MULTIPLE PATERNITY: A LIFE-HISTORY STRATEGY FOR PORCELAIN IN THE FACE OF RISING TEMPERATURES

A Thesis submitted to the faculty of San Francisco State University In partial fulfillment of the requirements for A 5 the Degree 3 G a o ik Master of Science In

Biology: Marine Biology

by

Thomas Joseph Yockachonis

San Francisco, California

May 2016 Copyright by Thomas Joseph Yockachonis 2016 CERTIFICATION OF APPROVAL

I certify that I have read MULTIPLE PATERNITY: A LIFE-HISTORY STRATEGY FOR PORCELAIN CRABS IN THE FACE OF RISING TEMPERATURES by Thomas Joseph Yockachonis, and that in my opinion this work meets the criteria for approving a thesis submitted in partial fulfillment of the requirement for the degree Master of Science in Biology: Marine Biology at San Francisco State University.

Jon i.D. Pro

Eri Professor of Biology

Frank Cipriano, Ph.D Professor of Biology MULTIPLE PATERNITY: A LIFE-HISTORY STRATEGY FOR PORCELAIN CRABS IN THE FACE OF RISING TEMPERATURES

Thomas Joseph Yockachonis San Francisco, California 2016

Multiple paternity is widespread across many taxa including birds, insects and marine species. Despite multiple paternity being rare among studied , a study found that -93% of female porcelain crabs, cinctipes, mate with more than one male and produce broods of mixed paternity. No explanation has been given to the reason of why multiple paternity is prolific in P. cinctipes, or what function polyandry may serve for crabs in general to my knowledge. In order to identify potential advantages of multiple paternity in P. cinctipes, brood survival differentials were measured under ambient conditions and after a heat-shock. Microsatellite profiling was used to distinguish multiple from single paternity and compared to brood survival, in the presence or absence of a heat- shock. When exposed to a heat-shock, single-sired broods experience a significant drop in mean brood hatching %, compared to multiply-sired broods. Multiply sired broods also show a substantial, but non-statistically significant, mean difference in mean hatching % between conditions, compared to single-sired broods. Results suggest that multiple paternity reduces embryo survival variance between ambient and heat-shock conditions and that multiple mating could be an advantage for P. cinctipes in the high-intertidal zone.

I certify 1 correct representation of the content of this thesis.

Chair, Thesis Committee Date ACKNOWLEDGEMENTS

I would like to thank my advisor, Jonathon Stillman, for giving me the opportunity to fulfill one of the greatest accomplishments of my life thus far. He has provided me the freedom to explore my research interests and his guidance has enabled me to develop my scientific skill-set. Because of his efforts, I have been able to obtain the career I have been seeking for the past seven years. I would also like to thank my supporting thesis committee members, Eric Routman and Frank Cipriano, for their guidance and direction in editing this document. My lab mates Eric, Lindsay, Emily K., Jennifer and lab-tech Adam of course deserve much appreciation for their stable humor and help when I could not come to RTC. I want to express immense gratitude to Seabird McKeon, the most important mentor of my college career. Thank you first of all for funding the vast majority of my graduate research. Also, thank you for allowing me assist on expeditions to Belize when I needed it most and for supporting me academically for the past five years. I would also like to thank my mentors at the Smithsonian, Amanda Windsor and Michele Weber. 1 appreciate you helping me develop my molecular skills, design an experimental approach and for your friendship. 1 also need to thank a fellow Navy EOD Tech and friend, Ike Kanakanui. Our adventures across Sicily by car and many islands aboard “The Freedom Boat” are some of my most valued memories, and taught me to follow my passion. Lastly, I must thank my soon-to-be wife, Katrina Eichner, for her love, patience and loyalty throughout my time in college. You are my biggest source of personal motivation to better myself in every way. Without you, I most likely would have never finished grad-school and 1 would be living in a remote part of a foreign country with no shoes or professional direction.

v TABLE OF CONTENTS

List of Tables...... viii List of Figures...... ix List of Appendices...... x 1.0 Introduction...... 1 2.0 Materials and Methods...... 14 2.1 Porcelain Collection and Heat-shock Treatment ...... 14 2.2 Identification of Multiple Paternity...... 16 2.2.1 Embryo Preservation...... 16 2.2.2 Tissue Digestion & DNA Extraction...... 16 2.2.3 PCR Amplification...... 17 2.2.4 Fragment Analysis...... 18 2.2.5 Quantifying paternity...... 19 2.3 Statistical Analysis...... 20 3.0 Results...... 22 3.1 Control hatching % by brood...... 22 3.2 Heat-shock Effect...... 23 3.3 Overall brood hatching %: MP vs. SP...... 24

3.4 Mean overall hatching %: MP vs. SP ...... 25 3.5 Mean Proportional hatchings by treatment: MP vs. S P ...... 26 3.6 Brood Hatching % Differences (NHS-HS)...... 27 3.7 Mean Differences in Mean Hatching % ...... 28 4.0 Discussion 29 4.1 Heat-shock Effect...... 29 4.2 Effect of Multiple Paternity: Ambient and HS Conditions...... 30

4.3 Multiple Paternity and Survival Variance...... 31 4.4 Conclusions...... 32 4.5 Future Directions...... 32 References...... 34 Appendices...... 38

vii LIST OF TABLES

Table

1. Primer sequences: Loci Pc 156s and Pc 170s LIST OF FIGURES

Figure Page

1. Low tide habitat temperatures of P. cinctipes and P. eriomerus...... 5 2. Thermal survival of P. cinctipes and P. eriomerus...... 6 3. Multiple mating: Geometric mean and survival...... 10 4. Multiple mating: Variance and direct fitness gains...... 12 5. No heat-shock hatching % by brood...... 21 6. Heat-shock effect of mean brood hatching %...... 22 7. Overall survival by brood: Multiple vs. Single Paternity...... 23 8. Mean brood overall survival: Multiple vs. Single Paternity...... 24 9. Mean hatching % by heat-shock treatment: Multiple vs. Single Paternity...... 25 10. Brood survival differences between heat-shock treatments...... 26 11. Mean brood survival differences: Multiple vs. Single Paternity...... 27 LIST OF APPENDICES

Appendix 1. Confirmed multiple paternity through fragment analysis 1

1.0 Introduction

Stress variation occurs naturally in the earth’s climate system over a range of

temporal scales, such as annually, seasonally and daily. This stress variability is reflected

in species’ present evolutionary adaptations and can be observed through small and large

scale patterns of biogeography (Harley et al. 2006) and physiological response under a

shifting physical stress, such as temperature (Helmuth and Hofmann 2001). An thermal

stress is a temperature that when changed, alters organismal physiological processes and

causes a clear drop in reproductive yield (Hoffmann and Hercus 2000). For a species to

have adaptive potential to thermal stress, intraspecific variability in fitness related traits

must exist, as variability is essential to evolution (Darwin and Bynum 2009). Therefore,

identifying contributing factors that affect variation in fitness between changing temperatures, is central to understanding a species' capability to survive a thermal stress.

