!"
! !
$ %
& '()* ! & + ! , & %- ./0, 01 2 . 2 !"
!0, . 3 , & %
'4 )( '()*
% - ! 5 ! 6 ) 1 ) 6 ' %6- !- 78 % 6 0 - 6 7 9 6 # : 6; $-< == 6 4 1 ! ! > ?* 6 = 6! @ 88 6 A % 0/ - # 6- )78 6 B' / 6 * . )?8 %- 6 6- 6 ? '== &66 / '?* & '?8
! %- - 0/ :6< ! !! 6 6 - . -; - - / 6 & /6 - ; 0 - :6< ! 6 - 9 6 - - # @ 6; -6- 66; - # 6- ; - / 6 %! 6 - ! ! ; - ! 6 3!; - ! 0 ; - - 6! - & 6 - - 0 ; ! 6- 6; # - 6! ! ! ! ! 6 - 6 ; 1 66 - ! C D $ % & & % . 6- 0 >& 6 - : 6 '< # 6- 6 6 6 9 - ; - - 0 - ; 6 ! 6 6 - 6; ! E' $ F 9 - ; 6 6 - ! - ; 6 6 6; 6 - 6; 6! 6- - 6 ! 0! & 6 # ! ! 6-D 6 0 6 ! - & / 6 6 66 : 6 7< ( % 9 - !- - ' $ ; 1 3!; !; C 6-- 6 ! ; C 0 - 6 - / 6 9 C 6 ; 1 !6 ! 6 E F : 6 4< ( $ 6 & % . ! - @ ; 1 # ; ,0 6; 6 : 6 =< B - 06; 0 >& 6 66 ! 3!; 6- # /6- ! 1 -6 6 6 # ; 6- $ # % ' $ 6 /6 D 6 - ! ; - 6- 6 B' / : 6 A< 9 - 6! - - 6 6- 9 - 6- - 6 C 1 ; 66 6 ; - 6 - / ; 6- 6 /- 6 ! ! 6 G 6 - 6; 6 - 6; /6; 6 ' $ /6 - 66 / !- 6; 6 6- 6- 6 - , # 0 - 6 1 ! !- - 6 6- ; @ ; ; ; ! 6 : 6 *<
! %- 1 - / :96 < + ! ! ! G0 %- 66 . %- ! G; %- B/ ! % ; 2 G 6 6 %- / 9 - ; @ - :, <; %- & " 6 %- G6 : 6< # %- # H 66 , ; -6 66 ; ! . & " 1 66 # @ ; 3 6 C D . ! / " 6 . & - G6 % +2 % H - G6 1 " - # %- " 6 %- G6 I & ! 6 J %-; ! ! ! ! . K ; D $ %)& & %5 & " ,- ! # 0& H %- %" >% :$6 '< 1 ; ! # 0& 6 6- 66 %- ; 1 " * 3- " ; $ 6 - 96 ! ; L' $ E 6 ; # 0%- " ! %- + ! ! & - ,- # 0& %- ; 1 , 6 @ G %- 1 # 0& 6 B & B" 2 JHI 6 " & %- / & & :$6 7< $ + " " % !" %- ! . %- ! ; ; ! G . C I 5 %- ; 6 6 2 ! M N ! :$6 4<
! $ & $ 6 , , + $ % . I & G6 ; 1 ; # H & ,6; . . G6 ! :$6 =< J 6 6 9 ! >%0 1 H & " ; ,- # J H :1 < 1 ! ; > # 0 & 2 2 ; M! N 6- % $ 2 $ - & # % 6- & - - '$ 2 D 1 J 6 %- % 2 6 B'0/ :$6 A< 2 ; ; '$ %- $ & 6 / G ! & ! %2 $ / O62 %C . . 6 " % ; 2 6 . 3 B/ ! %! 6 $ 2 % /- & " 6 ; 2 9 6 5 6 6- J 6 %- ; B 6" 6; . /6 , ; $ %- ' $ %- " %- I 36 6 ; %6 6 %- ; ! & 6 36 , # J B 9 :. < , 1 !" - 1 , 6- . 1 ; 3 6 . ! 9 ; 6 % G . ! , H :$6 *<
!
! " # ! ! $% ! & !& ! ' ! !
' # ! ' " ()*+, ! - . / 0)1' - ! ! ! ! ! ! ! ! ! ! ! 0)0 ! ! . ! . ! ! # ! 23 ),,
4 # . ! . ! 3 ! ! "2! ! ! # ' ! " ! ! 2! !! 5 0)3 ! !!
6 (# 0))5 7 82! ! .! ! ! " ! . ! ! ),,,
4 9' ( # :; ! / 0)1<! ! ! ! = $ 0)>
' ! ! # # 5 !! !! - ! 3 00?3 # # # @= !! @A!C.DE 0)+G3 ),1+3 ! ! ' C 2 4 ! !
' 7 2 2! ! ! ! ! !'
? ! 2 2! 7 C #
' ! H # ! ! 7 ! *= = 00* 2 ! I 000G4 0)+J !2 2 3 !
' 7 ! 2 C 3 ! ' 2 ! ! ! ! ' .2 C ! !!! ! ! ( ! ! (2 = # ! ! 2 2 2! 8 !! 2 C 2 (# <! # ),*+3 !! ! ! .
K ! . 7 ! !,L C 4 0)+' 2 C
>
/ ! ' !
. @ /
' ! ! 2! ! ! ! #
. # 3 !@ ( (# ! ( .(# ),>$ . ! ! ! ' ! ! 2 C < 0)0
' ! ! ' ! @3( # !+>0M3 C I 00)'@3(! ! D! 3 0)6'D! ! #3HN0> ! D C 0)6' ! # " !! (! $! ! . "O 8 "
1 00*3 ! < !! D! -< $ !
' ! 2 ' . 32 ! ! 32P ! 3! O" 00*G 8 00*3 ! -O 2 !32! 2 ( # ! ! ! # D 00,G4 0)+
3 .2 C # 7 ' ! 00* ! ! ! 0)+= D! 00* $! ! " Q 0)1GN 0)0 " !! D.J # 0))' C # ! ( 0)?G $ 0)) ! "= 0)0 # ! =2! ! ! . C
' ! ! ! # 00* " #
' ! ' 2 !. ! " N C < ),,> 2 ! 2 00)
+ ! C D.J # 0))G @ 0))
' ! 3 # 2 !!! ! 2 ! ! D.J # 0))' 2 C ! ! ! ! 82! . "! O ! C ! R 0)> !. !# C . 4! 0)?
' ! .# 2! ! = ( @ 0)0 ! 00) ! 2 - ! ! 2! 2 #C S !! O ! 3 00>
! ! 3 2 C ! ! / ! 5 ),,,G 0)? . 2 !
* # ! N ),*,' # ! ! ! 2 0)? ' ! !. !# 2 . 'KD 2! 3 0)>' . !
8. ! . 8 ),1, . . ! ( 0)65 # 9
" ! ! ! 2 . # ! 2! ! ! 2' C # N ),++4 O !! 2!! !! " ( C )0M ! ! ! 2 00," # ! 2! ! % C # % ! / 00?
' # ! ! C @ ! ! 2 82! T. ! 2 ! (
, 22 ! 3 < 001
" ' !. "# 2! ! C ! ' ! . !! % #!2 #! ( @ 0)0
' $ ! # ! < ! ! C )00M C U)# . # ! ! ! 2 ( 0)?G J! 00>" S / ),,*
= ! ! 2 C 2! D ),,)G/ ),,)
' . ! ! 2! ' )82! . ! ! # 3 C I 00)/ .
)0
-N . !
( = 2 ! D ! 2 C = ! J . # 22 N " ! 3! $ (3/V 3 ! . 3 = = 3 ! = = 3! ! ! = =
. ! ! 2 8 D ),,*G' 8 00>
( ! C 3 C I 00)J . . 2! ! ' 8 00>
' ! ! !. '! ! ! ! 2 ! C ! ! ' ! ! ! ! ! ! ! / 0))= ! C #! ! = ),*>
. ! C ! ! )) ! ! !/ 0)) ' # 2 ! C ! ' ! ! ( % ! !< ! ! ! 5 0)1@ ( ! # ! 5 0)
= ! ! ( C ! ! # D 00,
' ! ' D S !! ! !
= ! ! ! ! ! 2 3 2 2 '<" !# ! '
2 !!
5! 2! . " N 0)65 !
) ! ! !! ! 2 ! !
= # ! < .( .( <(( 2 '$ " ! 2 '<" =# 00+' 2 '<" R !
! !
/ <(( '<" # ! 2 ! !# ( 0))G 8 0))G5W 3 0)) !6. 2!! . 65N( ! D) ' & R 0)'! 65N( # < 2 !! YC# 00,'! C < 2 ! . ' # #C ! ! !' ! ! C ! R 0)
3 ! 2 ' ! & ! ! ! D)'
)6 D6 00)'D6 D) ' . ! &'
5 !! ! ! < ! R 0)> #
" !. ! ! ' ! !#
= ." K 5 =
5 N 0))' !! 7
5 ! ' . # ! . ! # H # . .2 C
# 5
! 2 ( ) 5 ),,6 5 ),,,D O ! ! ! ! R 0)
! " ' ! ! ' C! ! % ( C! . 2 RZ 0)1G N 0)1' C! ! ' N 0)1 C!
)?
! . ! 5
O )1"'N! # C 2D ),, O
/ . 2 # C . ! 4 ),*6 ! 2 ! 2! ! 2 !2 2 8 ' C! 2 ' ! 2 ! 2 2!
# ' < !-R 7 # 2! ! C #
! 7 N ! ! # D 0)1 ! ! 2 (
)>
@ ! "[( # ( <[ ( # K # ),1, ),+
$ % & < . # ! 5 C 4 O $ # = = ! @ 00*' # ! ! !
' ! C "! ! ! # " 2! ! 8 ! ! 8 (
)1
8 2R C @00* !
!
D$@$"$ $ . N / ! * ) R ),66
4@($K'/=/KN5"$ D N < + V 0)6 # !
@/V/"$ D N (# ( (W )**, =W " #
'K"<5$@/<$K<"$ = !! N ! $ R)**) ! # # # R$'K/N5/K"$ D " 3 # # ),*0 # ' 2 ! 8 " 2 7 ! 7 2 '! 2 ! C ' C - ! =D 00*GN ),,?G K # ),+ " " ! ! O ! ! #! ' ! 2 " K". " O $3P OP$3. < # T 0))G3 # 0)>'! ! !'2 ! ! 2 ! &# C .!! ! . 3 0)6 )+ R ! 2 ! 8 8 ),,*GK # ),*>8 " ! ! ! ! ! ' 2 # ! ' ! 7 ! ! !! 8 < K # ),+ " ! # ! ! ! ! ! < 5 ),++5 ! # . !5 8 ) !. . ! ! ( .' ),,GD RC 0)?G5 ),,1' # ! 2 . ! '# ! C !" )?0 ! < ),,G8 ),,* ! . . 8Q. 8 ),>0G8 ),1, ),,1G8 8 00*G8 8 ),,1 ' ( # # 2! R. ! ! ! # . # ! 8Q.8 ),>0GD 00,' # 2 ! C K # ),, ' R ! ' ! 82! )* @ 00*! R! ! ' 8 ),,*! @2 <!!. ' ! ! @ ! ! . ' ! 5 . ! !! #! !@# ),*? ! 8 ! ! # # R! @2 <!! 8 O # . ! !! ! " .K 8 ),,, = ! # 2 . K"N ! . ! #! . ! ! ! " 00,GD 0)0GV 0)6 8 O ! <!! ! ! ' !! ! 2! 82! O ! 2 V 0)6 O O ! ' !!<!' ! R 3 ),* # !! 8 ),,> J !! . ! O . # ! ), ! @2 8 ),,> ' ! . # . # # 8 ),,>' ' ! # ( 8 ),,>GV 0))' # ! # ( R ( ),,1 O ! " ! 8 ),,> # ! ! ' C7 )00M = ! . # ! <! 8 82! ' . ! . #!!' !! . . # 4 ),*5 ' 2 . ! ! ' C ! ' ! ! ' ! !- 3 ),*' -) . ! # K # ),*>3 ! ! -) ' > 8 ),,>GK # ),+/ . ! ! 2 'V 0))3 ! 'K # ),+ . ! !# 3 0 " !D( C . != 0)1#. G G G < # @ !! # < ),,GK # ),*>@ # C ! ! ! " !! ! 5 !<!6 8 3) # # .2 ' ' ! ! . D#3 ),*' ! # 2 ! # <!! 4' " R 2 ! D ! ! ! R ),6) ! R ),6>@ ) #( !5 ! '! # . # . # ! < .= J ! O 2 2 . ! ! ! ! ! ! !8Q.8 ),>0 ),>0 $ !$= ! # ! 2 K # ),+) ),+?' !! . # 2 $=8 ),,> 2 8Q.8 ),>0 ! .2 C ! $= ! 2 ! . # ' 8 ),,>GK # ),+) 'K # ),+? # . # 'K # ),+?5 !! ' 8 8 ),*, " # * ! )L $! ),,*5 # * # ' # # ! ! ( 2! ! 2 C 2! 8 8 ),*,' ! O# ## ! ! . . '! O 2 ' !2 >L ! 2! 2 8 8 ),*,< ! 2 . 2 8 ),1, #! ! . 2 ! 2 ! (# ! 6 8 ),,1 2 C ! 2 C 2 C ( 2 .2 ! ' O -! 6 !! J # 0)0 ! 3 3 ),,1= # 2! ! ! 2 ( 8 ),,1 <! .2 C !!7 >0 . . # )0000 )00000 . .2 C! 8 ),1,G8 8 ),*, ! ! ' ! 8 ),,>5 !! ! # ' ! . # ! ! ! $ % & ' C " ' 2! ! C ' 2 !! ! ! 4 ! ! # 9 !! !! ' - !CC ! ! ! ? & & 2! . ! ! # 7 ! ! 8 ! ! . # # ' ! # ! ( < ! ! !# ' ! ! C 0)GD 00,G3 # 0)6 "! ! ! $ # ! ( 0)?" . !! ! $' ! K # 00+' ' C !. ! 3C# 001 < O # 0)? = 0)0$' ! # ! " ! $' # . !!$' 3 ( 0)1" ! # ! !! 2 ! # = 0)0 =2! # ' 2 8 8 0)0" ! .O " 5# 000' > 8 8 ),,)G8 ),,?" ! 2 ! ! .! ' # < ! 5 .! S 8 8 0)0' ! ! ! 3 ! ! . ! 8 K ),, "# )D ! ! ! . ! !$ 0))( . ! ! ! ! 5 ! ! =! . ' ! R 00+GN # 0)+' ! . ' . 2 N # 0)+ = ! .# ! ! # ! /# ! . #" K" O ! ! !! ! 1 ' . O ! ! !! ( #! # ! ! ! ! ! !! 2 O . K" ! . C '! ! . <! ! ! . 2 !. #! ! = . 2 ! !. #!! ! ! <!4 !! 2 ! ! ! <!6 % = ! ' !" O ! O ! 2 2 ! " 2 ! C ! ! C ! ! <!? ) = ! # # . ! O D )*3 + K"! <! ! ! 5 ! .! O ! N ! 7 K! # ' 7 ! ! ! ! ! ! <!> * 2! ! .2 C ! 2 . ! 2 ' ! . ! ! ! ! D! # ! ' ! C . # 4 O R ! ! ! ! ! 4 ! ! ! ! <!1 " .K R"3 8 4),,,"! # NC < ! # !,' %# '- '?1 ?>*&?16 " = @ 8 8 3 D J 8 N D00,= ! R " < !$ ''6* 1>)&11 -)0))))P7)?16. 1?0,00,006,>2 * " Q " ( # < 5 7 R K @ D ( @ 0)1" ! ! !. !# $! ! '- '"'* *0>&*)6 -)0))))P)+>*.,)?? ( .(# @D=),>3 ! '! '6, 1)6&1>0 (# 8 <! # 5),*+" ! !! .61 *,)&*, -)0)06*P61*,)0 ( .' " N N K " "),," ! - 7 ! '.' ' '*, ,+1?&,+1* ( "0))$ ! ! &),61 -)0))*P"$=0?+6.)0 ( < 8 '),,13 ',' '6 ,6&,+ ( < K NN 4CZ 8 ' ( "0)65 !. (&&. * >6>,0 -)0)6+)P7 !00>6>,0 ( = $ ! .5 7 3 @# J .=0)?' $ ! ! ' C - ! ! / '- '> )?> -)066*,P 0)?00)?> ( = @ 850)0' & # - ! #0 "1 KD K""# =D )6&11 (# < 3 N K R7 3 ' '0))( ! '.' '')0* )?**&)?,6 -)0)0+6P! ))0)>,))0* < $ 3 8 ' ! ( ( @ ' $8 0)0" ! 2. &C < 660 )6+>&)6+* -)0))1P )),1**, < ND),,- 0 %#@ -<![5 < # @ T =.<0))" -' ! '"'* '?> +&?1 -)0))?1P ..))0?)0.)6?6 < / 5 $),++'! - O ! ! ! < !-% - ' 1) 1>&** < 8 <D00*- ( G T#-3! " - !-PP! P P! !29!\6++1:" "! )> 0)>; < 8 < R C "00*3 /2 N# # ( < HR-4 [3 @ " - !-PP P)0)00P,+*0?+00)>,000))>>:" "! )> 0)>; , ( ")*+,2 # 03 4 3 2 . ))3 -R 'W @ " =" @ Y 3 ! K 5 " 8C 0)+ ! ! #( -' 2 . ! '.' ''))? $61>&$61>* -)0)0+6P! )10?+0))? # / K 3@ @ 4' 8C R= @ @ K D 0)?' #- ! !-* )> ,? =$ 3 < =4),,,N ! ! >6 +6&+?? -)060+P1?0+)6 "$0)0# N -N H N ( < @ <00*3 - .'"'- '1 +>&+?0 -)0)06*P ),, =W < 8 ' ( N " R = 00)$ !. ! .2 C .?)) ,*&60 (00,( 0 # < = - 5 H N C < " = = =' D 5.N0)"] ! O / '- '6 -)066*,P 0)00** $ JN ( 3" T# ( N @ (3 0)) ! C /. ! - . - ,'> 6)&?6 -)0)06*P 70)0)) $ JN @ $K ( 4 ( ( =0))3 ! - 2 9/ '- ' -)066*,P 0))000>> $! 33 (C # " 8 45),,*$! ,' %# '- '?> 1?&+0 8Q.8 $),>0< Q Q! C^O Q 2 Q !' 55$ '/'+> )6?&)6+ 8Q.8 $),>0_ Q ! ! 2!'! '/'!'*? 6>&+> 8 '),1,' J3 ! ! !C&1 )&)* 8 '),,14 2 ! !C-'! ')+ ,+&60) 8 ' 8 (00*/2 ! ! '"'*6 >>6&>1, -)0))))P7)?1,.)*>V00*000>?2 60 8 ' 8 (),*, -" # &60 +>&,6 8 ' 8 (),,)' . ',' '1 0)&)> 8 ' 8 (0)08. !C 7 8# - 5N5# ( 5 -3! ( 5 )&)) -)0)00+P,+*.6.1?.)61)>.6`) 8 ' D K),,*J ! .2 C 2.6,? 61+&61, -)0)06*P*10, 8 ' K (),, !. )13K" ! '- ')>* 6,?&6,+ 8 ( $ D < # R 4 "D $ '= 5 KN),,?3 / -- '('))+ )>+&)1) 8 ( 8 '),,1$ -K 0 R5 N<( 3-D 8 ?)+&??0 8 4),,> < ! R - ' 8Q.8 ),>0 ! ! '/9 % ')?1 )1>&)+, 8 4),,*'# NC-< ! O - ! C ! # ) D5< RJ # ="3 "4@ -<![ 5 60>&6> 8 D0))" ! 2 2 - 9 '"'- '1> 16)&1>* -)0))?1P . .0,0))0.)0*0) D K),,K ! - 2 /.1# ') >+)&10, -)0))))P7)?1,.*)6+),,000*+2 D 8 RC @"0)?N !! 7 !! - '# ' '+0 ?0&?6 -)0)0)1P7! 0)6)000) D 8 4 " Y a D = = 3 N 0)1' . . ! ! N < !$# " '"'1 ?*+? -)0)06*P !?*+? D 3 3W .R!# =< " .K R"3 @ V 3 40)0= ! - " < !$ ''6, 60>&6)6 -)0))))P7)?16.1?0,0)000?)12 D K 3 K4 < "00,$ ! ! !# - ')+ >16&>1, -)0)0)1P7 00,0,00) D 4 (00,( ! 2 2 / -- '"'66 ,,,&)0?6 -)0))))P7)>+?.1,+100,00)*+2 6) D /00,- # 0 ( -3! . J D / < = D # D 3 <),,)K -' ' ''1* *+&,, D C 3 R R = # < @C = R0)63HN0> ! 2 C ! 2 < ( ( # 3 ' '- '+, +1+&++1 -)0))*P"$=06+++.) D.J # 5K # H @ ( < 3# R ( 3 0)) ! " !! '.' '')0* )0+*&)0*6 -)0)0+6P! ))0>6?+)0* 5 ( 3 = @ 5 @ ! 3 =@ K # (),,1 ! K" O ,' %# '- '?6 >&60 5 H ( $< ( = 8 # 5 / "),,,= 3 -' ' '')*6 )?,& )>* 5 H < 3< 8 # 5),,6 ! ! ( ) -' ' '',? 6>&?) 5 " =0)1< ! ! ! ! ! '! '1 66,6&66,* -)0)0)1P70)1)006? 5W = 3 3=0))( < -"! 2 ' "'-''6 1)&*, -)0))?1P . .)0+0,.)?+) 5 < D R K "# 3 ( 5 < "' 0)3 .?*1 0+&)? -)0)06*P))6? < N = 4 ' 5 5 3 D Z# 8/ 0)?' ! !. !" - . ! Y! '- ')1 +6&+6* -)0))))P)?1.,0)?01 54 = =),*>D !. , +)+& +> -)0))1P ,?+)>+)+ I ((000( - # 53 C =Y ( -3! )+6&0+" -!-PP # ! P!P)0)00+P,+*.6.11. 0??.+`>:" =, 0)+; R "),6)H NC-4 ! < 5 b ) ' N 212 -D8 )*)&6,* R "),6>H NC-4 ! < ?N < G 212 -D8 1>)&**1 6 R = N = 0)< .2 C C '& '- ')> 1)&16) -)0)0)1P7 0)0,006 R = 4! < 5 ' @ # D 5 @ < 0)>H 2 & '- ')+ >06&>06> -)0))))P)?1.,0),) R = 4! < @ < ' 5 4C 3 T 0)=! ! '.' '')0, $))+6&$))* -)0)0+6P! )))),*)0, R ' ( <8),,1' 2# ( ) '6> )6&* R N C =8 4 = 3 # =N D 3 ( =0)>$ ! . !! '.' '')) ))600& ))60> -)0)0+6P! )>0))10)) RZ 3 D / 5 3$ 5 C# ' 'W " N " 0)1 2 ! .'- ' )1),6 -)0)06*P 0)1),6 R " R ! 3 8Q D D 800+NC. !. / ! 8K -' '* 16& +) -)0))))P7)?6,.0?*>00100))*2 @ # H D.J # 5K 3 = 3 4 / "0))= ! ' ## < N $ #)60 1)&+) -)0)00+P 00?6>.0)).0)6>. @# 3$ 3 $( D ),*?N ! &'()6 ,&6? @A!C.DE N $ @ = 0)+3 # ,' '! ' -)0)0)1P77 0)+006) @ 500* ) 0) 4 4 6 -3! =# 3 " < 8 # 5 ( 3 3= 5W = 00+N ! "# 6)> ?+&>0 -)0))1P ))6,)6 = @< 5 = .@ D /0)0K ! ! O # !-"!! ! D !84 -' '"'1, 6*&6*, -)0)0)1P7 0)0000) =D <@ Y K" RC @"00*< * %# @"RC ( T#-/2 H N 1?&++ 66 = 8 8 K 4 D = '00*'! 3 3 K.<! 3 3 2"'& '"'' >> >0&+ -)0)0)1P7 00+)000) = D @ 0)1! . 2 ,? )*10 -)0++)+P!7)*10 = 8 ( ' @( 8 # 5 D /0)08 ! " ' ! -D ! 2 C '- ') 6+)&6*6 -)0))))P7)?1.,00)0060,2 = "" $ 0)>K # . ! #6* )00&)0* -)0)00P 0)>000+? # 3 3 3 '## T 3C# T =# 3 4 ' 0)?" -! ! - ,'* ?0&>) / ( 3 ( R $ R0))= # - '- '! '"'+> 61)&? -)0))*P==(K0006,.)0 / " ( = 3 8),,*' ! ! -' '), ,&?6 / " # K 3 8 5 H # = N C =),,)'# - ! -' ' ) 1)&+, / ( = ( 300?= ! & '-! "? ,>&))* / 3 C ( < '0)1$ 5 " (% )*+* ! c $ 3 %c %# 1, )6)&)6, -)0)00+P )6),,.0)1. 0?0,.* N # "@ D 3R ' N@ R3 @ @" K D4 0)+ < . ! / '-''6 +1 -)066*,P 0)100+1 N = R! " D.J # 5 < H D = R = 0)1 < ! 2 .'- ' )1),> -)0)06*P 0)1),> N = K " @ < <.( =." Y = 0)0 !" . ! ! = ." K '- ') 0?&)* -)0))))P7)?1. ,000,0),2 N = Y # 8H N! ' 3 K = < " K 0))5 .?+1 )+1&)*0 -)0)06*P)06> 6? N C =8 < <=),,> ! != ." K '.' '';''', +6&+61 N <.( =." Y = @! D " < @ 0)6 2 . !" - ,'+ ,1&)0, -)0)06*P 70)*+ N $),*,/2 - . . ! ,'-'"'?+ **+&,6 N =),,?'" !C- '- '! '"'>* 66&1+ N $=),++@ K ','#'?> 6&)) -)0))),P))0,06 K # (),1,' " ) # '.'</2 - NN )&)* K # (),+)(Q Q! C O Q! ! 8Q.8 Q !Q O + 61>&6+* K # (),+ ! 7 " ) # '.'</2 -NN )?+&,0 K # (),+' !! ! ! 8Q. 8 - C ) ')0 +&?+ K # (),+H ! 2! ! ! K # ),1 * ,,&6)6 K # (),+?_ Q Q! C O C O K # Q Q ! O'! '-')> 6+,&6,6 K # (),*>N . '"'# ',> ,+&6> K # (),,H 2 # - !! #* ),>&0) K # < @ K RC 3 ( =00+' ! ! $ '"' '!! ''+? >,&1, -)0)0,*P !00+016) K < ( 3K 8 K" # " N 3( D ' 00* = "# ' - ')0 ++&+6+ -)0))))P7)?1.,000+0)?,12 3 @ = HD 4 2 'N ( 00?' ! <'"'! '+, )6>&)10 -)0)0*1P6*6>?) 3 =(),,< -4 ! # )? )+&6) 3 @),1+/ ,' '! ')? >>&+? 3 J ( J ' # "0)6N ! ! 2 ! 3 (1 %)0? )1,&)*1 -)0)00+P )0?*.0)6.,,>. 6> 3 $),*(W # < '/9 % '1 6>>&?0+ 3 @ R = N K 4C 3 N $ ( J 0)>" 2 . !. (? 0+,11 -)0+>>?P@ 0+,11 3 C 5 I ((00)( '"'- '>> )0>&)6+ 3 @ ( =0)1" $ ! < ! / ! ! ! . (&&. )) 0)1*6? -)0)6+)P7 !0)1*6? 3 # = 87 = DZC 5.0)63 !# %# $K $8@ 3@ $3# 8 '! ( 5 -3! ( 5 ?+&?16" - !-PP # ! P)0)00+P,+*.6.1?.60),?.0`)*:" "! )> 0)>; 3 R' 3 (),,1/ ! ] !! -''>6 *)&*+ -)0)0)1P060?.?06,1000)?.V 3 8 < <=001( #= -( ]= & ! 3 (1 %,0 6?6&610 -)0)00+P )0?*.001.,0*1.1 3 8 @D < <=00>< - ! 2 &2 - ')6 ?6,&??* -)0)0)1P7 00>0+00+ 3C# T R7 3 3 # ' 3C# = H ' 4 5 0015 . ! ! 3 N ' '- '+ )6**&)6,6 -)0))*P"$=+)6**.)6,6001 3 $< ( K = J = 2 N < V Y T 0)6'&# -! 2# )1 000 ( ! ')) )00)?+6 -)0)6+)P7 ! )00)?+6 3 $< # =0)>'# K". " '.'=' '')6?) )01&))? -)0))))P )161 ' K 8 '00>3 ! !! 2 ' '- '+) 61*&61,) -)0))*P"$=+)+61*. 61,)00> 5 ' D @@ 8 / 5 D = R 7# == 0)" . 661 )?6&)?6? -)0))1P )),,+6 5# "5 " '" 3!# J3 @ " ( ' J D 000 = ! O - '! ' ')+ >)& >* 61 J # N # @ 4 3 4 3"0)0/ ! ( '& '>> )6)&)?+ -)0?6),P 0)0>>6)6) J! R ' / ( = KI 500>4 . 53 2 ! ( '& '>0 )*&)66 4 R =b = @ "0)+' - -= '- '"' -)0))))P)+>*.,)>6* 4 ( < <( ' K),*6" . 2 ! ( -' ) )?0)&)?06 -)0))1P )?1)*)?0) 4! < 4 " 3 # = ( # < 0)?8 !- !. C '- ' )1 61,,&6+)6 -)0))))P)?1.,0)>,+ 4# ' ' 5 5 = K = D # 8/ 0013 .??6 ,>0&,>> -)0)06*P0>), 4 =),*3 . 34 '! '-'6 +>&*> V T 5 4 " " .K R"3 " .87 3" 3 40))=! ! *< ! R ! ! < ',' '?+ )+&)*> -)0)0)1P77!0))06006 V T @ 3 4 4 "0)6N 4 ! < ! R ! C 2! + ! ,' %# '- '10 ?*0&?*, -)0))))P7)0>> YC# ( J =W = 8 D00, ! ! 6. 2!! 6+ 6* !"#$ % &' %() *+,- .!/$+ 0)(*12*+ 0)3*+4 *0+51+)6- 6 7/7 6 &' %$,,*&' %()'*" ,138:* 7!7. /,*$+ !6"5,);1 51+) .!/$+ ' < = 7 >?< 7 >7>@# < 7# 7/.A0 # 7 >#7>@ ! " ! " #$ %" ! & ! " ' 7 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 Specificity in diversity: single origin of a rspb.royalsocietypublishing.org widespread ciliate-bacteria symbiosis Brandon K. B. Seah1, Thomas Schwaha2, Jean-Marie Volland3, Bruno Huettel4, Nicole Dubilier1,5 and Harald R. Gruber-Vodicka1 Research 1Max Planck Institute for Marine Microbiology, Celsiusstraße 1, 28359 Bremen, Germany 2Department of Integrative Zoology, and 3Department of Limnology and Bio-Oceanography, University of Cite this article: Seah BKB, Schwaha T, Vienna, Althanstraße 14, 1090 Vienna, Austria 4 Volland J-M, Huettel B, Dubilier N, Gruber- Max Planck Genome Centre Cologne, Max Planck Institute for Plant Breeding Research, Carl-von-Linne´-Weg 10, 50829 Cologne, Germany Vodicka HR. 2017 Specificity in diversity: single 5MARUM, Center for Marine Environmental Sciences, University of Bremen, 28359 Bremen, Germany origin of a widespread ciliate-bacteria BKBS, 0000-0002-1878-4363 symbiosis. Proc. R. Soc. B 284: 20170764. http://dx.doi.org/10.1098/rspb.2017.0764 Symbioses between eukaryotes and sulfur-oxidizing (thiotrophic) bacteria have convergently evolved multiple times. Although well described in at least eight classes of metazoan animals, almost nothing is known about the evolution of thiotrophic symbioses in microbial eukaryotes (protists). In this study, we Received: 11 April 2017 characterized the symbioses between mouthless marine ciliates of the genus Accepted: 6 June 2017 Kentrophoros, and their thiotrophic bacteria, using comparative sequence analy- sis and fluorescence in situ hybridization. Ciliate small-subunit rRNA sequences were obtained from 17 morphospecies collected in the Mediterranean and Caribbean, and symbiont sequences from 13 of these morphospecies. We dis- covered a new Kentrophoros morphotype where the symbiont-bearing surface Subject Category: is folded into pouch-like compartments, illustrating the variability of the basic Evolution body plan. Phylogenetic analyses revealed that all investigated Kentrophoros belonged to a single clade, despite the remarkable morphological diversity of Subject Areas: these hosts. The symbionts were also monophyletic and belonged to a new microbiology, environmental science, clade within the Gammaproteobacteria, with no known cultured representa- taxonomy and systematics tives. Each host morphospecies had a distinct symbiont phylotype, and statistical analyses revealed significant support for host–symbiont codiversifica- tion. Given that these symbioses were collected from two widely separated Keywords: oceans, our results indicate that symbiotic associations in unicellular hosts can symbiosis, thiotrophy, ciliate, be highly specific and stable over long periods of evolutionary time. Gammaproteobacteria Author for correspondence: 1. Introduction Brandon K. B. Seah Symbiotic associations between eukaryotes and sulfur-oxidizing (thiotrophic) bac- e-mail: [email protected] teria have evolved several times in different groups of both hosts and symbionts [1,2]. Among metazoan animals, they have evolved independently in at least eight taxonomic classes. By contrast, much less is known about thiotrophic sym- bioses in protists (microbial eukaryotes), with only two groups described as hosts, namely euglenozoans [3] and ciliates [4]. The thiotrophic symbionts of ani- mals and protists fall in several clades of bacteria: mostly Gammaproteobacteria [1], but also Epsilon- [5] and Alphaproteobacteria [6]. Many are interpreted as nutri- tional symbioses because the hosts have reduced digestive systems, and the symbionts can use energy from inorganic reduced sulfur to produce new biomass from CO2. Kentrophoros (Ciliophora: Karyorelictea) is a genus of ciliates with two unu- sual characters: lack of a differentiated cytostome (oral apparatus, or ‘mouth’), and an obligate association with ectosymbiotic thiotrophic bacteria [7–9]. The cell body is flattened, with one side ciliated and the other densely covered by Electronic supplementary material is available the bacteria. The symbionts of Kentrophoros are sulfur oxidizers (thiotrophs) online at https://dx.doi.org/10.6084/m9. [10] and are phagocytosed by the ciliates directly along the whole cell body figshare.c.3810745. & 2017 The Authors. Published by the Royal Society under the terms of the Creative Commons Attribution License http://creativecommons.org/licenses/by/4.0/, which permits unrestricted use, provided the original author and source are credited. 