen also in Chionoecetes bairdi (Paul and Paul 1996).

Suecess of both activities would undoubtedly depend on a1l or most walking legs being intact.

Moreover, in snow crab and other majids, male posturing to intimidate rivaIs and/or to proteet a

mate from takeover implieates a uhigh-on-Iegs" stance (Hazlett 1972; Donaldson and Adams 1989) which May he facilitated by long and intact wa1king legs (Stevens et al. 1993).

AlI other things being equal, larger males were much more likely than srnaller males to pair with a pubescent female. However, in contrast to a previous inference for snow crab (Conan and

Corneau 1986), our results support the view that chela size is a more decisive trait than body size

for male mating success (aiso see Sainte-Marie et al. 1997). This is consistent with recent investigations showing that chela size is a more appropriate indicator than body size of male dominance and strength, and a better gauge orthe potential outeome ofagonistic sexual interactions,

in other brachyuran crabs (Lee and Seed 1992). In the velvet swimming crab Necora puber, contests between males outside the breeding season are resolved on the basis ofrelative body size, but during the breeding season this difference alone cannot explain the outeome ofan agonistic interaction

73 which may depend on other factors related to fighting ability (Smith et al. 1994).

The present results show that adolescent males participated only marginally in the mating with pubescent females and this could be due ta the fact that they seldom reach the intermediate or dirty-hard conditions characteristic ofthe most successful adult male breeders, and that their chelae are generally much smaller than those ofadult males (Carneau and Conan 1992; Sainte-Marie et al.

1995).

5.5.3 Assortative mating

Mate assessment and selection resulting in assortative mating May he a multifactorial problern in a number of species that cannot simply be reduced to a single feature ofprospective mates (Christy 1987a,b; Backwell and Passmore 1996). In the snow crab, it appeared that female choice was made on the basis ofquality assessed from a number offeatures. FemaIe state appeared to be important in male choice. Pubescent females seemed more appeaIing to males than primiparous females foUowed by multiparous and graspees in non-fecund pairs. Also, body size as well as degree offemale handicap and relative abdomen width appeared to be important in male choice. Female CW was positively correlated with that oftheir mates. It has been shown in a study by Sainte-Marie (1993) that the fecundity ofprimiparous femaJes was correlated with their CW.

Hence, males May maximize their reproductive success by mating with the larger more fecund females.

80th the degree offemale handicap (missing limbs) and the relative width ofabdomen were negatively correlated with the size ofmates. It is easy ta envisage how males can assess the number

of missing limbs for females t and how this handicap in a species with terminal malt may

74 compromise female survival and lifetime reproductive output owing ta reduced mobility that decreases the individual's capability to forage and escape predators (Juanes and Smith 1995). The relationship offemale relative abdomen width to size ofmate is not obvious, but there may be an optimal AW to CW ratio for the abdomen to function efIectively as a brood chamber while not impeding mobility (Hartnoll 1982).

There is one other potential and perhaps forernost source ofvariability that May be common ta Many crab species. In species combining female-centered competition and free search patterns for males, the process ofassortative mating May be ta sorne extent a lottery in which mobile males

May attempt to upgrade their mate until they fmd one offering the best fecundity benefits. This May involve sampling and rejecting unattended females, or rejecting a mate in favor ofa female stolen from a rival male, on the basis of traits increasing male fitness. We and Hooper (1986) have observed such a male sampling behavior in the laboratory and in the field. This process implicates sorne degree ofchance and would necessarily result in an imperfect assortation ofmates by size. In additio~ in many brachyuran species including snow crab, there May he sorne measure ofindirect or direct female choice implicated in pair fonnation, for example reluctance to mate, which would favor males with larger body size and/or chelae (Stevens et al. 1993; Claxton et al. 1994; Haddon

1994; Orensanz et al. 1995; Jivoffand Hines In press).

In conclusion, the present study indicates that the mating system ofsnow crab May offer considerable flexibility for female and male interactions, as suggested by Elner and Beninger (1995).

Crabs are not locked into a rigid mating pattern and there exist breeding opportunities, albeit less rewarding, for small or otherwise inferior males.

7S 5.6 Aclmowledgments

This work was conducted in dangerous and trying conditions. It would not have been possible without the help and diving skills ofL. Bourdages~G. Fournier, Y. Gagnon, J. Easton, S.

Raymond, P. Bernier, R. Larocque and C. Poirier. We are particulary grateful to P. Goudreau who endured extreme conditions during long hours of surface support. We thank P.R. Jivoff for preliminary discussions. This study was supported by Fishery and Oceans funds to B. Sainte-Marie and by a grant from the National Science and Engineering Research Council of Canada to U.

Kuhnlein.

76 Table 5.1. Yearly variation in composition ofpotentially fecund pairs by graspee identity~ expressed as a percentage of total number ofpotentially fecund pairs~ based on diver collections of paired

Chionoecetes opi/io in Baie Sainte-Marguerite during March 1991, 1992, 1995 and 1996.

Graspee identity 1991 1992 1995 1996

Pubescent female 87.1 94.2 78.6 91.8

Primiparous female 12.1 5.8 21.4 8.2

Multiparous female 0.8 0 0 0

Total number ofpairs 124 120 98 97

Number ofpaired crabs 4.2±1.9 4.9±3.3 8.9:1:4.7 6.5±3.5

(per by diver-hour) C

C One-way ANOVA: F=2.03, P=O.143.

77 Table 5.2. Yearly variation in the composition ofnon fecund pairs by graspee identity, as percentage oftotal number ofnon fecund pairs, based on diver collections ofChionoecetes op/lia pairs during

March 1991, 1992., 1995 and 1996.

Graspee identity 1991 1992 1995 1996

C. opi/io immature female 37 31 17 18

C. opi/io adolescent male 44 38 72 73

C. opi/io adult male 19 23 11 9

H. araneus multiparous female 0 8 0 0

Total number ofpairs 16 13 36 Il

78 Table 5.3. Yearly variation in Mean carapace width (CW, in mm) of pubescent females and of

primiparous females in potentially fecund pairs, and of graspees (immature females, adolescent

males or adult males) in non fecund pairs, for Chionoecetes opilio collected by divers in Baie

Sainte-Marguerite during March 1991,1992, 1995 and 1996. The Kruskal-Wallis test was used to

check for differences among years in Mean CW.

Graspee identity 1991 1992 1995 1996 Test

Pubescent female 49.4 53.2 46.0 43.0 P

Primiparous female 59.6 65.7 51.5 50.0 P

Graspees in non fecund pairs' 46.9 49.4 46.7 48.2 P=O.922

• a Excluding the one Hyas araneus graspee.

79 Table 5.4. Yearly variation in the composition by shell condition ofgrasping males in pubescent, primiparous, and non fecund pairs collected by divers in Baie Sainte-Marguerite during March of

1991, 1992, 1995 and 1996, as a percentage ofnumber ofpairs in each category ofpairs.

Pair type and grasper shell condition 1991 1992 1995 1996

Pubescent Clean-soft and clean-hard 0.93 0 1.30 1.12

Intennediate 77.78 54.87 54.55 41.57

Dirty-hard 20.37 41.59 42.86 49.44

Dirty-soft 0.93 3.54 1.30 7.87

Number ofpairs 108 113 77 89

Primiparous Clean-soft and clean-hard 0 0 9.52 0

Intermediate 40.00 14.29 33.33 50.00

Dirty-hard 46.67 85.71 52.38 50.00

Dirty-soft 13.33 0 4.76 0

Number ofpairs 15 7 21 8

Non fecund Clean-soft and clean-hard 0 0 22.22 0

[ntermediate 18.75 23.08 11.11 72.73

Dirty-hard 68.75 69.23 55.56 9.09

Dirty-soft 12.50 7.69 11.11 9.09

Number ofpairs 16 13 36 Il

80 Table S.S. Yearly variation in the mean carapace width (CW, in mm) ofmaIe graspers in pubescen~ primiparous, and non fecund pairs of Chionoecetes opilio collected by divers in Baie

Sainte-Marguerite in March of 1991, 1992, 1995 and 1996. The Kruskal·Wallis test was used to check for differences in mean male CW among years and ofmean male CW in different pair types within years.

Pair type 1991 1992 1995 1996 Test

Pubescent 84.0 82.7 95.7 93.3 P

Primiparous 76.9 70.6 85.0 84.3 P=O.145

Non fecund 68.1 68.7 81.3 66.8 P=O.002

Kruskal·Wallis test P

81 Table 5.6. Alleles at locus Cop3-4 observed in couples BSM-I, BSM-II, BSM-III, BSM-IV and

BSM-V. S and Estand for spermatheca and embryos, respectively. X, x indicate bands ofstrong and weak intensities respectively, while XX indicates a homozygous genotype.

BSM-[ BSM-II BSM-III BSM-IV BSM-V allele

~ (/ S E ~ (/ S E ~ r:I S E ~ (/ S E ~ r:I S E (bp) X 288 X x X X X X 282 X x X X 278 X 275 x 274 x 273 X x 272 X X X X 270 X 269 X X X X x 267 x X XX X x XX X 266 X x 265 X 264 X 263 X X X 262 X x 261 X X X 260 x x 258 X 257 XX x 256 X X X 254 X 253 X X X 252 X XX 250 X 246 X 244 X 242 ~

82 Table 5.7. Alleles at locus Cop24-3 observed in couples BSM·I, BSM·II, BSM·UI, BSM·IV and

BSM·V. S and E stand for spermatheca and embryos, respectively. X, x indicate bands ofstrong and weak intensities respectively, while XX indicates a homozygous genotype.