Examples of such factors that affect fitness variation between shifting environments

include mutation-selection balances (Turelli 1984; Turelli 1985), genotype by environment interactions (GxE) and mechanisms that maintain genetic variation

(Gillespie and Turelli 1989).

Genetic variability is recognized by the World Conservation Union as one of three levels of biodiversity warranting conservation; the first reason for this level of importance is that populations depend upon genetic diversity to evolve in reaction to stress (McNeely et al. 1990; Reed and Frankham 2003). Identifying current, contributing sources of 2

genetic variation can aid in detecting vital components to inspect in the unpredictable

future. One life-history strategy that contributes to genetic diversity is multiple mating by

female (multiple paternity or polyandry).

Multiple paternity remains one of the most controversial sexual strategies (Yasui

1997). Male fitness increases with increased matings through increased egg fertilization,

but female advantages to multiple mating remain difficult to prove because they usually

require multi-generational breeding designs (Philippi and Seger 1989; Jennions and Petrie

2000; Whittingham and Dunn 2010). In fact, the increased energetic demands and

predation risks associated has led to polyandry being termed a “conundrum”, being that it

is widespread across many taxa and lacks evidence to its benefits (Jennions and Petrie

2000). If direct material benefits are absent there must be indirect-genetic benefits to

“offset the costs” of polyandry, which persists in the population by raising mean offspring fitness above that of single-mating females (Jennions and Petrie 2000).

One of the proposed benefits of multiple mating is increased genetic diversity of the offspring as a form of “bet-hedging” (Jennions and Petrie, 2000). Bet-hedging has two hypothetical advantages to females: 1) a reduced chance of being fertilized by inferior males, and 2) a reduced chance that all fertilized eggs are unsuitable to the environment (Fox and Rauter 2003). Bet-hedging is a mating strategy that becomes beneficial in the long-term by minimizing fitness variance between environmental 3

conditions, and raising geometric mean fitness across generations within a population

(Philippi and Seger 1989). Because bet-hedging is usually advantageous only over longer time-scales, and confusion exists over how to evaluate this strategy, it is difficult to show evidence to its benefits (Simons 2009). Optimality is rarely able to be evaluated in a single generation, and even over longer time scales, it remains challenging (Simons

2011). The intrinsic difficulties that accompany bet-hedging studies have led to a lack of attention to this strategy’s potential benefits (Hopper 1999). Bet-hedging could potentially be an essential strategy in environmental stress response for polyandrous species (Simons 2011). Bet-hedging traits being difficult to recognize, and relative lack of attention to this tactic, have led to uncertainty about the proliferation of bet-hedging in animals (Simons 2011).

The intertidal zone is considered to be one of the “most physically harsh environments on earth” (Tomanek and Helmuth 2002). Temperature is among the strongest influential forces in shaping distribution and physiological performance of communities within the intertidal zone (Helmuth and Hofmann 2001). Within the intertidal, vertical micro-habitats are often fixed by the upper thermal tolerance limits of the species and the degree of stress variation endured during the tidal cycle (Somero

2002). Intertidal organisms live closer to habitat temperature maxima than subtidal species and could be at greater risk to increased thermal stress (Stillman 2002). Creatures 4

that live in this habitat reflect the intensity and variability of the stresses that have shaped their evolutionary adaptations.

The , Petrolisthes cinctipes (Randall 1839), aggregate under rocks in the upper intertidal on the west coast of California. The , Petrolisthes, exhibits high diversity in phenotypic response to current stresses in species-specific gradients across the littoral zone (Stillman and Somero 1996; Stillman 2002). Diversity of genotypic and phenotypic traits, likely played a large role in shaping the range of stress adaptations present in P. cinctipes. Upper-intertidal species in the northeastern Pacific coast, such as P. cinctipes, endure temperature ranges from 0-32°C annually whereas species inhabiting the lower intertidal zone, such as Petrolisthes eriomerus (Stimpson

1871), experience more narrow ranges (Fig 1) and have less ability to tolerate thermal stress (Fig 2) from tidal flux compared to P. cinctipes. These studies highlight that microhabitat stresses are echoed in the adaptations of Petrolisthes, and it is likely that variability of genotype and phenotype is advantageous for this genus when challenged with broad intertidal stress. To put it simply, it would make sense that when encountering fluctuating stress, having increased modes of response could be beneficial. 5

Fig. 1. Habitat temperatures for Petrolisthes cinctipes and Petrolisthes eriomerus during low tide at Cape Arago, OR, USA on 18 May 1995 (A) and 19 May 1995 (B). Maximum habitat temperatures were 31.2°C on 18 May (A) and 24°C on 19 May (B) (Stillman and Somero 1996). 6

if ie 2% tem perature (°C)

Fig. 2. Thermal stress experiment for 4 specimens each of Petrolisthes cinctipes and Petrolisthes eriomerus. Experiment contained 3 treatment temperatures of 15°C, 20°C and 25°C. Bar graphs represent average time (hours) each species survived at each temperature. It is clear that the high intertidal P. cinctipes is able to endure longer durations at higher temperatures, compared to the low intertidal P. eriomerus (Jensen and Armstrong 1991).

