www.nature.com/scientificreports
OPEN Molecular detection of giant snakeheads, Channa micropeltes (Cuvier, 1831), one of the most troublesome fsh species Maslin Osathanunkul1,2* & Toshifumi Minamoto3
A lack of reliable tools for determining the presence and distribution of fsh species can impede understanding of predator–prey interactions and fshery management. Conventional fsh survey methods are invasive, and can be size or species selective. Combining netting and electrofshing is a current method used to monitor fsh species in Phayao Lake (Kwan Phayao), Thailand. However, the methods are inefcient and time-consuming. Recently, locals who rely on inland fsheries in Kwan Phayao expressed their deep concerns about the giant snakehead, Channa micropeltes (Cuvier, 1831) destroying other fsh there. The giant snakehead prey on many commercially important fsh species, as the prey species is reduced, negative efects on both biodiversity and the fshery sector could follow. Here, an eDNA-based survey was developed to detect the presence of the giant snakehead. Water samples were collected from six sites within Kwan Phayao and 17 sites in Ing River where water fowed into and out of Kwan Payao. The eDNA of the giant snakehead was detected in water samples from all collection sites using the developed qPCR assay with various concentrations. The eDNA was shown here to be a sensitive and reliable tool for fsh surveillance so there will be a better chance for developing an efective management strategy.
In Tailand, inland capture fsheries are carried out principally in rivers, lakes, swamps and reservoirs. Phayao Lake (Kwan Phayao) is one of the major lakes used for inland fsheries 1 and is reputed to be the 4th biggest lake of the country. Te lake is home to about 50 fsh species, many small-scale fshermen, and around 18,000 people from the city of Phayao. Many small-scale fshermen are self-employed and usually catch fsh for direct con- sumption within their households or communities. Tus, small-scale fsheries tend to be frmly rooted in local communities, traditions and values and are very crucial in providing the rural poor with high quality protein food for home consumption. Recently, there is an urgent need for a fast, reliable and sensitive approach for fsh monitoring as it is not an invasive species that has caused huge problems but a troublesome, giant snakehead, Channa micropeltes (Cuvier, 1831). Because this species is native to Tailand, they have not gotten much attention until now. Locals who rely on inland fsheries in Kwan Phayao expressed their deep concerns about the giant snakehead destroying other fsh there. Te giant snakehead is not really capable of living in harmony with many other species as they can eat fsh almost as big as they are. In Kwan Phayao, it is reported that they prey on many fsh species such as Nile tilapia and Silver barb which are commercially important 2. As the fsh species which are prey of the giant snakehead are reduced, negative efects on both biodiversity and the fshery sector could follow. A lack of reliable tools for determining the presence, distribution and abundance of fsh species can impede understanding of predator–prey interactions and management of fsh stocks 3. Fish surveys in lakes can be a challenge because no single gear is capable of efectively sampling the wide range of habitats, each gear has specifc selectivity with respect to size and species of fsh (e.g.4–8). As a result, multiple methods are combined to complement each other for surveying fsh communities6. Conventional fsh survey methods are invasive and then can be harmful to the ecosystem 9. Te combining of netting and electrofshing is a current method used to monitor fsh species in Kwan Phayao2. A survey of fsh density and diversity by the Inland Fisheries Research and Development Division in 2009 found that electrofshing was inefective for capturing partipentazona barb,
1Department of Biology, Faculty of Science, Chiang Mai University, Chiang Mai 50200, Thailand. 2Research Center in Bioresources for Agriculture, Industry and Medicine, Chiang Mai University, Chiang Mai, Thailand. 3Graduate School of Human Development and Environment, Kobe University, Hyogo, Japan. *email: maslin.cmu@ gmail.com
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 1 Vol.:(0123456789) www.nature.com/scientificreports/
