sign in sign up
<<
Home , Blacktip grouper, Camouflage grouper, Cephalopholis, Cephalopholis fulva, Cephalopholis taeniops, Comet grouper

Food Control 31 (2013) 337e344

Contents lists available at SciVerse ScienceDirect

Food Control

journal homepage: www.elsevier.com/locate/foodcont

Ensuring seafood identity: identification by real-time nucleic acid sequence-based amplification (RT-NASBA)

Robert M. Ulrich a, David E. John b, Geran W. Barton c, Gary S. Hendrick c, David P. Fries c, John H. Paul a,* a College of Marine Science, MSL 119, University of South , 140 Seventh Ave. South, St. Petersburg, FL 33701, USA b Department of Biological Sciences, University of South Florida St. Petersburg, 140 Seventh Ave. S., St. Petersburg, FL 33701, USA c EcoSystems Technology Group, College of Marine Science, University of South Florida, 140 Seventh Ave. S., St. Petersburg, FL 33701, USA article info abstract

Article history: Grouper are one of the most economically important seafood products in the state of Florida and their Received 19 September 2012 popularity as a high-end restaurant dish is increasing across the U.S. There is an increased incidence rate Accepted 3 November 2012 of the purposeful, fraudulent mislabeling of less costly and more readily available fish as grouper in the U.S., particularly in Florida. This is compounded by commercial quotas on grouper becoming Keywords: increasingly more restrictive, which continues to drive both wholesale and restaurant prices higher each RT-NASBA year. Currently, the U.S. Food and Drug Administration recognize 56 species of fish that can use “grouper” FDA seafood list as an acceptable market name for interstate commerce. This group of fish includes species from ten Grouper fi fi Mislabeling different genera, making accurate taxonomic identi cation dif cult especially if distinguishing features such as skin, head, and tail have been removed. This is leading regulatory agencies to employ genetic identification methods which tend to have much higher species-level resolution than phenotypic methods. Standard genetic identification methods are highly technical and require expensive lab-based equipment to perform, which often leads to longer turnover times. We have developed a generic grouper assay that detects the majority of the grouper species listed on the 2011 FDA Seafood List, including all of the species found in Florida waters. This assay is based upon real-time nucleic acid sequence-based amplification (RT-NASBA) targeting mitochondrial 16S rRNA for the accurate detection of grouper. This assay can be performed in fewer than 90 min with little potential for cross-reactivity from non-target species. Ó 2012 Elsevier Ltd. All rights reserved.

1. Introduction prevention by the Department of Homeland Security’s Customs and Border Protection (CBP), and the Department of Commerce’s A continuing challenge facing the seafood industry is the accu- National Marine Fisheries Service (NMFS). rate identification of fish sold by wholesalers, seafood markets, and One of the most important commercial seafood products in the restaurants. Cases of fraudulent mislabeling of lesser-valued state of Florida is grouper. According to the Florida Department of species as more valuable species are becoming more common as Agriculture and Consumer Services, this iconic seafood product was commercial quotas on certain high valued species become more the most valuable finfish harvested in Florida in 2010, with restrictive. With finfish species, this of fraud is often made a dockside value estimated at over $14 million (Putnam, 2010). The possible due to similarities in texture, appearance, and taste when high demand and increased commercial regulation posed on in fillet form (Buck, 2010, pp. 1e15). Accurate identification of fillets grouper has led to an increase in the purposeful mislabeling of becomes even more difficult after the fish has been prepared and cheaper finfish as “grouper” in an effort to commit economic fraud cooked to edible presentations served in restaurants. The U.S. Food by both wholesalers and restaurants. In 2008, a $300,000 settle- and Drug Administration (FDA) is the principal federal agency ment was reached between the Florida Attorney General and responsible for ensuring the accurate labeling of food sold in a prominent seafood wholesaler for the purposeful mislabeling of interstate commerce, and is aided in international seafood fraud Asian catfish as “grouper” (Nohlgren, 2008, p. A2). In 2012, similar charges were brought against a California-based wholesaler amounting to a fine of $1 million and a three year probation period

* Corresponding author. Tel.: þ1 727 553 1168; fax: þ1 727 553 1189. (Staff, 2012). Sole fault of seafood wholesalers in the consumer- E-mail addresses: [email protected], [email protected] (J.H. Paul). level consumption of mislabeled grouper is not always warranted