Gravid female P. cinctipes extrude eggs that are brooded throughout embryogenesis underneath the abdomen. Early life-stages are considered particularly sensitive to acute variations in temperature (Calosi et al. 2013). Metabolic depression is described as an effective short-term response to stress but is potentially detrimental if 7

sustained as prolonged basal maintenance in embryos can cause delayed metamorphosis,

creating a bottleneck in ontogeny and potentially effecting population fitness (Gebauer

,Paschke and Anger 1999). Stressors such as temperature can be important factors

enabling adaptation of populations to harsh, fluctuating environments. With extreme

environmental change, increased stress-induced variation in phenotype and genotype is

frequently directional and directed by developmental pathways, which considerably

enables adaptive evolution (Badyaev 2005).

It is well recognized, especially in embryological studies, that environmental

stress and genetics structure organismal adaptation to unpredictable conditions (Badyaev

2005). One study of embryonic P. cinctipes noted significant variation in rate of oxygen

consumption in response to low pH, with metabolic reduction ranging from 20-65%

(Carter et al. 2013). Likewise, Ceballos-Osuna et al. (2013) observed wide-ranging

hatching success (30-95% of embryos) across broods of P. cinctipes, regardless of

ambient or low pH treatment. These studies note significantly higher phenotypic variation

between clutches compared to within clutches which is thought to be evidence of genetic

factors influencing clutch phenotypic similarity (Carter et al. 2013). In many

investigations, study focus usually falls on mean phenotype, and variation is regarded as clamor, when this variation could be attributed to genetic differences between individuals

(Reusch 2014). 8

A classic model of theory (Cohen 1966) describes that in unpredictable

environments, females gain a significant fitness advantage by producing offspring with

phenotypic variation. It is reasonable to assume that the high levels of intraspecific

phenotypic variation present in P. cinctipes embryos (Carter et al. 2013; Ceballos-Osuna

et al. 2013) could be explained by varying amounts of genetic information within and

between clutches. There is genetic evidence that shows a high percentage of P. cinctipes

females mate with multiple males (polyandrous) and produce broods of mixed paternity

(Toonen 2004). Paternity investigations for crabs are sparse (Diesel 1990; Koga ,Henmi

and Murai 1993), and of the few species investigated, multiple paternity appears to be

rare (Urbani et al. 1998; Toonen 2004). The frequency of multiple paternity in P.

cinctipes is estimated to be ~ 92.5% for the Bodega Bay, California population (Toonen

2004). Because of the rarity of paternity studies in crustaceans, it is unknown whether

this frequency of polyandry is uniquely high for crabs. Multiple paternity adds genetic

diversity into the brood which could potentially increase phenotypic variation, and be

beneficial under shifting stresses. It seems possible that polyandry could be under strong

positive selection in P. cinctipes, aiding in adaptation to dynamic stresses present in the

high intertidal zone.

There is evidence that multiple paternity gives indirect-genetic benefits to polyandrous females. One study (Kempenaers et al. 1999) found that in tree swallows

(Tachycineta bicolor), nests that were of mixed paternity had significantly higher 9

hatching success vs. nests of single paternity. Polyandrous female swallows do not receive any direct benefits from mating multiply (e.g. food access, mate guarding), yet

70% of the nests sampled contained young of mixed paternity (Kempenaers et al. 1999).

In some insects, polyandry may produce direct net fitness gains of as much as 30-70%, observed through increased fertility and egg production (Arnqvist and Nilsson 2000). In some taxa, bet-hedging works differently by buffering fitness declines in uncertain environments, which is observed through decreased survival variance between shifting environments (Fox and Rauter 2003). For example, two populations of the milkweed bug,

Lygaeus kalmi, were raised on three different plant food sources (environments) and geometric mean survival and survival variance were calculated and compared between single-mated and twice-mated males (Fox and Rauter 2003). Fox and Rauter (2003) observed a consistent rise in geometric mean survival (Fig. 3a) and decrease in survival variance (Fig. 3b) for twice mated males across environments. This study is focusing on multiple mating males instead of females, but serves to show how the genetic bet-hedging hypothesis expects multiple-mating to increase geometric mean fitness over time, through decreased survival variance between environments (Fox and Rauter 2003). 10

Survival to 5 cl Survival to 10 d Survival to Adult A 0.7S H.7H #.65

ihlQ CL 60 SSS MS <> 0,1*5 «UMI Cl. 55 m n S3 CI.5S 0,50

I 11,511 0*4$ 0,45 0.40

11.40 0*35

o,3S & ». * *.... HM 4.... *.... i.... »■.....*—ii...i- f S * . f S I f S I * I* I I f s I * f % I Ki Dorado Berkeley El Dorado Berkeley El Dorati o Berkeley B IMW acm QM m & 0JM> 11.06 0.06 * C5cs #0 M .,*.... JL 1 ,Jl. i. i i. in, r s r « r s t f S I . f S I f s t * I % t El Dorado Berkeley El Dorado Berkeley El Dorado Berkeley Mated Once (3 Mated Multiply

Fig. 3. Shows variance in mean survival (A) and survival variance (B) comparing single matings to multiple matings for 2 populations of Lygaeus kalmii, raised on 3 food sources (f,s,t). Note the stable relationship between decreased survival variance and increased geometric mean fitness for twice-mated males (Fox and Rauter 2003). 11

Despite the challenges to identifying bet-hedging benefits in a single study, there is clear evidence of direct-fitness gain via bet-hedging, as seen in the Australian toadlet

(Pseudophryne bibron); here oviparous females deposit eggs across several male-made nests to spread mortality risk from desiccation, a stress that varies drastically and irregularly between nests (Byrne and Keogh 2009). Frogs that partitioned their eggs across several nests (more male fathers) experienced a significant decrease in survival variance (Fig. 4a), which would increase geometric mean fitness across generations

(Byrne and Keogh 2009). Oviparous females also gained a significant increase in mean offspring survivorship (Fig. 4b) by spreading eggs across many nest sites (Byrne and

Keogh 2009). 12

Fig.4. Offspring survivorship and number of nests used. The number of nests (males) used for egg deposition by female Australian terrestrial toadlets are plotted against (a) variance in tadpole survivorship and (b) mean tadpole survivorship. An example of direct fitness gains and decreased survival variance from multiple matings (Byrne and Keogh 2009). 13

Byme and Keogh (2009) highlight that desiccation risk varies by nesting site, which is chosen by the males of this species; the oviparous females therefore successfully challenge the unpredictable developmental environment by spreading mortality risk across several sites and many brood fathers. Byrne and Keogh (2009) verified high levels of multiple paternity by genotyping offspring using microsatellite analysis and found that nearly all broods were fertilized by more than one sire. This study is a great example of the bet-hedging strategy being used to prevent zero-survivability in unpredictable environments. It seems that this strategy might be similarly beneficial within the intertidal, and applicable to other core stresses, such as temperature. In P. cinctipes, high levels of multiple paternity have been verified (Toonen 2004) but no studies have focused on the effect of multiple paternity on fitness in this species, or in crabs in general to my knowledge. It is possible the polyandrous mating observed in P. cinctipes could be bet- hedging at work, to buffer fitness mean and variance in the unpredictable intertidal zone.