Species Forward Reverse Identity, % GenBank Channa micropeltes 100.0 KX129904 Channa argus ●●●●●●●●●●●●●●●●●●●●●●ACTTT T A G T ●●●●●●●●●●●●●●●●●●●●●●●●●CCC C – 71.4 GU937112 Channa asiatica ●●A CACATT● ●●●●●A ●●G ●●T ● ●●●●●●TCC●●●●●●●●●●●●●A C ●– 67.3 KJ930190 Channa gachua ● ●TC C TT●● C●●●●● G●● TT● ●●●●●●TTT●●●●●●●●T ●●●●C●– 69.4 NC 036,948 Channa lucius –C●● ● ● T●●T ●●●●● A●● T ●●●●●●TAC●●● ●●●●●●●●●A C●– 75.5 MF804538 Channa maculata ●●●●●●ACTTT T ● ●●●●●●A G ●●T ● ●●●●●●CCC●●●●●●●● ●●●● C● – 71.4 KC823606 Channa marulius ●●TC ● ●●●●●T ●● ●●G ●T ●●●●●●CC ●●●●●●●●●●●●● C● – 81.6 AB968638 Channa striata –CTT●● ATA●●●● T ●●●●●●●●G ●●T ● ●●●●●●CCC●●●●●●●●●●●●●●T C ●– 67.3 KX177965 Anabas testudineus CAAACA● ●●●●●●●●T T CA●●CT● ●●●●●●A T–AA●●●●●●●● ●●●●C ●G 61.2 NC 024,752 Betta pi ACT● AAT TTT ● ● C●●●●●A CGCC● ● ●●● ●● CCC ●●●●●●●●●●●●T ●T– 57.1 AB920288 Betta splendens ACTAAT TTT ●●TC ●A ●●CAC ●● ●●●●●●CCC●●●T●●●●●●●●●●TG A C T T 49.0 NC 026,581 Chitala ornata ACTAATAAT●T ● A●● CCCC●●●T ●●●●●●T C C●●●– ●TG ● ● ●AT●●A– 49.0 NC 012,712 Helostoma temminkii CCTAGCTTT● ●●C ●● CGCCT● ●●●●●A C–CG● ●●● ● ●●●●T ● – 55.1 NC 022,728 Osphronemus goramy CCTAGCTTT●●C●●●●CACCT● ●●● ●●T CC ●●●●●●● ●●●●●●C G 59.2 NC 031,363 Trichogaster leerii TCTTA TTT●●C●●●●A CGCC ● ●●●●● ●CT ●●●●●●●●●●●●●T T●G 61.2 NC 026,725 Trichopodus trichopterus TCTTTA●TAT ●●TC ●A ●●CGCC ●● ●●●●●●TCC●●●●●●●●●T ●●●●C ●G 55.1 NC 026,580 ● ● ●● ●● ●●●●●● ●●●●●●●● ●●●● ● Table 1. Homology of the query to the forward and reverse primers, percentage identity as a function of the number of matching base sites divided by 47 (total number of base sites across the primer pair) Base site homology between the query and the primer is shown as a dot.
Puntius partipentazona (Fowler, 1934) and spiny eel, Macrognathus taeniagaster (Fowler 1935), whereas netting was inefective in sampling rohu, Labeo rohita (Hamilton, 1822), Asian redtail catfsh, Hemibagrus nemurus (Valenciennes, 1840) and Kissing gouramis, Helostoma temminckii (Cuvier, 1829)2. Tese strongly indicated that the methods are size and species selective. In addition, in the past 3 years of fsh surveys in Kwan Phayao (2016–2018), the giant snakehead was only detected in 2017 and no report of them was found during surveys in 2016 and 2018, although locals reported their present in the lake in both years 10. Terefore, the main limitations of the methods are their varying efciency, incomplete or bias samplings, not to mention the fact that it is time-consuming. Recently, the use of environmental DNA (eDNA), defned as short DNA fragments that an organism leaves behind in environments, was proved to be a powerful tool in biodiversity science and conservation action which can monitor the biodiversity of a region in near real-time (e.g.11–13). Detec- tion of the giant snakehead in Phayao Lake via eDNA instead of the traditional direct observation method could be more sensitive and less time consuming. In addition, eDNA monitoring of the giant snakehead could beneft the fsh stocks management plan of Kwan Phayao as well as saving the small-scale fsheries there as strategies to obtain fshery metrics must appropriately and efectively acquire information needed to manage a fshery 14. Results Species‑specifc primer design. Here, the primers were designed to amplify short target regions of 127 bp specifc to the giant snakeheads (C. micropeltes). To determine specifcity, the designed primers were tested in silico. Te specifcity of the generated primers was checked against the NCBI database by comparing the similar- ity of primers to Channa and related species. Te homology of Channa sequences to the specifc forward and reverse primers of C. micropeltes is 67.3–75.5% with at least fve mismatches on the forward and four mismatches on the reverse primers (Table 1). When comparing with other fsh species commonly found in Kwan Phayao, the homology was found to be lower (49.0–61.2%). Te qPCR assay with species-specifc primers and probe showed that only DNA from the giant snakehead could be amplifed, not other closely related fsh species or species that are commonly found in Tai freshwater environments including Clown featherback, Chitala ornata (Gray, 1831), Great snakehead, Channa marulius (Hamilton, 1822), Jullien’s golden carp, Probarbus jullieni (Sauvage, 1880), Red tailed tinfoil, Barbonymus altus (Günther, 1868), Smith’s barb, Puntioplites proctozysron (Bleeker, 1865) and Striped snakehead, Channa striata (Bloch, 1793).