BSM-I BSM·II BSM·III BSM-IV BSM-V ailele (bp) ~ rJ S E ~ rJ S E ~ rJ SE ~ rJ S E ~ rJ S E x x X 234 x X 222 x x 214 x x XX XX x 210 X x X X x 206 X X X x X X 202 x x X x X X 198 X X x X X 194 x X X x 190 X XX X x 186 X X X x 182 x XX X 178 X x X x X 174 X XX X 170 X x X 166 X X 162 X W.

83 Table S.8. Primiparous mating pairs collected by divers in Baie Sainte-Marguerite during March

1996. Male and female carapace width (CW, in mm), number of non-maternaI alleles in spennatheca for loci Cop3-4 and Cop24-3, least number of mates detennined from spermathecal contents (number in parentheses is inclusive of father when his genotype is not represented in spennatheca), presence offather's and ofgrasper's spenn in the spennatheca, and ejaculate load

(in mg, fonnalin-preserved equivalent weight) for the spermatheca are presented for each pair.

Female spennatheca

Pair Male Female Alleles Alleles Number Father Grasper Ejaculate

ldentity CW CW Cop3-4 Cop24-3 Mates Sperm Spenn Load

BSM-I 48.2 56.2 10 9 5 yes yes 0.199

BSM-II 61.6 55.2 2 2 1(2) no no 0.068

BSM·III 114.6 47.6 2 1(2) no no 0.036

BSM-IV 84.4 42.4 9 7 5 (6) no no 0.116

BSM·va 82.6 55.1 4 4 2 yes no 0.083

a This pair was collected by divers during a directed survey and is not tallied in other tables.

84 Figure 5.1. Potentially fecund mating pairs collected in Baie Sainte-Marguerite during March 1991,

1992, 1995 and 1996. Plot ofchela height ofgrasping male and carapace width ofpubescent (+), primiparous (e) or multiparous (~ female. The geometric Mean regression ofpubescent female carapace width on male chela height (solid line and equation), corresponding product-moment correlation coefficient and probability level are given in each graph.

8S 1991 y=1.122x+27.843 1992 y=1.623x+23.682 70 r=0.194, P=0.046 70 r=0.336, P<0.OO1 •• 60 ...... 60 • •+ +e..p-~• + 50 ~+ 50 + .--.. + E E 40 40 ~ + .c.. ~ .-~ 30 30 CD 5 10 15 20 25 30 35 5 10 15 20 25 30 35 u a-ca l! ca 1995 y=1.169x+20.099 1996 y=1.032x+20.887 U r=0.283, P=0.013 r=0.249, P=O.019 CD 70 70 -ca E CD U- 60 • 60 + •• • 50 50

40 40

30 30 +--'r--P--...-...... --- 5 10 15 20 25 30 35 5 10 15 20 25 30 35

Male chela height (mm) Figure 5.2. Alleles observed at locus Cop24-3 for femaIe, male, spennathecal contents and embryos ofprimiparous mating pair BSM-I collected by divers in Baie Sainte-Marguerite during March 1996.

Allele sizes are indicated on ordinate.

86 • BSM-I Pair 9d'SpE

~ -234 - _J'''0 - 226 - ..".., - ---218 - 214 ~ - 210 ~ - 206 • - 202 - 198 ...... - 194 ~ - 190 ~ - 186 .... _- 182 -- 178 - 174 - 170 - 166 - 162 • CHAPTER 6. GENERAL CONCLUSIONS

Given the economic importance ofC. opilio for the fishery industry, it appears crucial ta gain

a better understanding ofits mating system. While several aspects ofreproduction have been studied

under laboratory conditions, little is known on the mating behavior of snow crabs in the wild. In

addition, patterns ofsperm competition and paternity are still unclear in a species where females

can store spenn from their mates for extended periods (Watson 1970; Beninger et al. 1988). For the

purpose, microsatellite DNA markers appear effective tools for investigating patterns of spenn

competition and patemity.

A total of 186 clones containing microsatellite sequences were isolated and peRassays were

established for polymorphic loci Cop3-4, Cop4-I, CopS, CopIO, Cop24-3 and CopI Il. The six

markers were tested in additional crab species and cross-amplification revealed DNA

polymorphisms at one or more loci in Cancer majister, Chionoecetes bairdi, Hyas araneus, Hyas

coarctatus, Hyas 'yratus, Oregonia gracilis, and Pugettia graci/is. The six markers couId be used

in future research to assess patemity, sperm usage, and May he useful tools for phylogenetic analysis

in species other than C. opilio.

In arder to address questions reIating to sperm usage and patemity, loci Cop3-4 and Cop24-3

were chosen among the six markers established. Apart from heing highly variable, the two loci were

preferred because of the tetra-nucleotide nature of their repeats yielding low DNA polymerase

slippage during PCR compared ta mono-, di- and tri-nucleotide repeats. Law DNA polymerase

slippage rate simplified the work ofdetennining genotypes, especially for femaie spennathecae as

they often contained the sperm ofsevera! males.

1 87 In order to elucidate patterns ofsperm competition, the progenies and the spermathecae of

primiparous females from controlled multiple mating experiments and from the wild were

genotyped at loci Cop3-4 and Cop24-3. Histological slides were aIso prepared from spermathecae

and analysed in arder ta complement genetic data. The markers revealed single patemity for the

progenies of aIl females, despite that both wild and laboratory females commonly mated with

several males and that their ejaculates were stored in their spennathecae. The analysis oflaboratory

females suggested that the predominant sperm competition mechanism insuring single paternity was

sperm stratification. The ejaculate ofthe most recent mate occurred close to the oviduct opening

and had exclusive access to unfertilized eggs. The analysis ofwild-caught females revealed they had

mated on average with at least 3.7 males. However, their larvae were fathered by the f11'st males to

mate, indicating that females mated once, fertilized and extruded their eggs and mated thereafter

with additional males.

The analysis ofwild-caught females revealed the importance ofmating behavior with respect

to paternity, and indicated tbat there were two mechanisms responsible for single paternity in

primiparous females. One was behavioral through insemination and complete control ofa virgin

female by a dominant male until oviposition, the other mechanical and consisted in sperm

stratification. While patterns of spenn usage and patemity have been elucidated in primiparous

females, further research is needed to define whether single patemity is also common in multiparous

females, whether spenn mixing May occur over time and whether different broods ofa female are fathered by a same male.

The analysis of the mating dynamics of a population in the nonhwestem Gulf of Saint

Lawrence in Eastern Canada indicated the existence of male mating hierarchies and assonative

88 pairing processes based on the size and quality ofmates. For the fICst time in brachyurans, the data suggested that female handicaps and secondary sexual characters May also influence pair fonnation.

The genetic analysis carried out in five mating pairs involving males grasping primiparous females with their broods showed that females had mated on average with 3.4 males, but none of the graspers had fathered their mates' eggs. It appeared that these males had smaller shells or shells in poorer conditions than dominant males mating with recently molted pubescent females. While such subordinate males may not have had an immediate advantage by mating with primiparous females after oviposition, their sperm might have been used to fertilize a second egg clutch in the event females would not have re-mated.

The results presented in this thesis confll111 the polyandrous nature of female snow crabs during their flfSt breeding period and their capacity to store spenn ofseveral males. Sainte-Marie and Carriere (1995) demonstrated that females can etTectively fertilize a second egg clutch from sperm acquired at the malt to matwity, indicating that spenn stored in spennathecae May remain viable for several months. Male and female populations features, such as abundance, size structure and shell condition, are known to fluctuate on a circa-decadal time scaJe (Corneau et al. 1991;

Sainte-Marie 1997). In addition, owing ta sexual dimorphisrn in size and age at adulthood, the fluctuations are asynchronous between the sexes (Sainte-Marie and Sévigny In review) and result in important operational sex ratio fluctuations. Severallines ofevidence indicate that sperm stored in spennathecae may he important for females as an "insurance policy"{Beninger et al. 1993), since they may not a1ways find a male with which to mate. Sperm storage may therefore have evolved as a mechanism ensuring larvae production even when the number ofmales available for reproduction is low. It would he therefore interesting to sample pairs at different stages within their lO-years

89 fluctuation cycles and carry out genetic analysis to verify patterns ofpaternity and mating activity via the male genotypes in the female spennathecae.

90 APPENDICES

Appendix 1. DNA sequence of 16 microsatellite containing loci. *Indicates clones that were isolated after hybridization with the (CA),o probe, while the other clones were isolated after hybridization with a combination ofprobes (CAC~ and (GACA~. III Indicates stretches ofunknown

DNA sequences (ranging from 100 ta 400 bp). The primer binding sites are underlined for loci for which PCR primers were designed. n indicates an undetermined number ofrepeats.