0956-7135/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.foodcont.2012.11.012 338 R.M. Ulrich et al. / Food Control 31 (2013) 337e344 as several high-profile investigations have targeted restaurants as equipment, gel imaging apparatus (typically UV light generation), well (Copes, 2007; Nohlgren, 2007, p. A1; Staff, 2011). One inves- and expensive gel analysis software. tigation uncovered that 17 of 24 Tampa Bay (FL) area restaurants DNA barcoding is the latest evolution of DNA-based methods for surveyed were serving imposter fish instead of grouper, as ordered seafood species identification. This technique involves PCR ampli- from the menu. Substituted species were found to be to be emperor fication of a specific gene locus, typically the mitochondrial cyto- (generally a Lethrinus spp.), hake (typically Urophycis or Merluccius chrome c oxidase subunit I gene (COI), and performing DNA spp.), sutchi (Pangasius hypophthalmus), bream (numerous species sequencing reactions on the amplified gene target. This produces are considered bream), green weakfish (Cynoscion virescens) and an exact DNA nucleotide sequence (w650-bp) of the COI gene for painted sweetlips ( pictum)(Copes, 2007). the tested sample. This unknown sequence is then referenced to an The proper identification of seafood relies on the correct use of online database containing known reference sequences obtained standard market names as many global species have differing indig- from verified, or vouchered, specimens (Yancy et al., 2008). The FDA enous vernacular names, and the use of scientific binomial nomen- recently approved DNA barcoding as a regulatory protocol to detect clature is often impractical in the seafood industry. Putative naming of seafood fraud, in consortium with the Barcode of Life (FISH- commercially important seafood fish is aided by the standardization BOL) Initiative (www.fishbol.org), which is an international effort of common names performed by professional societies (Nelson et al., to assemble a standardized reference DNA sequence library for all 2004). Moreover, the NMFS and FDA have cooperated in creating the fish species, using only vouchered reference specimens (Hanner, “Seafood List” which is a compilation of acceptable market names 2011). DNA barcoding methodology has advantages, such as the (including ) for both domestic and imported use of a standardized gene locus, and standardized laboratory seafood species (FDA, 2011). Currently, there are 56 species (all in the procedures for its amplification. However, this method still requires family ) spanning ten distinct genera of fish that can carry PCR amplification, and is even more daunting in required hardware, the acceptable market name “grouper” according to the FDA Seafood reagent, and expertise. Thus, DNA sequence analysis is typically List (FDA, 2011). Most of these species are included in three major outsourced to only a few labs that have this capacity, increasing cost genera: (32 species), (8 species), and Myc- and turn-around time for results. teroperca (8 species). The rest are included in 7 minor genera: An alternate molecular technique termed nucleic acid sequence- Aethaloperca (1 species), Anyperodon (1 species), Capradon (1 species), based amplification (NASBA) is similar to PCR in that both involve (1 species), Diplectrum (1 species), (2 the amplification of specific nucleic acid sequences via enzymatic species), and (1 species). This wide species diversity often reactions (Compton, 1991). However, NASBA targets ribonucleic makes accurate taxonomic identification difficult using only pheno- acid (RNA) rather than DNA as in PCR, and NASBA is carried out typic characteristics, and can become even more difficult when in isothermally (41 C) whereas PCR requires thermal cycling within fillet form with the head and skin removed. Therefore, it is now large temperature ranges up to 95 C. An extension of conventional common practice for seafood regulatory agencies to employ the use of NASBA by the incorporation of fluorescently-labeled molecular molecular (protein, DNA, and RNA) identification techniques, which beacons (Tyagi & Kramer, 1996) allows for real-time detection of offer much higher taxonomic resolution. NASBA amplicons (RT-NASBA) first described by Leone, van Various protein-based techniques including immunologic, Schijndel, van Gemen, Kramer, and Schoen (1998). Our lab has an electrophoretic, and chromatographic methods have been extensive knowledge base in the development of RT-NASBA assays employed to identify seafood species. Immunologic methods tend used to detect several microbiological organisms (Casper, to be best suited for high-throughput sample analysis, whereas Patterson, Smith, & Paul, 2005; Casper, Paul, Smith, & Gray, 2004; chromatographic and electrophoretic methods are technologically Delaney, Ulrich, & Paul, 2011; Patterson, Casper, Garcia-Rubio, complex and require specialized facilities and instrumentation not Smith, & Paul, 2005; Patterson et al., 2006; Ulrich et al., 2010), routinely available to seafood regulatory agencies (Rasmussen & and we have recognized its potential applications in the accurate Morrissey, 2008). Until very recently (2011), protein isoelectric and timely identification of seafood species. focusing (IEF) of soluble muscle proteins (electrophoretic tech- Both ribosomal (mitochondrial rDNA) and COI genes have nique) was the standard method for seafood species identification previously been evaluated using both PCR and real-time PCR (RT- used by the FDA (AOAC, 1980). This method has been described as PCR) assays to accurately identify grouper species (Asensio, somewhat unreliable for species-level identification for heat- Gonzalez, Rojas, Garcia, & Martin, 2009; Chen et al., 2012; Trotta processed or dried fish products, and thus may not be suitable for et al., 2005). There is evidence that the 16S rRNA gene is use on cooked fish (Rasmussen & Morrissey, 2008). Recent research adequate for discriminating some Epinephelus and has been focused toward the use of nucleic acid-based technologies species from non-target species (Trotta et al., 2005). However the for more accurate identification of seafood species. Due to the COI target gene may be better suited for accurately identifying degeneracy of some gene sequences and the presence of non- some of the Asian market , such as Plectropomus and coding regions that are not translated to proteins, nucleic acid Caprodon species (Chen et al., 2012). Taking this evidence into sequence analysis offers increased resolution in identifying fish account, as well as the understanding that rRNA tends to be more species over protein-based techniques (Rasmussen & Morrissey, resistant to degradation than messenger RNA (mRNA), which is the 2008). Typically, DNA-based methods of fish identification form of COI RNA in tissue cells (Houseley & Tollervey, 2009; employ the use of polymerase chain reaction (PCR) to amplify Mitchell & Tollervey, 2000), we chose to target 16S rRNA in the target genes for subsequent use in random amplified polymorphic development of this assay. Moreover, there is an abundance of 16S DNA analyses (DNA-RAPD) (Asensio et al., 2002), PCR restriction rDNA sequence information from numerous fish species in public fragment length polymorphic (PCR-RFLP) (Asensio et al., 2000), and databases (i.e. GenBank) to aid in bioinformatic analysis used in PCR-single strand conformational polymorphism (PCR-SCCP) gene target design. Here we report the development of a 90 min (Asensio et al., 2001). These techniques all produce electrophoretic multiplex RT-NASBA assay targeting a portion of the mitochondrial DNA banding patterns which are referenced to a database gener- 16S ribosomal RNA (rRNA) gene for the accurate identification of ated from vouchered specimens also generated by their respective most grouper species on the FDA Seafood List with no cross- method. PCR-based methodologies require bench-top thermal reactivity to non-target species. We also provide evidence that cyclers which have cycling capacities ranging from approximately this assay can verify or negate the claim of grouper even when 50 Cto95C. These techniques also require electrophoretic testing previously cooked fish. R.M. Ulrich et al. / Food Control 31 (2013) 337e344 339