In this investigation, I examine hatching success of embryonic Petrolisthes cinctipes under ambient conditions and after a heat-shock to identify differences in fitness among broods and contrasting temperatures. Brood hatching success is compared to number of non-matemal alleles present in each brood through microsatellite analyses.

Creating the link between fitness and multiple paternity in this manner will give insight into the importance of polyandry for P. cinctipes, with and without heat stress. Because this study takes place in only one generation of embryos, I hypothesize that I will not 14

observe a direct increase in hatching success in polyandrous female offspring, but decreased hatching variance between ambient and heat-shock conditions.

2.0 Materials and Methods

2.1 Collection and Heat-shock Treatment

Gravid female porcelain crabs, Petrolisthes cinctipes, were collected by hand during low tides in April and May of 2015 from Pacifica, California (37.62°N,

122.49°W). Upon collection, females were placed in 7.5L coolers with 1L aerated seawater. Embryos were left undisturbed during collection and transported back to The

Romberg Tiburon Center and placed in seawater flow-through aquaria. Embryonic developmental stage was accessed in each clutch and broods in late development were selected (n=27) for experimentation and allowed to acclimate to ambient conditions

(temp: 12°C ± 0.5°, pH=8.0) for 24 hours, with embryos still attached to the respective females. After acclimation, embryos (n=24) from each female were randomly removed from the fringe of the egg mass. Half the embryos (n=12) were pipetted into a glass test- tube with lmL of 0.2pm filtered seawater and labeled HS (Heat-shock), and the remaining half (n=12 eggs) were pipetted into a separate glass test-tube with lmL of

0.2pm filtered seawater and labeled NHS (No Heat-shock). The HS tube (w/ n= 12 eggs) was exposed to a heat-shock treatment (30°C± 0.5° for 1 hour) and the other, NHS tube

(w/ n= 12 eggs) was exposed to ambient conditions (15°C± 0.2° for 1 hour). Treatment 15

tubes were positioned in a metal tube rack and placed in either the HS (30°C) or NHS

(15°C) cooler and a stopwatch was started for the 1 hour treatment. Incubation temperatures were monitored using a thermocouple and an iButton.

After 1 hour, HS & NHS tubes were removed from treatment coolers and taken to a temperature controlled room (15°C± 0.5°C). Embryos were removed from treatment tubes individually, assigned ID’s based on brood number (n= 1-27), embryo number (n=

1-24) and treatment category (HS & NHS). Embryos were then randomly assigned to sterile 96-well microplates (n=7) and individually pipetted into wells (1 embryo per well) with 300|il of 0.2|j.m filtered seawater. This was repeated for all broods (n=27) from late

April to mid-May. Microplates were stored in an incubator (12.5°C± 0.5°C) with a total of (648) embryos (27 broods/24 eggs per brood). All embryos were allowed to develop until either a hatching event occurred or mortality was observed. Microplates (n=7) were removed individually from incubator, and embryos were monitored through a dissection microscope every 48 hours. A successful hatch was defined as a visible intact larvae successfully emerged from egg casing. Mortality was defined as any condition that failed to yield a successful hatching. 16

2.2 Identification of Multiple Paternity

2.2.1 Preservation of Embryos

As embryos were being removed from broods for heat-shock treatments, ~ 50 embryos from each of the 27 broods were randomly removed and stored in 2mL collection tubes with 100 % ETOH. Also, a cheliped and leg was removed from the corresponding brood mother and stored in a 2mL collection tube with 100 % ETOH, in order to genotype the mother and matching brood embryos using microsatellite analysis.

2.2.2 Tissue Digestion and DNA Extraction:

Whole individual embryos were crushed in digestion buffer (total=200|nL) using autoclaved toothpicks and placed into labeled, individual Costar-plate wells. For mothers,

~ 5mg of muscle tissue was removed from the cheliped from each mother and placed in digestion buffer within labeled, individual Costar-plate wells. Tissue was digested for 24 hours prior to DNA extraction using 20pL Qiagen Proteinase K, 180pL Qiagen Lygase and incubated at 55°C during the 24 hour digestion period. DNA extraction was performed on embryos (n=l 1) from each brood (n=27) and each of the mothers (n=27), using an AutoGenprep 965 Automated DNA Isolation System

(http://www.autogen.com/automated-solutions/agp965/s) and following the manufactures

(AutoGen) procedure for extracting DNA

(http://www.autogen.com/assets/pdf/AutoGen%20ApGuide-965%20tissue.pdf). This 17

extraction method generated lOOpL of template DNA; 30|a.L of template DNA was

frozen as a working stock and the remaining 70|nL was frozen in a separate freezer as a

reserve stock. During the subsequent microsatellite analysis, only the original 30(aL of

working stock DNA template was needed.

2.2.3 PCR Amplification:

The primers used in this analysis were isolated following the procedure described

by Toonen (1997), using the ‘Microsatellites for Ecologists” protocol. Toonen (2001)

also describes the details on the isolation and characterization of the primers (Pci 56s and

Pci 70s) used to amplify the microsatellite loci used in this investigation.

Primer Primer sequence Pcl56sF TTGGCTTTGAAGACCCTGTGG Pcl56sR CGGGGGATCATTGCTTTGTC Pcl70sF TGGCCGTTGCTGTTGTTGTC Pcl70sR GGCACCAGTCATTCCCAGTTG

Table 1. Forward and reverse primer sequences for loci Pci 56s and Pci 70s.

