SCRS/2011/051 Collect. Vol. Sci. Pap. ICCAT, 68(4): 1543-1547 (2012)

INTER-ANNUAL VARIABILITY IN THE PROPORTION OF ROUNDSCALE SPEARFISH (TETRAPTURUS GEORGII) AND WHITE MARLIN (KAJIKIA ALBIDA) IN THE WESTERN NORTH ATLANTIC OCEAN

John E. Graves, Jan R. McDowell1

SUMMARY

The recent validation of the roundscale spearfish (Tetrapturus georgii) from the western North Atlantic indicates that historical landings of the morphologically similar white marlin (Kajikia albida) likely include misclassified roundscale spearfish. The objective of this study was to use genetic characters to determine interannual variation in the proportion of roundscale spearfish and white marlin from archived tissue samples collected at a fishing tournament held in Cape May, New Jersey (USA) during the third week of August each year for the past 19 years. Overall, roundscale spearfish comprised 21.8% of the two species combined but there was significant variation in the proportion of the two species over the course of the time series. Roundscale spearfish comprised only 2.1% of the combined species from 1992-2000, but represented 33.3% of the combined species from 2002-2010. There was also considerable year- to-year variation in the relative proportion of the two species over the past decade. These results suggest that extensive temporal sampling will be needed to accurately estimate the relative proportion of the two species at any single location.

RÉSUMÉ

La confirmation récente du makaire épée (Tetrapturus georgii) de l'Atlantique du Nord-Ouest indique que les débarquements historiques du makaire blanc (Kajikia albida), qui présente des similitudes morphologiques avec le makaire épée, incluent probablement des makaires épée ayant été classés de manière erronée. Cette étude vise à utiliser les caractéristiques génétiques dans le but de déterminer la variation interannuelle des proportions de makaire épée et de makaire blanc à partir d’échantillons tissulaires archivés et prélevés lors d’un tournoi de pêche ayant lieu chaque année depuis 19 ans à Cape May, New Jersey (États-Unis) pendant la troisième semaine d'août. Dans l’ensemble, le makaire épée représentait 21,8 % des deux espèces confondues, mais cette proportion des deux espèces a connu une variation significative tout au long de la série temporelle. Le makaire épée représentait seulement 2,1 % des espèces confondues de 1992 à 2000, mais cette proportion s'est élevée à 33,3 % de 2002 à 2010. En outre, d’importantes variations annuelles des proportions relatives des deux espèces sont apparues au cours de la dernière décennie. Ces résultats donnent à penser qu’un vaste échantillonnage temporel sera nécessaire afin d'estimer avec précision les proportions relatives des deux espèces dans une région spécifique.

RESUMEN

La reciente confirmación de la presencia de marlín peto (Tetrapturus georgii) en el Atlántico norte occidental indica que los desembarques históricos de la morfológicamente similar aguja blanca (Kajikia albida) incluyen probablemente marlín peto mal clasificado. El objetivo de este estudio es utilizar caracteres genéticos para determinar la variación interanual en la proporción de marlín peto y aguja blanca a partir de muestras de tejido archivadas recopiladas en un torneo de pesca que se celebra anualmente en Cabo May, New Jersey (Estados Unidos) durante la tercera semana de agosto desde hace 19 años. En conjunto, el marlín peto representaba el 21,8% de las dos especies combinadas pero existía una variación importante en la proporción de las dos especies a lo largo de la serie temporal. El marlín peto representaba el 2,1% de las especies combinadas entre 1992-2000, pero representaba el 33,3% de las especies combinadas entre 2002-2010. También existía una considerable variación de

1 Virginia Institute of Marine Science, College of William & Mary, P.O. Box 1346, Gloucester Point, VA 23062 USA; [email protected]; [email protected]

1543

año en año en la proporción relativa de las dos especies durante la década pasada. Estos resultados sugieren que será necesario un muestreo temporal amplio para estimar de forma precisa la proporción relativa de las dos especies en una localización particular.

KEYWORDS

Species identification, temporal abundance, DNA, white marlin, roundscale spearfish

1. Introduction

The roundscale spearfish (Tetrapturus georgii) was originally described in the nineteenth century from a single specimen from the island of Madeira in the Atlantic Ocean. Robins and de Sylva (1960) questioned the validity of the species, especially with the lack of a holotype; however, based on the examination of four specimens from the eastern Atlantic, Robins (1974) considered the species to be valid. Nakamura’s (1985) review of the world’s billfish included the roundscale spearfish, but in the introduction to the genus Tetrapturus it was noted “This genus includes six species of which one (Tetrapturus (sic) georgei) still requires proof with regard to its validity. The possibility of existence of a seventh species, the so-called hatchet marlin (Tetrapturus sp.) is even more doubtful.”