91 Locus DNA sequence CapA ATTTATAACTTCTATTCAAATACGTCTTTGTTCATGGACCTGCAAATGA GACTTTGAGTTATTTCTTTTTAATGAGAGAAACGTGAAGCATATTGGAC TAAAGACAAAGAAAACTTTTAATAGGTATTGCGATAGAAGGGAGGGGG AGAAG(GAG)sGAAAAG(GAG)>!I///AAAAAAATAAAGAAAAGAGTAAGAA ATACTAAGAACAGCAACAGTAAATAATGAACCAAAATAGACGCGAGAG TCAAAGTCAGAGAATAAAAATAATAAAACAGTTTAAAAGTTATACTATA TGTCAGAGGTAAAAGAAAAAACTCAAAATTGAAAAGAAAAATTATGAT AAAAAACTAAGACATGATCCCCGGGTACCGAG Cap l TGTGCCATATGAGGTGATTGCGCCACGGGGGGCGAACCTATAC(CA)28(G ACA)9(TA).J//TATGAATCACCAACATTCAATCAATCATTGGT Cop3-4 AAACCGTGCTGGTGAGGCAAGGAAAAGTTTATTACCCGCATCAAGGGA AAGTTTATAGCGTATTACCCTCTAGAAGTCAAGTT(C),(A),T(A)s(TAA)2T TGGCTTCT(CA)lCTCACTTG(A),TTGGGAAGCAAAATTATGAAGTGGAAA (GACA)I~GAAGCGAT AAGAAAAGACTCCGACATTGGGCAAAGAAGCAAC CAAGCAAACA(GACA),GATA(GACA).GAACATAAGAAAGGACTCAGAC ACATGAGCAACCAACTCCA(GACA)lCCAAG(GACA)3CCA(GACA)sAGAA GTCAAGTT Cop4-1 CAC ACTCATCACTCC AAACCCCAACTGTTTCCTA(GA)l,TGGGAAAGACA GACAGACAGAAAAT(GACA)2GAGACAGATAGAAACACTGACAAACAGA GAGAAAGAGAAACA(GA),GGCAGGGAAAGACAGA(GACA)sGATAGACA GAGCCAGAGAGAAAGAGAAAJ//(GGCA)nAAAAAAAAACAATGAAAACA GTAGTTGACGAGGCCAACCTTCAGCCCAATATCATCA

CopS TAGAGGATCGTTATATCTATOTCT ATCTGC(CTGT)~CTGCCTGTCT ATCT GCCTTCCTATCTGTCTTTCTGT(CT)l(CTGT),CTATCTACTCCCATATCTA TCTATCAATATTTTCAACCATCTATATATATAAATTCTATCATCTGTTTA TCTATATGTTA CoplO CCTACTACCACCGTAGCCTQÇCTCACCCCAGCCCCACCCCTGTTCTGCA G(CA),TA(CA)zCGCA(CA)z(CGCA),(CA).(TGCA)JGACCAGAGCTGGGCA CTTAATACATTGAATCTATTT Cop12 TTCATCTATTTTCATTQÇATTTTTTGTTTCTTGTGTTTGTATATATAAT(A G),///AAAAACAGCAAATAACATGAATGTAAAACTTTACCAGACATCGAA TACCTTGACA Cop 18 GCACTTGTGGQÇACAGGACAAGTGAATGAACCCTG(GT)zGCTGTCTCTT TCTCTAGTCCACCGACTTATTTCTTT(CT)lGTCTTTACCTCCATTT(CThC ACTCTGTATTTACTTGT(CT).(CTG1h(CT)s(CTGTh(CT)sCTGTCTGTCTC GCTCTAGTCCAGA Cap23 CGGGGATCCTCTTTACCAC(CAC).CAT(CAC)..CTCTAC(CAC),CAT(CAC), CATCACTAC(CAC),CTC(CAC),TAC(CAC),CCCCACCCC(CAC).CAGCT(C AC).CAGCT(CAC)!CATCACCAGCT(CAC)..CAT(CAC)JCTC(CAC)!CAGTA C(CAC)JCACCATGATGATGCAAACTT Cop24-3 ATCTATCTTTCTATTT(ATCT)8ATGAGCCTGTGTTGTCAATTCCTCTTGTT .~TAAGTAATAAGAATCACACAACATTTATATAATATCGTATGACTAA TTM TTT(AC)2.AAGATGAACGCCTTGAGACAAAGAGACATACAGACTG ACAGGCGAACGAAACAGATAATAGACAGACAAAGACTTAAACA(GACA ).!AAATAATACGTGCTCTCATATGTGTTTGATAATTTTGTGTATAAAGAT CTTAAGAGGAAAATICAGATACCCGGGTACCGAGCTCGAATTCGTAATCA Cap26 TTTTGGGATGAAATCTATTGACAACTGTTGCCATGGCAACCAATTGATG AAATATTCGCCGGACTATGAGCTCATACTGAG(TA»16 ·Cap41 CCTTGCTATAATCAATAAACAAGCAAAAC AATTTCTTTTTCTTCCATCTA AAAAAATCAATAATACATTTCAACACAAATACAATAATCTACAGTAGAA TAGCCCTTCCTAAACCCTGTTTGAGTTTCATTTATCAAGTTTTTTTCATC ACAATAATGCAGACAGACAATCATTCAAATAATAGAAGTAAATACTGA

A(GT)101CAACCAGGCCGACATTCGATAAAGTCTACTTATTGTGTCACAT ATACGCCTTGATGTCAGCTCTCGATAACACACACCACCATCTACCTC ·CapS1 GATCAAGGGATGTAAGCCAACACAGCAAAGGA(CA)14(GACACA)!(CA)u GAGACAGAAGCGAAGACATACGGGCGGTCTTCTTAAAA Cop 108 CTCTACCAACCAGGCCACTCTGACGGGTAA(GA).,CGCCACCATCGCCTC (CAC)llCAT(CAC)!CTCCACGAAGGATATAGAGGTCCGTATTCGCCTTTG CTTCGTTGGTGGTTTGG

Cop III GGATTTCTCAAAAAGTTACGAATAGATTTAGACCAAATTCGGTATACCA AGTATATTTGGTATAAGGAAGAACTGATATAATTTTGGATGAAATCTAT TGACACTGTGCATGCACATGATGAATATTCGGCCGQAGTAGGCGCTCAT ACTGAGTGA(A~nGTAGTCATGGCAACATTTATACACTCACAATCTGGG CTGCAACCACCTAAGTAAAAACCACAGAACGAAA Cop 181 GGGTGTTCCTTTGTTTCATGAGG(GT).TTA(GTlasAT(GT)3GG{GT)JATTT GTGGGGTT(GlhsAT(GT)2oAT(GT)11ATT(GT),G(GT),AC(GT)14GCAT(GT).. TT(GThAT(GT)2TT(GT)!CT(GT),TT(GThGGGTGGGGT(GTbTTTTAGTTG --_.~ ..._------Appendix 2. Banding patterns obtained from PCR amplification ofsix mierosateUite loci. In a) and b) are shawn two highly polymorphie loci made primarily oftetra-nueleotide repeats. The DNA polymerase slippage appear low. c) and d) illustrate the highly variable multiloeus banding pattern obtained at CopS and the single locus amplification at little polymorphie locus CoplO, respeetively.

Both markers show low DNA polymerase slippage sinee variability results primarily from tetra­ nucleotide repeats. In e) and t) are shawn two highly polymorphie loci made of di-nueleotide repeats. The DNA polymerase slippage at these loci appear high.

92 • a) Locus Cop3-4

2 3 ~ 5 6 7 8 9 10 II 12 13 I~

- 27S • =270

• • b) Locus Cop24-3

2 3 ~ 5 6 7 8 9 lU Il I~ 13 li 15

- :ix" ... - - ::I~ ... - ::10 .... - ::06 .. ... ~ - ::U: .. 19H .. IQ..J IlJO .. - 186 a..- 18: ...... - ...... 17S .. 17..J 170 • 166 - • -- - • • c) Locus Cop5 ~ § 12 J 45 6 7 8 910111213 141516 ~

-- __-- .... -222 - 21-1 - -206 -198 - 190 ... -182 -17-1 -166 -158 - 150 - 1-12 - U4

-IIH • d) L,ocus Cop 10 1 2 3 456

-145 -141 -137 -133 -129 ~-125 -121 • • e) Locus Cop4-1 1 2 3 4 5 6 7 8 9 10 ~ -200 ~- -190 __ ~-180 -:--..~ ~. -170 • __. =- -160 - it_· - ~ -150 • -140 ~ -130 -120 • f) Locus CopI!!

':.1 ~ 1 2 3 456 7 8 9 10 Il ':.J -130 -120 t -110 . =- 4 -100 ~- :.-._n._ ~ 90 • ..:.. Appendix 3. Compared variability at loci Cop34 and CoplO in closely related species. a) Locus

Cop3-4 appear highly variable in Hyas coarctatus but almost fixed at allele 239 bp in Hyas araneus. b) Locus CoplO appear highly variable in Chionoecetes bairdi but almost fLxed at allele 141 bp in

Chionoecetes opi/io.

93 • a) Locus Cop3-4

Hl'as coarC:lalus hras araneus 1 234 5 1 2 3 4 5

_,'"'t~ -210 -206 -2112 -25X .. ... -25.J -:!50 cd --.... -2.Jô -2~2 -23X -23.J -230

• b) Locus ('op 10

( ï,Ù)/T(J('cl.'{l','i haircli (• opilio

12345678 1234

-153 -I-N .. -1.+5 ...... ··.f·~-I.Jl .... . -l37 -133 -129 -125 -121 -117 • Appendix 4. Allele frequencies at loci Cop3-4, Cop4, CopIO, Cop24-3 and Copi II, and calculations ofexpected heterozygosities ~), i -values between Habs. and ~. and probabilities

(df=l). Freq. stands for allele frequency. Allele frequencies were calculated from 20 unrelated individuals, *except for locus Cop10, where 438 unrelated individuals were analysed.