For 96 (1 OjuL) samples, PCR reaction mixes contained: (500pL Qiagen HotStart

Master Mix, 30pL (F) primer, 30(iL (R) primer, 10|iL DMSO, 10pL BSA, 320(j.L H20). 18

Each PCR reaction plate contained 1 brood per 12 sample row (11 embryos plus mother), with 8 broods per reaction plate, for a total of 96 samples per reaction plate. Final PCR reaction volumes were 1 jliL of template to 9 pL of master mix for a total volume of 10 pL. Amplification of microsatellite loci was performed on a Perkin Elmer 9700 thermocycler. The touchdown PCR profile for Pcl56s was 94°C for 5 min; 2 cycles of:

94°C for 30 sec, 70°C for 30 sec, 72°C for 30 sec; 2 cycles of: 94°C for 30 sec, 68°C for

30 sec, 72°C for 30 sec; 2 cycles of: 94°C for 30 sec, 65°C for 30 sec, 72°C for 30 sec; 2 cycles of: 94°C for 30 sec, 63°C for 30 sec, 72°C for 30 sec; 30 cycles of: 94°C for 15 s,

60°C for 15 s, 72°C for 15 s; and a final extension of 72°C for 20 min. The touchdown

PCR profile for Pci 70s was 94°C for 5 min; 2 cycles of: 94°C for 30 s, 68°C for 30 s,

72°C for 30 s; 2 cycles of: 94°C for 30 s, 65°C for 30 s, 72°C for 30 s; 2 cycles of: 94°C for 30 s, 63°C for 30 s, 72°C for 30 s; 24 cycles of: 94°C for 15 s, 60°C for 15 s, 72°C for

15 s; and a final extension of 72°C for 20 min.

2.2.4 Fragment Analysis

In preparation for microsatellite fragment analysis, PCR product was prepared as a 1:20 dilution for Pcl56s (2pL PCR product to 38pLH20) and a 1:40 dilution for

Pci 70s (2|iL PCR product to 78pL H20). A 1:10 ROX standard dilution was prepared from the PCR product dilutions (lOpL PCR product dilution [Pci 56s 1:20 or Pci 70s

1:40] to 90 pL ROX standard) and submitted for fragment analysis on an Applied 19

Biosystems ABI 377 XL automated sequencer. Loci were scored using the microsatellite plugin on Geneious 8.1.6 (Appendix 1.).

2.2.5 Quantifying Paternity

Microsatellite loci Pci 56s and Pci 70s had 42 and 10 alleles, respectively, with heterozygosities of 0.87 and 0.55, respectively. In genotyping the embryos and corresponding mothers at these relatively polymorphic loci, the minimum number of male sires can be calculated. All brood offspring contained at least 1 maternal allele at both loci. Of course the genotypes of the male sires are unknown, and as describe by

Toonen (2004), I took the conservative approach in assuming all mothers mated with only heterozygous males. In assuming heterozygosity for all male sires, the minimum number of sires necessary to generate the distribution of alleles detected was estimated as one-half the number of non-matemal alleles. In broods where there was an odd number of non-maternal alleles, the minimum number of male sires were rounded up. To expound, in cases where there were 3 non-maternal alleles detected in a brood, 1.5 was rounded up to 2 males (Toonen 2004). With this conservative approach, any estimation of multiple paternity could be an underestimate and it is likely that multiple paternity is more prevalent for this population of P. cinctipes than described in this study. 20

2.3 Statistical Analysis

Under control conditions (15°C for 1 hour), individual brood hatching success (12

embryos per brood, 27 broods) was analyzed to determine the amount of fitness variation

present in the sample population under ambient temperatures. Each treatment (HS/NHS)

included 12 embryos from 27 individual broods (324 embryos per treatment) for a total of

648 embryos overall. A Paired T-test was used to analyze the difference in mean brood

hatching percentage under ambient (324 embryos) and heat-shock (324 embryos)

conditions.

After genotyping the mothers and corresponding offspring through microsatellite

analysis, the number of non-maternal alleles present in each brood revealed broods with a

single male sire, and broods that were multiply sired. Brood hatching percentage (%

hatched out of 12 eggs per brood) was compared by treatment category (HS or NHS) and

by multiple (MP) or single (SP) paternity using a paired T-test, to examine the effect of

multiple paternity on fitness when exposed or not exposed to a heat shock. Overall

hatching (out of 24 embryos) was calculated for each brood, and overall hatching % of

multiply-sired broods was compared to overall hatching % of single-sired broods using a

Welch 2-Sample T-test. For each brood, the mean hatching % of the Heat-shock treatment was subtracted from the mean hatching % of the No Heat-shock treatment

(NHS-HS). Mean hatching differences of single-sired broods were compared to mean differences of multiply-sired broods using a Welch 2-Sample T-test. All statistical analyses were performed using the statistical computing program, R Version 3.0.2. 22

3.0 Results

3.1 Control hatching % by brood

Hatching varied from 0% to 100% among the 27 broods under no heat shock

(15°C±0.5°C for 1 hour) conditions (Fig. 5). Mean hatching percentage for the control group was 53% (sd= 0.30).

Hatching Percentage Under Ambient Conditions

€0 o

Individual Broods

Fig.5. Hatching percentages for each of the 27 broods in the No Heat-shock category (15°C±0.5°C for 1 hour). Brood hatching % varied from 0% to 100%. 23

3.2 Heat-shock effect

Exposing late-stage embryos to a heat-shock (30°C±0.5°C/1 hour), which is just under the maximum habitat temperature for P. cinctipes, caused a 16% reduction in survival to metamorphosis (No heat-shock hatching 53% vs. Heat-shock hatching 37%,

Paired T-test, p<0.05) (Fig. 6).

Fig. 6. Effect of heat-shock treatment (30°C±0.5°C) on mean brood hatching percentage for 27 P. cinctipes broods (12 embyos per brood, 324 embryos per treatment, 648 embryos total). Note the significant difference (Paired T-test, p=<0.05) in mean hatching percentage for embryos exposed to heat-shock (53% of brood) compared to embryos exposed to ambient conditions (37% of brood). 24

3.3 Overall brood hatching-MP vs. SP

Overall hatching % (out of 24 embryos) across ambient and heat-shock conditions varied from 0%-88% among the 27 broods (Fig. 7). The mean overall hatching % for broods of multiple paternity was 44% (sd= 0.25), compared 47% (sd=0.26) in single­ sired broods.