The validity of the roundscale spearfish was clearly affirmed by Shivji et al. (2006). The findings of Shivji et al. (2006) were supported by a molecular phylogeny of the extant billfishes conducted by Collette et al. (2006). Their analysis of mitochondrial gene regions and a nuclear gene region included samples of both the putative hatchet marlin and roundscale spearfish. Analyses indicated hatchet marlin (thought to be a variant of the white marlin) and roundcale spearfish were, in fact, the same species. Furthermore, roundscale spearfish (including those identified as hatchet marlin) were found to comprise a distinct species that clustered most closely with the other spearfishes. Subsequent work by Beerkircher et al. (2008) demonstrated that the truncated fin morphology thought to be a defining character of “hatchet marlin” is present in a subset of both white marlin and roundscale spearfish.

Due to the close morphological similarity of white marlin and roundscale spearfish, as well as the uncertainty regarding the existence of the latter species, it is likely that some roundscale spearfish have been misclassified as white marlin, adding uncertainty to the historical catch records of white marlin. Recent work has provided information on the relative proportion of white marlin and roundscale spearfish in some areas of the Atlantic, and seasonal changes in the proportion of the two species have been noted (Beerkircher et al. 2008; 2009). In preparation for the 2012 SCRS assessment of white marlin, efforts are being made to obtain an estimate of the proportion of white marlin and roundscale spearfish at locations throughout the Atlantic Ocean, using samples that were collected opportunistically in various areas at different times. To better understand the significance of the spatial analysis, it is important to have an estimate of temporal variation of the proportion of these species at specific locations. The objective of this study was to use genetic characters to determine interannual variation in the proportion of roundscale spearfish and white marlin samples collected at the same time of year in one geographic location.

2. Materials and methods

2.1 Sample collection

We collected and archived 271 tissue samples of putative white marlin (including roundscale spearfish) from individuals landed at the Mid-Atlantic $500,000 Billfish Tournament from 1992-2010. This tournament is held during the third week of August out of Cape May, New Jersey, and participants are restricted to fishing in an area within 125 nmi of the Cape May sea buoy. The tournament includes “hatchet marlin”, a morphological variant that comprises roundscale spearfish and some white marlin in the white marlin category. Due to a federal minimum size of 66 inches (lower jaw fork length) and a tournament minimum weight of 60 lbs (65 lbs as of 2009), only the largest 2 - 5% of putative white marlin caught are landed and brought to the weigh station where they are available for examination and tissue sampling.

1544

2.2 Genetic analyses

Total genomic DNA was extracted from each sample, using the Qiagen Dneasy Tissue Kit (Qiagen Corp., Valencia, CA) according to the manufacturer’s directions. White marlin and roundscale spearfish samples were identified to species using the PCR/restriction fragment analysis method of McDowell and Graves (2002) and in cases of uncertainty, direct sequencing.

For the PCR/restriction fragment analysis method, putative roundscale spearfish were identified to species via PCR amplification of the nuclear locus MN32-2 (Buonaccorsi et al., 1999), and subsequent restriction fragment length polymorphism (RFLP) analysis using the enzymes Dra I and Dde I (New England Biolabs, Ipswich, Massachusetts) following the protocols of McDowell and Graves (2002). PCR reactions were 25 μl in total volume and consisted of 0.25 μl template DNA, 2.5μl 10X PCR buffer plus magnesium, 0.5μl dNTP mix, 0.25μl forward primer (BM32-2F: GTAGCAAGGGGCTGTTGCATAG), 0.25μl reverse primer (BM32-2R: GAGTCAGTGGTTCGGGATTTTATC), 0.125μl Taq DNA polymerase, and 21.125μl PCR grade water. Primers were ordered from Invitrogen (Gaithersburg, Maryland). PCR reactions were carried out in an MJ Research Corporation PTC-200 Peltier Thermal Cycler using Taq PCR Core reagents (Qiagen Corp.). Amplifications of BM32-2 were carried out under the following conditions: initial denaturation at 95οC for 5 min., 40 cycles of 94οC for 1 min., 57οC for 1 min., 65οC for 3 min., and a final extension at 72οC for 7 min. Restriction fragments were separated on 2.5% horizontal agarose gels made from 1.25% UltraPure agarose (Invitrogen) and 1.25% NuSeive GTG agarose (FMC BioProducts, Rockland, Maine), and visualized under UV light after staining with ethidium bromide. Fragment sizes were estimated by comparison with a 1 kb+ size standard, (Invitrogen) and identified to species using restriction profiles published in McDowell and Graves (2002). Restrictions profiles for roundscale spearfish, which were not included in McDowell and Graves (2002), were generated as above and are distinct from profiles for other istiophorid billfishes.