2. Materials and methods Museum & Biodiversity Research Center, Division of (Lawrence, KS); University of South Florida (USF), College of Marine 2.1. Sequencing 16S rDNA from grouper tissue Science, David Mann Lab; and Bama (BAMA) Sea Products, Inc. (St. Petersburg, FL) (Table 1). Tissue samples were received frozen or Numerous fish samples were obtained from several sources were preserved in 99% ethanol (KU), 50% isopropanol (SCRIPPS), or including: The National Oceanic and Atmospheric Administration without preservatives (NOAA, BAMA, and USF). To verify correct (NOAA), Southeast Fisheries Science Center (Charleston, SC); species identity for each tissue sample, as well as provide additional SCRIPPS Institution of Oceanography (SCRIPPS), Marine Vertebrates sequence information for RT-NASBA primer and molecular beacon Collection (La Jolla, CA); University of Kansas (KU) Natural History design, 16S rDNA sequence analysis was performed. DNA was

Table 1 Fish species permitted by the FDA (2011) to be sold as grouper in the U.S. and tissue samples used for assay validation.

Latin binary name Common name GenBank accession number Tissue sample designation Tissue sample source from source Epinephelus acanthistius Gulf coney HQ010109 19-74-2a NOAA Epinephelus areolatus Persian grouper DQ088038 07-77 SCRIPPS Epinephelus coioides Orange-spotted grouper JF750751 64-235 SCRIPPS Epinephelus diacanthus Spineycheek grouper DQ088043 No designation BAMA Epinephelus fasciatus DQ088039 5716a KU Epinephelus flavolimbatus Yellowedge grouper AF297293 1142a KU Epinephelus guttatus AF297299 ST159EGa NOAA Epinephelus hexagonatus Starspotted grouper DQ154106 5729a KU Epinephelus itajara Goliath AY857953 18-60-2a NOAA Epinephelus lanceolatus AY947588 6779a KU Epinephelus macrospilos Snubnose grouper AY731072 4173a KU Epinephelus malabaricus DQ067309 10-117 SCRIPPS Epinephelus marginatus Dusky grouper HQ592229 04-60 SCRIPPS Epinephelus morio AY857954 No designation USF Epinephelus nigritus Warsaw grouper AF297297 5439a KU Epinephelus niveatus AF297310 8347a KU Epinephelus polyphekadion Camouflage grouper EF503628 5464a KU Epinephelus striatus AF297311 305a KU Black grouper AF297315 ST017MBa NOAA Mycteroperca interstitialis Yellowmouth grouper AY947632 07-77 SCRIPPS Mycteroperca jordani AF297329 06-40 SCRIPPS Gag AF297312 No designation USF Mycteroperca tigris AY947574 104a KU Mycteroperca venenosa Yellowfin grouper AF297291 MVEN001a NOAA Broomtail grouper AY947637 07-77 SCRIPPS Purplespotted grouper DQ067315 5493a KU Cephalopholis cruentata AF297323 2424a KU Coney AF297292 219a KU Cephalopholis miniata Coral hind EF213713 6806a KU Spotted grouper AY947589 04-39 SCRIPPS Chevron tailed grouper EF213705 5554a KU Anyperodon leucogrammicus EF503630 7002a KU Plectropomus areolatus Squaretail coralgrouper EF213706 10-117 SCRIPPS Variola louti Yellow-edged lyretail DQ067319 7159a KU Diplectrum formosum Sand perch AY539048 3980a KU Caprodon schlegelii Grouper Sequence unavailable Cephalopholis spiloparaea Strawberry hind Sequence unavailable Plectropomus leopardus Leopard coralgrouper DQ067321 Aethaloperca rogaa EF503626 Epinephelus chlorostigma Brownspotted rockcod DQ088036 Epinephelus fuscoguttatus JF750752 Epinephelus maculatus Highfin grouper AY731068 Epinephelus merra Speckled dwarf grouper AY947629 Epinephelus miliaris Netfin grouper AY947634 Epinephelus morrhua AY947630 Epinephelus mystacinus Misty grouper AF297304 Epinephelus radiatus Oblique-banded grouper DQ067304 Halfmoon grouper AY947586 Epinephelus sexfasciatus Sixbar grouper DQ067310 Epinephelus tauvina Greasy rockcod EF213710 Wavy lined grouper DQ088041 Tomato hind HQ592261 Dermatolepis inermis AY314005 Mycteroperca rubra Comb grouper GQ485301 Epinephelus aeneus GQ485302 Epinephelus bleekeri Dusty tail grouper DQ088042

GenBank accession numbers represent a portion of the 16S rDNA gene for each species used in Clustal alignments. Sequences obtained from tissue samples are not from the same specimens referenced in GenBank. Minus sign designates species not available for tissue analysis. a Tissue from vouchered specimens. 340 R.M. Ulrich et al. / Food Control 31 (2013) 337e344