Overall Hatching % per Brood: MP vs. SP

o

Individual Broods (Black=MP White=SP)

Fig. 7. Shows the overall hatching % for each of the 27 broods (24 embryos per brood) among the ambient and HS conditions. Hatching % ranged from 0%-88% between broods. Black bars represent multiply-sired broods, while white bars and “SP” represent single-sired broods. The mean overall hatching % for broods of multiple paternity was 44% (sd= 0.25), compared 47% (sd=0.26) in single-sired broods. 25

3.4 Mean overall hatching %: MP vs. SP

A Welch 2 sample T-test showed that multiply-sired broods did not statistically differ (p=>0.05) from single-sired broods in mean overall hatching % (Fig. 8). The mean overall hatching % for broods of multiple paternity (n=l 1) is 44% (sd= 0.25), compared

47% (sd=0.26) in single-sired broods (n=16).

Fig. 8. Shows the comparison of mean overall hatching % of multiply-sired broods (n=l 1) to single-sired broods (n=16). There was no statistical difference in mean overall hatching % (Welch 2 sample T-test, p=>0.05). 26

3.4 Mean Proportional hatchings by treatment: MP vs. SP

Single-sired broods undergo a significant drop (Paired T-test, p=<0.05) in mean hatching percentage compared to multiply-sired broods (Paired T-test, p=>.05) (Fig.6).

Single sired broods experienced a 22% drop in mean hatching % (SP.NHS |j=0.57 sd=0.32, SP.HS p=0.35 sd=0.27) after a heat-shock, compared to a 0.07% drop in multiply-sired broods (MP.NHS ^=0.47 sd=0.26, MP.HS ^=0.40 sd=0.28). In the absence of thermal stress, a 10% gain in mean hatching is observed in broods of single paternity (SP.NHS |j=0.57) compared to multiply-sired offspring (MP.NHS (*=0.47).

Fig. 6. The effect of multiple paternity on mean brood hatching % under ambient conditions and after a heat-shock. A Welch 2 sample T-test showed that single-sired broods experience a significant, 22% decrease in mean brood hatching % (p=<0.05), compared to a 0.07% decrease in broods with multiple paternity. 27

3.6 Brood Hatching % Differences (NHS-HS)

Results show that multiply-sired broods experience 16% less disparity in mean hatching % between NHS and HS conditions, than do single-sired broods (Fig. 7). Broods of multiple paternity (n=l 1) showed a 6% mean difference (sd=0.16) in mean hatching

%, compared to a 22% mean difference (sd=0.27) in single sired broods.

m Proportional Hatching Differences by Brood (NHS-HS) o> u c 0) CD 9= d b CD C JC 3 d m I 15 c M M o o ■ ■ ■ I I t o o O a o

Individual Broods (Black=MP Whrte=SP M=MP)

Fig. 7. The mean treatment differences in mean hatching % displayed for each brood (n=27). The mean hatching % of the Heat-shock treatment was subtracted from the mean hatching % of the No Heat-shock treatment (NHS-HS), with the smallest to largest differences shown from left to right. 28

3.7 Mean differences in mean hatching %: MP vs. SP

There was a substantial, 16% (MP |i=0.06 sd=0.16, SP |i=0.22 sd=0.27) lower difference in mean hatching % between treatments in broods of multiply-sired embryos.

However, a Welch 2 sample T-test showed no statistical significance (p>0.05) between mean treatment differences. Likewise, an F test to compare two variances showed no statistical significance (p=>0.05) between the variances of the MP and SP groups.

Mean Differences in hatching %: MP vs. SP

MP SP

Fig. 8. The comparison of multiply-sired and single-sired broods, contrasting mean differences in mean hatching % between Heat-shock and No Heat-shock treatments. A Welch 2 sample T-test failed to show a statistically significant difference (p=0.G7) between the single-sired and multiply-sired broods. It is worth stating that broods of multiple paternity showed notably (16%) less disparity (MP jj=0.06 sd=0.16, SP p=0.22 sd=0.27) in mean brood hatching % between the HS and NHS conditions. 29

4.0 Discussion

4.1 Heat-shock Effect

The goals of this study were to determine the effect of heat-shock exposure of embryonic Petrolishthes cinctipes, and to identify any advantages to multiple paternity through microsatellite analysis. I hypothesized that exposure to a heat-shock would negatively impact survival % of broods and that multiple paternity would decrease survival variance between HS and NHS conditions. Firstly, results indicate that embryonic Petrolisthes cinctipes suffer a significant drop in fitness as a consequence of exposure to a heat-shock (Fig. 5), which is a temperature just below what broods naturally experience in the wild. With knowing that these crabs are subject to such drastic variations in naturally occurring stress within the intertidal zone, it is logical to adopt the notion that a strategy acting to buffer P. cinctipes from sharp fitness changes between environmental conditions would be beneficial. P. cinctipes exhibits prolific rates of multiple paternity (92.5% for the Bodega Bay, CA population) (Toonen 2004). This is a unique reproductive strategy for a and no evidence based explanation has been given to the question of “why is multiple paternity so common in this species?”. It is possible that the added genetic diversity stemming from multiply-mating females provides a selective advantage of some sort.

From an organism’s perspective, the intertidal zone is relatively dynamic in terms of the range of stresses encountered, even over the course of 24 hours. In terms of 30

temperature fluctuation, the intertidal is much more variant than say, the open ocean or the tropics. Conventionally, the ability to endure fluctuating environmental stress tends to be a characteristic of species with high genetic diversity, compared to organisms inhabiting relatively stable ecosystems (Jernelov and Rosenberg 1976). As theory predicts, genotype-by-environment interactions (GxE) could maintain genetic variation if genotype fitness changes between environments (Gillespie and Turelli 1989; Mitchell-

Olds 1992). Identifying forces that maintain genetic variation between generations and environmental conditions are vital to understanding and predicting the adaptive potential of a species to respond to future environmental change.