94 Locus

Cop3-4 Cop4 *CopiO Cop24-3 Cap III ABele freq. Allele Freq. ABele Freq. Allele Freq. ABele Freq. 234 0.025 118 0.025 123 0.0559 166 0.100 94 0.050

238 0.025 120 0.050 125 0.0114 170 0.025 102 0.125

241 0.025 138 0.025 141 0.9201 174 0.125 104 0.125

246 0.075 142 0.025 145 0.0126 178 0.050 106 0.100

249 0.050 150 0.025 182 0.150 112 0.125

250 0.025 152 0.025 186 0.125 114 0.150

251 0.050 154 0.050 190 0.075 116 0.175

252 0.050 158 0.075 194 0.075 120 0.050

254 0.075 162 0.025 198 0.025 130 0.100 256 0.025 164 0.075 202 0.075

257 0.050 170 0.075 206 0.050

258 0.125 172 0.025 210 0.025

259 0.025 178 0.100 214 0.075

261 0.050 180 0.025 222 0.025

262 0.100 182 0.050

266 0.050 184 0.025

270 0.025 188 0.150

276 0.050 192 0.050

278 0.025 198 0.075

282 0.025 204 0.025

358 0.025

360 0.025 Under the assumption ofHardy-Weinberg equilibrium, expected heterozygosities ~) at loci were calulated according to Verheyen et al. (1994) after the equation:

n Hexp. = l - ([ PI:! ) i =1 Where Pi represents the frequency ofthe ith allele and n = the total number ofaIleles. , Locus Haba· Hm· X- p Cop3-4 0.94 0.942 3.8 x 10-6 >0.995 Cop4-1 0.88 0.93 2.7 x 10·] >0.950 CopIO 0.16 0.15 6.6 x 10-4 >0.975

Cop24-3 0.9 0.906 4.3 x 10·~ >0.990 Cop 111 0.53 0.875 lA x 10- 1 >0.500 Appendix S. Copyright waivers for papers presented in chapters 3 and 4.

95 REFERENCES

Abele, L. G., Robinson, M. H. and B. Robinson. 1973. Observations on sound production by two

species of crabs from Panama (Decapoda, Gecarcinidae and Pseudothelphusidae)

Crustaceana 25: 147-152.

Abele, L. G., Campanella, P. J. and M. Salmon. 1986. Territoriality and social organization ofthe

semiterrestrial grapsid crab Pachygraphus transversus. 1. Exp. Mar. Biol. Ecol. 104: 153­

170.

Abe1l6, P., Wannan, C.G., Reid, D.G., and E. Naylor. 1994. Chela loss in the shore crab Carcinus

maenas (Crustacea: Brachyura) and its effect on mating success. Mar. Biol. 121: 247-252.

Achmann, R., HelIer, K. G. and J. T. Epplen. 1992. Last-male spenn precedence in the bushcricket

Poeci/imon veluchianus (Orthoptera, Tettigonioidea) demonstrated by DNA fmgerprinting.

Mol. Ecol. 1: 47·54.

Adams, A. E. 1982. The mating behavior ofChionoecetes hairdi. In B. Melteft ed., Proceedings

ofthe International Symposium ofthe Genus Chionoecetes. Sea Grant Report 82-10, pp.

235-271. University ofAlaska, Fairbanks, Lowell Wakefield Fisheries Symposia Series.

Adams, A. E., and A. J. Paul. 1983. Male parent size, sperm storage and egg production in the crab

Chionoecetes bairdi (Decapoda, Majidae). Int. J. Invenebr. Reprod. 6: 181·187.

Adiyodi, K. G. and G. Anilkumar. 1988. Arthropoda-Crustaeea. In K. G. Adiyodi and R. G. Adiyodi,

eds., Reproductive Biology ofinvertebrates. Vol. 3 Accessory Sex Glands, pp. 261·318. New

York: Wiley.

Abl, J.S.B., Laufer, H., Ahl, A.J., and P. Takac. 1996. Exoskeletal abrasion as an indicator of

96 reproductive readiness in the spider crab Libinia emarginata. J. Crustacean Biol. 16:

443-447.

Ali, S., Muller, C.R., and J.T. Epplen. 1986. DNA fingerprinting by oligonucleotide probes specific

for simple repeats. Hum Genet. 74: 239-243.

Alunno-Brusci~ M. and B. Sainte-Marie. 1998. Abdomen aIlometry, ovary development, and

growth offemale snow crab Chionoecetes opi!io in the GulfofSaint Lawrence (Brachyura,

Majiclae). Cano J. Fish. Aquat. Sei. (in press).

Amos, B., Sehlotterer, C. and D. Tautz .1993. Social structure ofpilot whales revealed byanalytical

DNA profiling. Science 260: 670-672.

Armour, J. A. L., Neum~ R., Gobert., S. and A. J. Jeffreys. 1994. Isolation ofhuman simple repeat

loci by hybridization selection. Hwn. molec. Genet. 3: 599..605.

Avise, lC. 1994. Individuality and Parentage. ln Molecular Markers, Natural History and Evolution.

Edited by J.C. Avise. Chapman and Hall New York., London. pp. 141-190

Backwell, P.R. Y. and N. 1. Passmore. 1996. Time constraints and multiple choice criteria in the

sampling behaviour and mate choice of the fiddler crab, Uca annulipes. Behav. Ecol.

Sociobiol. 38: 407-416.

Baker, C. S.., MacCarthy, M, Smi~ P. J., Perry, A. P. and G. K. Chambers. 1992. DNA fingerprints

oforange roughy, Hop/ostethus at/anticus: a population comparison. Mar. Biol. 113: 561­

567.

Beer, C. G. 1959. Notes on the behavior oftwo estuarine crab species. Trans. Roy. Soc. N.Z. 86:

197-203.

Beninger, P. G., Elner, R W., Foyle, T. P., and P. H. Odense. 1988. Functional anatomy ofthe male

97 reproductive system and the female spermatheca in the snow crab Chionoecetes api/io (O.

Fabricius) (Decapoda: Majidae) and a hypothesis for fertilisation. J. Crustacean Biol. 8:

322-332.

Beninger, P. G., Elner, R. W., and Y. Poussart. 1991. The gonopods ofthe majid crab Chionoecetes

opilio (O. Fabricius). J. Crustacean Biol. Il: 217-228.

Beninger, P. G., Lanteigne. C.. and R. W. Einer. 1993. Reproductive processes revealed by

spennatophore dehiscence experiments and by histology, ultrastructure, and histochemistry

ofthe female reproductive system in the snow crab Chionoecetes opi/io (O. Fabricius). 1.

Crustacean BioL 13: 1.. 16.

Beroud, C., Antignac, C., Jeanpierre, C., and C. Junien. 1990. Un programme informatique pour la

recherche d'amorces pour l'amplification par peRo Médecine/Sciences 6: 901-903.

Berrill, M. and Arsenault, M. 1982. Mating behavior ofthe green shore crab Carcinus maenas. Bull.

Mar. Sei. 32: 632-638.

Birkhead, T. R., and F. M. Hunter. 1990. Mechanisms ofspenn competition. Trends Ecol. Evol. 5:

48..52.

Bliss, D. E., van Montfrans, 1., van Montfrans, M. and 1. R. Boyer. 1978. Behavior and growth of

the land crab Gecarcinus lateralis (Freminville) in southem Florida. Amer. Mus. Nat. Hist.

Bull. 160: 111-152.

Bouchard, S., Sainte-Marie, B., and 1. N. McNeil. 1996. Indirect evidence indicates female

semiocbemicals release male precopulatory behaviour in the snow crab, Chionoecetes opilio

(Brachyura: Majidae). Chemoecology 7: 39-44.

Bovbjerg, R. V. 1960. Courtship behaviorofthe lined shore crab, Pachygrapsus crassipes Randall.

98 Pacifie Sei. 14: 421-422.

Bowcock, A., Osborne-Lawrence, 5., Bames, R., Chakravarti, A., Washington, S., and C. Dunn.

1993. Microsatellite polymorphism linkage map ofhuman chromosome 13q. Genomics 15:

376..386.

Brock, M. K. and B. N. White 1991. Multifragment alleles in DNA fingerprints of the parrot,

Ama:ona ventralis. J. Heredity 82: 209-212.

Burfit!, A. H. 1980. Glucose phosphate isomerase in Cancer pagarus L. broods as evidence of

multiple paternity (Decapoda, Brachyura). Crustaceana 39: 306-310.

Burke, T. and M. W. Bruford 1987. DNA fingerprinting in birds. Nature 327: 149.. 152.

Cano, G. 1891. Morfologia dell'apparecchio femminile, glandole dei cemente e fecondazione nei

crostacei decapodi. Mitt. zool. Sm. Neapel 9: 503-532.

Carlisle,D.B. 1957. On the honnonal inhibition ofmaturity in decapod Crustacea. II. The terminal

anecdysis in crabs. J. Mar. Biol. Assoc. U.K. 36: 291-307.

Cavalier-Smith, T. 1985. The evolution ofgenome size. John Wiley & Sons, New York.