Ò extracted and purified from tissues using DNeasy Blood & Tissue concentration of 400 nM, and the three molecular beacons were Kit (Qiagen, Valencia, CA) per manufacturer’s instructions for diluted to a final concentration of 100 nM each. The optimal KCL tissues. A highly conserved portion of the 16S rDNA gene concentration was determined to be 80 mM (data not shown). To (w500-bp) was amplified using PCR utilizing oligonucleotide maximize the number of reactions per kit, 10 ml reaction volumes primers designed in our lab (forward primer, 50-TATAA- were used (half the volume recommended by bio-Mérieux) con- GAGGTCCCGCCTG-30; reverse primer, 50-ACAAACGAACCCTTAA- taining 5 ml reagent mix (containing primers and beacons), 2.5 ml Ò TAGC-30). The resulting amplicons were TOPO TA cloned into RNA template, and 2.5 ml enzyme mix. RT-NASBA amplification Ò a pCR II cloning vector (Invitrogen, Carlsbad, CA) per manufac- and fluorescence detection were carried out at 41 C for 90 min Ò turer’s instructions and were sequenced using the Sanger method using a NucliSENS EasyQ analyzer (bio-Mérieux, Durham, NC). A at the DNA Sequencing Core at the University of Florida. defined fluorescence value was chosen as a positive signal level to be used in all subsequent assays. Typically, this value was 0.25 2.2. Primer and molecular beacon design relative fluorescence units (rfu) above the final fluorescence generated from a negative control reaction (generally 1.35 rfu). Target 16S rDNA sequences from grouper species obtained from The time at which target amplification curves reached the GenBank and sequencing efforts in our lab as well as numerous threshold level was recorded as the time to positivity (TTP) in non-target GenBank sequences from likely imposter fish (i.e. minutes for each reaction. Tilapia, Emperor, Hake, Catfish, Bream, and Sea Bass) were aligned using the Clustal W 1.6 algorithm (Thompson, Higgins, & Gibson, 2.4. RT-NASBA on cooked samples 1994) in the MEGA 5 software package (Tamura et al., 2011). Forward and reverse primers were designed to target a conserved, We obtained three frozen filets of Epinephelus diacanthus 136-bp region of the 16S rDNA gene. Primers were analyzed for (Spineycheek Grouper) from Bama Sea Products, Inc., which is self- and hetero-dimerization using OligoAnalyzer 3.1 primer a major seafood wholesaler in Florida that regularly authenticates design tool (http://www.idtdna.com/analyzer/applications/oligoa their imported fish samples using outsourced DNA lab testing. Each nalyzer/) and synthesized by Integrated DNA Technologies, Inc. filet had approximately the same size dimensions (17cm long 7cm (Coralville, IA) (Table 2). Due to target sequence heterogeneity wide 2 cm thick) and also weighed approximately the same found with some grouper species, a total of three molecular (110 g). Three separate tissue pieces (5 mg) were removed from each beacon variants were designed to target as many FDA grouper of the three filets while still frozen using a sterile biopsy punch and species as possible, while still allowing for non-target discrimi- RNA extraction and purification were carried out as described above. nation. Molecular beacons were designed internal of the two After allowing 3 h to thaw, each of the three filets was subjected to primers and labeled with 6-carboxyfluorescein (FAM) on the 50 pan-frying, which is a common method used by many restaurants end and DABCYL on the 30 end (Table 2). The three beacons were for grouper preparation. We performed a simplified version of synthesized by Eurofins MWG Operon (formerly Operon, Hunts- a recipe for fried grouper recommended by the Florida Department ville, AL). of Agriculture and Consumer Services’ Division of Marketing and Development (http://www.florida-agriculture.com/consumers/fnr/ fl fi 2.3. RNA extraction and RT-NASBA assay recipes/Seafood-4332.html). Brie y, each let was coated in an all- purpose flour, corn meal, and egg wash mixture. The filets were RNA was extracted and purification from both target and non- then pan-fried in canola oil (1-inch level) heated to 375 F(191 C) Ò fi target tissues using a slightly modified RNeasy Mini Kit protocol for 2 min on each side. Excess oil was removed from the lets by (Qiagen, Valencia, CA). Briefly, a small (5e10 mg) piece of tissue resting on a bed of absorbent paper toweling for 5 min. Three fi was removed from samples using a sterile, 2 mm biopsy punch separated pieces (5 mg) were removed from each cooked let using Ò fi (IntegraÔ Milex , York, PA) and placed into 500 ml RLT lysis buffer. a biopsy punch, taking care not to retain a signi cant amount of the fi After a 10 min incubation at room temperature with intermittent breading. RNA extraction and puri cation were again carried out on vortex agitation, 200 ml of 100% ethanol was added to the lysate. each cooked tissue sample as previously described. RT-NASBA The entire volume of lysate (attempting to exclude any un-lysed reactions were performed in triplicate for each tissue punch as tissue) was added to the RNA purification column, and the rest previously described. of the purification protocol was carried out per manufacturer’s instructions. Purified RNA was eluted from the column using 2.5. Phylogenetic and statistical analysis 100 ml nuclease-free water, and stored on ice until its use as RT- NASBA template. All RT-NASBA reactions were carried out in Phylogenetic analysis was performed on portions of mitochon- Ò triplicate for each tissue punch using NucliSENS EasyQ Basic Kit drial 16S rDNA gene sequences obtained from GenBank by (bio-Mérieux, Durham, NC). Primers were diluted to a final comparing evolutionary relatedness between target grouper species, as well as non-target species commonly used as grouper surrogates using the Neighbor-Joining method (Saitou & Nei, 1987) Table 2 within the MEGA 5 software package (Tamura et al., 2011). The RT-NASBA oligonucleotides. dendrogram is drawn to scale, using 1000 replicates in the boot- Oligonucleotide Sequence (50e30) strap test and the evolutionary distances were computed using the Grouper NASBA CCCCGCAAGGACCGAATGTA Maximum Composite Likelihood method (Tamura, Nei, & Kumar, forward primer 2004)(Fig. 1). Grouper NASBA AATTCTAATACGACTCACTATAGGG Summary statistics including mean calculations, standard reverse primer AGAAAGAGGAGATTGCGCTGTTA deviations, and significant relationships among means were Molecular beacon A [6-FAM]-CGATGCCATTCAC AACCAAGAGCGACGCATCG-[DABCYL] computed for variables of interest using GraphPad InStat version Molecular beacon B [6-FAM]-CGATGCCATTTA 3.00 (GraphPad Software, San Diego, CA). Differences among CAACCAAGAGCGACGCATCG-[DABCYL] average TTP between frozen and cooked grouper samples were Molecular beacon C [6-FAM]-CGAACATTCACAACCAAGAGTTCG-[DABCYL] determined using paired t-tests. All means were considered Italicized text indicates T7 RNA polymerase promoter site. significantly different when P < 0.05. R.M. Ulrich et al. / Food Control 31 (2013) 337e344 341