41 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 [8,11,12]. Of the ciliates known to have thiotrophic sym- method [21]. Caribbean samples were collected in 2015 off the 2 bionts—Kentrophoros, Zoothamnium niveum [4] and possibly southern end of Twin Cayes, Belize (16.823568 N, 88.1061508 W, rspb.royalsocietypublishing.org Pseudovorticella sp. [13]—only the symbionts of Z. niveum 1.5 m depth), by both decantation and Uhlig extraction. have been phylogenetically identified. Zoothamnium niveum is a single representative in a predominantly non-symbiotic (b) DNA extraction genus. By contrast, Kentrophoros is a genus comprising many Samples for DNA extraction were either fixed in RNAlater species that all bear thiotrophic symbionts. These hosts are (Sigma-Aldrich) (stored at 48C) or 70% ethanol (stored at geographically widespread in marine sediment interstitial 2208C) or directly digested in buffer ATL and proteinase K of habitats (references in [9]) and can be locally abundant [14], the DNeasy Blood and Tissue kit (Qiagen). DNA was extracted and are thus valuable for comparing the biology and evolution from single Kentrophoros cells with the DNeasy Blood & Tissue of symbiotic associations within a speciose group of hosts. Mini Kit following the manufacturer’s protocol, and eluted in m The symbiotic bacteria have remained unidentified, 50 l elution buffer. B Soc. R. Proc. although they were described a long time ago [15,16]. It is not known whether the Kentrophoros symbionts are all close relatives (c) Sequencing of Kentrophoros 18S rRNA gene to each other or if they come from different clades, nor is it poss- The 18S rRNA gene was amplified by polymerase chain reaction ible to infer from morphology and physiology alone if they are (PCR) with general eukaryote primers EukA (AACCTGGTT- 284 related to known groups of thiotrophic bacteria. They may rep- GATCCTGCCAGT) and EukB (TGATCCTTCTGCAGGTTCAC 20170764 : resent one or more entirely new clade(s) of symbiotic thiotrophs. CTAC) [22] using Phusion high-fidelity DNA polymerase The identity of the symbionts also relates directly to the question (Thermo), 50 ml reaction volume with 1 ml template, and touch- of host–symbiont specificity. Some clades of thiotrophic sym- down thermocycle: 988C/2 min—10 cycles of (988C/10 s—708C bionts have a very specific relationship to their hosts, even (reduced by 18C per cycle)/30 s—728C/1 min)—30 cycles of exhibiting a pattern of codiversification [6], while others are (988C/10 s—608C/30 s/728C/1 min)—728C/10 min—held at 8 associated with two or more different host taxa or have close 12 C. PCR product bands were cut from the gel after electrophor- relatives that are non-symbiotic [17]. esis, purified with the Qiaquick gel extraction kit (Qiagen) and sequenced with BigDye Terminator v 3.1 Cycle Sequencing Kit The remarkable morphological diversity of Kentrophoros (Life Technologies) on a 3130 1 Genetic Analyzer (Applied has also called their own phylogenetic position into question. Biosystems), using EukA, EukB and 18SF492karyo (AGGACC The described species differ widely in size and body shape, as CACTGGAGGG, modified from [23]) as sequencing primers. well as the number and arrangement of nuclei. The genus Sequence chromatograms were inspected and assembled in might therefore be polyphyletic, i.e. mouthlessness and sym- Sequencher 4.6 (Gene Codes), retaining sequences that had biotic lifestyle may have evolved more than once among the more than 95% of bases with a Phred score greater than 20. karyorelict ciliates [9]. Alternatively, Kentrophoros may PCR products that could not be directly sequenced were cloned simply be more variable than other ciliate genera. Molecular before sequencing, using the TOPO TA kit (Invitrogen) with phylogenetics can help to resolve such taxonomic problems pCR-4-TOPO vector and One-Shot TOP10 Escherichia coli chemi- when morphology is difficult to interpret, but only two 18S cally competent cells, after adding A-overhangs with Taq rRNA sequences have been published [18,19]. The true polymerase (5 Prime) and dATP. Vector primers M13F and M13R were used as sequencing primers for clones. extent of Kentrophoros species diversity is also unclear because karyorelictean ciliates are notoriously difficult to handle [9,20], and most descriptions have been exclusively morphological. (d) Sequencing of symbiont 16S rRNA gene In this study, we collected Kentrophoros from two geo- Metagenomic sequencing libraries were prepared from graphical regions, the Mediterranean and Caribbean Seas, Kentrophoros morphospecies H, SD, LPFa, LFY, TUN and UNK to identify the symbionts and test if the symbiosis had a with the Ovation Ultralow Library System V2 (NuGEN) follow- single origin. More specifically, we ask: (i) is Kentrophoros a ing the manufacturer’s protocol. Libraries were sequenced on the monophyletic group within the karyorelict ciliates? (ii) Do Illumina HiSeq 2500 platform as 100 bp paired-end reads, with the symbiotic bacteria also form a monophyletic group, and approximately 10 million reads per library. The 16S rRNA are they related to known groups of symbiotic bacteria? (iii) sequences were reconstructed with the phyloFlash pipeline (https://github.com/HRGV/phyloFlash): reads with greater How specific and stable are these associations, and have than 70% identity to reference 16S rRNA sequences were hosts and symbionts co-diversified? (iv) How does the mor- extracted by BBMap (https://sourceforge.net/projects/bbmap/), phological diversity of Kentrophoros relate to phylogeny? To and assembled with EMIRGE [24] or SPAdes [25]. The 16S address these questions, we used methods from molecular rRNA sequences with the highest read coverage per library ecology, phylogenetics and comparative morphology. were considered candidate symbiont sequences. The candidate symbiont 16S rRNA genes from the above six host morphospe- cies were aligned and used to design two sets of PCR primers to amplify symbiont 16S rRNA sequences from the remaining 2. Material and methods host morphospecies: chr4Amix (CGAACGGTAACGGGGGGA, CGAACGGTAACGGGGGAA, CGAACGGTAACGGAGGGA) (a) Sampling site and collection and chr4Cmix (CCGAGGATGTCAAAAGCAGG, CCAAGGAT Mediterranean samples of Kentrophoros were collected in 2013 GTCAAAAGCAGG). PCR was performed with primer pairs and 2014 from three localities off the island of Elba, Italy. At chr4Amix/1175R (CGTCATCCMCACCTTCCTC, [26]) or b341 the bays of Cavoli (42.7341928 N, 10.1858688 E, 12.8 m depth) (CCTACGGGAGGCAGCAG, [27])/chr4Cmix using Phusion poly- and Sant’ Andrea (42.8085618 N, 10.1422758 E, 7.3 m depth), cili- merase, 20 ml volume with 2 ml template, and a touchdown ates were extracted by decanting sandy sediment collected thermocycle: 988C/2 min—15 cycles of (988C/10 s—708C (reduced by scuba divers. At Golfo di Barbatoia off Fetovaia, Elba by 18C per cycle)/30 s—728C/1 min)—25 cycles of (988C/10 s— (42.73138 N, 10.15348 E, 1.5 m depth), sediment was collected 558C/30 s/728C/1 min)—728C/10 min—held at 128C. PCR in Plexiglas cores by snorkelling and extracted by the Uhlig products were purified and sequenced as described above. 42 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 (a) EUB338(b) Gam42a(c) chr4Ca(d) chr4Ba(e) NON338 3 rspb.royalsocietypublishing.org Figure 1. FISH of Kentrophoros sp. H cross-sections with oligonucleotide probes targeting bacterial rRNA. Emission in 508–534 nm channel from fluorophore Alexa 488 (excitation 488 nm) overlaid on transmitted light image. Probes match sequence signatures specific to successively more exclusive groups: (a) EUB338—most Bacteria (positive control), (b) Gam42a—most Gammaproteobacteria, (c) chr4Ca—symbionts of several Kentrophoros species, (d) chr4Ba—symbiont of Kentrophoros sp. H only, (e) NON338—reverse complement of the general bacteria probe (negative control). Scale bars, 25 mm. (Online version in colour.) B Soc. R. Proc. (e) Molecular phylogenetics onto glass slides (Superfrost Plus) and baked (568C, 2 h). Sections were dewaxed (3 Roti-Histol, more than 30 min, room tempera- For both ciliate 18S rRNA and bacterial 16S rRNA sequences, a 284 similar protocol was used. Sequences were dereplicated at 99% ture) and rehydrated (ethanol 96, 80, 70%). 20170764 : identity with Usearch [28] (cluster_fast, length-sorted). Outgroup Specific probes chr4Ca (CCGAGGATGTCAAAAGCAGG) sequences were downloaded from SILVA SSU Ref NR 123 [29] and chr4Ba (GTAGGCTCATCCAACAGC) were designed in or NCBI GenBank (accession numbers in electronic supplementary ARB [38]; chr4Ca targets five candidate symbiont phylotypes material) and aligned with sequences from this study using the with zero mismatches, and three with one mismatch (out of L-INS-i method in MAFFT 7.130b [30]. The best-fitting evolution- nine phylotypes with coverage of the probe target region), ary model, GTRþG in both cases, was found with jModelTest2 whereas chr4Ba targets only the candidate symbiont phylotype [31] from 44 alternatives. Phylogenies were estimated with four from K. sp. H with zero mismatches. Matches to published discrete rate categories. Maximum-likelihood estimation was per- sequences were checked with TestProbe versus the Silva SSU formed with RAxML v. 8.1.3 [32] using the rapid hill-climbing Ref NR 123 database [29]. All zero-mismatch hits to chr4Ca and algorithm, 10 randomized starts and Shimodaira–Hasegawa-like chr4Ba were uncultivated environmental sequences, numbering (SH-like) support values from the approximate likelihood ratio 11 and 5, respectively. No database sequence had matches to test (aLRT) [33]. Bayesian inference was performed with MrBayes both chr4Ca and chr4Ba. For probe chr4Ca, unlabelled ‘helper’ v. 3.2.5 [34] using two independent runs of four Monte Carlo oligonucleotides (TAAGGTTCTTCGCGTTGCAT, CGTGTGTAG Markov Chains (three heated, one cold) for 5 106 (18S rRNA) CCCTGCCCATA, CGTGTGTAGCCCTGCTCATA) were designed, or 10 106 (16S rRNA) generations, with 25% relative burn-in. which bind to adjacent regions in the rRNA and improve the For the 16S rRNA tree, the maximum-likelihood tree was used primary probe signal [39]. Different formamide concentrations as a starting tree to improve convergence. Potential scale reduction were tested in the hybridization buffer with and without helpers, factor values between 0.99 and 1.01 indicated convergence. For the on paraffin-embedded sections of K. sp.H.Finalformamide 16S rRNA tree, an initial run gave inconsistent results between concentrations used were 20% for chr4Ca and 40% for chr4Ba. maximum likelihood (ML) and Bayesian trees, and poor conver- Probe specificity was tested against Beggiatoa sp. 35Flor for gence in the Bayesian analysis. Potential rogue taxa were chr4Ca (three mismatches) and with cloneFISH [40] for chr4Ba identified with RogueNaRok v. 1.0 [35] on 500 bootstrap replicates (one mismatch), with NON338 as negative control. estimated on the original alignment with RAxML. Rogue taxa that Catalysed reporter-deposition fluorescence in situ hybridiz- were not candidate symbiont sequences were removed, and the ation (CARD-FISH) was performed as described by [41] with phylogenetic analyses were repeated with the previous fluorophore Alexa 488 (Life Technologies) except that hybridization 8 parameters. and washing were performed at 46 and 48 C, respectively, and an additional lysozyme permeabilization step was included [42]. Kentrophoros sp. H sections from two individuals were separ- (f) Host–symbiont codiversification analysis ately hybridized with four different probe sets of increasing Bayesian trees of host and symbiont small subunit (SSU) rRNAwere taxonomic specificity: EUB338I-III targeting most Bacteria used for codiversification analysis. Host morphospecies for which [43,44], Gam42a (with unlabelled Beta42a competitor) targeting the corresponding symbiont sequences were unavailable were most Gammaproteobacteria [45], chr4Ca (with unlabelled removed from the tree without changing other branches, as required helper probes) targeting most Kentrophoros candidate symbiont by the software tools used. Event-based analysis with Jane v. 4 [36] sequences and chr4Ba, targeting only the candidate symbiont used the default cost scheme and ran the genetic algorithm for 20 of K. sp. H. Slides were viewed under epifluorescence with a generations with population size 100. Random sampling for signifi- Nikon Eclipse 50i microscope, Intensilight C-HGFI light source cance testing used random tip mapping and sample size 100. (Nikon) and filter F46-018 (AHF Analysentechnik). Imaging for Distance-based analysis with PACo [37] used distance matrices cal- figure 1 was performed on a Zeiss LSM 780 confocal laser- 5 culated from the edited host and symbiont trees. A total of 10 scanning microscope with 63 Plan-Apochromat oil-immersion iterations of random permutation were used for significance testing. objective, excitation 488 nm, emission 508–534 nm. (g) Fluorescence in situ hybridization Formaldehyde-fixed specimens of Kentrophoros morphospecies H (h) Histology and three-dimensional reconstruction were dehydrated in ethanol (70, 80, 95, 95, 100, 100, 100%, more Samples for semithin sections were fixed in 1% OsO4 buffered with 2 than 30 min per step), transferred twice through Roti-Histol (Carl 0.1 M sodium cacodylate, 1100 mOsm l 1, pH 7.4 (Electron Roth) (more than 1 h per step), 1 : 1 mixture of Roti-Histol and Microscopy Sciences) for 2 h, washed three times in the same Paraplast paraffin (608C, 1 h) and six times through paraffin buffer, post-fixed with a mixture of 2.5% glutaraldehyde and 2% (608C, more than 1 h per step). The paraffin block was solidified formaldehyde in the same buffer overnight (more than 12 h), at room temperature for one week. Sections were cut on a Leica washed three times with distilled water, dehydrated in ethanol RM2165 microtome at approximately 5 mm thickness, floated (30, 50, 70%) and stored in 70% ethanol until use. All steps were 43 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 N 4 (a) (d) PT MF rspb.royalsocietypublishing.org 75 μm MF N (b) 180 μm N rc .Sc B Soc. R. Proc. 100 μm symbiotic bacteria N (c) ciliated surface 284 50 μm 20170764 : Figure 2. Schematic diagram of transverse sections illustrating different body involution types in Kentrophoros: (a) ‘open’, non-involuted (e.g. K. fasciolatus), (b) ‘tubular’ involution (e.g. K. fistulosus), (c)‘canalis-type’ with symbionts on part of ventral surface (K. canalis), (d) ‘pseudotrophosomal’ with pocketing of symbiont-bearing surface (K. sp. H). N, nucleus; MF, medial furrow; PT, pseudotrophosome. (Online version in colour.) carried out on ice or at 48C. Fixed specimens were dehydrated in an products from two specimens were separately cloned for ethanol series and embedded in EMBed 812 resin (Electron sequencing. Cloned sequences from the same individuals Microscopy Sciences) using acetone as intermediate solvent. The not only had substitutions but also insertion–deletion poly- 8 resin was mixed in the ‘hard’ formulation and cured at 60 Cfor morphisms, which is consistent with the difficulty in m 24 h. Blocks were serially sectioned at 1 m thickness on a Leica sequencing the initial PCR product directly. UC6 ultramicrotome (Leica Microsystems, Wetzlar, Germany). Sec- Kentrophoros sequences from this study fell into a single tions were stained with toluidine blue and photographed with an clade with the two published Kentrophoros sequences [18] and Axiocam colour camera mounted on a Zeiss Axio Image A1 micro- scope (Zeiss, Oberkochen, Germany). Semithin sections for three- three environmental clone sequences from deep-sea cold seep dimensional reconstruction were sealed in resin and photographed sediments in Sagami Bay, Japan, that were previously of uncer- with a DP73 camera on an Olympus BX53 compound microscope tain affiliation [46] (figure 3). The clade was well-supported in (Olympus, Tokyo, Japan). Section images were converted to grey- the maximum-likelihood analysis (98% SH-like aLRT) but only scale with Adobe Photoshop CS5 (Adobe, San Jose, CA, USA). moderately so in the Bayesian analysis (83% posterior prob- Each image stack was imported into the three-dimensional recon- ability). The Trachelocercidae were recovered as the sister struction software Amira 6.0 (FEI, Hillsboro, OR, USA), and group to Kentrophoros, with weak to moderate support (74% aligned with the AlignSlices tool. Aligned stacks were semi-auto- Bayesian, 60% maximum likelihood). Within Kentrophoros, matically segmented with threshold segmentation, followed by however, many internal branches were short and some species manual corrections. Specimens were visualized by volume render- relationships were poorly resolved, although there were some ing of the original image stack or surface rendering of the well-supported species clusters. Two morphospecies from the segmentation. Volumes of the segmented areas (entire body, sym- biont region and nuclei) were measured with the ‘measurement’ same locality in Belize, Kentrophoros spp. FM and G, differed option in Amira. by only 3 bp (in 1360 bp alignment), but these substitutions were consistently associated with their morphospecies identifi- cation (four individuals each sequenced). The 18S rRNA sequences corresponded well to their mor- 3. Results phospecies identification, for both direct and cloned sequences, with two exceptions. (i) Morphospecies Kentrophoros sp. SD (a) Kentrophoros is a monophyletic genus despite its required cloning, and the resulting clones were represented by morphological diversity two representative sequences when clustered at 99% identity. Specimens of Kentrophoros were identified in the field by their However, the representatives did not form a monophyletic clus- dense ectosymbiont coat, and sorted into 17 putative morphos- ter. (ii) Sequences from morphospecies K. spp. LPF, PF and PFC pecies by host characters observable in live organisms, clustered together with high identity (greater than 98%, resulting especially overall body shape, size, and whether the cell body in two representative sequences after clustering at 99% identity), was rolled up (involuted) (electronic supplementary material, but the clustering did not correspond to their assigned