Charlesworth, B., Sniegowski, P. and W. Stephan. 1994. The evolutionary dynamics ofrepetitive

DNA in eukaryotes. Nature 371: 215-220.

Cheung, T. S. 1968. Trans-malt retention ofspenn in the female stone crab, Menippe mercenaria

(Say). Crustaceana 1S: 117-120.

Christy, J. H. 1980. The mating system of the sand fiddler crab, UCQ pugi/ator, Ph.O. Thesis,

Comell University, Ithac&, New York. 322 pp.

Christy, 1. H. 1983. Female choice in the resource-defense mating system ofthe sand fiddlercrab,

Uca pugi/ator. Behav. Ecol. SociobioL 12: 169-180.

99 Christy, J. H. and M. Salmon. 1984. Ecology and evolution of mating systems of fiddler crabs

(genus Uca). Biol. Rev. 59: 483-509.

Christy, J.H. 1987a. Competitive mating, mate choice and mating associations ofbraehyuran crabs.

Bull. Mar. Sei. 41: 177-191.

Christy, J.H. 1987b. Fernale choiee and the breeding behavior ofthe fiddler crab Uca beebei. J.

Crustacean Biol. 7: 624-635.

Coffroth, M. A., Lasker, H. R., Diamond, M. E., Bruenn, 1. A. and E. Bermingham. 1992. DNA

fingerprints of a gorgonian coral: a method for detecting clonaI structure in a vegetative

speeies. Mar. Biol. 114: 317-325.

Claxton, W.T., Govind, C.K., and R. W. Elner. 1994. Chela function, morphometric maturity, and

the mating embraee in male snow erab, Chionoecetes op/lio. Cano 1. Fish. Aquat. Sei. 51:

1110-1118.

Corneau, M. and G. Y. Conan. 1992. Morphometry and gonad maturity of male snow crab,

Chionoecetes opi/io. Cano 1. Fish. Aquat. Sei. 49: 2460-2468.

Corneau, M., Conan, G.Y., Robichaud, G., and A. Jones. 1991. Life history patterns and population

fluctuations ofsnow crab (Chionoecetes opi/io) in the fjord ofBonne Bayon the west coast

ofNewfoundland, Canada - from 1983 to 1990. Can. Tech. Rep. Fish. Aquat Sci. 1817: 73p.

Conan, G. Y. and M. Corneau. 1986. Funetional rnaturity and terminal molt of male snow crab,

Chionoecetes opilio. Cano J. Fish. Aquat. Sei. 43: 1710-1719.

Cooper, G., Miller, P. and P. W. H. Holland. 1996. Molecular genetic analysis ofsperm competition

in the damselfly Ischnura e/egans (Vander Linden). Proc. R. Soc. Lond B 263: 1343-1349.

Crane, 1. 1957. Basic patterns ofdisplay in fiddler crabs (Ocypodidae, genus Uca). Zoologiea 42:

100 69-82.

Davidson~ K., Roff, J. C. and R. W. EIDer. 1985. Morphological, electrophoretie, and fecundity

characteristics of Atlantic snow crab~ Chionoecetes opi/io, and implications for fisheries

management. Cano 1. Fish. Aquat. Sei. 42: 474-482.

DeGoursey, R.E. and P. J. Auster. 1992. A mating aggregation of the spider crab (Libinia

emarginata). 1. North\v. AtI. Fish. Sci. 13: 77-82.

Diesel, R. 1986a Population dynamics ofthe symbiotic spider crab lnachus pha/angium (Decapo~

Majidae) Mar. Biol. 91: 481-489.

Diesel, R. 1986b. Optimal male searching strategy in the symbiotic spider crab lnachus phalangium

(Decapoda). Ethology 72: 311-328.

Diesel~ R. 1988a Discrete storage ofmultiple-mating spenn in the spider crab Inachus pha/angium.

Naturwissenshaften 75: 148-149.

Diesel, R. 1988b. Male-female association in the spider crab Inachus phalangium: the influence of

female reproductive stage and size. 1. Crustacean Biol. 8: 63-69.

Diesel, R. 1989. Structure and function of the reproductive system of the symbiotic spider crab

lnachus pha/angium (Decapoda: Majidae): observations on sperm transfer, sperm storage,

and spawning. J. Crustaeean Biol. 9: 266·267.

Diesel, R. 1990. Spenn competition and reproductive success in the decapod Inachus phalangium

(Majidae): a male ghost spider crab that seaIs offrival's spenn. J. Zool. London. 220: 213·

223.

Diesel, R. 1991. Sperm competition and the evolution ofmating behavior in Brachyura, with special

reference ta spider crabs (Decapoda: Majidae). In Crustacean sexual biology. Edited by R.

101 G. Bauer and 1. w. Marti~ Colwnbia University Press~ New York. p. 145-163.

Di Rienzo, A., Peterson, A. C., Garza, J. C., Valdes~ A. M., Slatkin, M. and N. B. Freimer. 1994.

Mutational processes of simple-sequence repeat loci in human populations. Proe. Natn.

Acad. Sei. U.S.A. 91: 3166-3170.

Dodd, B. E. 1985. DNA fingerprinting in matters offamily and crime. Nature 318: 506-507.

Donaldson, W. E. and A. E. Adams. 1989. Ethogram ofbehavior with emphasis on mating for the

tanner crab Chionoecetes bairdi Rathbun. J. Crustaeean Biol. 9: 37-53.

Dover, G. A. 1982. Molecular drive: A cohesive mode ofspecies evolution. Nature 299: 111-117.

Dover, G. A. 1986. Molecular drive in multigene families: How biological novelties arise, spread

and are assimilated. Trends Genet. 2: 159-165.

Dower, W. J., Miller, J. f. and C. W. Ragsdale. 1988. High efficiency transfonnation ofE. coli by

high voltage electroporation. Nucleic Acids Res. 16: 6127-6145.

Dufour, R., Bernier, D., and 1. -Co Brêthes. 1997. Optimisation de la récolte de ehair et mortalité

dW'3Jlt les opérations de pêche au crabe des neiges (Chionoecetes opi/io O. Fabricius) dans

l'est canadien. Rapp. Tech. Cano Sei. Halieut. Aquat. 2152: 31 pp.

Eales, A. 1. 1974. Sex pheromone in the shore crab Carcinus maenas, and the site ofits release from

females. Mar. Behav. Physiol. 2: 345-355.

Edwards, E. 1966. Mating behavior in the European edible crab (Cancer pagurus L.). Crustaceana

10: 23-30.

Edwards, A., Hammond, H. A., Jin, L., Caskey, C. T. and R. Chakraborty. 1992. Genetie variation

at five trimeric and tetramerie tandem repeat loci in four human population groups.

Genomics 12: 241-253.

102 Elner~ R and A. B. Stasko. 1978. Mating behavior ofthe rock crab Cancer irroratus. 1. Fish. Res.

Bd. Canada 35: 1385-1388.

ElneT, R and 1. K. Elner. 1980. Observation on a simultaneous mating embrace between a male and

t\vo female rock crabs Cancer irraratus (Decapo~ Brachyura). Crustaceana 38: 96-98.

Elner~ R., Gass, C.A. and A. Campbell. 1985. Mating behavior ofthe Jonah crab, Cancer borealis

Stimpson (Decapo~ Brachyura). Crustaceana 48: 34-39.

Elner, R. W. and P. G. Beninger. 1992. The reproductive biology ofsnow crab, Chionoecetes opilio:

a synthesis ofrecent contributions. Amer. loo1. 32: 524-533.

ElneT, R. W. and P. G. Beninger. 1995. Multiple reproductive strategies in snow crab, Chionoecetes

opilia: physiological pathways and behavioral plasticity. 1. Exp. Mar. Biol. Ecol. 193:

93-112.

Engstrom, N. A. and 1. M. Lucenti. 1984. Time-lapse movies and the diurnal time budget and

activity patterns ofCata/eptodiusfloridanus, a tropical intertidal xanthid crab. 1. Crust. Biol.

4: 266-276.

Fielder, D. R. and A. 1. Eales. 1972. Observation on courtship, mating and sexual maturity in

Portunus pe/agicus (L., 1766) (Crustacae, Portunidae). J. Nat. Hist. 6: 273-277.

FoyIe, T. P., Hurley, G. V., and D. M. Taylor. 1989. Field testing shell hardness gauges for the snow

crab fishery. Cano Ind. Rep. Fish. Aquat. Sei. 193,38 pp.

Fries, R., Eggen, A. and G. Stranzinger. 1990. The bovine genome contains polymorphie

mierosatellites. Genomies 8: 403-406.

Georges, M., Cochaux, P., Lequarre, A. S., Young, M W., and G. Vassart. 1987. DNA

fingerprinting in man using a mouse probe related to part ofthe Drosophi/a "Per" gene.

103 Nucleic Acids Res. 15: 7193.

Gifford" C. A. 1962. Sorne observations on the general biology of the land crab, Cardisoma

guanhumi (Latreille), in southern Florida. Biol Bull. 123:207-223.

Gill, P., Jeffreys, A. J. and D. 1. Werrel. 1985. Forensic application ofDNA "fingerprint." Nature

318: 577-579.

Gleeson, R. A. 1980. Pheromone communication in the reproductive behavior of the blue crab

Callinectes sapidus. Mar. Behav. Physiol. 7: 119-134.