3. Results

3.1. RT-NASBA specificity

To confirm the species identity of tissue samples used to test the specificity of the RT-NASBA,16S rDNA sequences obtained from each sample were aligned with a member of their respective species entry in GenBank (Table 1). No tissue sample had less than 98% percent homology for the entire w500-bp 16S rDNA amplicon to its respective GenBank entry, and no sample had less than 100% homology in the 136-bp NASBA target sequence to its respective GenBank entry (data not shown). Phylogenetic analysis comparing 16S rDNA sequences obtained from GenBank illustrate cladal divergence between target and non-target fish, with minimal exceptions (Fig. 1). The RT-NASBA assays for all tissue samples were performed using a multiplex chemistry mix containing beacons A, B, and C using the same forward and reverse primers. The RT-NASBA assay was able to detect 29 of the 35 target grouper species tested. Target species not detected were; three Cephalopholis spp., one Plectropomus spp., one Variola spp., and one Diplectrum spp. All six of these non-detectable species have no less than four mismatched to any beacon variant (Table 3). The average TTP (min) for species with no more than one nucleotide mismatch for any beacon variant was 17.1 2.3, 30.3 1.8 for species with no more than two mismatches, and 42.1 2.4 for species with no more than three mismatches (Table 3). Typical RT-NASBA fluorescence signatures for the various levels of beacon heterogeneity are shown in Fig. 2. No target grouper species were detected having more than three beacon mismatches for any beacon variant, and none of the 14 non-target species tested were detected (Table 3). Seven of the 8 Florida grouper species listed by the Florida Department of Agriculture and Consumer Services’ Division of Marketing and Development (http://www.florida- agriculture.com/consumers/crops/seafoodproducts/species/ grouper/types.html) were positively detected using RT-NASBA including: Black Grouper (Mycteroperca bonaci), Gag (Mycteroperca microlepis), Yellowfin Grouper (Mycteroperca venenosa), Yellow- mouth Grouper (Mycteroperca interstitialis), Yellowedge Grouper (Epinephelus flavolimbatus), Snowy Grouper (Epinephelus niveatus), and Red Grouper (Epinephelus morio)(Table 3). The one other Florida grouper we were unable to obtain tissue samples for testing was Misty Grouper (Epinephelus mystacinus), which has zero nucleotide mismatches to at least one of the three molecular beacons deter- mined from GenBank alignments (data not shown).

3.2. RT-NASBA on cooked grouper samples

RT-NASBA was performed on three individual E. diacanthus filets both before and after cooking. This species of fish has no more than one nucleotide mismatch to any molecular beacon included in the RT-NASBA multiplex chemistry (Table 3). Average TTPs were calculated from triplicate RT-NASBA assays performed on three separate biopsy punch tissue samples obtained from each filet (Table 4). All replicate RT-NASBA reactions for all three cooked and non-cooked filets gave positive detection results. The average TTP for all RT-NASBA reactions from frozen tissues was 15.7 0.7; whereas the average TTP for all cooked tissues was increased to 18.4 1.5 (Table 4). There was a significant increase in average TTP for each of the three filets after being cooked (all P-values < 0.05) Fig. 1. Phylogenetic dendrogram comparing mitochondrial 16S rDNA sequence relat- however; rRNA from all cooked tissues was still able to be detected edness from FDA seafood list grouper species (highlighted in gray), as well as non- in less than 20 min. target species commonly used as imposters (not highlighted). Species representa- tives are accompanied by the GenBank accession number used in the comparison. Grouper species most commonly found in Florida waters are indicated with arrows. 4. Discussion

Given the high taxonomic diversity of fish that the FDA allows to be sold as grouper in the U.S., we provide evidence that the 342 R.M. Ulrich et al. / Food Control 31 (2013) 337e344

Table 3 RT-NASBA results testing tissues from target and non-target species.