qPCR assay. Te assay designed in this study was found to be species-specifc to giant snakehead. Both PCR and qPCR did not result in any positive detection of the non-target species. Te LOD and the LOQ of the assay determined by an analysis of the standard curve (Slope = − 3.016, Y inter = 33.674, R 2 = 0.976) generated from a dilution experiment under laboratory conditions. Te LOD was 0.93 copies per reaction and the LOQ was 1.0 copies per reaction.
Aquarium and feld collection samples. An aquarium experiment was conducted to test the extent to which the qPCR of water samples can detect the giant snakehead at low simulated densities. Te eDNA of the giant snakehead were detected from water samples collected at time 0, 3, 6, 12, 24, 48, 72, 96, 120, 144, and 168 h.
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 2 Vol:.(1234567890) www.nature.com/scientificreports/
Figure 1. Map showing sampling sites. 1–6 water collecting sites in Kwan Phayao, A–K where water fowed into Kwan Phayao and L–Q where water fowed out of Kwan Phayao.
afer removing the fshes. Tus, the eDNA qPCR assay resulted in positive DNA signals in 100% of the aquarium experiment even 7 days afer removal of the fshes from the tanks. Water samples were collected from six sites at the same locations where the teams from the Inland Fisheries Research and Development Division, Department of Fisheries conducted the traditional surveys (Fig. 1). Te eDNA of the giant snakehead were detected in water samples from all collection sites in Kwan Phayao using the qPCR assay (Fig. 2 and Table 2). Tere were no amplifcation detected in the negative controls. Concentration of the giant snakehead found in Kwan Phayao ranges from around 2.0–9.8 copy numbers per mL (Table 2). Further investigated Ing River which fows into and out Kwan Phayao was carried out. Water samples were collected from total of 17 sites (11 sites where water was going into Kwan Phayao and 6 sites where water was going out from Kwan Phayao to Mekong River). It is expected to detect the giant snakehead throughout the Ing River as there are no barriers stopping them from commodity. Also, the giant snakehead is now distributed all over Kwan Phayao with a large number that have an efect on other fsh species. From qPCR assay with the water samples from Ing River, samples from all 17 sites were found to be positive in detecting the giant snakehead with various concentrations (Fig. 2). Concentration of the giant snakehead found in Ing River ranges from around 1.5–14 copy numbers per mL (Table 2). Te highest concentration of the giant snakehead DNA outside Kwan Phayao was found at sampling site E (14 copy numbers per mL) which is higher than the highest concentration found in Kwan Phayao (site 4; 9.8 copy numbers per mL). Discussion Recently, the use of environmental DNA (eDNA) has proved to be a powerful tool in biodiversity science and conservation action which can monitor the biodiversity of a region in near real-time. eDNA monitoring is likely to have a major impact on the ability of species detection. Te ability to rapidly and sensitively detect the pres- ence of a target species through eDNA analysis has enabled a wide range of scientifc discoveries and technical advancements. One key of the success in eDNA detection of target species using qPCR is the specifcity of prim- ers and probe. In this study, the efciency of specifc primers and probe was tested. Te primers and probe were confrmed to amplify only DNA from the giant snakehead, not other closely related fsh species or species that are commonly found in Tai freshwater environments. As eDNA is thought to be easily degraded and presents itself in a short fragment, PCR primer sets used for eDNA studies should then be designed to yield short ampli- cons (100–180 bp)15. Also, it is noteworthy that short-amplicon PCR assays have high detection sensitivity 16. Several biotic and abiotic factors can afect the ability of eDNA detection such as breeding, feeding, season- ality, temperature, pH and potential natural inhibitors (e.g. algae, humic substances, and suspended sediment particles)17–21. To guarantee the success of eDNA qPCR experimenting, there are several ways to test for inhibitory efects such as using qPCR amplifcation of Internal Positive Controls 19, using control DNA that known not be found in the sample13 and using DNA extraction kits with inhibitor removal steps20. Although there was report
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 3 Vol.:(0123456789) www.nature.com/scientificreports/
Figure 2. Map showing sampling sites with estimated concentration eDNA of the giant snakehead obtained from species-specifc qPCR assay.