Gordon, 1. 1963. The anatomy ofthe crab iVeptunus sanguinofentu~ (Herbst). Part V. Reproductive

system and embryological studies. 1. Madras Univ. Sect. B 33: 289-304.

Grafen, A. and M. Ridley. 1983. A model ofmate guarding. 1. Theor. Biol. 102: 549-567.

Greenspan, B. N. 1980. Male size and reproductive success in the communal courtship system of

the fiddler crab Uca rapax. Animal Behav. 28: 387-392.

Griffin, D. 1. G. 1968. Social and maintenance behavior in two Australian ocypodid crabs. 1. Zool.

London 156: 291-305.

Haddon, M. 1994. Size-fecundity relationships, mating behaviour, and larval release in the New

Zealand paddle crab, Ovalipes catharus (White 1843) (Brachyura, Portunidae). N.Z. 1. Mar.

Freshwat. Res. 28: 329-334.

Hadrys, H., BaIick, M. and B. Schierwater. 1992. Applications ofrandom amplified polymorphie

DNA (RAPD) in molecular ecology. Malec. Ecol. 1: 55-63.

Hadrys, H., Scbierwater, B., Dellaporta, S. L., Desalle, R. and L. W. Buss. 1993. Detennination of

patemity in dragonflies by random amplified polymorphie DNA fmgerprining. Molec. Ecol.

2: 79-87.

104 Hanotte, O., Bruford, M W. and T. Burke. 1992. Multilocus DNA fingerprints in gallinaceous birds:

general approach and problems. Heredity 68: 481-494.

Hartnoll, R. G. 1963. The biology ofManx spider crabs. Proc. zool. Soc. Land. 141: 423496.

Hartnoll, R. G. 1968. Reproduction in the burrowing crab, Carys/es cassivelaunus (Pennant, 1777)

(Decapoda, Brachyura). Crustaceana 15: 165-170.

Hartnoll, RG. 1982. Growth, pp. 111-196./n Abele, L.G. (ed). The biology ofCrustacea. Academie

Press, New York, NY.

Hazlett, B. 1975. Agonistic behavior oftwo sympatric species ofxanthid crabs, Leptodius florrdanus

and hexapanopeus anguistifrons. Mar. Behav. Physiol. 4: 107-119.

Hazlett, B. 1972. Responses to agonistic postures by the spider crab Microphrys bicornutus. Mar.

Behav. Physiol. 1: 85-92.

Hazlett, B., Bach C. and C. Mitchell. 1977. Distribution patterns ofthe xanthid crab Cataleptodius

tloridanus (Gibbes, 1850) (Decapoda, Brachyura, Xanthidae). Crustaceana 33: 316-319.

Hicks, 1. W. 1985. The breeding behaviour and migrations of the terrestrial crab Gacarcoidea

natalis (Decapoda: Brachyura). Aust. 1. Zool. 33: 127-142.

Hinsh, G. W. 1968. Reproductive behavior in the spider crab, Libinia emarginata CL.). Biol. Bull.

135: 273-278.

Hill, W. G. 1987. DNA fingerprints applied ta animal and bird populations. Nature 327: 98-99.

Homola, E., Sagi, A., and Laufer, H. 1991. Relationship of claw fonn and exoskeleton

condition to reproductive system size and methyl famesoate in the male spider crab, Libinia

emarginata. Invertebr. Reprod. Develop. 20: 219-225.

Hooper, R. G. 1986. A spring breeding migration ofthe snow crab, Chionoecetes opi/io (O. Fabr.),

lOS into shallow water in Ne\rt"oundland. Crustaceana 1986 50: 257-264.

Hooper, R E. and M T. Siva-Jothy. 1996. Last male spenn precedence in a damselfly demonstrated

by RAPD profiling. Molec. Ecol. 5: 449-452.

Huber, M. E. 1985. Nonrandom mating with respect to mate size in the crab Trape=ia (Brachyura,

Xanthidae). Mar. Behav. Physiol. 12: 19-32.

Huber, M. E. 1987. Phenotypic assortative mating and genetie population structure in the crab

Trape=ia digita/is. Mar. Biol. 93: 509-515.

Hya~ G. W. 1977. Field studies ofsize-dependent variation in waving display and other behavior

in the fiddler crab Uca pugilator (Brachyura, Ocypodidae) Mar. Behav. PhysioL 4: 283-292.

Jarman, A. P. and R. Wells. 1989. Hypervariable Minisatellites: Recombinators or Innocent

Systanders? Trends in Genet. 5: 367-371.

Jarne, P., Delay, B., Sellee, C., Roizes, G. and G. Cuny. 1990. DNA fingerprinting in sehistosome­

vector snails. Biochem. Genet. 28: 577-583.

Jeffreys, A. J., Tamaki, K., Macleo<1 A., Monkton, D. G., Neil, D. L. and 1. A. Armour. 1994.

Complex gene conversion events in germline mutation at human minisatellites. Nature

Genet. :136-145.

Jeffreys, A. J., Wilson, V. and S. L. Thein. 1985a. Hypervariable 'minisatellite' regions in human

DNA. Nature 314: 67-73.

Jeffreys, A. 1., Wilson, V. and S. L. Thein. 1985b. Individual-specific "fingerprints" ofhuman DNA.

Nature 316: 76·79.

1effreys, A. J., BrookfieId, 1. F. Y. and R Semenoff 1985c. Positive identification of an

immigration test-case usÎDg buman DNA fingerprints. Nature 317: 818-819.

106 Jeffreys, A. 1. and D. B. Morton. 1987. DNA fingerprints ofdogs and cats. Anim. Genet. 18: 1-15.

Jeffreys, A. J., Wilson, V.. Kelly, R., Taylor, B. A. and G. Bulfield. 1987. Mouse DNA

··fingerprints": analysis ofchromosome localization and germline stability ofhypervariable

loci in recombinant inbred strains. Nucleic Acids Res. 15: 2823-2836.

Jivoff, P. 1997. The relative roles of predation and sperm competition on the duration of the

post-copulatory association between the sexes in the blue crab. Callinectes sapidus. Behav.

Ecol. Sociobiol. 40: 175-186.

Jivoft: P. In press. Sexual competition among male blue crab, Ca//inectes sapidus. Biol. Bull. 193.

JivotI: P. and Hines, A.H. In press. Fc:male behaviour, sexual competition and mate-guarding

in the blue crab, Callinectes sapidus. Anim. Behav.

Johnson, C. 1982. Multiple insemination and sperm storage in the isopod, Vene=i//o evergladensis

(Schultz 1963). Crustaceana 42: 225-232.

Jones, D. R. and R. G. Hannol!. 1997. Mate selection and mating behaviour in Spider crabs. Estuar.

Coast. Shelf. Sei. 44: 185-193.

Juanes, F. and L. D. Smith. 1995. The ecological consequences oflimb damage and loss in decapod

crustaceans: a review and prospectus. J. Exp. Mar. Biol. Ecol. 193: 197·223.

Kazmi, Q.B. and N. M. Tirmizi 1987. An unusual behaviour in box crabs (Deca~ Brachyura.,

Calappidae). Crustaceana 53: 313-314.

Kirby, L. T. 1990. DNA Fingerprinting: An Introduction. Stockton Press. New York. 365 pp.

Koga, T., Henmi, Y. and M. Murai. 1993. Sperm competition and the assurance ofunderground

copulation in the sand-bubbler crab Scopimera g/obosa (Brachyura: Ocypodidae). J.

Crustacean Biol. 13: 134-137.

107 Knuckey, I.A. 1996. Maturity in male mud crabs, Scylla serrata, and the use ofmating scars as a

functional indicator. 1. Crustacean Biol. 16: 487-495.

Koga, T., Henmi, Y., and M. Murai. 1993. Sperm competition and the assurance ofunderground

copulation in the sand-bubbler crab Scopimera globosa (Brachyura: Ocypodidae). 1.

Crustacean Biol. 13: 134-137.

Langeron, M. 1949. Précis de microscopie, Tome 1. Masson, Paris, 720 p.

Laws, E.A. and J. W. Archie. 1981. Appropriate use ofregression analysis in marine biology. Mar.

Biol. 65: 13-16.

Lee, S. Y. and R. Seed. 1992. Ecological implications ofcheliped size in crabs: sorne data frorn

Carcinus mae,:as and Liocarcinus holsatus. Mar. Ecol. Prog. Ser. 84: 151-160.

Levinson, G. and G.A. Gutman. 1987. Slipped-strand mispairing: A major mechanism for DNA

sequence evolution. Mol. Biol. Evol. 4: 203-221.

Lindahl, T. 1994. DNA repair. DNA surveillance defect in cancer cells. Curr. Biol. 4: 249-251.

Lindberg, W. J. 1980. Behavior of the Oregon mud crab, Hemigrapsus oregonensis (Dana)

(Brachyura, Grapsidae). Crustaceana 39: 263-281.

Litt, M. and J. A. Luty. 1989. A hypervariable microsatellite revealed by in vitro amplification of

a dinucleotide repeat within the cardiac muscle aetin gene. Amer. J. Human Genet. 44: 387­

401.

Longmire, J. L., Kraemer, P. M., Brown, N. C., Hardekopt: L. C. and L. L. Daeven. 1990. A new

multi-locus DNA tingerprinting probe: pV47-2. Nucleic Acids Res. 18: 1658.