Latin binary name Common name Tissue sample Molecular beacon nucleotide mismatches RT-NASBA Average detection TTP (min) ABC (stdev) Epinephelus acanthistius Gulf coney NOAA 19-74-2a 011þ 15.5 0.2 Epinephelus areolatus Persian grouper SCRIPPS 07-77 0 1 1 þ 16.4 0.3 Epinephelus coioides Orange-spotted grouper SCRIPPS 64-235 1 2 0 þ 16.0 2.2 Epinephelus diacanthus Spinycheek grouper BAMA no designation 0 1 1 þ 15.2 0.6 Epinephelus fasciatus Blacktip grouper KU 5716a 102þ 16.2 0.3 Epinephelus flavolimbatus Yellowedge grouper KU 1142a 011þ 14.8 1.2 Epinephelus guttatus Red hind NOAA ST159EGa 011þ 16.4 0.9 Epinephelus hexagonatus Starspotted grouper KU 5729a 122þ 19.4 0.4 Epinephelus itajara Goliath NOAA 18-60-2a 120þ 16.1 1.0 Epinephelus lanceolatus Giant grouper KU 6779a 120þ 15.3 0.2 Epinephelus macrospilos Snubnose grouper KU 4173a 011þ 15.8 1.4 Epinephelus malabaricus Malabar grouper SCRIPPS 10-117 1 2 0 þ 16.8 0.8 Epinephelus marginatus Dusky grouper SCRIPPS 04-60 1 0 2 þ 15.4 0.7 Epinephelus morio Red grouper USF no designation 0 1 1 þ 16.3 1.4 Epinephelus nigritus Warsaw grouper KU 5439a 011þ 15.7 1.7 Epinephelus niveatus Snowy grouper KU 8347a 011þ 16.4 0.8 Epinephelus polyphekadion Camouflage grouper KU 5464a 231þ 21.3 2.1 Epinephelus striatus Nassau grouper KU 305a 231þ 22.8 1.5 Mycteroperca bonaci Black grouper NOAA ST017MBa 122þ 19.0 2.1 Mycteroperca interstitialis Yellowmouth grouper SCRIPPS 07-77 1 0 2 þ 15.3 0.7 Mycteroperca jordani Gulf grouper SCRIPPS 06-40 0 1 1 þ 15.4 1.6 Mycteroperca microlepis Gag USF no designation 0 1 1 þ 16.8 0.9 Mycteroperca tigris Tiger grouper KU 104a 213þ 21.1 2.3 Mycteroperca venenosa Yellowfin grouper NOAA MVEN001a 122þ 21.2 1.6 Mycteroperca xenarcha Broomtail grouper SCRIPPS 07-77 1 0 2 þ 16.9 1.2 Cephalopholis argus Purplespotted grouper KU 5493a 545 NA Cephalopholis cruentata Graysby KU 2424a 434þ 42.2 2.3 Cephalopholis fulva Coney KU 219a 434þ 41.0 2.8 Cephalopholis miniata Coral hind KU 6806a 545 NA Cephalopholis taeniops Spotted grouper SCRIPPS 04-39 4 3 4 þ 43.2 2.6 Cephalopholis urodeta Chevron tailed grouper KU 5554a 545 NA Anyperodon leucogrammicus Slender grouper KU 7002a 324þ 30.3 1.8 Plectropomus areolatus Squaretail coralgrouper SCRIPPS 10-117 8 7 8 NA Variola louti Yellow-edged lyretail KU 7159a 677 NA Diplectrum formosum Sand perch KU 3980a 656 NA Pangasius hypophthalmusb Swai catfish Market 6c 6c 6c NA furciferb Creole-fish Market 6c 6c 6c NA Lethrinus nebulosusb Emperor fish Market 6c 6c 6c NA Unknown speciesb Sea bass Market 6c 6c 6c NA Unknown speciesb Porgy Market 6c 6c 6c NA Unknown speciesb Tilapia Market 6c 6c 6c NA Unknown speciesb Corvina Market 6c 6c 6c NA Unknown speciesb Hake Market 6c 6c 6c NA Gadus morhuab Atlantic cod Market 6c 6c 6c NA Unknown speciesb Catfish Market 6c 6c 6c NA Unknown speciesb Flounder Market 6c 6c 6c NA Melanogrammus aeglefinusb Haddock Market 6c 6c 6c NA Unknown speciesb Triggerfish USF no designation 6c 6c 6c NA Coryphaena hippurusb Mahiemahi BAMA no designation 6c 6c 6c NA

a Denotes a vouchered specimen. b Denotes a non-target fish. c Denotes molecular beacon mismatches when referencing non-target 16S rDNA sequences from same species entries in GenBank, or members of the same if species is unknown.

multiplex RT-NASBA assay described here targeting 16S rRNA can noticed that the inclusion of four beacon variants into a single RT- be useful in the accurate detection of most of these species, NASBA master mix detrimentally increased the background fluo- including all of groupers commonly caught in Florida waters. This is rescence and also decreased the specificity of the overall assay important in that many restaurants not only claim to serve grouper, (data not shown). but also often claim to serve “Fresh from Florida Grouper.” Thus, Unfortunately, two grouper species listed on the FDA Seafood applications of this assay may be optimally suited for grouper retail List (Caprodon schlegelii and Cephalopholis spiloparaea) had no 16S in Florida. Of the 35 target grouper species we could obtain tissue rDNA sequence submissions in GenBank, nor were we able to from, we were able to successfully detect 29 of them using RT- obtain any tissue samples from these species. Thus, we are NASBA. The six species that were undetectable had exceeded the currently unable to make any assumptions about the potential for threshold of nucleotide mismatch for our three molecular beacon accurate detection of these species using the RT-NASBA assay. We variants. We have performed some research using a fourth beacon were, however, able to obtain 16S rDNA sequence information from variant ([6-FAM]-CGATCGCGTTTACAACCAAGAGCTACCGATCG-[DA GenBank for the remaining 19 target grouper species for which we BCYL]) that may better target some of the outlying Cephalopholis were unable to obtain tissues from. Fortunately, sequence align- spp. (no more than two mismatches to any species). However, we ments performed on entries from each of these species presented R.M. Ulrich et al. / Food Control 31 (2013) 337e344 343

3 A 3 B

2 2

1 1 Fluorescence value

0 0 0 20 40 60 80 100 0 20 40 60 80 100

3 C 3 D

2 2

1 1 Fluorescence value

0 0 0 20 40 60 80 100 0 20406080100 Time (min) Time (min)