Site ID Average copy number per mL Average Ct Positive tank 25.6 27.33 1 5.9 29.24 2 2.9 30.17 3 2.0 30.66 4 9.8 28.58 5 2.8 30.24 6 2.2 30.54 A 6.4 29.15 B 1.5 32.53 C 7.3 28.97 D 8.9 28.71 E 14.0 28.12 F 8.6 28.76 G 5.3 29.38 H 4.4 29.64 I 4.8 29.52 J 7.9 28.86 K 2.4 30.40 L 8.0 28.85 M 6.2 29.18 N 9.4 28.64 O 5.5 29.34 P 4.8 29.52 Q 4.6 29.57
Table 2. Average copy number and Ct (cycle threshold) obtaining form qPCR amplifcation of DNA samples from all sampling sites and standard fragments. Average values were calculated from three qPCR replicates with each replicate contain three replicates of each samples.
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 4 Vol:.(1234567890) www.nature.com/scientificreports/
Primer name Type Length (bp) Primer sequence 5′–3′ Cmi-F Forward primer 24 CTCGCACCAACTAGGCTTTTCC Cmi-R Reverse primer 25 GGTTAATGTTCGGTGGATTGTCCGT Cmi-PR Probe 20 TGCTAACATGGAAGCACTTA
Table 3. Details of species-specifc primers and the probe designed to amplify a 127 bp fragment of the 16S region of Channa micropeltes (Cuvier, 1831).
of algae found in Kwan Phayao 22 which could act as inhibitors for our eDNA assays, we found no problem with the PCR amplifcation process here. Previous traditional surveys of fsh in Kwan Phayao failed to recognize the presence of the giant snakehead in some years and sampling sites (within Kwan Phayao) even when there were reports of locals fnding and catching them from the lake. However, our method can detect the eDNA of the giant snakehead at all sampling sites in Kwan Phayao. Other works also proved eDNA detection is more sensitive than the conventional survey or sampling and, in many cases, it can be used for habitat selection and migration pattern study, biomonitoring the fsh community and exploring genetic diversity 23–25. In addition, there were results from further investigation carried on at Ing River, which fows into and out Kwan Phayao. All sites were positive in detection of the giant snakehead DNA with various concentration. It indicated the expanding distribution of the fsh. Even though Phayao authorities have several campaigns to reduce the number of the giant snakehead in Kwan Phayao, such as fshing competitions which reward fsher- men a big prize to catch the most giant snakeheads in Kwan Phayao, and setting up training courses to educate locals in fsh processing from the giant snakehead. Early detection monitoring of harmful species such the giant snakehead and others should be ranked among the top priorities in fsheries and conservation management due to the efects these organisms pose to ecosystems. Te known ecological impacts of the giant snakehead include losing endangered species, altered structure and composition of aquatic communities, and a reduction in overall diversity of species. While long-term changes associated with the giant snakehead are being monitored through traditional surveys, it is also critical to be able to detect populations early. To the best of our knowledge, this is the frst report of eDNA detection the giant snakehead in Tailand. Te earlier they are found, the better the chances are of developing an efective management strategy. Early detection, rapid assessment and rapid response are critical defences against the establishment of population. Methods Ethics statement. All procedures were conducted in accordance with the current laws in Tailand on experimental animals and were approved by the safety management committee for experiments of the Labora- tory Animal Center, Chiang Mai University (Project Number 2561/FA-0001). Te study also followed the rec- ommendations in the ARRIVE guidelines.