4.2 Effect of Multiple Paternity: Ambient and HS Conditions

By genotyping the mother and offspring, I was able to determine the minimum number of fathers that contributed alleles to a brood of embryos and categorize the brood as single or multiply-sired. The effect of multiple paternity on mean brood hatching % under ambient conditions and after a heat-shock was analyzed; results show that single­ sired broods experience a 22% drop in fitness, compared to 0.07% drop in broods of multiple paternity (Fig. 6). The significant decline in fitness for single-sired broods marks a large disparity between environmental conditions, contrast to small fitness differences in multiply-sired broods. 31

Under the bet-hedging hypothesis, females gain a fitness advantage by mating with more than one male, which acts to increase genetic diversity and potentially spread the risk of zero survivability by decreasing fitness variance between environmental conditions. This reduction in fitness variance becomes advantageous over generations by increasing geometric mean fitness (Fox and Rauter 2003). The selection of polyandry

(multiple mating) by a mechanism of bet-hedging is unlikely in stable environments when there is any cost associated with mating multiply; however in unstable environments, polyandry is sometimes advantageous over single matings, even if there is a small fitness cost involved (Yasui 2001).

4.3 Multiple Paternity and Survival Variance

Despite the analysis failing to show that multiply-sired broods experience significantly less disparity in mean hatching % between ambient and heat-shock conditions, broods of multiple paternity do not experience a statistically significant drop in survival, when exposed to a heat-shock, as singly-sired broods do (Fig. 8). Multiple paternity substantially reduced the variance in survival between heat-shock and ambient conditions, relative to single-sired broods. Fox and Rauter (2003) argue that “when comparing two sets of values that have the same arithmetic mean, the set of values that exhibits the largest variance must necessarily have the smallest geometric mean.” It seems that the 16% lower difference in mean hatching % between treatments in broods of 32

multiply-sired embryos, although not statistically significant, buffers against drastic declines in survival due to a heat-shock. It seems likely that multiple paternity is evolutionary significant for P. cinctipes and persists at such high frequencies because it is advantageous under stress.

4.4 Conclusions

The heat-shock treatment used in this study (30°C for 1 hour) is a temperature intensity and exposure duration that P. cinctipes encounters in nature and these crabs have evolved to endure such environmentally sourced drops in fitness. The first important outcome of this study is that brood mothers do suffer a significant drop in reproductive output due to short exposures near maximum habitat temperatures. Results show that multiple paternity acts to buffer against significant decreases in fitness, when broods are exposed to a heat-shock. For a clutch of P. cinctipes embryos, it seems advantageous to be less genetically diverse in the absence of thermal stress, but more diverse in its presence.

4.5 Future Directions

Being that polyandry only seems advantageous under stress for P. cinctipes, it would be interesting to examine the frequency of multiple paternity for porcelain crabs inhabiting lower intertidal zones (Petrolisthes eriomerus, Petrolisthes manimaculus), 33

which are subject to lower stress intensities and variations. Based on my findings, I would hypothesize that the degree of stress intensity and variation of the habitat would correlate to the frequency of multiple paternity of the occupying species. I would also hypothesize that animals capable of multiple paternity will experience an increase in positive selection for this natural history strategy in the coming centuries, due to rising global temperatures and climate variation. Although temperature was the only stress examined in this study, there is rarely only one stress acting on a population. It has been shown that synergistic stressors, such as temperature and ocean acidification, negatively impacts energetics (oxygen consumption rates) of P. cinctipes (Paganini,Miller and

Stillman 2014). Future lab studies on polyandrous species might incorporate multiple stressors, to examine the benefits of multiple paternity under synergistic influences.

Multiple paternity warrants further investigation in P. cinctipes, and could possibly be a key element in maintaining genetic and phenotypic variability for many species inhabiting fluctuating physical environments, and in populations where paternity has not been examined to date. 34

References

Arnqvist, G. and T. Nilsson (2000). "The evolution of polyandry: multiple mating and female fitness in insects." behaviour 60(2): 145-164. Badyaev, A. V. (2005). "Stress-induced variation in evolution: from behavioural plasticity to genetic assimilation." Proceedings of the Royal Society B: Biological Sciences 272(1566): 877-886. Byrne, P. G. and J. S. Keogh (2009). "Extreme sequential polyandry insures against nest failure in a frog." Proceedings of the Royal Society of London B: Biological Sciences 276(1654): 115-120. Calosi, P., S. P. S. Rastrick, C. Lombardi, H. J. d. Guzman, L. Davidson, M. Jahnke, A. Giangrande, J. D. Hardege, A. Schulze, J. I. Spicer and M.-C. Gambi (2013). "Adaptation and acclimatization to ocean acidification in marine ectotherms: an in situ transplant experiment with polychaetes at a shallow C02 vent system." Philosophical Transactions of the Royal Society B: Biological Sciences 368(1627): 20120444. Carter, H. A., L. Ceballos-Osuna, N. A. Miller and J. H. Stillman (2013). "Impact of ocean acidification on metabolism and energetics during early life stages of the intertidal porcelain crab Petrolisthes cinctipes." Journal of Experimental Biology 216(8): 1412- 1422. Ceballos-Osuna, L., H. A. Carter, N. A. Miller and J. H. Stillman (2013). "Effects of ocean acidification on early life-history stages of the intertidal porcelain crab Petrolisthes cinctipes." Journal of Experimental Biology 216(8): 1405-1411. Cohen, D. (1966). "Optimizing reproduction in a randomly varying environment." Journal of theoretical biology 12(1): 119-129. Darwin, C. and W. F. Bynum (2009). "The origin of species by means of natural selection: or, the preservation of favored races in the struggle for life." Diesel, R. (1990). "Sperm competition and reproductive success in the decapod Inachus phalangium (Majidae): a male ghost spider crab that seals off rivals' sperm." Journal of Zoology 220(2): 213-223. Fox, C. W. and C. M. Rauter (2003). "Bet-hedging and the evolution of multiple mating." Evolutionary Ecology Research 5(2): 273-286. 35