morphos- table S1; figure 2). Each morphospecies was given a placeholder pecies. This suggests that the 18S rRNA gene had insufficient identifier (electronic supplementary material, table S1). resolution, or that the morphological sorting was imperfect. Five Kentrophoros morphospecies appeared to have more than one 18S rRNA sequence per genome. Their PCR pro- (b) Symbionts of Kentrophoros are a new lineage of ducts consistently yielded overlapping chromatograms when directly sequenced, suggesting that they were mixtures thiotrophic symbionts of different sequences, although PCR was performed on The 16S rRNA sequences from the symbionts, as confirmed single-cell samples. For each of these morphospecies, PCR later by FISH (see below), were obtained by metagenomic 44 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 (a)(b) 5 0.1 ciliate bacterial rspb.royalsocietypublishing.org 18S rRNA 16S rRNA Chromatiaceae Kentrophoros Gamma1 symbionts of Olavius ‘Candidatus Thiobios zoothamnicoli’ 0.1 Trachelocercidae symbiont of Alviniconcha hessleri symbiont of Ifremeria nautilei Loxodidae Sulfurivirga caldicuralii Thioprofundum hispidum Geleiidae symbionts of Bathymodiolus Wilbertomorpha colpoda and Calyptogena branch length = 0.934 Gamma3 symbiont of Olavius algarvensis symbiont of Rimicaris exoculata Heterotrichea Leucothrix mucor Thiothrix flexilis Sedimenticola selenatireducens symbiont of Lamellibrachia columna (c) Kent. PE and LPF, Elba (O) symbiont of Escarpia spicata clone ‘Candidatus Endoriftia persephone’ Kent. SD, Elba (O) B Soc. R. Proc. clone Symb. TC symbiont of Codakia orbicularis clone Kent TC, Belize (T) Symb. LPFa clone Env clone ‘Candidatus Kentron’ Kent . LPFa, Elba (T) JF344692 Symb. UNK clone Kent. MB, Belize (O) clone Symb. SD environmental sequences Kent. LFY, Elba (O) Symb. LFY Kent. TUN, Elba (T) Symb. TUN 100% B Coxiellaceae Kent. UNK, Elba (T) 284 Symb. BT 100% ML Kent. BT (clone), Elba (T) Ectothiorhodospiraceae 83% B Kent. FW (clone), Belize (O) Symb. FW 20170764 : Kent. FB, Elba (O) Thioalkalispira microaerophila 98% ML Symb. FB 81% B Thiohalophilus thiocyanatoxydans Env. clone RM2 SGM26 Symbiont of Solemya reidi Kent. H, Elba (P) Symb. H 73% ML Kent. FM, Belize (O) Symb. FM Xanthomonadales Kent. G, Belize (T) Symb. G Beggiatoa alba B18LD Kent. gracilis, China (O) Symb. FBG Kent. flavus, China (O) Cardiobacterales Kent. FBG, Elba (C) Env. clone RM2 SGM25 environmental sequences Halothiobacillaceae Env. clone RM1 SGM25 99% B host symbiont 99% ML Caedibacter Legionellaceae taeniospiralis Francisella philomiragia maximum- Piscirickettsia salmonis Bayesian 90–100% likelihood Methylococcaceae p.p. posterior SH-like aLRT 80–90% topology conflict probability support Rheinheimera chironomi Methylophaga thalassica Methylococcus capsulatus body form variants: (O) (T) (C) (P) Nitrosococcus halophilus open tubular canalis- pseudo- Nitrosococcus oceani type trophosomal Methylocaldum szegediense Figure 3. Small-subunit rRNA phylogenies of host (a)andsymbiont(b) species, with detail of representative sequences (see §2) from the Kentrophoros and Ca. Kentron clades (c). Trees from Bayesian inference are displayed, with support values from both Bayesian and maximum-likelihood analyses (see Key) on branches. In (c), blue lines connect host–symbiont pairs, body involution type of host morphospecies is indicated by letters in parentheses (see key), and other uppercase letters are iden- tifiers for Kentrophoros morphospecies (see table S1). Full trees available online at TreeBASE (S19762). Scale bars: substitutions per site. (Online version in colour.) sequencing from six host morphospecies, and by PCR ampli- Symbiont sequences from the same host morphospecies fication with specific primers (approx. 600 bp region) from a always clustered together or collapsed to the same representa- further seven. PCR was not successful for four morphospe- tive sequence (at 99% identity) (figure 3). Host and symbiont cies (electronic supplementary material, table S1). The phylogenies significantly supported codiversification under minimum sequence identity among symbiont sequences two different types of analysis. Event-based analysis, which was 93%. The top-scoring hits to the SILVA SSU Ref NR considers only tree topology, predicted 10 cospeciation and 123 database [29] were all uncultivated environmental two host-shift events, with an optimal total cost of 8, signifi- sequences. The best hits with more than 90% identity were cantly less ( p ¼ 0.0) than the cost of randomized trees (mean included in our analysis, along with cultivated strains repre- 27.3, standard deviation 4.9). Distance-based Procrustean senting each taxonomic order in basal Gammaproteobacteria, analysis, which uses branch length information, yielded a good- and known thiotrophic symbionts. ness-of-fit metric m2 ¼ 0.0157, significantly better ( p ¼ 0.0) The symbiont sequences fell within the basal Gammapro- than the metrics for randomized associations (mean 0.062, stan- teobacteria, forming a well-supported clade (99% Bayesian, dard deviation 0.0053). Nonetheless, host and symbiont 99% maximum likelihood) with environmental sequences. phylogenies were not strictly congruent. For example, symbiont Within this clade, the symbionts alone formed a moderately sequences from two host morphospecies, K. spp. UNK and well-supported clade (81% B, 73% ML), and if the most LPFa, were more than 99% identical, even though their host basal symbiont (from K. sp. FBG) was excluded, the remain- 18S rRNA sequences were not closely related (figure 3). ing group was highly supported (100% B, 100% ML). An FISH confirmed that the 16S rRNA sequence recovered environmental sequence from marine sediment (JF344692) from Kentrophoros sp. H came from the bacterial cells covering fell among the symbionts, while the other environmental its surface. The following oligonucleotide probes were used: sequences, which were from marine sediment or coral-associ- Gam42a targeting the Gammaproteobacteria in general, ated, formed a separate cluster (84% B, 83% ML). The next chr4Ca targeting most symbiont sequences and chr4Ba tar- closest relatives were the Coxiellaceae (92% B, 83% ML), fol- geting only the symbiont sequence from morphospecies K. lowed by the Ectothiorhodospiraceae (90% B, 92% ML). The sp. H. All probes gave an unambiguous signal corresponding symbionts diverged from other known thiotrophic symbiotic morphologically to the symbiotic bacteria, comparable in bacteria, including Ca. Thiobios zoothamnicoli, the only other intensity to the positive control probe EUB338I-III, which well-characterized thiotroph symbiont from a ciliate host. binds to all bacteria (figure 1). 45 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 We propose the name ‘Candidatus Kentron eta’ for the (a)(b) 6 bacterial ectosymbiont of Kentrophoros morphospecies H, rspb.royalsocietypublishing.org with Ca. Kentron comprising the thiotrophic symbionts of Kentrophoros ciliates in general. The assignment is based on the symbiont 16S rRNA sequence (accession LT621987), and Cyt hybridization with oligonucleotide probes chr4Ca and Bac chr4Ba. The generic name (nom. neut. sing.) means ‘spine’ in Greek and is the first half of the host genus name, while the species name (irreg. neut. indecl.) is from the Greek pro- (c) genitor of the Latin letter H. Morphologically, all known Mf Ca. Kentron are rod-shaped bacteria, containing refractile glo- Cyt bules that are presumably elemental sulfur, and exhibiting Bac Bac B Soc. R. Proc. cell division along the longitudinal, rather than transverse, Cyt axis [8,9,12,16]. Cil (c) Diversity of the symbiotic body plan 284 To document the morphological diversity of Kentrophoros Figure 4. (a) Three-dimensional rendering of Kentrophoros sp. H recon- 20170764 : hosts, we focused on cell body involution, which can be structed from serial sections. Highlighted volumes: off-white—cell outline; directly observed in live specimens in the field. At both the blue—symbiont-bearing pseudotrophosome; red—nuclei of the ciliate. m Mediterranean and Caribbean sites, we found three types Scale bar, 200 m. (b) Longitudinal section of K. sp. H, stained with tolui- m of involution that have been described previously: dine blue. Scale bar, 20 m. (c) Transverse section of K. sp. H, with m (i) ‘open’—cell body flattened and ribbon-like, ventral side pseudotrophosome outlined in grey. Scale bar, 20 m. Each image is from ciliated and the dorsal side bearing ectosymbionts, e.g. the a different individual. Bac, bacteria; Cyt, ciliate cytoplasm; Mf, median type species Kentrophoros fasciolatus [7]; (ii) ‘tubular’—invo- furrow; Cil, cilia. (Online version in colour.) luted into a tube, with the ectosymbiont-bearing dorsal side inside the tube, e.g. Kentrophoros fistulosus [8,9]; (iii) ‘canalis- No clear phylogenetic pattern was observed when either like’—ectosymbiont coat extends beyond dorsal side over to cell body involution types or nuclear characters were mapped the ciliated ventral side, leaving only a stripe down the onto the 18S rRNA phylogeny (figure 3; electronic supplemen- middle that is ectosymbiont-free, so far only known in tary material, table S1). For example, the clade containing Kentrophoros canalis [47]. K. spp. FB, H, FM and G has members with open, tubular A new type of cell body involution was observed in mor- and pseudotrophosomal body shapes; one has only three phospecies Kentrophoros sp. H from Elba. The entire body nuclei per cell (K. sp. H), while the others have more than 10. was involuted except for the anterior and posterior extremities (‘head’ and ‘tail’), with the symbiont-bearing surface on the inside. Moreover, the bacteria appeared to be packed into a regular series of pouches, projecting laterally from the 4. Discussion median axis. Serial sections of two entire individuals showed We have presented evidence for a single origin of the Kentro- that the pouches were formed by folds and undulations of phoros symbiosis among both the hosts and symbionts. the symbiont-bearing surface, but that the surface was contigu- Kentrophoros specimens belonging to different morphospecies ous and did not form closed-off chambers (figure 4). In analogy and collected from two well-separated localities, the Mediter- to the endosymbiont-bearing trophosome body region in ani- ranean and the Caribbean, fell in the same 18S rRNA clade. mals such as the tubeworm Riftia pachyptila, we call the Their associated symbionts formed a new distinct clade, symbiont-filled region of morphospecies K. sp. H the ‘pseudo- which we have named Ca. Kentron. Moreover, the ciliates trophosome’, because the symbionts appear enclosed but are are more morphologically diverse than previously antici- still topologically outside the host cell body. The pseudotropho- pated, with a new variant on the Kentrophoros body plan some occupies 50% of the total volume of the symbiotic discovered during this study. This is only the second group organism, as estimated from three-dimensional reconstruction of ciliates and third group of protists for which thiotrophic of a complete, serially sectioned individual (figure 4). symbionts have been phylogenetically identified. It is now For some morphospecies, there was adequate material to clear that thiotrophic symbioses have evolved independently characterize the number and arrangement of nuclei by in these three protist groups, as well as in their symbionts, staining with the DNA-specific dye DAPI (electronic sup- which belong to phylogenetically distinct lineages in plementary material, table S1). These were also diverse: the Gamma- and Epsilonproteobacteria [3,4]. Our results high- nuclei were arranged in a single loose row, or in clusters. light the relevance of microbial eukaryotes as hosts for such Some had a single cluster, while others had multiple clusters symbioses, and we predict that many more thiotrophic arranged in a row, and the numbers of micro- and macronu- symbioses remain to be discovered in protists. clei per cluster could also differ. The nuclear configurations observed in our samples corresponded to many of those already described in published species (summarized in (a) Phylogenetic position of the symbiotic bacteria [48]). Based on the nuclei and body shape, a tentative identi- The symbionts of Kentrophoros belong to the basal Gammapro- fication was made for two of the morphospecies we collected teobacteria, which include ‘classical’ free-living thiotrophs on Elba: K. sp. FBG with K. canalis, and K. sp. PFC with such as Beggiatoa, and also thiotrophic symbionts of eukar- K. uninucleatus. yotes. Both thiotrophy and symbiosis have repeatedly 46 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 evolved in basal Gammaproteobacteria [1] and many clades of cells of some Kentrophoros morphospecies. The different 7 thiotrophic symbionts are either affiliated with more than one gene copies may undergo duplication, divergence and loss rspb.royalsocietypublishing.org clade of host organisms, or have free-living members within a single organismal lineage, independently of specia- [17,49,50]. The Ca. Kentron clade contains all known Kentro- tion. Most eukaryotes have multiple rRNA gene copies, phoros symbionts but only one environmental sequence often in identical tandem repeats, but many cases of diver- (JF344692) from anaerobic marine sediment, which is a habitat gent paralogues have also been reported, particularly where Kentrophoros can be found, so it is likely that Ca.Kentron among the alveolates, the group that includes the ciliates comprises only Kentrophoros symbionts. [57]. Intra-individual diversity of rRNA gene copies has pre- Our phylogenetic analyses showed that Ca. Kentron rep- viously been demonstrated with single ciliate cells [58], but resents an independent origin of thiotrophic symbiosis this is the first time that this has been shown for the karyor- within the Gammaproteobacteria. The sister group to Ca. elicteans. The 18S rRNA gene is routinely used for ciliate Kentron is a cluster of environmental sequences from sedi- taxonomy, but the tree is not well resolved at the species B Soc. R. Proc. ment, sponges and corals. As these sequences come from level, which illustrates some limitations of single-gene phylo- environmental clone libraries with no information on how genies. Having additional markers, such as mitochondrial they were collected, we cannot determine whether they origi- genes [59], may circumvent some of these problems, but for nated from Kentrophoros, symbionts of other hosts or free- most ciliate species, especially the karyorelicteans, the 18S 284 living bacteria. However, the next closest relatives are obli- rRNA gene is the only molecular marker available [60], so gate intracellular parasites (the Coxiellaceae) and free-living this would come at the cost of reduced taxon sampling. 20170764 : sulfur-oxidizers (Ectothiorhodospiraceae), and not other symbiotic thiotrophs. (c) Diversity of the host ciliates The monophyly of Kentrophoros falsifies the hypothesis [9] (b) Host–symbiont codiversification that the genus is polyphyletic. Its morphological diversity The phylogenies of host and symbiont showed statistically can instead be interpreted as variants upon a basic body significant evidence of codivergence. Kentrophoros is assumed plan, which we postulate to be exemplified by a flat ribbon- to reproduce asexually by fragmentation or fission, so the like cell body, and an approximate 2 : 1 ratio of macro- to symbionts would generally be inherited vertically by daugh- micronuclei (the ratio in most karyorelicts [61]). The extensive ter cells. Codiversification between ectosymbiotic bacteria folding of the symbiont-bearing surface in K. sp. H into a and motile eukaryotic hosts may seem surprising, as ecto- pseudotrophosome represents a new body plan variant. symbionts are constantly exposed to their surrounding This increases the available surface area for ectosymbiont environment. However, recent studies have shown that the attachment, despite the ciliate’s large size, maintaining a thiotrophic ectosymbionts of marine nematode worms [51] high bacteria : holobiont biovolume ratio of 50%, comparable and the ectosymbionts of termite gut flagellates [52] have to smaller species such as K. fistulosus (53%, measured from also cospeciated with their hosts, which highlights how codi- fig. 1 of [8]) and K. cf. flavus (50%, [10]). This is higher than versification and mechanisms for symbiont recognition and the ratio in the gutless flatworm Paracatenula (33–50%, [6]), maintenance, previously assumed to be characteristic for which is the highest known from metazoans with thiotrophic endosymbioses, also occur in ectosymbioses. symbionts. Given that the ciliate cytoplasm also contains The phylogenies of Kentrophoros and their symbionts are digestive vacuoles with engulfed symbionts, the bacteria are not strictly congruent (figure 3). Indeed, our analyses indi- arguably the dominant partner in terms of biomass. cated that Ca. Kentron switched between host species at The morphological diversity of the Kentrophoros symbiosis least twice. Strict host–symbiont codiversification patterns contrasts with the thiotrophic symbiosis hosted by marine would also be disrupted if hosts take up hitherto unrecog- interstitial stilbonematine nematodes (family Desmodoridae) nized free-living Ca. Kentron strains from their environment [62,63]. In Kentrophoros, the hosts are diverse in body form, [53]. Kentrophoros have not been cultivated, so symbiont-free while the bacteria are consistently rod-shaped, whereas for life cycle stages that would also disrupt vertical transmission, the nematodes, the symbionts are diverse (small cocci to such as cysts, cannot be ruled out, although cysts are not long unicellular filaments [62,64,65]), while the hosts are known from the karyorelict ciliates [54]. always more or less cylindrical and do not vary widely in Our study adds to a growing body of evidence that most size, although they have specializations in other characters thiotrophic symbionts, including intracellular ones, have such as the cuticle and sexual organs [66]. In both the Kentro- mixed modes of transmission [53]. Nonetheless, in Kentrophoros, phoros and nematode symbiotic systems, several species can both the host and symbiont clades remain specific and exclusive co-occur in the same localities. Although the functional signifi- to each other, a pattern that has only been observed among thio- cance of the different morphologies is unclear, co-occurrence trophic symbioses in the flatworm Paracatenula [6] and the of related species may indicate niche differentiation at small vesicomyid clams [55]. In other cases, a single symbiont clade spatial scales within the interstitial environment. may be associated with more than one host clade [51], or vice We argue that the symbiosis between Kentrophoros and versa [56]. The apparently stable association between Kentro- Ca. Kentron is an adaptive radiation: it has a single phyloge- phoros and Ca. Kentron indicates that there are clade-specific netic origin but is speciose, geographically widespread and recognition mechanisms (otherwise thiotrophic symbionts morphologically diverse, although we have likely only from other lineages would associate with Kentrophoros), in sampled a small fraction of its diversity. As a ciliate, Kentro- addition to species/strain-specific recognition (otherwise host phoros provides a contrast to the well-known metazoan- switches would occur more often within Ca.Kentron). hosted models for thiotrophic symbiosis, and gives us the The phylogenies may be even more congruent if not for opportunity to explore functional and evolutionary parallels the presence of multiple 18S rRNA sequence types in single among disparate organisms with such a lifestyle. 