Uncertainties in identifications were resolved by sequencing the mitochondrial control region using Taq PCR Core reagents (Qiagen Corp.) with control region primers containing M13 tails; Pro5 M13F (5’ CAC GAC GTT GTA AAA CGA CCT ACC YCY AAC TCC CAA AGC K) and dloopi M13R (5’ GGA TAA CAA TTT CAC ACA GGC CAT CTT AAC ATC TTC AGT G) (K. Gray and J. McDowell, unpublished). Amplified products were purified by column filtration (QIAquick PCR Purification, Qiagen Corp.) prior to DNA sequencing. Purified PCR products were sequenced in forward and reverse directions using BigDye Terminator v3.1 Cycle Sequencing reagents (Applied Biosystems, Warrington, UK). Amplification products were electrophoresed on an ABI 3130xl sequencer equipped with an 80cm capillary and results were analyzed using SEQUENCING ANALYSIS 5.2 software (Applied Biosystems, Warrington, UK). Standard chromatogram format (SCF) curves were exported for subsequent analyses and consensus sequences of forward and reverse reactions will be created using SEQUENCHER 4.10.1 (Gene Codes Corp., Ann Arbor, Michigan). All sequences were aligned with sequences from Collette et al. (2006) using the CLUSTAL W algorithm (Thompson et al. 1994) in MACVECTOR 8.1.2 (Accelrys Inc., San Diego California) and identified based on alignments with representative sequences from Atlantic billfish species via neighbor joining analysis in PAUP* 4.0 (Swofford 2003).

3. Results and discussion

Molecular characters were used to identify the species composition of sixteen annual collections comprising 271 individuals of putative white marlin sampled at the annual Mid-Atlantic $500,000 Billfish Tournament in Cape May, NJ from 1992-2010. Archived tissues from three years (1997, 1999, and 2001) were not available for analysis. As is evident from the data in Table 1, roundscale spearfish were rarely landed in the tournament during the 1990s. In fact, roundscale spearfish comprised only 2 of 96 (2.1%) putative white marlin samples collected from 1992-2000. Beginning in 2002, the frequency of roundscale spearfish in the collections dramatically increased. In 2003, 2005, and 2010, the majority of putative white marlin brought to the weigh station were, in fact, roundscale spearfish. For the period from 2002 through 2010, 57 of 175 (32.6%) of putative white marlin were identified as roundscale spearfish. For the entire sampling period (1992-2010), roundscale spearfish comprised 57 of 271 (21.8%) of the tournament landings.

The difference in the proportion of roundscale spearfish between the first and second half of the time series is striking, as is the interannual variation during the last ten years. It is important to note that the tournament landings represent only the largest 5% of the putative white marlin caught, and may not reflect the proportion of the two species in smaller size classes. Furthermore, the tournament fishing occurs over a narrow time window and in a relatively restricted area (125 nmi from the Cape May sea buoy), and as such, could be influenced by

1545

local oceanographic conditions. Despite these caveats, these data demonstrate a very high degree of interannual variation in the relative proportion of the two species in the same location at the same time of year.

Seasonal variation in the proportion of white marlin and roundscale spearfish has been previously reported. Beerkircher et al. (2008) noted a high proportion of roundscale spearfish in U.S. pelagic longline catches from the Sargasso Sea, especially during the winter months. Additional analyses of vessels fishing in the same area during summer months showed a very low abundance of roundscale spearfish relative to white marlin, indicating seasonal movements (Beerkircher et al. 2009). Similarly, Arocha and Silva (2010) analyzed observer records from the Venezuelan pelagic longline fleet and noted a seasonal change in the proportion of the two species in the northwest Caribbean, with a higher proportion of roundscale spearfish in the latter half of the year.