Gebauer, P., K. Paschke and K. Anger (1999). "Costs of delayed metamorphosis: reduced growth and survival in early juveniles of an estuarine grapsid crab, Chasmagnathus granulata." Journal of Experimental Marine Biology and Ecology 238(2): 271-281. Gillespie, J. H. and M. Turelli (1989). "Genotype-environment interactions and the maintenance of polygenic variation." Genetics 121(1): 129-138. Harley, C. D. G„ A. Randall Hughes, K. M. Hultgren, B. G. Miner, C. J. B. Sorte, C. S. Thornber, L. F. Rodriguez, L. Tomanek and S. L. Williams (2006). "The impacts of climate change in coastal marine systems." Ecology letters 9(2): 228-241. Helmuth, B. S. and G. E. Hofmann (2001). "Microhabitats, thermal heterogeneity, and patterns of physiological stress in the rocky intertidal zone." The Biological Bulletin 201(3): 374-384. Hoffmann, A. A. and M. J. Hercus (2000). "Environmental stress as an evolutionary force." Bioscience 50(3): 217-226. Hopper, K. R. (1999). "Risk-spreading and bet-hedging in insect population biology 1." Annual review of entomology 44(1): 535-560. Jennions, M. D. and M. Petrie (2000). "Why do females mate multiply? A review of the genetic benefits." Biological Reviews of the Cambridge Philosophical Society 75(01): 21-64. Jensen, G. C. and D. A. Armstrong (1991). "Intertidal zonation among congeners: factors regulating distribution of porcelain crabs Petrolisthes spp.(Anomura: Porcellanidae)." Marine Ecology Progress Series 73: 47-60. Jemelov, A. and R. Rosenberg (1976). "Stress tolerance of ecosystems." Environmental conservation 3(01): 43-46. Kempenaers, B., B. Congdon, P. Boag and R. J. Robertson (1999). "Extrapair paternity and egg hatchability in tree swallows: evidence for the genetic compatibility hypothesis?" Behavioral Ecology 10(3): 304-311. Koga, T., Y. Henmi and M. Murai (1993). "Sperm competition and the assurance of underground copulation in the sand-bubbler crab Scopimera globosa (Brachyura: Ocypodidae)." Journal of Crustacean Biology 13: 134-134. McNeely, J. A., K. R. Miller, W. V. Reid, R. A. Mittermeier and T. B. Werner (1990). "Conserving the world’s biodiversity." International Union for Conservation of Nature and Natural Resources, Gland. Switzerland. 36

Mitchell-Olds, T. (1992). "Does environmental variation maintain genetic variation? A question of scale." Trends in ecology & evolution (Personal edition) 7(12): 397-398. Paganini, A. W., N. A. Miller and J. H. Stillman (2014). "Temperature and acidification variability reduce physiological performance in the intertidal zone porcelain crab Petrolisthes cinctipes." Journal of Experimental Biology 217(22): 3974-3980. Philippi, T. and J. Seger (1989). "Hedging one's evolutionary bets, revisited." Trends in Ecology & Evolution 4(2): 41-44. Reed, D. H. and R. Frankham (2003). "Correlation between fitness and genetic diversity." Conservation biology 17(1): 230-237. Reusch, T. B. H. (2014). "Climate change in the oceans: evolutionary versus phenotypically plastic responses of marine animals and plants." Evolutionary applications 7(1): 104-122. Simons, A. M. (2009). "Fluctuating natural selection accounts for the evolution of diversification bet hedging." Proceedings of the Royal Society of London B: Biological Sciences 276(1664): 1987-1992. Simons, A. M. (2011). "Modes of response to environmental change and the elusive empirical evidence for bet hedging." Proceedings of the Royal Society of London B: Biological Sciences: rspb20110176. Somero, G. N. (2002). "Thermal physiology and vertical zonation of intertidal animals: optima, limits, and costs of living." Integrative and Comparative Biology 42(4): 780-789. Stillman, J. and G. Somero (1996). "Adaptation to temperature stress and aerial exposure in congeneric species of intertidal porcelain crabs (genus Petrolisthes): correlation of physiology, biochemistry and morphology with vertical distribution." The Journal of experimental biology 199(8): 1845-1855. Stillman, J. H. (2002). "Causes and consequences of thermal tolerance limits in rocky intertidal porcelain crabs, genus Petrolisthes." Integrative and Comparative Biology 42(4): 790-796. Tomanek, L. and B. Helmuth (2002). "Physiological ecology of rocky intertidal organisms: a synergy of concepts." Integrative and Comparative Biology 42(4): 771-775. Toonen, R. (2001). "Genetic analysis of recruitment and dispersal patterns in the porcelain shore crab." Petrolisthes cinctipes [dissertation!.fDavisl: University of California. 37

Toonen, R. J. (1997). "Microsatellites for ecologists: non-radioactive isolation and amplification protocols for microsatellite markers." Website http://biogeek. ucdavis. edu/Mstats/laccessed May 20041. Toonen, R. J. (2004). "Genetic evidence of multiple paternity of broods in the intertidal crab Petrolisthes cinctipes." Marine Ecology Progress Series 270: 259-263. Turelli, M. (1984). "Heritable genetic variation via mutation-selection balance: Lerch's zeta meets the abdominal bristle." Theoretical population biology 25(2): 138-193. Turelli, M. (1985). "Effects of pleiotropy on predictions concerning mutation-selection balance for polygenic traits." Genetics 111(1): 165-195. Urbani, N., B. Sainte-Marie, J.-M. Sevigny, D. Zadworny and U. Kuhnlein (1998). "Sperm competition and paternity assurance during the first breeding period of female snow crab (Chionoecetes opilio)(Brachyura: Majidae)." Canadian Journal of Fisheries and Aquatic Sciences 55(5): 1104-1113. Whittingham, L. and P. Dunn (2010). "Fitness benefits of polyandry for experienced females." Molecular Ecology 19(11): 2328-2335. Yasui, Y. (1997). "A" good-sperm" model can explain the evolution of costly multiple mating by females." American Naturalist: 573-584. Yasui, Y. (2001). "Female multiple mating as a genetic bet-hedging strategy when mate choice criteria are unreliable." Ecological Research 16(4): 605-616. 38

Appendix 1. Microsatellite traces showing alleles of locus Pci 56s for a brood mother and 3 embryos of that brood. The mother (top trace) shows homozygosity for allele 172 bp, while the subsequent 3 traces demonstrate heterozygosity for 3 embryos of that brood. All 3 embryos share a maternal allele of 172 bp, with additional non-maternal alleles of 203 bp, 211 bp and 232 bp (3 or more non-maternal alleles is evidence of multiple paternity).