47 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 Data accessibility. Sequences: European Nucleotide Archive (Kentrophoros Betty Moore Foundation through grant GBMF 3811 to N.D. Part of 8 18S rRNA—LT621756 to LT621967; symbiont 16S rRNA—LT621968 the histology work by J.-M.V. was supported by the Austrian Science to LT622020). Alignments and trees: TreeBASE (study number Fund (FWF) grant P24565-B22 to Monika Bright. rspb.royalsocietypublishing.org S19762). Three-dimensional imaging: Dryad: http://dx.doi.org/10. Acknowledgements. We thank the Hydra Institute team on Elba, 5061/dryad.nc5dp [67]. especially Miriam Weber, Hannah Kuhfuß and Matthias Schneider, Authors’ contributions. B.K.B.S. collected samples, performed exper- and the staff at Carrie Bow Caye Field Station, for invaluable support iments and analysed data. B.K.B.S. designed the study and wrote in fieldwork. We also thank Julia Bauder for sectioning samples for the paper with H.R.G.-V. and N.D. T.S. created the three-dimen- three-dimensional reconstruction, Mario Schimak and Oliver Ja¨ckle sional reconstructions of morphospecies H and calculated the for help in specimen collection, Nikolaus Leisch for sharing reagents, bacteria : holobiont ratio. J.-M.V. performed histology work. B.H. Veronika Will for preliminary sectioning, Martina Meyer for main- prepared NGS libraries with B.K.B.S., and coordinated NGS taining the Beggiatoa culture and Georg Herz for building the Uhlig sequencing. apparatus. We also thank Monika Bright for arranging financial sup- Competing interests. We declare we have no competing interests. port for J.-M.V., the Core Facility of Cell Imaging and Ultrastructure Funding. Financial support was provided by IMPRS MarMic to B.K.B.S., at the University of Vienna and the anonymous referees for their B Soc. R. Proc. the Max Planck Society to B.K.B.S., H.R.G.-V., N.D., a Marie-Curie IEF reviews. This is contribution 998 from the Caribbean Coral Reef PIEF-GA-2011-301027 CARISYM to H.R.G.-V. and the Gordon and Ecosystems (CCRE) Program, Smithsonian Institution. 284 References 20170764 : 1. Dubilier N, Bergin C, Lott C. 2008 Symbiotic 10. Fenchel T, Finlay BJ. 1989 Kentrophoros:a Trachelolophos and Trachelotractus (Alveolata, diversity in marine animals: the art of harnessing mouthless ciliate with a symbiotic kitchen garden. Ciliophora). Zool. Scr. 39, 305–313. (doi:10.1111/j. chemosynthesis. Nat. Rev. Microbiol. 6, 725–740. Ophelia 30, 75–93. 1463-6409.2010.00416.x) (doi:10.1038/nrmicro1992) 11. Faure´-Fremiet E. 1950 E´cologie des cilie´s 20. Foissner W, Dragesco J. 1996 Updating the 2. Stewart FJ, Newton ILG, Cavanaugh CM. 2005 psammophiles littoraux. Bull. Biol. Fr. Belg. 84, trachelocercids (Ciliophora, Karyorelictea). I. A Chemosynthetic endosymbioses: adaptations to 35–75. detailed description of the infraciliature of oxic–anoxic interfaces. Trends Microbiol. 13, 12. Raikov IB. 1974 E´tude ultrastructurale des bacte´ries Trachelolophos gigas n.g., n. sp. and T. filum 439–448. (doi:10.1016/j.tim.2005.07.007) e´pizoiques et endozoiques de Kentrophoros latum (Dragesco & Dragesco-Kerne´is, 1986) n. comb. 3. Edgcomb VP, Breglia SA, Yubuki N, Beaudoin D, Raikov, cilie´ holotriche me´sopsammique. Cah. Biol. J. Eukaryot. Microbiol. 43, 12–25. (doi:10.1111/j. Patterson DJ, Leander BS, Bernhard JM. 2011 Mar. 15, 379–393. 1550-7408.1996.tb02467.x) Identity of epibiotic bacteria on symbiontid 13. Maurin LC, Himmel D, Mansot J-L, Gros O. 2010 21. Uhlig G. 1964 Eine einfache Methode zur Extraktion euglenozoans in O2-depleted marine Raman microspectrometry as a powerful tool for a der vagilen, mesopsammalen Mikrofauna. sediments: evidence for symbiont and host quick screening of thiotrophy: an application on Helgola¨nder Wiss. Meeresunters. 11, 178–185. co-evolution. ISME J. 5, 231–243. (doi:10.1038/ mangrove swamp meiofauna of Guadeloupe (doi:10.1007/BF01612370) ismej.2010.121) (F.W.I.). Mar. Environ. Res. 69, 382–389. (doi:10. 22. Medlin L, Elwood HJ, Stickel S, Sogin ML. 1988 4. Bright M, Espada-Hinojosa S, Lagkouvardos I, 1016/j.marenvres.2010.02.001) The characterization of enzymatically amplified Volland J-M. 2014 The giant ciliate Zoothamnium 14. Fenchel T. 1969 The ecology of marine eukaryotic 16S-like rRNA-coding regions. niveum and its thiotrophic epibiont Candidatus microbenthos IV. Structure and function of the Gene 71, 491–499. (doi:10.1016/0378- Thiobios zoothamnicoli: a model system to study benthic ecosystem, its chemical and physical factors 1119(88)90066-2) interspecies cooperation. Front. Microbiol. 5, 145. and the microfauna communities with special 23. Andreoli I, Mangini L, Ferrantini F, Santangelo G, (doi:10.3389/fmicb.2014.00145) reference to the ciliated protozoa. Ophelia 6,1– Verni F, Petroni G. 2009 Molecular phylogeny of 5. Goffredi SK. 2010 Indigenous ectosymbiotic bacteria 182. (doi:10.1080/00785326.1969.10409647) unculturable Karyorelictea (Alveolata, Ciliophora). associated with diverse hydrothermal vent 15. Kahl A. 1935 Urtiere oder Protozoa I: Wimpertiere Zool. Scr. 38, 651–662. (doi:10.1111/j.1463-6409. invertebrates: indigenous bacteria associated oder Ciliata (Infusoria) 4. Peritricha und 2009.00395.x) with vent invertebrates. Environ. Microbiol. Rep. 2, Chonotricha; Nachtrag I. In Die Tierwelt 24. Miller CS et al. 2011 EMIRGE: reconstruction of full- 479–488. (doi:10.1111/j.1758-2229.2010.00136.x) Deutschlands, pp. 651–886. Jena, Germany: G. length ribosomal genes from microbial community 6. Gruber-Vodicka HR et al. 2011 Paracatenula,an Fischer. short read sequencing data. Genome Biol. 12, R44. ancient symbiosis between thiotrophic 16. Faure´-Fremiet E. 1950 Caulobacte´ries e´pizoı¨ques (doi:10.1186/gb-2011-12-5-r44) Alphaproteobacteria and catenulid flatworms. Proc. associe´es aux Centrophorella (cilie´s holotriches). Bull. 25. Bankevich A et al. 2012 SPAdes: a new genome Natl Acad. Sci. USA 108, 12 078–12 083. (doi:10. Socie´te´ Zool. Fr. 75, 134–137. assembly algorithm and its applications to single- 1073/pnas.1105347108) 17. Petersen JM, Wentrup C, Verna C, Knittel K, Dubilier cell sequencing. J. Comput. Biol. 19, 455–477. 7. Sauerbrey E. 1928 Beobachtungen u¨ber einige neue N. 2012 Origins and evolutionary flexibility of (doi:10.1089/cmb.2012.0021) oder wenig bekannte marine Ciliaten. Arch. Fu¨r chemosynthetic symbionts from deep-sea animals. 26. Buchholz-Cleven BEE, Rattunde B, Straub KL. 1997 Protistenkd. 62, 355–407. Biol. Bull. 223, 123–137. (doi:10.1086/ Screening for genetic diversity of isolates of 8. Raikov IB. 1971 Bacte´ries e´pizoiques et mode de BBLv223n1p123) anaerobic Fe(II)-oxidizing bacteria using DGGE nutrition du cilie´ psammophile Kentrophoros 18. Xu Y, Huang J, Warren A, Al-Rasheid KAS, Al-Farraj and whole-cell hybridization. Syst. Appl. fistulosum Faure´-Fremiet (e´tude au microscope SA, Song W. 2011 Morphological and molecular Microbiol. 20, 301–309. (doi:10.1016/S0723- e´lectronique). Protistologica 7, 365–378. (doi:10. information of a new species of Geleia (Ciliophora, 2020(97)80077-X) 1016/S0074-7696(08)60584-7) Karyorelictea), with redescriptions of two 27. Juck D, Charles T, Whyte LG, Greer CW. 2000 9. Foissner W. 1995 Kentrophoros (Ciliophora, Kentrophoros species from China. Eur. J. Protistol. Polyphasic microbial community analysis of Karyorelictea) has oral vestiges: a reinvestigation of 47, 172–185. (doi:10.1016/j.ejop.2011.03.003) petroleum hydrocarbon-contaminated soils from K. fistulosus (Faure´-Fremiet, 1950) using protargol 19. Gao S, Stru¨der-Kypke MC, Al-Rasheid KAS, Lin X, two northern Canadian communities. FEMS impregnation. Arch. Fu¨r Protistenkd. 146, 165–179. Song W. 2010 Molecular phylogeny of three Microbiol. Ecol. 33, 241–249. (doi:10.1111/j.1574- (doi:10.1016/S0003-9365(11)80107-7) ambiguous ciliate genera: Kentrophoros, 6941.2000.tb00746.x) 48 Downloaded from http://rspb.royalsocietypublishing.org/ on July 12, 2017 28. Edgar RC. 2010 Search and clustering orders of Microbiol. 71, 1553–1561. (doi:10.1128/AEM.71.3. 55. Stewart FJ, Young CR, Cavanaugh CM. 2008 Lateral 9 magnitude faster than BLAST. Bioinformatics 26, 1553-1561.2005) symbiont acquisition in a maternally transmitted rspb.royalsocietypublishing.org 2460–2461. (doi:10.1093/bioinformatics/btq461) 42. Ishii K, Mussmann M, MacGregor BJ, Amann R. chemosynthetic clam endosymbiosis. Mol. Biol. Evol. 29. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, 2004 An improved fluorescence in situ hybridization 25, 673–687. (doi:10.1093/molbev/msn010) Yarza P, Peplies J, Glockner FO. 2013 The SILVA protocol for the identification of bacteria and 56. Krueger DM, Cavanaugh CM. 1997 Phylogenetic ribosomal RNA gene database project: improved archaea in marine sediments. FEMS Microbiol. Ecol. diversity of bacterial symbionts of Solemya hosts data processing and web-based tools. Nucleic Acids 50, 203–213. (doi:10.1016/j.femsec.2004.06.015) based on comparative sequence analysis of 16S Res. 41, D590–D596. (doi:10.1093/nar/gks1219) 43. Amann RI, Binder BJ, Olson RJ, Chisholm SW, rRNA genes. Appl. Environ. Microbiol. 63, 91–98. 30. Katoh K, Standley DM. 2013 MAFFT multiple Devereux R, Stahl DA. 1990 Combination of 16S 57. Torres-Machorro AL, Herna´ndez R, Cevallos AM, sequence alignment software version 7: rRNA-targeted oligonucleotide probes with flow Lo´pez-Villasen˜or I. 2010 Ribosomal RNA genes in improvements in performance and usability. Mol. cytometry for analyzing mixed microbial eukaryotic microorganisms: witnesses of phylogeny? Biol. Evol. 30, 772–780. (doi:10.1093/molbev/ populations. Appl. Environ. Microbiol. 56, FEMS Microbiol. Rev. 34, 59–86. (doi:10.1111/j. B Soc. R. Proc. mst010) 1919–1925. 1574-6976.2009.00196.x) 31. Darriba D, Taboada GL, Doallo R, Posada D. 2012 44. Daims H, Bru¨hl A, Amann R, Schleifer KH, Wagner 58. Gong J, Dong J, Liu X, Massana R. 2013 Extremely jModelTest 2: more models, new heuristics and M. 1999 The domain-specific probe EUB338 is high copy numbers and polymorphisms of the rDNA parallel computing. Nat. Methods 9, 772. (doi:10. insufficient for the detection of all bacteria: operon estimated from single cell analysis of 1038/nmeth.2109) development and evaluation of a more oligotrich and peritrich ciliates. Protist 164, 284 32. Stamatakis A. 2014 RAxML version 8: a tool for comprehensive probe set. Syst. Appl. Microbiol. 22, 369–379. (doi:10.1016/j.protis.2012.11.006) 20170764 : phylogenetic analysis and post-analysis of large 434–444. (doi:10.1016/S0723-2020(99)80053-8) 59. Dunthorn M, Foissner W, Katz LA. 2011 Expanding phylogenies. Bioinformatics 30, 1312–1313. 45. Manz W, Amann R, Ludwig W, Wagner M, Schleifer character sampling for ciliate phylogenetic inference (doi:10.1093/bioinformatics/btu033) K-H. 1992 Phylogenetic oligodeoxynucleotide using mitochondrial SSU-rDNA as a molecular 33. Anisimova M, Gascuel O. 2006 Approximate probes for the major subclasses of proteobacteria: marker. Protist 162, 85–99. (doi:10.1016/j.protis. likelihood-ratio test for branches: a fast, accurate, problems and solutions. Syst. Appl. Microbiol. 15, 2010.06.003) and powerful alternative. Syst. Biol. 55, 539–552. 593–600. (doi:10.1016/S0723-2020(11)80121-9) 60. Gao F et al. 2016 The all-data-based evolutionary (doi:10.1080/10635150600755453) 46. Takishita K, Kakizoe N, Yoshida T, Maruyama T. 2010 hypothesis of ciliated protists with a revised 34. Ronquist F et al. 2012 MrBayes 3.2: efficient Molecular evidence that phylogenetically diverged classification of the Phylum Ciliophora (Eukaryota, Bayesian phylogenetic inference and model choice ciliates are active in microbial mats of deep-sea Alveolata). Sci. Rep. 6, 24874. (doi:10.1038/ across a large model space. Syst. Biol. 61, 539–542. cold-seep sediment. J. Eukaryot. Microbiol. 57,76– srep24874) (doi:10.1093/sysbio/sys029) 86. (doi:10.1111/j.1550-7408.2009.00457.x) 61. Raikov IB. 1985 Primitive never-dividing 35. Aberer AJ, Krompass D, Stamatakis A. 2013 Pruning 47. Wright JM. 1982 Some sand-dwelling ciliates of macronuclei of some lower ciliates. Int. Rev. Cytol. rogue taxa improves phylogenetic accuracy: an South Wales. Cah. Biol. Mar. 23, 275–285. 95, 297–325. efficient algorithm and webservice. Syst. Biol. 62, 48. Carey PG. 1992 Marine interstitial ciliates: an 62. Polz MF, Felbeck H, Novak R, Nebelsick M, Ott JA. 162–166. (doi:10.1093/sysbio/sys078) illustrated key. London, UK: Chapman & Hall. 1992 Chemoautotrophic, sulfur-oxidizing symbiotic 36. Conow C, Fielder D, Ovadia Y, Libeskind-Hadas R. 49. Heindl NR, Gruber-Vodicka HR, Bayer C, Lu¨cker S, bacteria on marine nematodes: morphological and 2010 Jane: a new tool for the cophylogeny Ott JA, Bulgheresi S. 2011 First detection of biochemical characterization. Microb. Ecol. 24, reconstruction problem. Algorithms Mol. Biol. 5, 16. thiotrophic symbiont phylotypes in the pelagic 313–329. (doi:10.1007/BF00167789) (doi:10.1186/1748-7188-5-16) marine environment: pelagic thiotrophic symbiont 63. Ott J, Bright M, Bulgheresi S. 2004 Symbioses 37. Balbuena JA, Mı´guez-Lozano R, Blasco-Costa I. 2013 phylotypes. FEMS Microbiol. Ecol. 77, 223–227. between marine nematodes and sulfur-oxidizing PACo: a novel Procrustes application to (doi:10.1111/j.1574-6941.2011.01096.x) chemoautotrophic bacteria. Symbiosis 36, 103–126. cophylogenetic analysis. PLoS ONE 8, e61048. 50. Rinke C et al. 2006 ‘Candidatus Thiobios 64. Pende N, Leisch N, Gruber-Vodicka HR, Heindl NR, (doi:10.1371/journal.pone.0061048) zoothamnicoli,’ an ectosymbiotic bacterium covering Ott J, den Blaauwen T, Bulgheresi S. 2014 Size- 38. Ludwig W et al. 2004 ARB: a software environment the giant marine ciliate Zoothamnium niveum. Appl. independent symmetric division in extraordinarily for sequence data. Nucleic Acids Res. 32, 1363– Environ. Microbiol. 72, 2014–2021. (doi:10.1128/ long cells. Nat. Commun. 5, 4803. (doi:10.1038/ 1371. (doi:10.1093/nar/gkh293) AEM.72.3.2014-2021.2006) ncomms5803) 39. Fuchs BM, Glo¨ckner FO, Wulf J, Amann R. 2000 51. Zimmermann J et al. 2016 Closely coupled 65. Leisch N, Verheul J, Heindl NR, Gruber-Vodicka HR, Unlabeled helper oligonucleotides increase the in evolutionary history of ecto- and endosymbionts Pende N, den Blaauwen T, Bulgheresi S. 2012 situ accessibility to 16S rRNA of fluorescently from two distantly related animal phyla. Mol. Ecol. Growth in width and FtsZ ring longitudinal labeled oligonucleotide probes. Appl. Environ. 25, 3203–3223. (doi:10.1111/mec.13554) positioning in a gammaproteobacterial symbiont. Microbiol. 66, 3603–3607. (doi:10.1128/AEM.66.8. 52. Desai MS, Strassert JFH, Meuser K, Hertel H, Ikeda- Curr. Biol. 22, R831–R832. (doi:10.1016/ j.cub. 3603-3607.2000) Ohtsubo W, Radek R, Brune A. 2010 Strict 2012.08.033) 40. Schramm A, Fuchs BM, Nielsen JL, Tonolla M, cospeciation of devescovinid flagellates and 66. Tchesunov AV. 2013 Marine free-living nematodes of Stahl DA. 2002 Fluorescence in situ hybridization of Bacteroidales ectosymbionts in the gut of dry-wood the subfamily Stilbonematinae (Nematoda, 16S rRNA gene clones (Clone-FISH) for probe termites (Kalotermitidae). Environ. Microbiol. 12, Desmodoridae): taxonomic review with descriptions validation and screening of clone libraries. Environ. 2120–2132. (doi:10.1111/j.1462-2920.2009.02080.x) of a few species from the Nha Trang Bay, Central Microbiol. 4, 713–720. (doi:10.1046/j.1462-2920. 53. Bright M, Bulgheresi S. 2010 A complex journey: Vietnam. Meiofauna Mar. 20, 71–94. 2002.00364.x) transmission of microbial symbionts. Nat. Rev. 67. Seah BKB, Schwaha T, Volland J-M, Huettel B, 41. Blazejak A, Erse´us C, Amann R, Dubilier N. 2005 Microbiol. 8, 218–230. (doi:10.1038/nrmicro2262) Dubilier N, Gruber-Vodicka HR. 2017 Specificity in Coexistence of bacterial sulfide oxidizers, sulfate 54. Lynn DH. 2008 The ciliated protozoa: characterization, diversity: single origin of a widespread ciliate- reducers, and spirochetes in a gutless worm classification, and guide to the literature,3rdedn. bacteria symbiosis. Dryad Digital Repository. (http:// (Oligochaeta) from the Peru margin. Appl. Environ. Dordrecht, The Netherlands: Springer. dx.doi.org/10.5061/dryad.nc5dp) 49 ! " #$ % & % ' ( )* + * & % , % & -.& / , +) + 0 #$ 1 2 3 , +)4 - / + #$ & % 3 % & & 5+6 0 . . % 7& % 5!+ + * 73 % 8 ( % 7& % 5!+ + 0 73 % 3 !+ + 0 #$ % & % . !+ - / + 0 & % 9 :, % & 732 & % <, ; + 0 % & -,8 / 8 *=> * . . => & & +% *$ 0 #$ 1 2 , , 4 *$ * #$ 1 2 , , +? *$ 0 & -&& / . %) *$ 0 & -&8 / * *$ * & -&' / . !" !# @ @ !# % @ % @ 32 # ' #> $ %A(A2A B83 3& %&A3,A3 =.(AA.A ;C'&&,'& 5. 3 ( =3'.AA. D3.(,&( 5. 3 ' +>83A'&& +.3(A . D+'22A2' !"#$""#"$ !A(2&,A "$ 6 '(A&3 6 '(A.& % """& D+,.(33' ''" 6 '(A.. ( +D,8(323 ) *+",$$- +D,8(328 ) *+",$$-$ 3,&A., ) 5. 3 A .% %A,82. .% ./ 6 '(A&, 0 DB2 3.(3 1 !"#",$""$ DB2 3.(. 1 !$"",2"$ 4C 8( 3. 3 )323,'& = E ' #> F #% " 4%&3 )3233.. = E ' #> F #%&" 4%&3 )3233., = E ' #> F #%&" 4%&8 DB&2,(.8 4 !$$"/"/"$ 3 % ) 4 8 #> $& && +.'(.2 % +,2833, 5.67$ + ,('. !22 'A8 -&2&33.," &2&(2,'/ +5$2" 6.3A&'& 8 5G %,2,&8, 8 ;C&.A(88 B %&88. 8 + 2&(, $2.+ * 62 2222.8 -,&(8"3(A(/ 3 $/2, D&&.&., %&2'.'. % 5G !2223 . - ..822'" ..(3.A/ + 9 $:"- 4C'3(3,A + 5G 6&A'A2, 7 =(222'& 7 H.&8.( ; 5G 6A&'.A, ; * +,A3&&' BA.,(& 6 !2223,, -A3&&,'" A3.('3/ 6 .$ )8,.,(. 6 + (2, A 6 D> (3.., 6 D&&,,.2 < D228& & . D22828. . H,A(.' . (( 5G B'(&(( . % * +882(3' . B ) 88'(' . B ='32'28 5 B(&((. 5 ( % ='A.22 5 0 % B(&(( 5 % B(&(8( 5 % B(&((8 5 % +.2, A8 5 % BA3,82 5 * =8(A&A 5 % + 2. &( & %2.'22 & 3& +&'(&A' & 68A2..8 & =.8A, * %, '.', % % B B',. 8 1 ;C&A'2&3 1 +,.& ,3 I =8&8,8 B )&,3,(A * D( (.A, +&&( 8 3 5G = &,88' 3 +,' ' 3 + &83,3 3 +.&A2'. 