Species‑specifc primer design. All the DNA tissue analysed originated from the mucus of the individual giant snakehead. Total DNA was extracted from the mucus sample using the Qiagen DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA). Extracted DNA was used as a template for qPCR assay together with synthetic frag- ments. DNA samples were quantifed using a Qubit fuorometer (Life Technologies) calibrated with the Quant- iT dsDNA HS Assay following the manufacturer’s instructions. For each replicate, 3 µL volumes were measured. Species-specifc primers and a minor-groove binding (MGB) probe incorporating a 5′ FAM reporter dye and a 3′ non-fuorescent quencher were designed to amplify an 127 bp targeting within the 16S region for the giant snakehead (C. micropeltes), using Primer Express (V3.0, Life Technologies; Table 3). Probe and primer sequences were matched against the National Centre for Biotechnology Information (NCBI, http://www. ncbi. nlm. nih. gov/ ) nucleotide database with BLASTn (Basic Local Alignment Search Tool) to confrm the species’ specifcity for the giant snakehead in silico assays. To ensure that the assay only amplifed the giant snakehead, it was deployed on a closely related species com- monly found in Tai freshwater environments using conventional PCR amplifcation and visualization on a 1.5% agarose gel stained with SYBR Safe DNA Gel Stain (Life Technologies).
qPCR assay. Te qPCR assay was deployed using Environmental Master Mix (Applied Biosystems) on mucus samples from the giant snakehead and related species to ensure the species specifcity to the qPCR assay. In addition, eDNA qPCR assay for the giant snakehead, a water sample collected from tank at Phayao Freshwa- ter Aquarium (Phayao Inland Fisheries Research and Development Center) was known to have only the giant snakehead was included as a positive control for the presence of amplifable eDNA in water samples. Te tank contains around 4.5 m3 of water with one individual of giant snakehead resides in the tank (the fsh is about 60–70 cm in length). All eDNA qPCR amplifcations were performed in three replicates in a fnal volume of 20 µL, using 10.0 µL of 2 × TaqMan Environmental Master Mix 2.0 (Termo Fisher Scientifc), 2.0 µL of DNA template, 900 nM each of the F/R primers, and 125 nM of the probe. Samples were run under the following conditions: an initial 10 min incubation at 95 °C followed by 50 cycles of denaturation at 95 °C for 15 s and annealing/extension at 60 °C for 1 min. Negative controls with all PCR reagents but no template (three replicates) were run in parallel to assess potential contamination. Te quantifcation cycle (Cq) was converted to quantities per unit volume using
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 5 Vol.:(0123456789) www.nature.com/scientificreports/
the linear regression obtained from the synthesized target gene standard curve (Integrated DNA Technologies Pte. Ltd., Singapore). Te giant snakehead eDNA concentrations were then reported as copies/mL. Te limit of detection (LOD) and the limit of quantifcation (LOQ) were also measured using the standard dilution series of synthesized target gene fragment with known copy numbers. A dilution series containing 1.5 × 101 to 1.5 × 104 copies per PCR tube were prepared and used as quantifcation standards. Te calculation of LOD and LOQ was done using published R script by Klymus et al.26.
DNA extraction from the flters. DNA trapped on the flters obtained from the aquarium experiments and feld collections were extracted using Qiagen DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) using a protocol modifed from the manufacturer’s protocol with the following changes: the DNA from all sam- ples were eluted twice with 25 µL AE bufer, in a total volume of 50 µL to obtain a more concentrated eDNA solution. Te volume of ATL bufer (360 µL), Proteinase K (40 µL), AL bufer (400 µL) and Ethanol (400 µL) were doubled.
Aquarium experiment. An aquarium experiment was used to test the extent to which qPCR of water sam- ples can detect eDNA of giant snakehead at low simulated densities. Te juvenile giant snakehead was obtained from the fsh store and transported to a laboratory at Chiang Mai University. Te giant snakeheads were then held in separate 120 L plastic holding containers in which the water was continuously fltered. Te fsh were fed frozen shrimp/commercially available fake fsh food three times a week, and were held at 23 ± 1 °C. Te sensitivity of eDNA detection in the aquaria was evaluated by conducting three aquarium experiments using plastic tanks (30 × 45 × 25 cm) flled with 120 L of aged-tap water. Te water in the tanks was continuously aerated through a flter. In each experiment, the giant snakeheads were randomly assigned to the tanks (10 individuals per tank). Te average size of the snakeheads was 9.7 cm (body length ranging from 9.1 to 10.6 cm). Te average weight was 8.15 g (ranging from 6.7 to 10.6 g). Te water in the tanks was maintained at 23 ± 1 °C. A 300 mL water sample from each tank was collected at each time point (0, 3, 6, 12, 24, 48, 72, 96, 120, 144, and 168 afer removal of the fshes from the tanks) in triplicate. Collected water was fltered on a GF/F flter (0.7 μm Whatman International Ltd., Maidstone, UK). Te eDNA from each sample solution was extracted using a Qiagen DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) in a fnal volume of 50 µL, detailed in DNA extraction from the flters. To confrm the absence of the giant snakehead eDNA in the water prior to the experiments, three tanks without giant snakehead were prepared and water sample was collected and treated as described above. Real-time PCR was performed with the species-specifc primers and probe set using a Rotor-Gene Q system (Qiagen, Hilden, Germany). Te reaction conditions were the same as described in qPCR assay. Tree replicates were conducted for each sample including the negative PCR control and positive control.