Meng, A, Carter, R. E. and O. T. Parkin. 1990. The variability ofDNA fingerprints in three species

ofswan. Heredity 64: 73-80.

108 Messier, W. Li, S. H. and C. B. Stewart. 1996. The birth ofmicrosatellites. Nature 381: 483.

Miller, P. L. 1995. Spenn competition and penis structure in sorne libellulid dragonflies

(Anisoptera). Odonatologica 24: 63-72.

Muller, von K. 1983. Population biology, activity rythms and distribution ofUca tangeri (Decapoda,

Brachyura). Zoo1. lb. Syst. 110: 221-226.

Nakamura., Y., Leppert, M., D'Connell, P., Wolff, R., Holm, T., Culver, M.. Martin.. C., Fujimoto,

E., Hoff: M., Kuml~ E. and R. White. 1987. Variable Number ofTandem Repeats (VNTR)

Markers for Hurnan Gene Mapping. Science 235: 1616-1622.

Nakasone, Y., Akamine, H. and K. Asato. 1983. Ecology ofthe fiddler crab Uca vocans vocans

(Linnaeus) (Decapoda: Ocypodidae) II. Relation between the mating system and the drove.

Galaxea 2: 119-133.

Nelson, K. and D. Hedgecock. 1977. Electrophoresis evidence ofmultiple paternity in the lobster

Homarus americanus (Milne-Edwards). Am. Nat. Il: 36 i -365.

Nye, P. 1977. Reproduction, growth and distribution ofthe grapsid crab Helice crassa (Dan~ 1851)

in the southem part ofNew Zealand. Crustaceana 33: 75-89.

Orensanz, lM., and V. F. Galluci. 1988. Comparative study ofpostlarvallife-history schedules in

four sympatric species ofCancer (Decapoda: Brachyura: Cancridae). J. Crustacean Biol. 8:

187-220.

Orensanz, lM., Panna, A.M., Annstrong, D.A., and P. Wardrup. 1995. The breeding ecology of

Cancer gracilis (Crustacea: Decapoda: Cancridae) and the mating system ofcancrid crabs.

J. Zool. (Land.) 235: 411-437.

Parker, G.A 1970. Sperm competition and its evolutionary consequences in the insects. Biol. Rev

109 45: 525-567.

Pardue~ M. L. and 1. G. Gall. 1970. Chromosomal Localization ofMouse Satellite DNA. Science

168: 1356.

Paul, A. 1. 1984. Mating frequency and viability ofstored sperm in the tanner crab Chionoecetes

bairdi (Decapoda, Majidae). 1. Crustacean Biol. 4: 374-381.

Paul, A. J., Adams, A. E.~ Paul~ J. M, and H. H. Feder. 1983. Sorne aspects of the reproductive

biology ofthe crab Chionoecetes bairdi. University ofAlaska Sea Grant Rep. 83-1.

Paul, A. 1., Paul, 1. M, and W. E. Donaldson. 1995. Shell condition and breeding success in Tanner

crabs. 1. Crustacean Biol. 15: 476-480.

Paul, A.1. and 1. M. Paul. 1996. Observations on mating of multiparous Chionoecetes bairdi

Rathbun (Decapoda: Majidae) held with different sizes ofmales and one-clawed males. J.

Crustacean Biol. 16: 295-299.

Pearso~ W. and B. Olïa. 1977. Chemoreception in the blue crab Cailinectus sapidus. Biol Bull. 151:

346-354.

Reid, D.G., Abello, P., Kaiser, M.J., and C. G. Warman. 1997. Carapace calout, inter-moult

duration and the behaviouraI and physiological ecology ofthe shore crab Carcinus maenas.

Est. Coast ShelfSei. 44: 203-211.

Ricker, W.E. 1984. Computation and uses ofcentral trend lînes. Cano 1. Zool. 62: 1897-1905.

RidIey, M 1983. The explanation oforganic diversity. The comparative method and adaptations for

mating. Clarendon Press, Oxford. 272 p.

Riedy, MF., Hamilton, W. 1. and C. F. Aquadro. 1992. Excess ofnon-parental bands in offspring

from known primate pedigrees assayed using RAPD peR. Nuel. Acids Res. 20: 918.

110 Rogstad, S. H., Patton, J. C., and B. A. Schaal. 1988. Ml3 repeat probe detects minisatellite-like

sequences in gymnosperms and angiospenns. Proc. Nat!. Acad. Sei. USA 85: 9176-9178.

Rubenstei~ D. 1. 1989. Sperm competition in the water strider, Gerris remigis. Animal Behav. 38:

631-636.

Ryan, E. P. 1966. Pheromones: evidenee in a deeapod crustacean. Science 151: 340-341.

Ryan, E. P. 1967. Structure and function of the reproductive system of the crab Portunus

sanguino/entus (Herbst) (Brachyura: Portunidae). L The male system, p. 506-521. ln

Proceedings ofthe Symposium on Crustaeea, Emakulam. Part m. Mar. Biol. Assoc. Indi~

Bangalore Press, Bangalore, India.

Ryskov, A. P., Jincharadze, A. G., Prosnyak, M. I., Ivanov, P.L. and S. A. Limborska. 1988. M13

phage DNA as a universal marker for DNA fingerprinting of animais, plants and

microorganisms. FEBS Letters 233: 388-392.

Sainte-Marie, B. 1993. Reproductive cycle and fecundity ofprimiparous and muJtiparous female

snow crab, Chionoecetes opilio, in the Nonhwest Gulf of Saint Lawrence. Cano 1. Fish.

Aquat. Sei. 50: 2147..2156.

Sainte-Marie, B. 1997. Comment - An improved Hnk between industry, management and science:

review ofcase history ofthe southwestem GulfofSt. Lawrence snow erab fishery. Cano J.

Fish. Aquat. Sei. 54: 496-500.

Sainte-Marie, B. and F. Hazel. 1992. Moulting and mating ofsnow crabs, Chionoecetes opilio (O.

Fabricius), in shallow waters of the nonhwestem Gulf of Saint Lawrence. Cano 1. Fish.

Aquat. Sei. 49: 1282-1293.

Sainte-Marie, B. and G. A. Lovrich. 1994. Delivery and storage ofsperm at tirst mating offemale

III Chionoecetes opi/io (Brachyura: Majidae) in relation to size and morphometric maturity of

male parent. J. Crustacean Biol. 14: 508·521.

Sainte·Marie~ B., and C. Carrière. 1995. Fertilization of the second clutch of snow crab,

Chionoecetes opilio, mated once or twice after their molt to maturity. Fish. Bull. V.S. 93:

758-763.

Sainte-Marie, B. and R. Dufour. 1995. Crabe des neiges de l'estuaire et du nord du golfe du

Saint-Laurent, pp. 2-27. In Savard., L. (ed.), Rapport sur l'état des invertébrés en 1994:

crustacés et mollusques des côtes du Québec, crevette nordique et zooplancton de l'estuaire

et du golfe du Saint·Laurent. Rapp. manus. cano sei. halieut. aquat. 2323.

Sainte-Marie, B. and J. -M. Sévigny. In review. Evidence for sperm limitation in the snow crab

(Chionoecetes opi/io). rCES J. Mar. Sei.

Sainte-Marie, B., Raymond, S., and J. -Co Brêthes. 1995. Growth and maturation of the benthic

stages ofmale snow crab, Chionoecetes opi/io (Brachyura: Majidae). Cano 1. Fish. Aquat.

Sei. 52: 903-924.

Sainte-Marie, B; Sévigny, J.·M., and Y. Gauthier. 1997. Laboratory behavior ofadolescent and adult

males ofthe snow crab (Chionoecetes opi/io) (Brachyura: Majidae) mated noncompetitively

and competitively with primiparous females. Cano 1. Fish. Aquat. Sei. 54: 239·248.

Salmon., M. 1965. Waving display and sound production in Uca pugi/ator Bosc, with comparisons

to U. minax and U. pugnax. Zoologica 50: 123-150.

Salmon., M 1971. Signal characteristics and acoustic detection by tiddIer crabs, Uca rapax and Uca

pugilator. Physiol. Zool. 44: 210-224.

Salmon, M. 1984. The counship, aggression and mating system ofa "primitive" fiddler crab (Uca

112 vocans: Ocypodidae). Trans. Zool. Soc. London 37: 1-50.

Salmon, M. 1987. On the reproductive behavior ofthe fiddler crab Uca thayeri~ with comparisons

to LZ pugilator and U. vocans: evidence for behavioral convergence. 1. Crustacean Biol. 7:

25-44.

Salmon, M. and S. P. Atsaides. 1968. Visual and acoustic signaling during courtship by fiddler crabs

(genus Uca). Amer. Zoo1. 8: 623-639.

Sambrook~ J., Fritsch, E., and T. Maniatis. 1989. Molecular cIoning: a laboratory manual~ 2nd

edition. CoId Spring Harbor Laboratory, Cold Spring Harbor, NY.

Sanger, F., Nicklen, S. and A.R Coulson. 1977. DNA sequencing with chain tenninating inhibitors.

Proc. Nat!. Acad. Sei. USA 74: 5463-5467.

Sassam~ C. 1978. Mating system in porcellionid isopod: Multiple paternity and spenn mixing in

Porcel/io scaher (Latr). Heredity 41: 385 ...397.