3 = D,2,228 3 + &AA' 3 +>&A.233 3 4+2 22228. - ,AA." 832A/ 3 +5$#2 +AAAA(, 3 D22&(A8 3 ;C,8A3', 3 % ;C,8A3(8 3 +% ('&( 3 +2 .A(3 3 * %(,'A&3 3 )&88.'A 3 +>&A.23( 3 4+;2 2222&2 -&3833"&( ('/ 3 3 :""/22 )2 8A'8 3 ( )2,&3,3 3 % % * ) '&.8 3 % +#(,AA 2 B )33'33( B + A&.,. B 6 2&8 & =((,(' 7 > ?1 @ !222,'' - 2' &(2" 2'&'2(/ 1 > ? @ =,.A22. 30 > ?A @ )& ,A.& 6A3 A. ) J %&.8.&( ) E +>'&&((A ) +%& ((. E =((,'& 3. )&.'A8, I =((,' 5 +.&''38 4 0 G D8&232( 4 0 D8&2,A8 4. 0 G D8&232' 4. 0 +>83'8AA # K 5&3(2A %A2, 3 DC.,(.( = 4= A2,( ! = ;C3 .2.& ) ) = )8A,28 " D = +DA23(,( K *G = D+&(& 2& = 22AA2' + 4 = D+.,, ,& " L I = D+.,,8A& " L I = DB32,,'. G ) = DB32,,2A G ) = D>A((&&' DJ ) = +>33.323 5G = % D+'2A(,, % = % D+'2A(A2 % = =83&3(& 6$ = DC'22A(& 6$ # ; = DC'22A&. 6$ # ; = ' ('. G O = D>8(&8. = P> E G G 8 #> G PP*K G 5! > -FQQ$$$ Q/ $ 3, ! "#$% %%& '() % *+,-. ! ( / %% & '(. 0 ' /( / %% &$%' % 12 '(3 1 %( & 4%% * 45-5 4% 463 )% & 71 % 3 1 %( &. +,-. ! ( &7 ( % '( ! ( % %" & // %% % & ( % % %% % (/' (% 8. ( 9/ % 1 % '8:& ( % / " & 7 ;$%(<" & )(;. 9< 1 ' % / & 8" ';55=>55?>5=@ 1 1 < % / % / (& %( % ' & & % / / %%8 / '(" ( % % '% '' % % " ; %5=8,= 85@ /% 1( " <8" &% (% % 1( ' ; =8,@% 5=8+@ # $ % % % ,D & E% / ( % % % % 1 ' 1 ' % / / 4 %%;6 1-+,-- <8 1& %(/ % %% %( ' & % / % 'B/ % 1C & ' 9% ;) % '->><8 1 /( ' & % ' 64 ; 64<';. %8--A %%8--D< %( %/( ' % ;! E%95 < %%%( % % % % % // %%% % 1(/ % %%% &% 1% %84 % ( % %%"/% &%''(& & % 1 % % % ( %8 " (-+;(8 E- E-,< ( %'%% % 9(% & 1 // %;B %C< % &% ( % & % &% ; ( -+AE-,AFF (-+-AF --,<8( % ' & % % % 1 % % % A% % & ' 9 %%' % / &% " % ;F --+AFF (-+-<8:% %/ % ' " % % % %& %%& B% C % % A% (/ % 9% 1% ';F --,< 1 % % % / % " " ;G%85<8% % % ( 1% '% &" % % % 1 / '% % % '& &%/ 1 & ; (-+AF HF %-,5 -, ' -, A-D56 1-D-DAE 11-DDA6 1E 11 -D+A: '%-+<8 / %% / ' 1 %( '% && %/ % '1 / 1 ( % /( '( &%+ 64'%%" /(% %" ;%85><8$% &%%%( 1 /%% 1 / / ;"8/8 <& 7$%( "/% ( ' /" & ' &%( % ' &%%& / / %%%% ,> ! & / % / 8 1 1% 1 / '% % /(% & ( / / B C % ' / / BF C& . 9/ " " /% 1( % % & % 8 " % ( 1 5 & % &7 $%(%%( &)1 ; 8> -J58+,+D+J78+/%<%K4 ; 8+5+,DJ58 >,J7>8/%<8( %'%( 1( 1 % / % 8) % "% %('%% ' & % %% %% % % (& % '8" % L(5,& )(. 98 % &&% % &% ;D8+,DJ++85D,5J:8,/%< / % /% %8) % "% %( %%% %% % ;3 '-D <8 1 / '% & %F M9! % ;F M9! ->D< % & % ; ) '55AF 5 <8 % / / '% F 9! ;->D<"/%%%.% (/% ;.. < % %%& //% 8F M9! & / / & ((& /( ;,@<6 %' % ;>,@<% (/% ; 5@< 9% ;+55@<8 1 " 1 % & % 8,5@ / &% ' ;/ & %# % & <& " %,5@ & N& (;7% /( < % & % % 9% % & "& & % %,5@ & N& ( 9% 8,5@ & F M9! & % % / "'%( %& % %/ % 8 % %/%%,+O) % ';,5 /< 1% /% ' 84&% 1 '"& %/ '%( %% % % 1 /& / % ' /( % '%& % % % 0(/.G, 2 4" / /8F / %/ / % % 1 / 1%/ / % & " %,5@ & 8,N % &%; '4 <& , % %/ % % % %% & ' ( %% ' &% ;>5+5 ,+ & E% / -DN< & % % %P "% &% 6 % % ;) 6 %<& (55N 6 % % % %# %;F % & < 1 /8 $% / % % %% & ( %( " &% ' 9& ' % % & / '%/ 8$%% %(/ '& / % %( % &%/ ' &%,5 % % ( ' 8 & ( % (% %% % & % % ( %% % % ( / '8 /& 7 & "% O) %8,N'% (&& %?# 7 ;5 #$#7,5 7#75 7!4 ' & ' 4 <; % ! 5D<& Q5% % "% &N '% (;7% /( <N& (&& %? # 7 & Q5%% % 8,?# 7 % '&& % O)% 8F "/ / %& " N %% " R8;7% /( <& %%%% %% 8) %% ' 1 / % %/ (( ( % % ;5 5,5D5>5+5 -5-D-D5555NQ5 / %/< % / % %)0 7 )#55 ; < ' S%F7!,5 '% /;F7$< % % % (% %% 8 /& 7 & " N00 %58 (%550 % / >8 ;7% /( <& % % 58 (%550 % / >8 1 '%;Q<% % % % % ( %& 7 ; 1< 7 .+ ;7% /( < '% % % 1%87 .+ " %B C& % %D5O)& 83% % % % & % % ' %F 1 T// %& % %58,N (%%N % %& " % %2 5% % / / % ' %5 8 ,- ! .PF / % % ' 1 % /% % /% 8 '1 & % %/% ;BC</ %/ % ;B% C< ' ;% '( &% %% F '8<) (// '% % R ' % & '%%% (%% ( % & % 8( % ' ' // % %% % 87% ( % %%& ( % ' 8 '%( (% %% '% 1%%&% 8;F '8< 7% ( 1 %"/%& % % %% (1% ; F HF %-,5< % & &%& (( % ' &8# 1 /% &" 1 ' 9% ;( % '<1% & %%&% '% /% 1( &% " %;F --,--+AG%85<8F %( 1%% B&%CB '%C% & % %% & B CB1% C & ' %% (8F "/ % 1 % ( ' % '% &% % "/ %% 1% &8;F '8< 4% ' %% % ;F '8D<8) %(% / % ' % / % " % & ' (% / % ;F '8D<8 3 " ;F --,<1 % 1( 1 &% / %% 1 1%& ' &%( % ' &% % % 8 1% ( ' ' %%& % ' % 8$ #% % %' '% %% % '% % ' / & ' 83/ % ;8'8 ' & <%(& R%( % % / &(& 9' % 8 1%&% % (' %% %% % &% (% '% ' % %8 ' 1 1 %% % 1&& % U ( ' % '/ % % % (% %8 .% ( %// / % ' &/ / U% '% (& % D5 & E% / " ;F '8 F< % ( % ' ' '%% ;F '8D<8 # & (& % &&% %% / ' ( % % ( %% % ' %"% 8% ' && % ( %% / % / & ( B 'C;F '8D<8 6 '% % % % / % (" 86 '% % /85=58,, @/ % % ( ' 88 %55% 55 % % (8) ( R( % % % ( '% % & 8;F '8,4<) % ' ' %( %( ' % & '% % & 1 % ( ' "% ' % % % ' & % R( %% ( % %"% ' % % ;F '8 <8 $ 1 % % % ' 1 / A % % % & % % % % ' / 7 ' /;F '8,.< && % % & % %% ( % % % (/% ' (%%% %( %8 &% % % %( ' %%// %( 1 /% %% ;F '8 4 .<8E % &&% %( % % % 1 / '%"% %%(& 86 '% % / U% // % 1 8&% %( 1 % ' % ( & & % % % % ( ' &% 1 % % &%8 7 '% %( ( ' &(/ & 1 / '%& % & % '(% %% % ;F '8 7<8F '( ' % (% 1 % % ' % 1& ' % %% 84 % ' ( & / % % ' %% &( % %(% / ;F '8 4 !<8 7&&% 1 & 1 / '% %%(% ' %% ' ( %& % % ( ' 1 %/ % / ;F '8 F<8 $&/ ( % %& / % &% 1 % ( ' % ' % %(% ' ( %& / %8 D ! ' / ' % (% / % '(% / % &8 ' / / ; $)<&( % ; 4)< ;F '8,)<8 % '( & % '%& % % %% ( F M9! % 8 $) %/ %-8D=8,@// % ( & % '%& % 4#$% % % 8 4) 1 % % // % %58,= 85@// % (% ' '%& 8$% % % 4) % % '(% % % / ' (% ' 8 ) & % & ' % '% % 8$ % %(% %% '%(% & % " %% 1'% ' ' & % 1 %% ' '%8 % ( " / %1 // % / A % / ( 1 %%%/ & ' &%( %( 8$% & 9 % % % " ; <% % '% & % " % % %( 8 " % % % 7V)1 %W4 V% R %% 1 % 1 // % / % % 84% 1 % ( &1 ; 40 4<%% 1/ / % ;" '% '% & '%<& %% / /% % U%%(/ % &R % % ; X58>DX # . %%%%% % <8$ 1 :% / %% %/ % ( %; X58, X,) %; X585D X < % U%%(/ % 8+ 64R & % 1 %( % %55N % %(% % "/% )1 R % % %% ; % &,,>/<18% % R8:% & ' % % / /% / & 8 .PF / % % ' 1 % /% % /% 8 D & E% / ' %A% %/ ( ;F '8><8&% 1 ( % & /( % % "/%& % 8 ' % ' 1 1 % ( / % 1 %8)(% /% '% / % & ' (% / % 8) % 1 (// % '% 1 1 %// %( % / / '% (% / % 8 6 '% % ' % % %( % 1 / '% / 8 % % & % % % % ' / ;F '8-4<8 ( ' % % 18&% % % %( %(U% % % % ' ;F '8-.<8 ' ' ' (/ (% / % % (/( % 1 % 8 $) % / (1 ( ' & 4);F '8+<8 $) %/ ' (% 8 4) &% %(/P;</ ' % $) % %/ % ;</ 9% $) %/ % ;< ' % % $) % & 1 / ' % 8(/;< % ( 1%% 4)%(// % 8 $)( %(&(%(/;< ;< 4)8 " 9 % ( % + 64 R% % / / & %( '%B!C/ 1 (;% 85><8 1 % / (& &" "8/8! 1 % (/ %/ & ' &%( % ' &% % 1 % / %/ % / " 8: % % '/ & "8/8!& & /% 8 ! &" " ' %(" ( % D ! / %& ;6 1-+,A) (--< 1%(/ 9 &@ ; $)< D@; 4)<;<8$%+ 64/( '(;%85><" " ; '%B CBF C /% 1(< '% % % " %% % % % 18$% % & % &% ' 1% %8:/%%%% ' 1 ' %& / (/ (1% %% & R& 1 8 " ( '% & ; 4)Y $)</ % ' ' %8 /99 ' % % " " % /' / % & ' % 8 % & '%/ ( U ( % & %/ & ' % % 1 8 / ( &" / % 8 1 & " % ( ' &%& '% (% %% & / & / % 8 && % / ' &" // % / % 1 /%%'%%1 & % ( %;6 1-+,< % / %%% 1%(/P;< ' %1 L' %%% % % % ;<% %/ % % ;<' %% 8 % / %% // % (%// &% %&%%%%(/ (% %(U%% %%(/ "/%% 1& 1 &% 8/ % &%% "/ (% 4)P $) % % ' %%%(/ P % & ( %8 1 %( & / ' &% %%F ;--,<''% " % /(% 8 '& '% & 4)Y $) ;8'8" <% ' & 4) $);8'8" ;G%85<<% / /" / ' % % 4) $) ( % % % ;8'8" ;6 1-><<;F '85<8: % 1 %( & " % & '% 9 % ' % ( % ' 1 %( % / ' ;6 1-+,<8F "/( / &* 1 ' 4)Y $) ' / %% $)/ % %% 4)U% " % / '%%(/* D & E% / 1 ' & %Q5 4);G! %85<8 1 1 % %& '% '% & ( % / / B & C; ' % %B%& C '(<8$& % & ' /(% & 4)%% & $)%% & ?;(Y%<8$&% ' / /%( % %%& ?)/;(Y%<8$&% %' / % % % ' ' %% (" %6;(Y%< (% %% % & 4) $)84 ' % ' &1 %(R% (/ /% 1(8F '' / && % % % B CB% C / ( % & 8: % // % "/ & " % ( % 8 1 / '% & ( % ' ';F 5 <& %%(% & % / (% " % & 1% " 8 F ;--,<(/ % 9%%% ' ( '& %% &" ' % & % %% % %( & % " ;8'8* <% / %1% ' &% & % 8" & " %( & %%% / % 8$&% 1% ' % %%%(1 % 1 % & % % % 1 %8! 1%%% ' & & ( % % % (( %& / % &% (%( / & ' % &% & % % %% & '% ' 1%8 ' % &" (/ 1 ( 1 % & " 8( (1 %& % % 1 % ( ' % ' % %% & ' ' &% % %%( % % % %% 8$" / & ' %&% %(% & '% % &% 1 % ( ' ;F ;--,< F '8 ,<8&% %( &" 1 % %& % ' %( % % % %8$" % ' %( &% '% AG%8;5<%%%% % %/ % ' %% & ' D, ! ;,< %% % ; / % % % '% % % < % (% ' % 8! 1%% (& / ; '" < & " 1% %% %%% % % & % % ' %( / (& % / 8 ' '& ;/%% 1 % %< %// % ' %& % ' %( (% ' %% % %( &% " 8 / & ' % & ' % '% % % %// % ( %( %% % % %(% 1 % %& ( % '%% &% % %/ 8 / % % / ( %% (%F 9! % % / % ' % 8 1 '% ( % % %( " ( ( %&% & %(;%/ % % '%<% % % &+8 ' % ( / (&% ( % % 1% % ( %% % %%1%8 % 1 % (/% ( % % & ;(55+PD< % / 1% % 8 . %" " ' % % 1/ ( % ' & % ' 8 1/ &" / % ((% % &( &% / % / 8(% & B&' // C / %%(1 % &% // B (% 1 C ;F ) E%955+<8:& " % 1 (% % / ' % 8&%%%/ 1 ( 1 / %% %1 / ' & & % 1 %(8$% ' ' / % % &" // % / % %&1 / ' / % &%& &/ % % ' % 1 % ( %;F '8<8 " (1% % &/ 1 / ( &% ' 9V%( ( %& V &% % 1 %( / % % %/ 8/ & %(% /%( %&% &%' $ / % (% 'P%( %1/( L % %/ / % % / ' % &% ( ( // &( % & % 8$ "/ % % % &" DD & E% / /%(A % %(/ % & (% & 1 % % ', % & % &% %8(/ "% % % & % % % % %3 '% %% 9% %' (& % & %%% (% 1 % ' & % 8 1 &9 ' % ' 71 (& % ' % % % ;! 7 H5580%%/ 8 8<8: ''%%% % ' % ' % &1 %( &"% % % ;8'8 (! 55-<%((( R % && % %8 % % % 1% %% & %"%% &%' % %18& ;G %85<' ;)/ %8 5,< & ( % % % ' 1 8/ ' & % % '% ' % % / %(( ( 1 % &8 ! )E ( %) -> 0 # % % % Z(-+, F (E% / -+5 !" (-+ " "" ) 1 1 55=>55?>5=@;=% 1 % >=@ ; 1 < '%((% % '% ' 1%&% ' 8 %/ '%-=@; 1 <84% ' 1 % ( ' %% % 8&% ; '( %<"% 1(& 1 /( ( 1 % %%% // %( % ( /%/ ;B/ % / C<86 '% %85555 ' % % % %( /85=58,,@84% %/ % & '% % ( ' R( %8 ' % '% ; %(& ' % < % ( ' % A % "% % % %& R( %% %( %"% % % 8&% %// %( ' D> ! % %(% %% % % ( ' & % & '8 '' /% / % & / '% % %( 8 %/ %5=8,@( % ' % ( ' 8 1 % % // %= 85@ % (% ' % / % 8 %U%% $ ' &&)1 $ W7$%(; 8> -J58+,+D+J78+/%<8 % % % % % % %%8 0 %(/; 3E5D8D88% </ %%% % ( / %(/;0 5DL5,% </ %% 0 [% 9 / ' @% & ' % / "( % %% 8 % ;U8< 'B' %C B 'C & % % 9 &% / / % % ' 8 # % + 64R; 8D+>% D+ 7 / % 4 1< %B" /8 C8;%85>< " "" ) 1 1 55=5?>>= @A (&% 8 % %/ ( % 1 (( %8 ' % ' 1 1 86 '% ' % % %( /8+=8@8 ' ' % 8 %/ %=8,@(% ' % ( ' ',8-=8>/ (/ % %% 8 / % 1 %5=8+@% ' (% '%' = 8@% % '%'+8=8@% ' (/%'86% & % 8>=58DD8 %U%% ' && )( . 9;D8+,DJ++85D,5J:8,/%< % % % % % % %%8 %(/; 3E5D8D88 <;F 9! 1 / '% < / %%% % ( 8# %(/P0 5DL;F 9 ! 1 <0 5DL;7 %</ %%0 [% D+ & E% / 9A 3E5D8D88,;7 %</ %%% % ( 8 % '%;U8< 'B 1 (C& %// & 1 ' % '%8 # % + 64R; 8D+ >% D+,5 7 / % 4 1< %B" /8F C8;%85>< #$ :%% ( $% %%% 7/ ( : E&* %% %%&&%) . )(F %% & 1// % & 8: % % %%& % %% /(. % & %& (// %. & 6 % % [ ' 0%% . '%& /&''% %) F %( &)$' ' 3% % % &%%3 1 %( & 8F // %/ 1 (% " # %(% . !%! .%%( F % ' % !. F+% 8 // %(4% F;F:F<' %# ,D,. % . '%8 . '%( % ! %/ / & "/ %(9 % %// % !8 / & 7 &" 8/ & 7 &" 8/ / %(/ &" 8 % . 48' #8# 68Z4 %%48--84 /( '( & %P % & % &U 1 % (% % % %/(8$ , - +-P->D V->D+8 )/ #8 8F 8' 8Z 1% $885,8 /% /( '% / % & '8 18/8 18;E ( %! < % % % % & . 9 % & % &%& (! 8 . -% / D,P ->V 5+8 ) (#8!8--8 % % % %P % %(8 )/Z 8 ) 808Z % '78->>8B/ % 1C % % % %P% '( R / %%/ %1 % (%% &%/() / 80 DPD,V++8 ' 8-, 8 ' / H RR H 1".( ;$<81 D- ! PDVD>8 ' 8-, 8 ' / H RR H/ / 1"82 -3 3 5 >-P,>VD8 ' 8-D58) HH / R %% ";(%H% R / ' H ' <8 - 2 * -PV,D8 F HF %78-,58] ' H/ / %% "82 2 5 2+ P,V>,8 F HF %78-,8 ' % &)/) 82 255P,-V>58 F8ZF (.88-+-8" P4 % % %( % %' 86 5P>,V-8 F M9! 8->D8 1 / '% & %/ % 9 P/ ( '' % %% /( % 1 %% 8 , --,P,,>8 F :8--,8" ;) / E ( %< 1% 'P 1% '% &" ;F HF %-,5< '/ % ' / '% 8, 57 $ 0 DPD,V>-8 F :8--D84 /% &* ;E-< 18'8 18 8;) / E ( %</ 9 '% & % "% 8/ . $ P V,58 F :8--+8 ( % ;# % 9 P) / < R '% ' & % % % %P 1 / 9 ' (/%% 1 % 8P) !8 8 E8 ' 848Z: 48;8<71 % ( % / '# % 9 8 )/Z 8 /85,V,8 F :85 84/% &B '% '% / % & %" % & %/ % 9 8C . -% / D P>V-8 F :8) 48ZE%984855+8 1 %(' ' / % % & %;# % %P) / <8 2 >P ,VD8 ! F8ZE%98485 8#( ' (// %% & % & % % % U %% && / / % & 1 8 $% />5P 5V 8 ! 0855-8 % '( P% / % & &R% %88. / ' '8 ! 08Z7 H)8558" (% ( &'% & ;4 0 ' %<& %$ &7;$%(<86 9 /P+-V->8 %.8' 8(8 8 /88 ' 88Z6 1$8.8--D8$ '% % % 1 % & % % 1(/( '% ( & 64R8. /0% P,V58 E48-83 % # % 9 $P: / % ) %;$& <8 % * 8 %# % %8P %%8 88!8F 8/8+V-+8 E48-,83 % # % 9 $P: / % ) %;$& < 8# % ) % A % '$8P %%8 858!8F 8/8D,V++D8 E 11 8!8-DD8^$& &% / ( &%._8 ,PD55V >5 & E% / D8 (8 855+8 %/ % 9 P % 9% & % ' % % % % 8 8 %/ ' 8 8) 8E8Z ':85584 / 1 1 % / '% & %/ % 9 8 , $ PDVD 8 % 8! 8Z 85D8$/ 1% % % & 1 % % ' % " && 8$. P+D58 6 1$8.8-D8 HH / R %% .;386888<1 /% RR/` 1 / 8 2 P,VD8 6 1$8.8-D8^) % &% / &%3 '&;/<_8 P>,V>D>8 6 1$8.8->8.%H H/ 9 R% % % H/ / " F HF %;H% /H% R<8$ >PD,V>+8 6 1$8.8->83% % % B/ C;B (" / C< / / " 6 1-D8$ +P--V8 6 1$8.8-+,8# % 11 1 ' & %8 * % -,P->V,8 6 1$8.8-- 8 // % & / % 1 %% ( % P% % 1 ' 9% 82 DP-V+8 6 1$8.8ZE 11 8!8-D+8) /%% %& &/ % % &%/ ;# U%!&<8, $ DP5-V8 (78-+8. %'b ' '% ) %8, 57 $ 0DP,,V 5>8 .8E8.88 8 8 %%.8 8Z! 8685>8/ & %( 1 %(P ' ' & / %% ( 8$ * - 2 2 - + P5>5>D 8 3 '!8-D 87 & % 9 7"% % 1' / &8:; < P>+V+,8 : '%8 8-+8 ' % & %:8 2 P>,V+,8 Gc8! 8 G846 E8488Z ':858#( '((%% 1 &% ( % '* ;) / E ( %< % /% &% / 8/ . $ -P +V ,8 Gc8 '8: 4846 E84884F U848Z ':858 / ' & % &/ &+;) / E ( %< % /% &% " / & ) 8/ . $ >P>V+,8 Gc8 8 ':8Z: 4858#( '(% % & %& ( : % / &8 18;) / E ( %< '(/ 9%" / %( < '8 18/8 18. /0% D5P +5V +-8 > ! > & E% / 8 '( &% %% " > ! 8 ' & & % &" 8 8 88 (8!8 8'P 6 '% ( AFF A)&% ( A&% A )% ' A F & A060 R '% ( A## % (%A6)6 '% % ( A66 '% 8P,@8 > & E% / "8 % &" 8 8 1 1 % '%8: % % '%%% (% ( %8P,55@88 1 / '% 1 '%& 8P,55@8!87 8P,5@8 >, ! #8$& % &" 1 / '%/ '%& % ;4% <7 ;$<8 % !84% ' & / && % & /86 '% ( A)&% ( A06 R '% ( 8 ,5@8 8 ( ' ( ; <& ' & 8 P,@886 '% % ( & % ( %& ' % ; <8P,@88( %B/ C% (8P,@8 8# % ' '& 8P,@8$8&% ( ; <% / % ' 8P,@8%8&% ( ; <7 8P,@8 >D & E% / &8% 1 &" 8 8 % 1 &% / % 7 8P, @88# % '% % ' 7 8P@8!8 ' / / ' ; $)<% ; 4)<% ( '%& 8 P,@8 '8) % &" % (7 / % '8.4)% ( %A)$ A)c %(% /A F & 8P,@8 >> ! (8 % &" 8 8 1 % '%88 1 / '% '%& 8 !87 8;,5@<8 )8% 1 &" ' $) && % 4)%'8 1 / '% '%& 8P,5@8 *8% &" 7 8 8# % '% ; <86 '% 1 &&&(% %%(8P,@88 %&% ( ; < %(U%% /% 8P, @8!8.% % &% % (8P5@8 >+ & E% / +8 ' % ' & 1 %( " / / % %8P5@8 >- ! 8 / % % &" & )1 ;)4 <%K4 ;4< / /% 8 ! , - - -. !/ 012 . ('%;@< 4 1 -5 D5 55 >5 8 - )4 1 5 D-D - ,5 8- D )4 1 + + D > >- 8- . ( %;@< 4 1 D 8- > -8 - )4 1 > 8 8D D )4 1 >8 , -D 8 '%;@< 4 1 D 5 55 >5 -8 - )4 1 5 > - , , -8> D )4 1 5+ ,85 5, > 8D %;@< 4 1 >,8 8+ >8- 5 -8D - )4 1 + 8D 8 DD8D D ,8- , )4 1 >>8 8- ,D8 D8> - '%;@< 4 1 D >8> D8 >, 8D , )4 1 -,8+ 8 8 + 8+ + )4 1 -8 8 8 D> 8 D ) ( )4 1 85 58,, 85 8 +8 / ';@< ;DD< 8 ( )4 1 5 ,8 5+ 5 +85 5 % (;%8< $) %;@< )4 1 -8D 8, D8 8D 85 ;< 4) %;@< )4 1 58, 85 ,8 -8, 8 5 ;-< % & 1 8: % % / % % & % ' 1 %8 +5 & E% / 8 / % % &" ! - - -. !/012 . ('%;@< 1 5 - ,-D >5 -8 1 55 D >D -5 ,8 . ( %;@< 1 >>8 8 ,8> --8+ +8 ) ( / ';@< 1 8>- 8 8D D8> -8 - $) %;@< 1 8+ 8 > -8 D8D 8, ,;D-< 4);< %;@< 1 58 8>+ 8+ D8D 8+ +;+< 4);< %;@< 1 8> 8 +8D 8 8 ; < 4);< %;@< 1 +85 85 D8+ 8 8D ;>< & $) 1 ,8- 8> 5 +8+ , 4)P $) % 1 8> 58DD 8, , & 1 & % A && % &% %' 1 %8 % && %/%% 11 /%%' & %"%8 + ! "8 9 & ; 4)< ; $)< &" / % / % % % / % % 8 -%!3 - !3 042 5 6 042 " 1 % -8D 58, %( " 1 % 8+ 8>;% %'< %( " F " D : '%-+ " # % ' 8 8 F --, " F' 8 6 1 E 11--D " # % ' % / % G%85 " F' % / % 6 1-D " % / % % / % F HF % -, + & E% / #8 1 %( & '% %" % ( % % % '% &%B & C; <8 - ! -%! 5 6 " 6;Y< 6 %( " 6;,Y< , ;( 6 : '%-+ / < " 6;+ 5Y 5< + 5 5 6 %( " 6;>,Y < >, 6 G%85 " 6;- -Y>< - - > 6 G%85 " )/;dY< d )/ 6 1-D " )/;DYD< D D )/ E 11 -DD " ?)/; Y< / 6 1-> " e,?; Y< ,% F --, + 6;Y< 6 G%85 * 6;> Y-< > - 6 F --D ?; Y< % 6 1-+, '( ?;Y< % 6 1-+, ?;DY < D % 6 1-+, 0 + ! " # $ % " & ' ! ( $ % " & ' ! ( ) $ * % +,- * % .'. * % . +/ 0" 1 $ * 23. 4 . 57 % +-2 ++- " 89 . 57 % +- " 9 : $ +/ 0 " ; % ( +/+ *.% ) + < %" <9 0 +, ; = " 4 (+> : % * % : ( %* ( " $ * # " : ". ( ( 8 # " ?% $ ' 4 (+ &. . <74 ++/ " . 7 . 78 ; $ +-> 9 . " 4. 4 (+@, A 4. 4 ( +@/ " 4. 4 ( ++@ /> 74 ++/4 % ( %&. 8 : . *.7 . @B-+-C@ ". ( (DE8 # F<$7 % % % %%. @B>C ; $ &+->; $ ' 5 % G. G. 5 . .H " . 7. 78 IJ >B@,,C@, . 57 % +-K$ 5 ' %%' .H />B,-C- . 57 % +-! % 7 $ ' B-+C !E "&+/+ B%. % ( $ ! ,B-C+, :++- I ' J $ B $ I . 57 % +-J. $' $ %' $ " $%>@B@-C+ * L 7'( 874 < 3E$:8 . '$ % $.. $ B & & I ' J ' ,+B,-C,, ) )+ (B ' %% $ % .. ' ),+B,C> +,-9 A # B: %' I. J>A . 2 0 $* B; ! ; . D,& * '@-C//@ 0 <+,? % *. & ( -@B@ 4 ("+@,N % ' %% 9 . $.I& ' JO' ' >B-,C@ 4 ("+" 5 5' # G. % . . 5' %%' ( . 57 % I5 . .% ' 5 G. J B,@-C,/ 4 ("+>K . . . . 5 5' # G. # G. ( 4 ( 5 %5 ' %% G. -B,+C,+, 4 ("E D*+@/%' % . ' %% & ' IA P *.J + @B,+C,,, 4 ("E D*++@0. $ .' % . ( I ' J % & ' , ,B,C,,- . +/" .$ L $ . $ ( % " $%@B,--C> "" !D &78). ";. 0E* . 7D ( )4' B $ $ ' 7 % />B@> ! ( ( # 0F !E8 . % !8 . '$ $ /- -. ' % % '7 7 ' % ,$ -B@C/@ : ( %* ( E" $ 97*" .% B %' % $ '' / , B+C+ : $ &8+/% 7 $ . : ,B-C/- 3.F). $&: 74 7 PE$:8 '$ % . % ' I ' J ' ' % , >BC/- /@ !"#$%& ' ' ( ) *!+ $, ) -$ ) + ##"%.' !+ $ + -$ "" METHODS published: 18 December 2015 doi: 10.3389/fmicb.2015.01451 gbtools: Interactive Visualization of Metagenome Bins in R Brandon K. B. Seah and Harald R. Gruber-Vodicka* Department of Symbiosis, Max Planck Institute for Marine Microbiology, Bremen, Germany Improvements in DNA sequencing technology have increased the amount and quality of sequences that can be obtained from metagenomic samples, making it practical to extract individual microbial genomes from metagenomic assemblies (“binning”). However, while many tools and methods exist for unsupervised binning with various statistical algorithms, there are few options for visualizing the results, even though visualization is vital to exploratory data analysis. We have developed gbtools, a software package that allows users to visualize metagenomic assemblies by plotting coverage (sequencing depth) and GC values of contigs, and also to annotate the plots with taxonomic information. Different sets of annotations, including taxonomic assignments from conserved marker genes or SSU rRNA genes, can be imported simultaneously; users can choose which annotations to plot. Bins can be manually defined from plots, or be imported from third-party binning tools and overlaid onto plots, such that results from different methods can be compared side-by-side. gbtools reports summary statistics of bins including marker gene completeness, and allows the user to add or subtract Edited by: Marc Strous, bins with each other. We illustrate some of the functions available in gbtools with University of Calgary, Canada two examples: the metagenome of Olavius algarvensis, a marine oligochaete worm Reviewed by: that has up to five bacterial symbionts, and the metagenome of a synthetic mock Chuang Ma, Northwest Agricultural and Forestry community comprising 64 bacterial and archaeal strains. We show how instances University, China of poor automated binning, sequencer GC% bias, and variation between samples Hao Song, can be quickly diagnosed by visualization, and demonstrate how the results from Tianjin University, China different binning tools can be combined and refined to yield manually curated bins with *Correspondence: Harald R. Gruber-Vodicka higher completeness. gbtools is open-source and written in R. The software package, [email protected] documentation, and example data are available freely online at https://github.com/ kbseah/genome-bin-tools. Specialty section: This article was submitted to Keywords: metagenomics, exploratory data analysis, visualization, microbiology, symbiosis, binning Microbial Physiology and Metabolism, a section of the journal Frontiers in Microbiology INTRODUCTION Received: 29 September 2015 Accepted: 04 December 2015 Metagenomics originated in the field of microbial ecology as a means to look into the function Published: 18 December 2015 of whole communities, given that most environmental microbes are resistant to cultivation Citation: (Handelsman, 2004; Kunin et al., 2008; Teeling and Glockner, 2012). By shotgun-sequencing DNA Seah BKB and Gruber-Vodicka HR from an entire microbial community, researchers can treat the resulting metagenome as a sample (2015) gbtools: Interactive Visualization of Metagenome Bins from the pool of genes of the entire community, and either reconstruct a picture of their collective in R. Front. Microbiol. 