eDNA feld collection. Water samples were collected at 6 points within Kwan Payao according to the sur- vey locations of the Inland Fisheries Research and Development Center. Additional water samples were collected from 11 and 6 locations in Ing River where water fowed into and out of Kwan Payao, respectively (Fig. 1). To avoid contamination, all feld equipment was sterilized using 10% bleach, UV-Crosslinker or autoclaved and sealed prior to transport to the study site, and a separate pair of nitrile disposable gloves were used for each sam- ple. At each site, water samples were collected three replicate in bucket that had been previously decontaminated with a 10% bleach rinse followed by two distilled water rinses. In total, water samples were collected from 6 sites (in Kwan Phayao) and from 17 sites (in the Ing River) from 15th February to 5th March 2019, the middle of the dry season. Each site was sampled in triplicate, 300 mL samples of water were collected and fltered on GF/F flter (0.7 μm Whatman International Ltd., Maidstone, UK). In total, 306 water samples were collected from the surface water of lakes and rivers. For every sampling day, deionised water (300 mL) was fltrated as a negative control. Te water samples and real-time PCR was processed as described above in qPCR assay.
Received: 22 January 2020; Accepted: 1 April 2021
References 1. Pawaputanon, O. Inland capture fsheries in Tailand. In FAO Inland Fisheries Report 106–111 (Rome, 1992). 2. Rattanadaeng, P., Panboon, K. & Soe-been, S. Structure and distribution of fsh community in Kwan Phayao, Phayao Province. Inland Fisheries Research and Development Division, Department of Fisheries. http://www. inlan dfsh eries. go. th/ resea rch/ fles/ full/ F32551.pdf (2015). 3. Mason, D. M. et al. Hydroacoustic estimates of abundance and spatial distribution of pelagic prey fshes in western Lake Superior. J. Great Lakes Res. 31, 426–438 (2005). 4. Porreca, A. P., Pederson, C. L., Laursen, J. R. & Colombo, R. E. A comparison of electrofshing methods and fyke netting to produce reliable abundance and size metrics. J. Freshw. Ecol. 28, 585–590 (2013). 5. Říha, M. et al. Te size selectivity of the main body of a sampling pelagic pair trawl in freshwater reservoirs during the night. Fish. Res. 127–128, 56–60 (2012). 6. Kubecka, J. et al. Te true picture of a lake or reservoir fsh stock: A review of needs and progress. Fish. Res. 96, 1–5 (2009). 7. Tate, W. B., Allen, M. S., Myers, R. A. & Estes, J. R. Comparison of electrofshing and rotenone for sampling largemouth bass in vegetated areas of two Florida lakes. N. Am. J. Fish. Manag. 23, 181–188 (2003). 8. Hanchin, P. A., Willis, D. W. & Sauver, T. R. Comparison of concurrent trap-net and gill-net samples for black bullheads. J. Freshw. Ecol. 17, 233–237 (2002). 9. Baker, D. G. L. et al. Comparative analysis of diferent survey methods for monitoring fsh assemblages in coastal habitats. PeerJ 4, e1832. https://doi.org/10.7717/peerj.1832 (2016).