Fig. 2. Typical RT-NASBA amplification plots for four levels of molecular beacon heterogeneity. Panel (A) represents at least one beacon having no more than one nucleotide mismatch with the target sequence. Panel (B) represents no more than two mismatches; panel (C), no more than three mismatches; and panel (D), more than three mismatches. Thin, horizontal line is the detection threshold, set at 1.35. no more than two mismatches to any one beacon variant used in preserved tissue. More research needs to be performed on cooked the RT-NASBA assay, most having less than two mismatches (data filets from alternate grouper species to better define the limitations not shown). Thus, there is no evidence to suggest any of these 19 of the assay on species with greater beacon heterogeneity. species would not be accurately detectable using the current One significant advantage that RT-NASBA has over RT-PCR is the multiplex RT-NASBA assay given that a maximum of two high potential for integration into hand-held sensor assay appli- mismatches is within the beacon heterogeneity threshold of all cations that can be performed in real-time on location, decreasing other species tested. Moreover, we were able to support the spec- turnover time significantly. Due to the isothermal (41 C) nature of ificity of the RT-NASBA assay by testing 14 non-target species, often NASBA amplification, adaptability to remote sensing platforms is sold as imposter grouper, for cross-reactivity. None of the non- more practical than molecular assays requiring thermal cycling for target species generated a positive detection over the 1.35 detec- amplification, as thermal cycler machines tend to be very bulky and tion threshold set for the assay. have very high power demands. We have developed a prototype We also present evidence that the RT-NASBA assay may have hand-held NASBA analyzer for the detection of harmful algal practical applications in the testing of cooked grouper samples bloom-causing organisms (Casper et al., 2007), and are currently served in restaurants. We were able to generate positive fluores- developing a next-generation hand-held NASBA analyzer that is cence detection on tissues from three filets of Spineycheek Grouper being optimized for the accurate identification of grouper species (E. diacanthus) after being cooked at 375 F(191C). It is important by employing the RT-NASBA assay described herein. This type of to note that these were the only full-sized filets that could be ob- technology, coupled with an accurate and timely molecular assay tained from a reputable seafood wholesaler that regularly tests such as RT-NASBA, has the potential for a myriad of commercial and their imported grouper using outsourced DNA analysis at the time regulatory applications in seafood forensics. of publication, and that this species has 100% homogeneity to one of the beacon variants. Moreover, there was a statistically signifi- Acknowledgments cant increase in the TTPs for all replicate assays after the tissue was cooked. Thus, positive detection of cooked tissues may prove This article is the result of research funded by the Florida Sea unreliable when testing species with higher beacon heterogeneity Grant project R/LR-Q-33-Grouper Forensics for Seafood Quality which already tend to have large TTPs when assaying frozen or Control awarded to JHP, as well as an endowment from the Guy Harvey Foundation and support from the Gulf and South Table 4 Atlantic Fisheries Foundation, Inc. to USF. RT-NASBA on cooked grouper samples and paired t-test analysis. We would like to express our gratitude to Trey Knott and members of the NOAA Center for Coastal Environmental Health and Filet designation Average TTP Average TTP P-value Pre-cooked (stdev) Post-cooked (stdev) Biomolecular Research in Charleston, SC, Philip Hastings, H.J. E. diacanthus 1 15.4 0.6 17.7 1.2 0.0001 Walker, and members of the Marine Vertebrates Collection at E. diacanthus 2 16.0 0.7 18.9 1.8 0.001 SCRIPPS, Edward Wiley, Andrew Bentley, and members of the E. diacanthus 3 15.9 0.6 18.1 1.1 0.0008 Natural History Museum & Biodiversity Research Center, Division of Average from all filets 15.7 0.7 18.4 1.5 0.0001 Ichthyology at KU, members of the Mann Lab in the College of Means are considered significantly different when P < 0.05. Marine Science at USF, as well as Fred Stengard at Bama Sea 344 R.M. Ulrich et al. / Food Control 31 (2013) 337e344