6:1451. functional potential, or assemble and extract individual microbial genomes (“binning”). While doi: 10.3389/fmicb.2015.01451 binning of genomes from metagenomes has been done in the past with relatively low-diversity Frontiers in Microbiology | www.frontiersin.org 1 December 2015 | Volume 6 | Article 1451 89 Seah and Gruber-Vodicka Metagenome Visualization samples (Tyson et al., 2004; Woyke et al., 2006), recent However, existing visualization tools are mostly attached to advances in high-throughput sequencing have vastly increased particular binning methods or pipelines; as such, their application the sequencing depth that can be obtained with the same is relatively narrow (Table 1). Albertsen et al. (2013) have resources, and this has made it practical to bin individual made available their scripts (written in the statistical computing genomes from increasingly diverse communities. language R) for plotting and manual binning, but these require Strategies for binning can be classified by the source of the extensive customization for new data sets. Our motivation information that they use for separating genomes from each was therefore to provide a tool that integrates data relevant other: (i) the internal statistical properties of the sequence, to metagenome binning and let the end-user perform data e.g., k-mer frequencies (Teeling et al., 2004), (ii) comparison to exploration and visualization in an intuitive way. external sequence information, e.g., conserved taxonomic marker genes (Kembel et al., 2011) or entire nucleotide databases (Kumar et al., 2013), or (iii) the biological or technical variation in METHODS AND IMPLEMENTATION sequence abundance/coverage between different read libraries (the differential-coverage approach) (Albertsen et al., 2013; The gbtools software, documentation, and example Imelfort et al., 2014; Nielsen et al., 2014). A variety of statistical data are available online at: https://github.com/kbseah/ and machine learning methods have been applied to the problem, genome-bin-tools/. The online manual provides a multi-chapter including self-organizing maps (Dick et al., 2009), interpolated walk-through of installation, data import, data exploration, and Markov models (Strous et al., 2012), expectation-maximization manual bin curation. Commands and data for reproducing the (Wu et al., 2014), and k-medioids clustering (Kang et al., 2015), usage examples and Figures 2–6 are given in the Supplementary with the ultimate aim of binning microbial genomes from many Information to this paper. samples automatically and with high throughput. Visualization is usually the first step in data exploration, Example Workflow: Contig Annotation and despite the sophistication of many of the current methods The binning process begins with a metagenomic sequence for unsupervised binning, it remains an important part of the assembly. Each contig or scaffold (from here onward, the term metagenomics toolkit. For low-diversity, high-coverage samples, “contig” refers to both) in the assembly is then annotated with such as those encountered in host-symbiont systems, or microbial data relevant to the binning procedure; these annotations are consortia, it may already be possible to define bins manually imported into the R workspace with gbtools. The coverage value from coverage-GC plots, where read coverage is plotted against for each contig in the assembly is calculated by mapping the the proportion of G and C bases in the sequence (GC%) read library back onto the assembly, e.g., with the short-read for each contig, or from differential-coverage plots, where aligner bbmap.sh, from the BBtools suite, version 34 (Bushnell, for each contig the coverage in one read library is plotted 2015). This produces a mapping file in the SAM format, from against the coverage in another read library. Contigs originating which coverage values are calculated with pileup.sh from BBtools from the same genome are expected to have similar sequence (Bushnell, 2015), which also reports the GC% of each contig. composition (represented by GC%) and abundance (represented Conserved protein-coding marker genes are identified in the by coverage), and so should cluster together in these plots. assembly and assigned to taxonomic groups with Amphora2 Each cluster therefore represents a single putative genome (Wu and Scott, 2012) or Phyla-Amphora (Wang and Wu, 2013). bin. Such a heuristic approach was used by Albertsen et al. Alternatively, an approximate phylogenetic affiliation of each (2013) to extract 12 nearly complete genomes of uncultivated contig can be obtained by Blastn alignment (Camacho et al., bacteria from an activated sludge community, with the aid of 2009) against the NCBI nt database, using part of the Blobology principal-components analysis of tetranucleotide frequencies and pipeline (Kumar et al., 2013). Small-subunit ribosomal RNA (SSU additional taxonomic information from marker genes overlaid on rRNA) genes are identified with barrnap version 0.5 (Seemann, the plots. Visualization is also useful post hoc,tospotpotential 2015) and classified by comparison to the SILVAdatabase version artifacts from imperfect binning, and to verify or troubleshoot 119 (Quast et al., 2013) using Vsearch version 1.1.1 (Rognes, automated methods. 2015). tRNA genes are annotated with tRNAscan-SE 1.23 (Lowe TABLE 1 | Comparison of features available in visualization tools for metagenomic binning. Feature Blobology MetaWatt GroopM gbtools Coverage-GC plots ++−+ Differential coverage plots −−++ Plot taxonomic annotations ++−+ Import annotations from third-party tools −−−+ Import bins from third-party tools −−++ Merge two bins −+++ Subtract one bin from another −−++ Export plot graphics ++++ Interactively select bins from plots −+−+ Frontiers in Microbiology | www.frontiersin.org 2 December 2015 | Volume 6 | Article 1451 90 Seah and Gruber-Vodicka Metagenome Visualization and Eddy, 1997). In principle, users may choose other software of taxonomic markers and how many of them are single-copy. tools than the above for the read-mapping and marker gene Two bins can be combined into a new bin object (taking the annotation, so long as the results are formatted as text files with union), or the difference between two bins can be taken (relative the appropriate column headers for input to gbtools. Wrapper complement). If taxonomic marker data are supplied, then it is scripts, example commands, and a description of each input file also possible to filter contigs in a bin by the taxon assignments type are given in the package documentation. of the markers, retaining only those contigs that are assigned to a certain taxon. Bin objects can also be plotted or overlaid on existing plots Integrating and Visualizing Data with with the point() function. If more than one set of coverage data gbtools are available, then the user need only change one parameter in Contig annotations and coverage information are imported into the plotting commands to specify which set to use to generate a an R version 3.1.1 workspace (R Core Team, 2014) for analysis coverage-GC or differential-coverage plot. This provides a quick with the package gbtools. way to see how a bin “behaves” with coverage data from different gbtools organizes the imported data as objects within the samples. Multiple bins can also be overlaid onto a single plot, each R workspace. There are two object classes, corresponding in a different color. to metagenomes (the “gbt” class), and to bins defined from metagenomes (the “gbtbin” class). In this way, all the data relating Usage Examples to a single metagenome or a single genome bin are stored in a To demonstrate the use of gbtools, we used two publicly single object. The minimum data required to create a new gbt available metagenome datasets: (1) the symbiotic oligochaete object are the coverage and GC% values for the contigs of a worm Olavius algarvensis, and (2) the synthetic community of single metagenome. However, coverage data from more than one Archaea and Bacteria from Shakya et al. (2013). read library mapped to the same metagenome can be imported Read libraries from the O. algarvensis metagenome, sequenced simultaneously. Similarly, more than one set of marker gene or in 2013, were downloaded from the Integrated Microbial taxonomic annotations can be stored in one gbt object, e.g., when Genomes portal [Joint Genome Institute (JGI) project IDs such annotations are produced by different tools or pipelines. 1021953 and 10219591,2]. This species is known to harbor up Functions are defined for the two object classes in gbtools to to five bacterial symbionts: two Gammaproteobacteria (Gamma1 produce plots and overlays, report summary statistics, and create and Gamma3), two Deltaproteobacteria (Delta4 and Delta1), or manipulate bins. and a Spirochaeta (Dubilier et al., 2001; Woyke et al., 2006; Coverage-GC and differential-coverage plots can be produced Ruehland et al., 2008; Kleiner et al., 2011). Of these, the with the familiar plot() function; the package provides a plot() Gamma1, Gamma3, and Delta4 symbionts are the most abundant method for the gbt class. When more than one set of coverage (Ruehland et al., 2008). This makes it a relatively low-diversity data are available, then the user can specify which set(s) to use microbial community that should be amenable to visualization for plotting. If taxonomic marker data are available, they are and differential-coverage binning. automatically used to color the plot. If more than one set of The two metagenome libraries represent two separate Olavius taxonomic markers have been imported, the user can choose host individuals. They were sequenced as 150 bp paired-end which marker set to overlay on the plot, and which taxonomic reads with the Illumina HiSeq 2000 and 2500 platforms. A subset level (kingdom to species) to use for coloring, in order to compare of 15 million read-pairs from the first library were assembled the results of different taxonomic-classification tools or pipelines. with IDBA-UD (Peng et al., 2012). Coverage values of both Differential coverage plots can also be colored by the GC% of each read libraries were calculated separately by mapping onto the contig. Contigs with SSU rRNA and tRNA genes can be marked assembly. Contigs were taxonomically annotated with Amphora2 on the plot; if available, the taxonomic assignments of those SSU markers and the Blobology pipeline, while SSU rRNA genes were rRNA genes can be added as labels. Typing the name of a gbt or identified with barrnap, as described above. gbtbin object, or using the summary() function, gives a summary Two automated binning tools were applied to the assembly, of the assembly and marker statistics, e.g., total length, N50, and usingdefaultparameters:MetaBATversion0.25.4(Kang et al., how many marker genes are present. 2015) and MetaWatt version 3.5 (Strous et al., 2012). Both tools Bins can be defined from a “parent” gbt object in several ways. use tetranucleotide frequency profiles as the main source of New bins can be created interactively by selecting a region from information to define bins. The automated binning results were a coverage-GC or differential-coverage plot of a gbt object. They parsed with a Perl script; the resulting table was imported to R can also be created by specifying cutoff values for contig length, and converted to gbtbin objects. Lists of contigs in the draft and coverage, and/or GC%. It is also possible to simply supply a curated Gamma1 bins were exported from R, for evaluation with shortlist of contig names. If a third-party binning tool has been the genome-quality tool CheckM (Parks et al., 2015)usingthe used to produce a set of Fasta files each corresponding to a Gammaproteobacteria taxon-specific workflow. single bin, a wrapper script is provided with gbtools to tabulate The second example is a synthetic community that comprises the contig names and bin names so they can be imported by 16 archaeal and 48 bacterial strains, which was used to compare gbtools to create new gbtbin objects in the R workspace for those bins. Similarly to its parent object, typing the name of a gbtbin 1http://genome.jgi.doe.gov/OlaalgELextract2/ object reports summary statistics, which includes the number 2http://genome.jgi.doe.gov/OlaalgELextract1_2/ Frontiers in Microbiology | www.frontiersin.org 3 December 2015 | Volume 6 | Article 1451 91 Seah and Gruber-Vodicka Metagenome Visualization the results of community characterization from rRNA amplicon genome bin manipulations, and an extensible, open-source sequencing vs. metagenomic sequencing (Shakya et al., 2013). We framework that is amenable to future development (Figure 1). used the metagenomic data sequenced as 100 bp paired-end reads Higher-level commands streamline the process of data on the Illumina HiSeq 2000 platform, available from NCBI SRA3 exploration and make it more intuitive. Albertsen et al. (2013) under accession number SRX200676. The reads were filtered and also use R as an environment for analyzing differential coverage trimmed to remove reads with Phred quality <10 and trimmed to data, and some of the code in gbtools is adapted from their remove TruSeq adapter sequences, with bbduk.sh from BBtools work. They provide example commands showing how functions (Bushnell, 2015), and then assembled with Megahit under the from existing packages can be used to produce plots and perform “meta” setting (Li et al., 2015). Coverage and taxonomic markers binning. However, these commands have to be manually copied, were annotated as above. Automatic binning was performed with edited, and pasted at each step, because many of the parameters MetaBAT and parsed/imported to R as described above. Curated for plotting have been modified from their defaults in R. gbtools merged bins were exported from R and evaluted with CheckM conceals many of these lower-level tasks from the user, freeing using the lineage-specific workflow. up more time and attention for actually exploring the data. For example, different colored overlays for the taxonomic affiliation of contigs can be switched on and off with a single parameter in RESULTS AND DISCUSSION the gbtools plot() function. A deliberate decision was made to define object classes (within Design of the Software Package the S3 object orientation system in R), rather than to create The concepts implemented in gbtools, in particular GC-coverage custom function names, so that the two most important tasks – and differential coverage plots, and the use of taxonomic drawing plots and viewing summary statistics – can be performed information from marker genes (including protein-coding with the commands plot() and summary(), whose names are genes and RNA genes) to annotate these plots, are not new. already familiar to most R users. Likewise, the default behavior What gbtools additionally offers are high-level commands for when typing an object name is to show its summary, which visualizing and exploring the data, “arithmetic” operations for displays metrics commonly used for assessing the completeness and quality of a genome, such as marker gene counts, total contig 3http://www.ncbi.nlm.nih.gov/sra length, and contig N50. FIGURE 1 | Diagram of objects and functions available in the gbtools package. All user-supplied annotation data associated with one metagenome (left) are integrated into a single gbt object. For each metagenome, the GC% and coverage data from at least one read library must be supplied, whereas all other input data are optional. Functions (diamonds) in the gbtools package allow import and export of data (green), visualization with plots and overlays (orange), and creating or manipulating of bins (blue). Frontiers in Microbiology | www.frontiersin.org 4 December 2015 | Volume 6 | Article 1451 92 Seah and Gruber-Vodicka Metagenome Visualization gbtools encourages data exploration by making it possible to graphics engine in R, for manual editing to publication quality. string together fairly complex operations like an “arithmetic” for Because the gbtools classes are designed to be extensible, users bin manipulations. For example, one could manually define a bin can import their own variables, e.g., tetranucleotide frequencies, from a GC-coverage plot, take a subset of those contigs above and attach them to gbt or gbtbin objects for display or processing. a length cutoff, extract only those contigs with marker genes Users who are already familiar with R can take advantage of its classified to a certain taxon, and then see how this new bin looks extensive statistical functions to perform additional analyses of like in a differential coverage plot with coverage values drawn their own, alongside graphical data exploration with gbtools. from a different pair of samples. Intermediate steps can be saved as separate objects, so it is possible to backtrack or branch a Usage Example: Exploration of a series of operations. The command history is embedded in the Challenging Assembly bin objects themselves, so that all user actions are documented The symbiotic worm O. algarvensis has up to five known and reproducible. symbiotic bacteria with different abundances, as summarized Existing visualization tools tend to be limited by the specific above (Ruehland et al., 2008). Nonetheless, each of them is binning tools that they were designed to complement (Table 1). believed to play an important biological role in this symbiosis For example: GroopM (Imelfort et al., 2014)cancolorcontigs (Woyke et al., 2006; Kleiner et al., 2012). The first published by GC% or by the automatically defined bins, but it does not metagenome of Olavius (Woyke et al., 2006)usedthreedifferent yet support adding marker-gene based annotations; Blobsplorer capillary-sequenced libraries constructed from the DNA of a total (Kumar et al., 2013) shows taxon-annotated GC-coverage plots, of ca. 600 animals collected at different times; binning of the but cannot display differential coverage plots; MetaWatt (Strous symbiont genomes was based on intrinsic sequence information et al., 2012) is a powerful tool that implements many functions for only (k-mer composition, values of k ≤ 6). It was necessary assessing the completeness of genome bins, but the plots cannot to pool a large number of animals because the