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 6 Vol:.(1234567890) www.nature.com/scientificreports/
10. Inland Fisheries Research and Development Division. Status of inland fsheries resource in rivers, large swamp and reservoirs in Tailand. https://www4.fsheries.go.th/local/indexphp/main/view_activities/125/1006 (2019). 11. Itakura, H. et al. Environmental DNA analysis reveals the spatial distribution, abundance, and biomass of Japanese eels at the river-basin scale. Aquat Conserv. 29, 361–373 (2019). 12. Minamoto, T., Hayami, K., Sakata, M. K. & Imamura, A. Real-time polymerase chain reaction assays for environmental DNA detection of three salmonid fsh in Hokkaido, Japan: Application to winter surveys. Ecol. Res. 34, 237–242 (2019). 13. Doi, H. et al. Environmental DNA analysis for estimating the abundance and biomass of stream fsh. Freshw. Biol. 62, 30–39 (2017). 14. Vokoun, J. C. & Rabeni, C. F. Catfsh sampling in rivers and streams: A review of strategies, gears, and methods. Am. Fish. Soc. Symp. 24, 271–286 (1999). 15. Dejean, T. et al. Improved detection of an alien invasive species through environmental DNA barcoding: Te example of the American bullfrog Lithobates catesbeianus. J. Appl. Ecol. 49, 953–959 (2012). 16. Huver, J. R., Koprivnikar, J., Johnson, P. T. J. & Whyard, S. Development and application of an eDNA method to detect and quantify a pathogenic parasite in aquatic ecosystems. Ecol. Appl. 25, 991–1002 (2014). 17. Stewart, K. A. Understanding the efects of biotic and abiotic factors on sources of aquatic environmental DNA. Biodivers. Conserv. 28, 983–1001 (2019). 18. Seymour, M. et al. Acidity promotes degradation of multi-species environmental DNA in lotic mesocosms. Commun. Biol. 1, 4. https://doi.org/10.1038/s42003-017-0005-3 (2018). 19. Buxton, A. S. et al. Seasonal variation in environmental DNA in relation to population size and environmental factors. Sci. Rep. 7, 46294. https://doi.org/10.1038/srep46294 (2017). 20. Sellers, G. S., Di Muri, C., Gómez, A. & Hänfing, B. Mu-DNA: A modular universal DNA extraction method adaptable for a wide range of sample types. Metabarcoding Metagenom. 2, e24556. https://doi.org/10.3897/mbmg.2.24556 (2018). 21. Stoeckle, B. C. et al. A systematic approach to evaluate the infuence of environmental conditions on eDNA detection success in aquatic ecosystems. PLoS ONE 12, 0189119. https://doi.org/10.1371/journal.pone.0189119 (2017). 22. Kaewsri, K. & Traichaiyaporn, S. Monitoring on water quality and algae diversity of Kwan Phayao, Phayao Province, Tailand. J. Agric. Sci. Technol. 8, 537–550 (2012). 23. Valdez-Moreno, M. et al. Using eDNA to biomonitor the fsh community in a tropical oligotrophic lake. PLoS ONE 14(4), e0215505. https://doi.org/10.1371/journal.pone.0215505 (2019). 24. Wu, Q. et al. Habitat selection and migration of the common shrimp, Palaemon paucidens in Lake Biwa, Japan-An eDNA-based study. Environ. DNA 1, 54–63 (2019). 25. Eiler, A. et al. Environmental DNA (eDNA) detects the pool frog (Pelophylax lessonae) at times when traditional monitoring methods are insensitive. Sci. Rep. 8, 5452. https://doi.org/10.1038/s41598-018-23740-5 (2018). 26. Klymus, K. E. et al. Reporting the limits of detection and quantifcation for environmental DNA assays. Environ. DNA 2, 271–282 (2020). Acknowledgements Tis work was supported by Chiang Mai University. We thank the Phayao Inland Fisheries Research and Devel- opment Center, for providing the tank water. We are thankful to our colleagues and students, for every little help from them and also Dr. Lauren R. Clark for English editing. Our thanks also to Dr. Santhiti Vadthanarat for providing map vector. Author contributions M.O. conceived the project, designed the experiments, collected samples, performed the experiments and ana- lysed the data. M.O. and T.M. participated in data interpretation and discussed the experiment. M.O. wrote the paper with contributions from all authors and all authors approved this manuscript.
Competing interests Te authors declare no competing interests. Additional information Correspondence and requests for materials should be addressed to M.O. Reprints and permissions information is available at www.nature.com/reprints. Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional afliations. Open Access Tis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. Te images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
© Te Author(s) 2021
Scientifc Reports | (2021) 11:9943 | https://doi.org/10.1038/s41598-021-89320-2 7 Vol.:(0123456789)