For the upcoming white marlin assessment it would be useful to be able to remove misidentified roundscale spearfish from the historical landings of white marlin. However, the results of this and other studies suggest that obtaining an accurate estimate the relative proportions of the two species throughout the Atlantic based on historical data will be difficult, if not impossible. Based on an analysis of observed landings from the Venezuelan longline fleet, Arocha and Silva (2010) recommended that spatial analyses be done on a scale of 1° squares. The results of Beerkircher et al. (2009) and Arocha and Silva (2010) suggest that areas should be sampled seasonally as well. Finally, the results of this study demonstrate strong interannual and decadal variation, suggesting that long term sampling will be needed to address this question.

References

Arocha, F., and Silva, J. 2010, Proportion of Tetrapturus georgii (SPG) with respect to T. albidus (WHM) in the Venezuelan pelagic longline catch in the western Caribbean Sea and adjacent Atlantic waters during 2002-2007. Collect. Vol. Sci. Pap. ICCAT, 66(4): 1787-1793 (2011).

Beerkircher, L.R., Lee, D.W. and Hinteregger, G.F. 2008, Roundscale spearfish Tetrapturus georgii: morphology, distribution, and relative abundance in the western North Atlantic. Bull. Mar. Sci. 82:155- 170.

Beerkircher, L., Arocha, F. Barse, A., Prince, E., Restrepo, V., Serafy, J. and Shivji, M. 2009, Effects of species misidentification on population assessment of overfished white marlin Tetrapturus albidus and roundscale spearfish T. georgii. Endangered Species Res. 9:81-90.

Buonaccorsi, V.P., Reece, K. S. Morgan, L W., and Graves, J. E. 1999, Geographic distribution of molecular variance within the blue marlin (Makaira nigricans): A hierarchical analysis of allozyme, single-copy nuclear DNA, and mitochondrial DNA markers. Evolution 53(2): 568-579.

Collette, B.B., McDowell, J.R. and Graves, J.E. 2006, Phylogeny of Recent billfishes (Xiphioidei). Bull. Mar. Sci. 79:455-468.

McDowell, J.R., Graves, J.E. 2002, Nuclear and mitochondrial DNA markers for specific identification of istiophorid and xiphiid billfishes. Fish. Bull. 100(3): 537-544.

Nakamura, I. 1985, FAO species catalogue. Vol. 5: Billfishes of the world: an annotated and illustrated catalogue of marlins, sailfishes, spearfishes and swordfishes known to date. FAO Fish Synop 125, 65p.

Robins, C.R. 1974, The validity and status of the roundscale spearfish, Tetrapturus georgei. Proceedings of the first international billfish symposim. R.S. Shomura and F. Williams (Eds.) NOAA Tech. Rep. NMFS SSRF-675: 54-61.

Robins, C.R., and de Sylva, D. P. 1960, Description and relationships of the longbill spearfish, Tetrapturus belone, based on western North Atlantic specimens. Bull. Mar. Sci. 10:383-413.

Shivji, M.S., Magnussen, J.E., Beerkircher, L.R., Hinteregger, G., Lee, D.W., Serafy, J.E. and Prince, E.D. 2006, Validity, identification, and distribution of the roundscale spearfish, Tetrapturus georgii (Teleostei: Istiophoridae): morphological and molecular evidence. Bull. Mar. Sci. 79: 483-491.

1546

Swofford, D.L. 2003, PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. SInauer Associates, Sunderland, MA.

Thompson, J.D., Higgins, D.G. and Gibson, T.J. 1994, Culstal W: improving the sensitivity of multiple sequence alignment through sequence weighting, specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680.

Table 1. Species composition of putative white marlin landed at the Mid-Atlantic $500,000 Billfish Tournament in Cape May, New Jersey. The fish brought to the weigh station represent the largest 5% of the catch.

Year White marlin Roundscale spearfish % Roundscale spearfish 1992 13 0 0 1993 18 2 11.1 1994 21 0 0 1995 10 0 0 1996 18 0 0 1998 11 0 0 2000 3 0 0 2002 6 3 33.3 2003 3 9 75.0 2004 12 2 14.3 2005 4 10 71.4 2006 11 3 21.4 2007 16 7 30.4 2008 29 2 6.0 2009 24 4 14.3 2010 13 17 56.7

1992-2000 94 2 2.1 2001-2010 118 57 32.6

Total 212 59 21.8

1547