sequencing be customized and do not show individual contigs. Being aware technology at the time required milligram quantities of DNA. In of this, we aimed to make gbtools as flexible as possible. For contrast, the metagenome used here to illustrate the capabilities example, there have been several sets of conserved, purportedly of gbtools was assembled from a single-host-animal read library single-copy genes published for the purpose of phylogenetic sequenced on an Illumina platform. Single-host samples illustrate analysis or checking genome completeness (Wu and Scott, 2012; the inter-individual variability in relative symbiont abundance, Wang and Wu, 2013; Darling et al., 2014; Parks et al., 2015). which could be exploited for differential coverage binning. gbtools users can import the results of different marker sets The relative abundances of the symbionts are reflected together into a single gbt object, and choose which set they wish in the metagenome used in this manuscript. Contig clusters to plot as a color overlay. corresponding to the Gamma1, Gamma3, and Delta4 symbiont By implementing gbtools in R – which is open-source, has a genomes can already be seen in the plot of coverage vs. GC%, rich software development ecosystem, and which many scientists and match the taxonomic markers (single-copy conserved genes are already familiar with – we aimed to make it easier for users to from the Amphora2 bacterial marker set, and SSU rRNA genes) write their own extensions for their own needs. Plots produced by overlaid on the plot (Figure 2). The SSU rRNA genes of the gbtools can be readily exported to various formats by the native Olavius animal host and the Gamma1 and Delta4 symbionts were FIGURE 2 | Coverage-GC plots for an O. algarvensis metagenome (plot symbols are scaled by contig length), illustrating overlays for taxonomic affiliation: (a) crosshairs mark contigs with SSU rRNA genes, and are labeled by their affiliation in the SILVA taxonomy, (b) contigs containing conserved marker genes colored by taxonomic affiliation at class level (red – Gammaproteobacteria, blue – Deltaproteobacteria), (c) taxonomic affiliation of contigs at class level by direct Blastn search vs. the NCBI nt database (modified Blobology pipeline) (red – Gammaproteobacteria, cyan – Deltaproteobacteria, other colors – lower-abundance taxa). Colors in (b,c) are arbitrary. Plots in Figures 2–6 are identical to on-screen output, except enlarging axis labels and crosshairs for legibility, adding labels in Figure 3c, and adding arrows in Figures 4b,c. Frontiers in Microbiology | www.frontiersin.org 5 December 2015 | Volume 6 | Article 1451 93 Seah and Gruber-Vodicka Metagenome Visualization FIGURE 3 | Coverage-GC plots of an O. algarvensis metagenome, illustrating overlays for visualizing multiple genome bins: (a) 11 genome bins produced by MetaBAT, each in a different color, (b) 20 genome bins produced by MetaWatt, each in a different color, (c) boundaries of manually defined bins that were interactively selected on the plot, corresponding approximately to the indicated symbiont genomes. Colors in (a) and (b) are arbitrary. assembled and identified, but the SSU rRNA sequences of the Therefore, this cluster probably represents most of the Gamma1 other symbionts were not identified (Figure 2a). Sequences from symbiont genome, despite the wide GC% spread, although there the other symbionts could be present but have too low coverage is some contamination with contigs from other genomes. in this assembly. The large “cloud” of relatively short contigs The performance of different automatic binning tools can also with GC% between 35 and 50% is probably from the host animal be visually compared side-by-side. MetaBAT and MetaWatt both genome. use tetranucleotide frequencies as the main source of information With gbtools, one can quickly check if apparent contig clusters for defining bins, but apply different statistical methods to the may plausibly correspond to a single microbial genome. For data. The results from these two tools were parsed, imported, and example, the uppermost contig cluster marked in Figure 3c used to make colored plots, where each color corresponds to a contains the 16S rRNA sequence of the Gamma1 symbiont, different bin; the bins predicted by MetaBAT and MetaWatt are but the GC% values seem to have an unusually wide spread shown in Figures 3a,b, respectively. The two programs produced for a single microbial genome, between ca. 50 and 70%. The a total of 11 and 20 bins, respectively. These plots show that indicated polygon region was selected with the interactive MetaBAT seems to produce less-fragmented bins than MetaWatt, choosebin() function, and was found to have a total length of when default settings are used. For example, MetaBAT predicts 2.8Mb,andcontains31of32single-copyAmphora2marker a bin that appears to contain most of the Gamma3 symbiont genes, all assigned to Gammaproteobacteria. However, there was genome (Figure 3a, yellow, with 30 of 32 Amphora2 markers), additionally a single marker assigned to Deltaproteobacteria. whereas MetaWatt assigns only a part of these contigs to two FIGURE 4 | Coverage-GC plots (a,b) and differential coverage plot (c) of an O. algarvensis metagenome, illustrating the appearance of manually defined genome bins (colored overlays) from Figure 3c: (a) with the original coverage data, (b) with coverage data from a different read library, and (c) when the two sets of coverage data are plotted against each other. Contigs with GC <45% were omitted from (c) for clarity, as they are mostly from the host animal genome. Arrows indicate contigs which were included in the originally defined bin but have low coverage in another read library, suggesting that they may be contaminant sequences or strain variation. Frontiers in Microbiology | www.frontiersin.org 6 December 2015 | Volume 6 | Article 1451 94 Seah and Gruber-Vodicka Metagenome Visualization TABLE 2 | Comparison of bins of the Gamma1 symbiont in the Olavius algarvensis metagenome, produced by interactive selection from plot, automated binning with third-party tools, and a manually curated merger and refinement of the above. Bin source Length (Mb) Contigs Amphora2 markers CheckM completeness (%) CheckM contamination (%) Total GPB Interactively selected from plot 2.80 1193 32 31 90.2 0.72 MetaBAT 1.38 342 18 18 57.8 0.56 MetaWatt (merger of two bins) 2.13 785 19 19 87.7 1.12 Curated final bin 2.75 1156 31 31 94.1 1.12 separate bins (Figure 3b, purple and dark blue, 21 and 3 markers, from a different read library are plotted (Figure 4b). Manual respectively). bin definition from a coverage-GC plot would have been less However, both tools do not perform well with the genome of successful with that read library; in that sample, the three the primary symbiont Gamma1. MetaBAT assigns only part of symbionts may have been more similar in their abundance than the Gamma1 genome to a single bin (Figure 3a,red,18of32 in the first sample. In both the coverage-GC plot of the second markers), whereas MetaWatt assigns fragments to two separate sample (Figure 4b), and the differential coverage plot of the bins (Figure 3b, orange and light blue). None of these three bins two samples plotted together (Figure 4c), there are contigs with contain an SSU rRNA gene. These partial bins of the Gamma1 considerably lower coverage in the second sample than the first from both MetaWatt and MetaBAT can be combined into a (arrows). These may represent contaminant sequences that do consensus bin with the add() function in gbtools, and were found not actually belong to the target genome. Alternatively, they may to contain 791 contigs, with only 23 of 32 markers. Alternatively, represent genomic variation between different samples – e.g., the two MetaWatt bins can be subtracted from the MetaBAT genes that are present in some samples but not others because bin with the lej() function, showing that six scaffolds with four of inter-individual variation. markers were binned by MetaBAT but not MetaWatt. Such We combined the results from manual bin selection, the “arithmetical” operations are a natural and intuitive means of two automated binning tools, and differential-coverage data to comparing the binning results. It is possible that tetranucleotide- produce a manually curated bin for the Gamma1 symbiont. The based binning methods do not perform well with genomes that bin-manipulation functions in gbtools were used to perform have a wide spread of GC% values, like the Gamma1. This the following actions: the interactively defined Gamma1 bin GC% spread could possibly reflect horizontal gene transfer or (selected from the coverage-GC plot) was merged with the different selective pressures acting on different parts of the partial Gamma1 bins that were produced by MetaBAT and genome. MetaWatt. To remove likely contaminants, we removed the The plausibility of a bin can also be tested by seeing whether contig containing a Deltaproteobacteria-affiliated marker, any its contigs still cluster together when coverage data from other contigs that were in the Gamma3 or Delta4 bins produced by samples are used. This is easily done in gbtools by varying the MetaBAT, and any contigs with <5-fold coverage in the second “slice” parameter of the plot() and points() functions. Figure 4a read library. The manual curation produced a Gamma1 bin shows the three bins that were created by drawing polygons with higher completenesss than either the interactively selected (Figure 3c) interactively on the coverage-GC plot to define them. or automatically binned drafts, although the curated bin had a The same bins form overlapping clusters when coverage data slightly higher contamination score (Table 2). FIGURE 5 | Coverage-GC plots for the synthetic AB metagenome (plot symbols are scaled by contig length). (a) Coverage levels show decrease at extreme GC values; note logarithmic scale in vertical axis. Crosshairs mark contigs with SSU rRNA genes, which tend to have higher coverage and more moderate GC values on average than other contigs. (b) Genome bins produced by MetaBAT as colored overlays (colors arbitrary), showing that not all contigs were assigned to a bin, including some high-coverage contigs; unbinned contigs shown in gray. The genome of Nanoarchaeum equitans assembled into a single contig (arrow) and was therefore not assigned to a bin by MetaBAT. Frontiers in Microbiology | www.frontiersin.org 7 December 2015 | Volume 6 | Article 1451 95 Seah and Gruber-Vodicka Metagenome Visualization TABLE 3 | Summary statistics of the curated bins from the Archaea-Bacteria metagenome assembly. Bin Affiliation (Amphora2)∗ No. MetaBAT Length (Mb) Contigs Amphora2 markers CheckM CheckM bins combined completeness(%) contamination(%) Total Single-copy − Nanoarchaeum equitans 00.474 1 86 84 73.1 0 23 Haloferax volcanii 45.17 474 134 108 100 28.2 28 Methanosarcina acetivorans 35.85 369 106 100 99.8 6.24 35 Zymomonas mobilis 12.00 86 32 30 99.8 0.92 13 Chloroflexus sp. Y-400-fl 1 4.98 141 31 31 99.7 0 10 Wolinella succinogenes 22.02 29 30 30 99.4 0.42 2 Aciduliprofundum boonei 31.38 23 104 101 99.2 0 32 Nostoc sp. PCC 7120 1 6.97 142 31 31 99.2 0 18 Ignicoccus hospitalis 25.13 421 115 113 98.7 35.4 20 Dictyoglomus turgidum 21.47 14 31 31 98.3 0 38 Thermus thermophilus 31.95 59 29 29 98.1 0 7 Archaeoglobus fulgidus 52.05 37 108 101 98.0 0 44 Akkermania muciniphila 22.58 31 32 32 97.3 0 31 Nitrosomonas europaea 32.27 55 31 31 97.1 0.26 36 Treponema denticola 32.64 43 31 31 95.2 0 24 Herpetosiphon aurantiacus 15.68 67 31 31 94.6 0.91 19 Geobacter sulfurreducens 22.71 19 31 31 89.0 0 22 Gemmatimonas aurantiaca 12.01 6 31 31 87.9 0 15 Deinococcus radiodurans 32.48 168 31 29 79.3 0.21 1 Acidobacterium capsulatum 32.91 30 31 31 77.8 0.17 33 Rhodopirellula baltica 74.92 60 31 31 74.3 0 4 Shewanella baltica 22.04 458 35 29 50.0 0.92 *Majority consensus, if more than one species assignment. Usage Example: Visualizing a Diverse above. Because the number and phylogenetic placement of the Synthetic Metagenome component microbial genomes is known in advance, the AB metagenome is useful for testing the effectiveness of binning The Archaea-Bacteria metagenome (from here on abbreviated methods. Nonetheless, it is arguably less complex than a as AB metagenome) (Shakya et al., 2013) represents a synthetic real microbial community because the strains have a wide mock community of 64 microbial strains, an order of magnitude phylogenetic distribution (close relatives can be more difficult more diverse than the Olavius symbiont example described to bin because of sequence similarity), high clonality because they come from pure cultures, and lack contaminating eukaryotic DNA which can make assembly more difficult. Visualization of metagenomic binning remains useful as a diagnostic tool, despite the higher complexity of this metagenome. The coverage-GC plot shows a pronounced hump at moderate GC values, but coverage falls off at high (>70%) and low (<30%) values (Figure 5a). Error-rate and coverage biases at high and low GC are known to afflict various sequencing platforms, potentially causing problems for assembly and downstream analyses (Ross et al., 2013). However, there is no obvious indication from the plot that the AB metagenome assembly is considerably more fragmented at extreme GC values. This technical bias also provides one possible explanation for the discrepancy between community composition estimates by Illumina and 454 sequencing in the original study (Shakya et al., 2013). FIGURE 6 | Detail of coverage-GC plots for the synthetic AB We also observe that the SSU rRNA genes have a higher metagenome, showing how MetaBAT bins that have Amphora2 average coverage and more moderate GC composition than taxonomic markers assigned to Archaeoglobales were merged to a the rest of the metagenome (Figure 5a), as many microbial single bin. Colors – five individual MetaBAT bins that were merged; black genomes have multiple copies of the rRNA operon per genome, outlines – contigs containing Archaeoglobales marker genes. and the sequence conservation of the rRNA genes is relatively Frontiers in Microbiology | www.frontiersin.org 8 December 2015 | Volume 6 | Article 1451 96 Seah and Gruber-Vodicka Metagenome Visualization high compared to most protein-coding genes. This could make can already produce usable draft genomes from a complex it difficult to bin a genome together with its corresponding sample. rRNA operon(s) when relying only on coverage or sequence composition binning methods. Automated binning with MetaBAT yielded many fragmentary CONCLUSION bins. A total of 146 bins were predicted, however, not all contigs were assigned to a bin, particularly those which are short We show that hands-on exploration of data is not replaced (<1000 bp), but surprisingly also some relatively large, high- by automated statistical methods for genome binning from coverage contigs (Figure 5b). Given that the community should metagenomic assemblies. Proper visualizations can suggest what contain only 64 strains, most bins are probably incomplete. automated methods to apply, and in return can be used to check A simple taxonomic annotation by taking the best Blastn hit the results of such analyses afterward. We offer gbtools to the to the NCBI nt database initially appeared to yield a similarly community as a tool for this task that simplifies repetitive actions inflated diversity estimate: 403 species in 76 orders and 28 phyla. and lets users rapidly plot and manipulate their data. What However, only 58 of those species assignments account for more distinguishes gbtools from existing software for metagenomic than 1 Mbp of sequence each, a number which is more consistent binning is that it is primarily a visualization tool which does not with the known diversity in the AB mock community. rely on any particular binning method. It is extensible, for users ThegenomeofthearchaeonNanoarchaeum equitans who may want to implement their own functions, and can be used assembled into a single contig of 474 kb, close to the published with third-party tools for mapping and marker-gene annotation. value of 491 kb (Waters et al., 2003). However, because MetaBAT defines genome bins as clusters of contigs, this individual contig was not assigned to a bin (Figure 5b). With the visualization AUTHOR CONTRIBUTIONS in gbtools, this fact can be immediately recognized, and so the Nanoarchaeum contig was manually extracted. CheckM evaluates BS wrote the software. BS and HG tested the software, planned its completeness at 73.1% (Table 3), but this is attributable to the the manuscript, and wrote the manuscript. highly reduced nature of this genome. As with the Olavius example, we can combine different FUNDING annotations and binning tools to produce curated bins with higher completeness. We used the conserved single-copy This project was funded by the Max Planck Society. Amphora2 marker genes to identify which MetaBAT bins belong to the same taxa and should be merged. Unlike the previous example, it is impractical to do this individually for each bin. ACKNOWLEDGMENTS Instead gbtools has functions that can operate on and compare sets of bins. A list of new bins was created with the function We thank Manuel Kleiner for permission to use the O. algarvensis binsFromMarkers() from the metagenome gbt object; each bin data as an example, Juliane Wippler for the Olavius metagenome contains contigs that have Amphora2 markers with the same assembly, gbtools users who have alerted us to bugs and made taxonomic annotation at the level of order. The MetaBAT suggestions for improvements, Lizbeth Sayavedra for comments bins were then merged into these new bins, with the function on the manuscript, and the two peer reviewers for their reviews. mergeOverlapBins(). The resulting 44 merged bins each contain Olavius metagenome sequence data were produced by the US one or more of the original MetaBAT bins, all of which have Department of Energy Joint Genome Institute in collaboration Amphora2 markers belonging to the same taxon. An example with the Max Planck Institute for Marine Microbiology under of such a merged bin is shown in Figure 6. The summary the Community Science Program. We thank Nicole Dubilier for statistics of these bins were tabulated with summaryLOB(). Those comments on the manuscript, and for arranging financial support merged bins that have at least 90% of the Amphora2 marker from the Max Planck Society. genes in single-copy (for the Bacteria marker set, 28 of 31, for Archaea, 94 of 106) were regarded as most likely to represent single genomes. This subset of 22 merged bins was exported, SUPPLEMENTARY MATERIAL and checked for completeness with CheckM. The evaluation showed that 16 of the 22 had >90% completeness, and 13 of The Supplementary Material for this article can be found those 16 had contamination of <1% (Table 3). This shows online at: http://journal.frontiersin.org/article/10.3389/fmicb. that a relatively straightforward visualization-aided curation 2015.01451 REFERENCES multiple metagenomes. Nat. Biotechnol. 