Savage, T. 1971. Mating of the stone crab, Menippe mercenaria (Say) (DecaPOda, Brachyura).

Crustaceana 20: 315-316.

Seipie, W. and M. Salmon. 1982. Comparative social behavior of two grapsid crabs, Sesarma

reticu/atum (Say) and S. cinereum (Bosc). J. Exp. Mar. Biol. Ecol. 62: 1-24.

Sekkelsten, G.!. 1988. Effect ofhandicap on mating success in male shore crabs Carcinus maenas.

Oikos 51: 131-134.

Sévigny, J. ...M, and B. Sainte-Marie. 1996. Electrophoretic data support the last...male spenn

precedence hypothesis in the snow crab, Chionoeceles opi/io (Brachywa: Majidae). J.

Shellfish Res. 15: 437-440.

ShlOtterer, C. and D. TaU1Z. 1992. Slippage Syntbesis ofSimple Sequence DNA Nucleic Acids Res.

113 20: 211-215.

Schone, H. and H. Schone. 1963. Courtship and other behavior ofthe mangrove crab Goniopsis

cruenata Latr. And beckoning behavior ofthe eulitoral brachyura. Z. Tierpsychol. 20: 641­

656.

Silas, E. G. and C. Sankarankutty. 1967. Field investigations on the shore crabs of the Gulf of

Manner and Palk Bay, with special reference to the ecology and behavior ofthe pellet crab

Scopimera proxima Kemp. Mar. Biol. Assoc. India Symp. Ser. 2(3): 1008-1025.

Sinclair, M. E. 1977. Agonistic behavior of the stone crab, Menippe mercenaria (Say). Anim.

Behav. 25: 193-207.

Siva-Jothy, M. T. and R. E. Hooper. 1995. The disposition and genetic diversity ofstored sperm in

females ofthe damselfly Ca/opteryx sp/endens xanthostoma (Charpentier). Proc. R. Soc.

Lond. 8 259: 313-318.

Smith, M. 1963. Deoxyribonucleic acids in crabs of the genus Cancer. Biochem. Biophys. Res.

Commun. 10: 67..72.

Smith, R. L. 1979. Repeated copulation and sperm precedence: patemity assurance for a male

brooding water bug. Science 20S: 1029.. 1031.

Smith, L.D. 1992. The impact of limb autotomy on mate competition in blue crabs Cai/inectes

sapidus Rathbun. Oecologia 89: 494-501.

Smi~ J.P., Huntingford, F.A., Atkinson, R.I.A., and A. C. Taylor. 1994. Mate competition in the

velvet swimming crab Necora puber: etfects ofperceived resource value on male agonistic

behavior. Mar. Biol. 120: 579...585.

Snedden, W. A. 1990. Determinants ofmale mating success in the temperate crayfish Orconectes

114 rusticus: chela size and sperm competition. Behaviour 115: 100-113.

Southern, E. M. 1975. Detection of specifie sequences among DNA fragments separated by gel

electrophoresis. J Mol. Biol. 98: 503-527.

Stallings, R. L., Ford, A. F., Nelson, D., Tomey, D.C., Hildebrand, C.E. and R.K. Moyzis. 1991.

Evolution and distribution of(GT)n repetitive sequences in mammalian genomes. Genomics

10: 807-815.

Stevens, B.G., Donaldson, W.E., Haaga, JA., and J E. Munk. 1993. Morphometry and maturity of

paired tanner crabs, Chionoecetes bairdi, from shaJlow- and deepwater envrionments. Cano

J. Fish. Aquat. Sei. 50: 1504-1516.

Stevens, B.G., Haaga, JA., W. E. Donaldson. 1994. Aggregative mating of Tanner crabs,

Chionoecetes bairdi. Cano J Fish. Aquat. Sei. 51: 1273-1280.

Strand, M., Pralla, T. A., Liskay, R. M. and T. D. Petes. 1993. Destabilization oftraets ofsimple

repetitive DNA in yeast by mutations affecting DNA mismateh repair. Nature 365: 274-276.

Stephan, W. and S. Cha. 1994. Possible Role ofNaturaI Selection in the Formation ofTandem­

Repetitive Noncoding DNA. Genetics 136: 333-341.

Sueoka, N. and T. Y. Cheng. 1962. Natural occurrence ofa deoxyribonucleic acid resembling the

deoxyadenylate-deoxythymidylate polymer. Proc. Nat!. Acad. Sei. USA 48: 1851-1856.

Swartz, R. C. 1978. Reproductive and molt cycles in the xanthid crab, Neopanope sayi (Smi~

1869). Crustaeeana 34: 1532.

Tarn, Y. K. and 1. Kornfield. 1996. Characterization of microsatellite markers in Homarus

(Crustacea, Decapoda). Mol. Mar. Biol. Biotechnol. 5(3): 230-238.

Tautz, O. 1989. Hypervariability ofsimple sequences as a general source for polymorphie DNA

115 markers. Nucleic Acids Res. 176463-6471.

Taylor, D. M., Hooper, R. G., and G. P. Ennis. 1985. Biological aspects of the spring breeding

migration ofsnow crabs, Chionoecetes opi/io, in Bonne Bay, Newfoundland (Canada). Fish.

Bull. U.S. 83: 707-711.

Urbani, N., Sévigny, J.wM., SaïntewMarie, B., Zadwomy, D., and U. Kuhnlein. 1998. Identification

ofmicrosatellite markers in the snow crab Chionoecetes opi/io. Mol. Ecol. 7: 357-358.

Urbani, N., Sainte-Marie, B., Sévigny, J-M., Zadwomy, D., and U. Kuhnlein. In press. Sperm

competition and paternity assurance during the first breeding period offemale snow crab

Chionoecetes opi/io (Brachyura: Majidae). Cano 1. Fish. Aquat. Sei.

Valdes, A. M., Sla~ M. and N. B. Freimer. 1993. AJlele Frequencies at Microsatellite Loci: The

Stepwise Mutation Model Revisited. Genetics 133: 737w749.

Van der Meeren, G.r. 1994. Sex- and size..

crabs Carcinus maenas. 1. Anim. Ecol. 63: 307-314.

Vassart, G., Georges, M., Monsieur, R., Brocas, H., Lequarre, A. S. and D. Christophe. 1987. A

sequence in M13 phage deteets hypervariable minisatellites in human and animal DNA.

Science 235: 683-684.

Verheyen, G. R., Kempenaers, B., Burke, T., Van den Broeck, M., Van Broeckhoven, C., and A.

Dhondt 1994. Identification ofhypervariable single locus minisatellite DNA probes in the

blue tit Parus caeruJeus. Mol. Ecol. 3: 137-143.

Waage,1. K. 1979. Dual function ofthe damselfly penis: sperm removal and transfer. Science 203:

916·918.

Wamer, G. f. 1967. The life history ofthe mangrove tree crab, Aratus pisoni. 1. Zool. London 153:

116 321-335.

Wamer, G. F. 1970. Behavior of two species of grapsid crab during intraspecific encounters.

Behaviour 36: 6-19.

Watso~ 1. 1970. Maturity, mating, and egg-laying in the spider crab, Chionoecetes opi/io. 1. Fish.

Res. Board Ca. 27: 1607-1616.

Watso~ 1. 1972. Mating behavior in the spider crab~ Chionoecetes opilio. J. Fish. Res. Board Cano

29: 447-449.

Weber, 1. L. and P. E. ~tay. 1989. Abundant class ofhuman DNA polymorphisms which can be

typed using the polymerase chain reaetion. Amer. 1. Human Genet. 44: 388-396.

Wilber, D.H. 1989. Reproductive biology and distribution ofstone erabs (Xanthidae, Menippe) in

the hybrid zone on the northeastem Gulf ofMexico. Mar. Ecol. Prog. Ser. 52: 235-244.

Wilber, D.H. 1995. Claw regeneration among North Florida stone crabs (genus Menippe) and its

implications to the southwest Florida fishery. Bull. Mar. Sei. 56: 296-302.

Wright, J. M. 1994. Mutation at VNTRs: Are minisatellites the evolutionary progeny of

microsatellites? Genome 37: 345-347.

Winz, P. and R Diesel. 1983. Social structure ofInachus phalangium., a spider crab associated with

the sea anemone Anemonia su/cata. Z. Tierpsychol. 62: 209-234.

Wong, Z., Wilson, V., Patel, L, Povey, S. and A. 1. Jeffreys. 1987. Characterization ofa panel of

highly variable minisatellites c10ned from human DNA. ADn Hum. Genet. 51: 269-288.

Yamaguchi, T. 1971. Courtship behavior ofa fiddIer crab, Uca /actea. Kumamoto 1. Sei. Biol. 10:

13-37.

Yamaguchi, T. and Y. Noguchi. 1979. Studïes ofthe courtship behavior and copulation ofthe sand

117 bubbler crab, Scopimera g/obosa. Publ. Amakusa Mar. Biol. Lab. 5( 1): 34-44.

Zeh, D. W., Zeh, 1. A., Coffroth M. A. and E. Bermingham. 1992. Population...specific DNA

fingerprints in a neotropical pseudoscorpion (Cordylochernes scorpioides). Heredity 69:

201-208.

Zucker, N. 1983. Courtship variation in the neo-tropical fiddIer crab Uca deichmanni: another

example offemale incitation to male competition? Mar. Behav. Physiol. 10: 57-79.

118