Products, Inc. for providing us with numerous tissue samples used Leone, G., van Schijndel, H., van Gemen, B., Kramer, F. R., & Schoen, C. D. (1998). fi in the validation of this assay. Molecular beacon probes combined with ampli cation by NASBA enable homogeneous, real-time detection of RNA. Nucleic Acids Research, 26(9), 2150e 2155. Mitchell, P., & Tollervey, D. (2000). mRNA stability in eukaryotes. Current Opinion in References Genetics & Development, 10(2), 193e198. Nelson, J. S., Crossman, E. J., Espinosa-Pérez, E., Lloyd, F. T., Carter, G. R., Robert, L. N., AOAC. (1980). Official method 980.16: identification of fish species: thin-layer et al. (2004). Common and scientific names of fishes from the United States Canada polyacrylamide gel isoelectric focusing method. Journal of AOAC International, and Mexico (6th ed.). Bethesda, MD: American Fisheries Society. 63(69), 684. Nohlgren, S. (2007). State finds more grouper impostors. St. Petersburg, FL: Tampa Asensio, L., Gonzalez, I., Fernandez, A., Cespedes, A., Hernandez, P. E., Garcia, T., et al. Bay Times (formerly St. Petersburg Times). (2000). Identification of Nile perch (Lates niloticus), grouper (Epinephelus Nohlgren, S. (2008). Deal with Sysco ends inquiry into fake grouper. St. Petersburg, FL: guaza), and wreck fish (Polyprion americanus) by polymerase chain reaction- Tampa Bay Times (formerly St. Petersburg Times). restriction fragment length polymorphism of a 12S rRNA gene fragment. Jour- Patterson, S. S., Casper, E. T., Garcia-Rubio, L., Smith, M. C., & Paul, J. H. (2005). nal of Food Protection, 63(9), 1248e1252. Increased precision of microbial RNA quantification using NASBA with an Asensio, L., Gonzalez, I., Fernandez, A., Rodriguez, M. A., Hernandez, P. E., Garcia, T., internal control. Journal of Microbiological Methods, 60(3), 343e352. et al. (2001). PCR-SSCP: a simple method for the authentication of grouper Patterson, S. S., Smith, M. W., Casper, E. T., Huffman, D., Stark, L., Fries, D., et al. (Epinephelus guaza), wreck fish (Polyprion americanus), and Nile perch (Lates (2006). A nucleic acid sequence-based amplification assay for real-time niloticus) fillets. Journal of Agricultural and Food Chemistry, 49(4), 1720e1723. detection of norovirus genogroup II. Journal of Applied Microbiology, 101(4), Asensio, L., Gonzalez, I., Fernandez, A., Rodriguez, M. A., Lobo, E., Hernandez, P. E., 956e963. et al. (2002). Application of random amplified polymorphic DNA (RAPD) anal- Putnam, A. H. (2010). Florida Department of Agriculture and Consumer Services ysis for identification of grouper (Epinephelus guaza), wreck fish (Polyprion Division of Marketing and Development. http://www.florida-agriculture.com/ americanus), and Nile perch (Lates niloticus) fillets. Journal of Food Protection, consumers/crops/seafoodoverview/ Accessed 18.09.12. 65(2), 432e435. Rasmussen, R. S., & Morrissey, M. T. (2008). DNA-based methods for the identifi- Asensio, L., Gonzalez, I., Rojas, M., Garcia, T., & Martin, R. (2009). PCR-based cation of commercial fish and seafood species. Comprehensive Reviews in Food methodology for the authentication of grouper (Epinephelus marginatus)in Science and Food Safety, 7(3), 280e295. commercial fish fillets. Food Control, 20(7), 618e622. Saitou, N., & Nei, M. (1987). The neighbor-joining method e a new method for Buck, E. U. (2010). Seafood marketing: Combating fraud and deception. Congressional reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4), Research Service, RL34124. 406e425. Casper, E. T., Patterson, S. S., Bhanushali, P., Farmer, A., Smith, M., Fries, D. P., et al. Staff. (December 2011). Mystery fish: The label said red snapper, the lab said baloney. (2007). A handheld NASBA analyzer for the field detection and quantification of Yonkers, NY: Consumer Reports Magazine. Karenia brevis. Harmful Algae, 6(1), 112e118. Staff. (2012). Department of Justice: California Seafood Corporation sentenced to pay Casper, E. T., Patterson, S. S., Smith, M. C., & Paul, J. H. (2005). Development and eval- $1 million for false labeling of seafood products. http://www.justice.gov/opa/pr/ uation of a method to detect and quantify enteroviruses using NASBA and internal 2012/February/12-enrd-171.html Accessed 18.09.12. control RNA (IC-NASBA). Journal of Virological Methods, 124(1e2), 149e155. Tamura, K., Nei, M., & Kumar, S. (2004). Prospects for inferring very large Casper, E. T., Paul, J. H., Smith, M. C., & Gray, M. (2004). Detection and quantification phylogenies by using the neighbor-joining method. Proceedings of the of the red tide dinoflagellate Karenia brevis by real-time nucleic acid sequence- National Academy of Sciences of the United States of America, 101(30), 11030e based amplification. Applied and Environmental Microbiology, 70(8), 4727e4732. 11035. Chen, S. Y., Zhang, J., Chen, W. L., Zhang, Y. X., Wang, J. H., Xu, D. M., et al. (2012). Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., & Kumar, S. (2011). Quick method for grouper species identification using real-time PCR. Food MEGA5: molecular evolutionary genetics analysis using maximum likelihood, Control, 27(1), 108e112. evolutionary distance, and maximum parsimony methods. Molecular Biology Compton, J. (1991). Nucleic-acid sequence-based amplification. Nature, 350(6313), and Evolution, 28(10), 2731e2739. 91e92. Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). Clustal-W e improving the Copes, S. (2007). Attorney General Bill McCollum news release: Attorney General, sensitivity of progressive multiple sequence alignment through sequence Tampa restaurants reach agreement over fish substitutions. http://myfloridalegal. weighting, position-specific gap penalties and weight matrix choice. Nucleic com/newsrel.nsf/newsreleases/F0E7379FBC8638CE8525729900698028 Acids Research, 22(22), 4673e4680. Accessed 18.09.12. Trotta, M., Schonhuth, S., Pepe, T., Cortesi, M. L., Puyet, A., & Bautista, J. M. (2005). Delaney, J. A., Ulrich, R. M., & Paul, J. H. (2011). Detection of the toxic marine diatom Multiplex PCR method for use in real-time PCR for identification of fish fillets Pseudo-nitzschia multiseries using the RuBisCO small subunit (rbcS) gene in two from grouper (Epinephelus and Mycteroperca species) and common substitute real-time RNA amplification formats. Harmful Algae, 11,54e64. species. Journal of Agricultural and Food Chemistry, 53(6), 2039e2045. FDA. (2011). The seafood list e FDA’s guide to acceptable market names for seafood sold Tyagi, S., & Kramer, F. R. (1996). Molecular beacons: probes that fluoresce upon in interstate commerce. http://www.accessdata.fda.gov/scripts/SEARCH_ hybridization. Nature Biotechnology, 14(3), 303e308. SEAFOOD/index.cfm?other¼complete Accessed 18.09.12. Ulrich, R. M., Casper, E. T., Campbell, L., Richardson, B., Heil, C. A., & Paul, J. H. (2010). Hanner, R. (2011). Fraud. Barcode of life connect: FDA approves DNA barcoding as Detection and quantification of Karenia mikimotoi using real-time nucleic acid a regulatory protocol to detect seafood. http://connect.barcodeoflife.net/group/ sequence-based amplification with internal control RNA (IC-NASBA). Harmful fishbol/forum/topics/fda-approves-dna-barcoding-as-a-regulatory-protocol-to- Algae, 9(1), 116e122. detect?xg_source¼activity Accessed 18.09.12. Yancy, H. F., Zemlak, T. S., Mason, J. A., Washington, J. D., Tenge, B. J., Nguyen, N. L. T., Houseley, J., & Tollervey, D. (2009). The many pathways of RNA degradation. Cell, et al. (2008). Potential use of DNA barcodes in regulatory science: applications 136(4), 763e776. of the regulatory fish encyclopedia. Journal of Food Protection, 71(1), 210e217.