31, 533–538. doi: 10.1038/nbt. 2579 Albertsen, M., Hugenholtz, P., Skarshewski, A., Nielsen, K. L., Tyson, Bushnell, B. (2015). BBMap.Availableat:http://sourceforge.net/projects/bbmap/ G. W., and Nielsen, P. H. (2013). Genome sequences of rare, Camacho,C.,Coulouris,G.,Avagyan,V.,Ma,N.,Papadopoulos,J., uncultured bacteria obtained by differential coverage binning of Bealer, K., et al. (2009). BLAST+: architecture and applications. Frontiers in Microbiology | www.frontiersin.org 9 December 2015 | Volume 6 | Article 1451 97 Seah and Gruber-Vodicka Metagenome Visualization BMC Bioinformatics 10:421. doi: 10.1186/1471-2105-1 R Core Team (2014). R: A Language and Environment for Statistical Computing. 0-421 Vienna: R Core Team. Darling, A. E., Jospin, G., Lowe, E., Matsen, F. A., Bik, H. M., and Eisen, J. A. (2014). Rognes, T. (2015). Vsearch. Available at: https://github.com/torognes/vsearch PhyloSift: phylogenetic analysis of genomes and metagenomes. PeerJ 2, e243. Ross, M. G., Russ, C., Costello, M., Hollinger, A., Lennon, N. J., Hegarty, R., doi: 10.7717/peerj.243 et al. (2013). Characterizing and measuring bias in sequence data. Genome Biol. Dick,G.J.,Andersson,A.F.,Baker,B.J.,Simmons,S.L.,Thomas,B.C.,Yelton, 14:R51. doi: 10.1186/gb-2013-14-5-r51 A. P., et al. (2009). Community-wide analysis of microbial genome sequence Ruehland, C., Blazejak, A., Lott, C., Loy, A., Erséus, C., and Dubilier, N. (2008). signatures. Genome Biol. 10:R85. doi: 10.1186/gb-2009-10-8-r85 Multiple bacterial symbionts in two species of co-occurring gutless oligochaete Dubilier, N., Mülders, C., Ferdelman, T., de Beer, D., Pernthaler, A., Klein, M., et al. worms from Mediterranean sea grass sediments. Environ. Microbiol. 10, 3404– (2001). Endosymbiotic sulphate-reducing and sulphide-oxidizing bacteria in an 3416. doi: 10.1111/j.1462-2920.2008.01728.x oligochaete worm. Nature 411, 298–302. doi: 10.1038/35077067 Seemann, T. (2015). Barrnap.Availableat:https://github.com/tseemann/barrnap Handelsman, J. (2004). Metagenomics: application of genomics to Shakya, M., Quince, C., Campbell, J. H., Yang, Z. K., Schadt, C. W., and uncultured microorganisms. Microbiol. Mol. Biol. Rev. 68, 669–685. doi: Podar, M. (2013). Comparative metagenomic and rRNA microbial 10.1128/MMBR.68.4.669-685.2004 diversity characterization using archaeal and bacterial synthetic Imelfort, M., Parks, D., Woodcroft, B. J., Dennis, P., Hugenholtz, P., and Tyson, communities: metagenomic and rRNA diversity characterization. G. W. (2014). GroopM: an automated tool for the recovery of population Environ. Microbiol. 15, 1882–1899. doi: 10.1111/1462-2920. genomes from related metagenomes. PeerJ 2:e603. doi: 10.7717/peerj.603 12086 Kang, D. D., Froula, J., Egan, R., and Wang, Z. (2015). MetaBAT, an efficient Strous, M., Kraft, B., Bisdorf, R., and Tegetmeyer, H. E. (2012). The binning tool for accurately reconstructing single genomes from complex microbial of metagenomic contigs for microbial physiology of mixed cultures. Front. communities. PeerJ 3:e1165. doi: 10.7717/peerj.1165 Microbiol. 3:410. doi: 10.3389/fmicb.2012.00410 Kembel, S. W., Eisen, J. A., Pollard, K. S., and Green, J. L. (2011). Teeling, H., and Glockner, F. O. (2012). Current opportunities and challenges in The phylogenetic diversity of metagenomes. PLoS ONE 6:e23214. doi: microbial metagenome analysis – a bioinformatic perspective. Brief Bioinform. 10.1371/journal.pone.0023214 13, 728–742. doi: 10.1093/bib/bbs039 Kleiner, M., Wentrup, C., Lott, C., Teeling, H., Wetzel, S., Young, J., et al. Teeling, H., Meyerdierks, A., Bauer, M., Amann, R., and Glockner, F. O. (2012). Metaproteomics of a gutless marine worm and its symbiotic microbial (2004). Application of tetranucleotide frequencies for the assignment of community reveal unusual pathways for carbon and energy use. Proc. Natl. genomic fragments. Environ. Microbiol. 6, 938–947. doi: 10.1111/j.1462- Acad. Sci. U.S.A. 109, E1173–E1182. doi: 10.1073/pnas.1121198109 2920.2004.00624.x Kleiner, M., Woyke, T., Ruehland, C., and Dubilier, N. (2011). “The Olavius Tyson,G.W.,Chapman,J.,Hugenholtz,P.,Allen,E.E.,Ram,R.J., algarvensis metagenome revisited: lessons learned from the analysis of the low- Richardson, P. M., et al. (2004). Community structure and metabolism through diversity microbial consortium of a gutless marine worm,” in Handbook of reconstruction of microbial genomes from the environment. Nature 428, 37–43. Molecular Microbial Ecology, ed. F. J. de Bruijn (Hoboken, NJ: John Wiley & doi: 10.1038/nature02340 Sons, Inc). Wang, Z., and Wu, M. (2013). A phylum-level bacterial phylogenetic Kumar, S., Jones, M., Koutsovoulos, G., Clarke, M., and Blaxter, M. (2013). marker database. Mol. Biol. Evol. 30, 1258–1262. doi: 10.1093/molbev/ Blobology: exploring raw genome data for contaminants, symbionts and mst059 parasites using taxon-annotated GC-coverage plots. Front. Genet. 4:237. doi: Waters, E., Hohn, M. J., Ahel, I., Graham, D. E., Adams, M. D., Barnstead, M., 10.3389/fgene.2013.00237 et al. (2003). The genome of Nanoarchaeum equitans: insights into early Kunin, V., Copeland, A., Lapidus, A., Mavromatis, K., and Hugenholtz, P. (2008). archaeal evolution and derived parasitism. Proc. Natl. Acad. Sci. U.S.A. 100, A bioinformatician’s guide to metagenomics. Microbiol. Mol. Biol. Rev. 72, 12984–12988. doi: 10.1073/pnas.1735403100 557–578. doi: 10.1128/MMBR.00009-08 Woyke, T., Teeling, H., Ivanova, N. N., Huntemann, M., Richter, M., Li, D., Liu, C.-M., Luo, R., Sadakane, K., and Lam, T.-W. (2015). MEGAHIT: Gloeckner, F. O., et al. (2006). Symbiosis insights through metagenomic an ultra-fast single-node solution for large and complex metagenomics analysis of a microbial consortium. Nature 443, 950–955. doi: 10.1038/nature assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676. doi: 05192 10.1093/bioinformatics/btv033 Wu, M., and Scott, A. J. (2012). Phylogenomic analysis of bacterial and Lowe, T. M., and Eddy, S. R. (1997). tRNAscan-SE: a program for improved archaeal sequences with AMPHORA2. Bioinformatics 28, 1033–1034. doi: detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25, 10.1093/bioinformatics/bts079 955–964. doi: 10.1093/nar/25.5.0955 Wu, Y.-W., Tang, Y.-H., Tringe, S. G., Simmons, B. A., and Singer, S. W. (2014). Nielsen, H. B., Almeida, M., Juncker, A. S., Rasmussen, S., Li, J., Sunagawa, S., MaxBin: an automated binning method to recover individual genomes from et al. (2014). Identification and assembly of genomes and genetic elements metagenomes using an expectation-maximization algorithm. Microbiome 2:26. in complex metagenomic samples without using reference genomes. Nat. doi: 10.1186/2049-2618-2-26 Biotechnol. 32, 822–828. doi: 10.1038/nbt.2939 Parks, D. H., Imelfort, M., Skennerton, C. T., Hugenholtz, P., and Tyson, G. W. Conflict of Interest Statement: The authors declare that the research was (2015). CheckM: assessing the quality of microbial genomes recovered from conducted in the absence of any commercial or financial relationships that could isolates, single cells, and metagenomes. Genome Res. 25, 1043–1055. doi: be construed as a potential conflict of interest. 10.1101/gr.186072.114 Peng, Y., Leung, H. C. M., Yiu, S. M., and Chin, F. Y. L. (2012). IDBA-UD: a de novo Copyright © 2015 Seah and Gruber-Vodicka. This is an open-access article assembler for single-cell and metagenomic sequencing data with highly uneven distributed under the terms of the Creative Commons Attribution License (CC BY). depth. Bioinformatics 28, 1420–1428. doi: 10.1093/bioinformatics/bts174 The use, distribution or reproduction in other forums is permitted, provided the Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., et al. (2013). The original author(s) or licensor are credited and that the original publication in this SILVA ribosomal RNA gene database project: improved data processing and journal is cited, in accordance with accepted academic practice. No use, distribution web-based tools. Nucleic Acids Res. 41, D590–D596. doi: 10.1093/nar/gks1219 or reproduction is permitted which does not comply with these terms. Frontiers in Microbiology | www.frontiersin.org 10 December 2015 | Volume 6 | Article 1451 98 ! " # $%& '()* + + % " #&$%, - %# . / . ! +& &$ $& - 0 13$/)/(*&$ + % 45, & # - + , - %# + ()* + + % & $ 6# % 7 + 8 $97" + !+ 67 :; $# +7 < =$ + + -%# + + :37 # $ +# + 6+ 67 9 < 7 = - 6# <> % =:;7$ + 7+$# + $ 6 -% $ #: 4 77 7 + 6 $ 6 %- $ ?6 - 7+$#+< =+ %- 7 -7 $ # :@ % 6$ % # !+ 67 :, 7 6+ 67 + 54$ 66 % 6: $ $% -?7 % + 6+ 67 $ + $ + $+ # + $ 6 :!7%$ #7 7 $ -9+ ++7 %# A $ + # - $ A- % - $ $% % + $#7+6 < &= # 6 66 # + % :" 7 + 7 7$7$ & 66 7 6$%# + $ %:37%67.7 7 667%$ %## # 6 - + $: B 7 54B + 54: !" #$%&' ' ( ) ' * ' * // & $ 6# %<6 =7 # + A - + :;7 A$ +# + 67+ - $ + $ $7## #7 %6# - 7A $ + %- 6 #7- % 7$ 6# $ +:46 767 7# $7 " + 77 #7 + 8 $ 767%+<0% //(? C> ./=: #7 6 + +7 " + :56 -# +77 $7 !+ 67 # + 77 7 # + $ +7 7 $.$ 76 #6$ % $ # # :;76+ 67 7 > % : 7 - # $ 6$+ # 7 + # 7 7 ?+7 - $7 7 %:$: <; *F= , <*D=:" % + 7 $ $- # 6 + 7 - 67 7+: % 6 +# $ +- $ + + / - 7 A - $ + ## # - $ A #+6 - : - # +7 $ 6 A 7 @4 <@H ://*= &@<+7 # 7$$ 6=<> :/= +6+ $ 7 !# + , ! :G 7 + +7+$ - $ A ++ 7+ -+77 $ + 7 7 -+< = -# ++6 A $ 7 77 7 7 % $ $ $6 #A +<5++ :/=: $ + 67%$ 76:G 76 67% -% + . + : - 7+ 67%$ # 7 +% $+ $ 7 + 54< , 54= 7$7+7 + 7 - # + :;7# - $ +6 54$ + 7++ ## + $ % 6 $ %66<0% C I >%6//F? &7 $ ://D?> . :/?; $ :/? 7 :/=: " 7 #7 A $6 8< :/F? 7 :/D= A + $ +# + 6+ 67 $ 6 $7 % 7 7 6-%:" 7 $ +#77 7 %67 $ 7 + $ +< :/D=:3+6 7+ #67 $ +# + + 6# 7 + 7% +# 7 $ 6$ $ <% %=:; 7 7+6 767$ + 77 +66 767 7## +7 # :3 # 67%$ # +7 $ 77 7% 7 $ # $ #7% - 76 + $# % 6: $ + +# +/ $ + $ + 6 $6 -+ 6767 - % 7#%7 $ / + 67$%< 6# 7 #%- %=:4 % # $- 76 -+ 676# - :; +%. $# +)< 6:;,=)6<6:= 77 7 7 $ -# +7 <; =:&- /K<6:= (K<: 6:G3=:;7L/6 $6 ## &K- 7$ + 7 7 - " 7 $ +#" " 7 -&K# K 6-%:& $%#7 +6 76 - +6::6:0GM 7 # $+ < $= 7 7# 6:< $ $ +6DD&= :6: < $7 $= 7+# $+ : 37 7 +6 - + 676 +% $7 &K <; = - $ # + $ + <4"= 7$7 4 $ $ 6 $7 $ + +# + # &@0# +0- " %:;7 $+ 7 7 </6= 7 7 $ + 7 /K& : #7+7 $ 7 # # - 7 + 8 $# :" # $ !+ 67 #7 $ " + <; =? # % +$7+$# $ :@# 7 $ +-. *. + 7 6 77 $$ +6+ A $7 6 -% < :/=: ;7# $$ 6 + 7 + 6 6+ 67 $ +9 /<6 + 6 0 = 1< + 62 0 = 3 <6 + 62 0 =:- 7 + # / ## $ +# 7 # + 7 6 % % # +7!+ 67 : +$ % # + #7- 6- # 7 $# +6 @5G?7+ %# $ -# $+ $ + +: 5+ 6 $ %## #7 7 $7 +6 ;7# $ + 6 # 7 - $7# 9565656F56O 565656 @ 7$ 76 +7+$%56O 56 56/ # % $ + < 76 =< 7P5Q ; 66+ % =: - 7% 6 ++ + / - 7 + + 6 $ < 3 1= 6 7 $ +#+ + # + ' 67 7% +6%- $ # %A 7+$%:"#7% %6 # + 6 67+# + 7$ < + $% 6= 7 -767%7+ # 6# + 6 :;7 # # % 7$ # 7 7 ++ ++ + 7 - $ -7% 6 7%: #7 7$ 7 #7 6 -# + 6 6# $ # -# :"7 # %7 7P+ $Q + 6 # 7 $ : ;7 + + 54$ 6 + +7 $ +:" % $ # 6 !+ 67 : - -77+$%#756O A # +6+ 67 66 +:;7 # % +$% 6$ : " 7 + $ + #7 # + -. *.7 - - $ 7 - # $766 ?7 $ $ 7 $ /) 7 $ - : ;7+$ #!+ 67 2 6:" 7 A $# +)) + $7 7 - 6 ++ $ 6# :6: 7 7@5G 66 # $+ 7 % ++ + 776% #+6 + +%:G 7 7+$ 67 + # ++ + 7 6 ):37 6A $ 77 6 7%7 - 7 #766 $7 $7#7 $ + < 66+ % G$ =: ;7 @5G 7 6 7 . $ :;7@5G 8 - 66 $% 7 # +7# 7 : - 7$77 66A $ 7 + & + #& 7 $ 77 & A 7+ 7 + $:; # 7+ $& 6 7 $ + 7 $ + 7 -6& $ $$ $7 7 + +% A $ 7 $ + 7 7 6$ : ;7 + 54$ #!+ 67 66 6 + :;7+ $ 8 7 7 + 7 7% %6 %- 6:" 7 54$ $ ,0 , 7 7 0 , ,:466 + 54$ 6 %7 + - #%7$754A- $ 76 $ $ 6# 77+ 6+ - <6: :6: =:;7 7 6 54A- $ 7 7 54$ 6 7 $$$ 6 $ # . - $ 7++ % 6 6 ;7 66 % -% 7 6+ 67 + /F - + $76+ 67 7 7 + 6 7 @$7%+ 67 7$77 + % $+ # 7 7 6 77 :37 7$ $ #% % 6 % 77 % 7% " 7$ 7 - $6 + % 6 :" +67 - $ 6 6: 66:G3 7 - 6 - $ $# + $ $ @5G< 66+ %G$ =:" 7 7- # 6 +# +$ +7 + $ ##: - # $- 6 +6+ % + $?# 77 7% $ 7 $ 7 7 6 - $:;7 $ 4; 7 + 6 < 66+ %G$ =:;7 # # $+ $ + +6 %#7 6%+ 67+ 7 6 + $ 7+7 $ +6 - : !7%$ #7 , 54 0 , 54 6 A $ + + ++7< 0= $% 7 67%$ 7$ - - /D 7$7 76 666 <K=: 37##### 0 %6 + 7 6$% 7 7 $ %7 6 $ + ;7## 6 + 66 96 +# 7$ 6 7 $ + $7 $% $ + A % $ $ %A 7 +# + !+ 67 # + :;7 ## 6$ # 7 : 0 % - $ 6$% " 7 0 % % %#7!+ 67 6 $ + <6 6 =$-6 6 #L/:**# 6$%P4Q#7 ;7466 + %, <4,=< 7+ //= 77 7 -6$#7 $ # %## 0 # + :" 7 6$# +7 6 $ + & #A $ + 6 + - $ # + 77 # +7 667%$ %<> C $ //D? ://D=:37 # 66 % % 7,&>% + 7$ #$ 7 -: S5 77 6 -#!+ 67 " + 6-%: 6 #7 + A $ + $ + + $ # +T $$7 7- $ + 6 A # + %- $ $ 7 # 6 # +7 % 7 7 + 6 A : $ + 7 S5 /( 66+ %; =:47$7# $ %.# < # + $ # +6=7 + # $ 6$6 7$7 7 # S5 $ # 77 7 + 6 :37 + 6 7 < $ =% + + #D: $ 6$-::6$ # S5 <F$ F =<6 UV=:37 + 6 7 <($ =%):/ 6$-: :)6$# S5 <$ F =:3 ## - - # 7 +6 $ $<"0 =7% . 7 . $ # <;= $ :"0 %7# 6 6 6 % # $ + 7 %%6# $ < **D=: ;# # 76 %+ $"0 % +6 +<C ++ //= # 7 S5 6 7 +6 7 "0 7 #$ $7 + 6 %: ;7+6 S 7 6 6 %#/:** 76 7 + # # % /:/ # 76 + % 37%67.7 7##% $7 67%$ % 7 /* + $$ % 6 - + $ 7 77 6 6 % 7 6 7 77 7 7$7 ##-66 .:$:7 6 $7 S;, 7 S;,SG3 " 7% # 7 $ +# +6+ 67 % + + +#7 # $ 7%7 -# 6$ 7 66 %#% $ 7 - 7 $:G $ <" + = $ # # 66 6 77+ 8 $# 7" + !+ 67 :;7$$7 7 $ - + $7 7 6# 7 #$ + 0 7 7+7 # 7% $ +< # :/=: 7 7 $ %+ %## 7 $ 76+ 67 77 7$ 7 7 7 + : 37%776+ 67 $ % #7 + W3$$ 6 77 + % -9<= +A - $ 7 + +6 #% 6+ 67 7+$#7$ <=7 $ 7 + + 76+ 67 : . $ # $ + # $ #6 7% :$:7 -. *. 6 +< :/= 7 7$ 7 % +$%6 -. : " 7 $+6 7 7 + % % 7 $ + + - # + 67%$ :G +6 :</F=6 67 8 7 67%+ 7 7 7 #7 : - 7$77 67%$ %6 / # $ <77 54$ 6 67 = %7 ( 54A - # 8 77 %- $ $ 7 X -$ +7 7 76 #6#$ #6 $ #% ## $ + 67%$ % # + -7 7 - A % +6 7- $: 7 7 - $ +# +76+ 67 $ %7 +7 7 6 -%7$7% 6+ 67# +% 76 54 +$ < % ://= %6#7 + : 7$ $ % 6#7 - 7 7+ % 7 $ - < 7- ## :/=7 6 % 6:X -7 +6+ 67%$ % A + 77 % 6+ $#7 - % + 66 $7+ A 67%$ 7 - 7 : " 7 #7 7 - $+ $ A %+6 -767%$ # :3# 7 # $ + # ++6$ $-+ $%7$766 - + <7 7 % % 7%= 7 $ 7 < : //D?> C$ //D=:" 6 + 7$77 $ + % $- -67%$ 7% +P Q# # 76- 7 7 ( 54$ ## ## <0% C I >%6//F?&7 $ ://D= 7 6 $#7 54 $ +6 7 % < 7 :/D= $ 7 < $ :/=: 47$767%$ 76 7 - 7 $ 7 $$ 6 6 B+ $7 -- # 7 -%7 6 #+:G 7 7 - 6- 7$$ 67 6 $ - %- 77 %+ : 7 6 ###-66 . $ 6 P7 # Q6 < //*= 7+ 67%$ - $ # +6 $ $<"0 =:" 7$7 +6 + #% 6 7 - +7$ 7 + # 7 +- 7$7 7 $7 7 7 7 :&+6+ % 7%67# 6- # 7 $7 -+ ##-66 . 6- $ 7 % $7### +6 $ $: G 7 + 67 + 7 7 "0 7 $ 6 7% . 7 . $ # 767%$ $ $ : # ## $ 4 $ +6 :G +67 6 + -. *.7 6 P-7Q# 7 . # < :/= 7 . $ 8 6 -7 - 7 . % # # + 76 7%67%$ #7 $ < :/F=: ;7+6 # $ +6 6 #- $ 7A - - - +#$ 7 7 + :G + 67%$ A $ $ ++ %+ ##- -!&5 +6# # $ # %6 6 $ A $ # + + #4 54- # + $ ++ ## 9& $ + $ $ 7+6 7 - 6 - $ +6A # ++6 6%-- $:G 7 + 76% + #7 $ +6 7$7+6 7 $ +7 7 % + + # $7$- A A $67# +%:% P $Q %+ A $#+7 $ +# + 7 $ 6#% 6 +6# +7 - + < = # + < =## # % -$ 766 $%$$ 67% 6 #7+ 6 $ +: &@0 //D# + % 6 7 4 + - 0- " %:;7 + ++6 # $ % 79 %" < :/F=: 6 / /# +7 # " % 7 %#& -<:D*Y/:()(F(Y:(+67= Z4 <:(/()FY /:D)YD:+67= G- <:DY/:)Y:)+67=? /)# +; & %.<F:()FY((:/F)/Y3:)+67= 6 -% < 7 :/D=: !"#"# $ % G 4 77 % ;> 4 %6 6 # &@0 6 # + < :/F= A "+ A)// 6 # + )66 #6: $ + # + 7"4, 7$7+ - $ # +%: 6-<7 /)= + - $<V=#7 ?# +7- $7$ + 7 7 - $- + %7 - $+ ? 77$7 - $+ % 6 77P7$7 67Q6 :;7+ - $ $6 $ $# +7 $ + # + A - 7 +6 - $7 +%#7$7- $ $$ +7 7+7 : + %# + 7 <&77C5./=<# 6 + = "4,<+ +++ V)+ +++ V)6.)= 6 -% < :/F=: 7 $ #% 7 7 $ + + $ 77 + <> :/= 7# 6 + # P7$7 -%N Q +%: 4- $ %<4"=- 78 6<57 C5\ \ //*=# + $ + :$7 8 $ # + + 74! 7 $ +# + < 6 - +%6 + 676= < !,////F)= $7 7 #7 6<; =?67 $ + 67 7 -## +7:@6 $# +<@5G= 6 7! $ :F:<% ://= 77 # $ $9P $Q+$ 7 6 A 7 7 6<& + 7 ://*= $ 7 &@ <> :/= 7 6 $ 7 G 7 7:<%/= $ !# +4 G $ + % 7+ &@!# + , 6 :;7+ -6 $ %7 -7# + 7 :" 7 # # +, 6 6 -# $ %#767 $ :G 7$ 7 # 6 6 $ ++ #7 : #7 - -7 7- G @ 7+ 7 7$ + %7 7 + :! + # ++ <; = $ 9 + 6 %6 % 7 -; $ 7 7 #47% $ 77 - + #; $ 7$: 4# 7$ 7# 6 $ + 7 6 # + 76 A # 7$ $ 7$ + A # 6@5G+6 :5 $7 +67 6 66+ %; : !7 54A 6 # +7 6" ) 54 6 754 :<0 C%**D= $7 $ + &- ###/: ;7 - 66 < 6+ - # = + 7 ! 6 <769NN$7:+N 7N+ 9/:)(N. :)*)=: @ %$ + + 7L*/K#@5G $ ## :G 76 # $ +7@5G6 %! $ $ % 6:;77# 7@5G 6 76 G$ $7 6P% 6:6Q 7 6 $:; + 6 ## +6 6 :/ <> + ://D=:@5G $ + 4;K$ 67 66+ %G$ 6 # + - *<769NN :$ :+N=<> :/=: 4+ A # 7# $$ 6 % $ 7 $ $ + 946*&+G&& & / 0 ) D5656F565656:;7$ 7 7% 6 %#7 %.$ +: $ # 7$ 6: 4$ + A % 7+ 7T <3 :/=:# $ 6 +# 7$ # 7 $ + # 754 0 $ ! 6%4: + <769NN:7 : $N N N N# N! :6=: ++7 < 0= # +7 + < : := $ + 754 0 67+ $+ 7# $ 9< = $6 ;T@4 + 7 ++ - +6 # A < ;T@4S ++ SG=<= 6 %$ $ $+6 6 <= $6 ;T@4S ++ SG++ $7 $%T $ : 66 - %9// 6 6 6 66 + 7 < 05;= 7 - +6+ 54 0: & G 7!+ 67 % $ + 7# $ + A 6 % $ 7 946*&& & / F 0 ) D5656F565656:# $6 + # -:;7 +7 0 % 6 # + 7 : : $ + -:4 - 6$ +6 %# $76#7# 7 $ + $ 7 - $54 0 7 6 # + $7 466 + %, <4,=+6+ &@ 0< 7+ C $ //=: % % 6 # + 7 %::)<5 A :/=# 7 !+ 67 $ + $6 6 %$ + + + 76 ++ 6 6 :;7 &7 & < & &=7 # )]/F /]/F$ 6-% #7 7 +6 $- %//$ :& - $ - %! 5G- :/:;7+ 8 % ++ . 7 - #)K: % %# % 6 # + 7,&>%<0 $ ://=:G + $ + #6 $$ # 6<46* && & / ) D5656F5656= - $ # 7 %<+ + + ++ #7 # )+ & &$ +6 $- %)//=:;7 7 ++ . ,&>% $ $#6 - # 76 + U % % 6 # 7 + 6 %<46*&& & / ) D=: ;76 # +6 +^ <C ++ //= - ::< :/= $7 + $ + # + 6 %: ++ # 6 :G 76 7 + ;5S ++ < $ = 77 66 + + # + :4 + 66# 76 7 # 76 + - 46*:;7 + 66 # : 6 6 7M+ 6%# 76 PM +7 Q:; 6 & & #)/]/F$ +6- %)///$ 7 /K :& - $ A -%- # +6 + D ; :F:/<769NN ::: :N; = ##- +6.# 76 + //: ' ( ;7# $ + A # + 5 6 % $ 7 946*&+G&& & / 0 ) D5656F565656: % % 6 # + 7,&>% $ $#6 - # 67 ! 6 54$ 7 $ 770" $ 7+ 4GG;D <> 7C %/=: ++7< 0= # 7 , 0 , $ # %54 0(::< + /= 67+ $+ $ 7;5S ++ + // 6 6: "# 37 7 ###7# $# # 7 66 $ +697 M54" " %6 % +3 7 7 7 >7#'? 7& & %# .6 %7& & 5#%+<&&5=6 $ +#7 +7 " :37 ! 7 3 7 # - 7 $ +A G .0 $# $A # 0.7 % - # ++ 7+ 6: 3 7 7 ! +& &$ # 6 # + $A $# :G 66 6 -%7 ! %: $ 4 1&0 $ +4 +7 5 4://F: % + # + $$ : ::-:9BF:9/:/*N+-N+D/: 7- ##;5 % ! 45 7&G:/:4- 67%$ % # $ + 6 :E: %: :)(9B:9/:N8:))/D/(:/://))): : ( -74 :/: !49 $ + +% $ 7+ 66 $ A $:E:&+6::*9))BDD:9/:/(*N+:/://: 7 ;,:/:;7+7 $ +A #7 " - 7# +6 $ 7 7$ " : & +: 9D:9/:(FNDFD: 5 :/:4 ;94 # ! # +# % - %4 %:!0@ &+6: :/9//)D:9/:DN8 :6://)D: &G00&; 40E://:&+6A #7+7 $ +# +6 -+7# #% $7$7%- $ $ :45:9FDB F(:9/:/*N N$$D/: $ :///:&+6A #7+7 $ +# * +6 7" +7 4:E: ::*D9F)B(/:9 /://FN8+:///:)*: 7 :/):,,8 :769NN # $: N6 8N+ 6N: & + 7& ://*:04 ;S9 7 66 : & # + :/9:9 /:(FND/)/: &7 $& ://D: $ 9 +6 7 -%#D) #7$ : " :E: %:-: :)D9B:9/:/**N8:/:F(F)/: &7755.:/: 6 ## 8 $ 67 6 +# : 4$ 7+ ::(9:9/:(FND(D(((: - $ 4 $ &:/:, $ &0 # + :" 9 : E; 4C;7## % ::(/ 6 $ M 9 M M 66:(B*):769NN :6 $ :+N/://DN*D(FDD*F)O)<4 %/)=: 7 G 3> .04:/: 6 $7 +6 $# 67%$ # $ +7 , 4 + + :! :F9()B**:9/:/FN8:6 ://:/F://: % 5:/:4 6 # 7:!0@ &+6:D9//*):9 /:DN8 :6://*): $ 5&://: , &09+6A $ + 77$7 % 7$77 $76: 45:9D*BD*D:9/:/*N N$7/: ://*:" $ 7 %#+ %+ + $ $W- :F9B*:9 /:N8:))()FF://(://)*: : 00! >://D:$7 6 7 :! : :4 : : /9)*FB)*:9/:/DN6 :/F/D///: G 5 :/:!# +976 # + :45:9B/:9 /:/*N N$: G 3:**(:;7 % $7 4C3 4 :&7 6+ C 9 * 0 66:/)B): G :/F:;7 - %7%67# 6 7 - # # 7!7%+&67 < % 4- =: :56:F9(D:9/:/(N 6(D: G> .04:/:!7%$ + %66 7# # + 8 7 ## 6 6 # - : :!7%$ :-:D/9/B:9 /:/FN8:%+6-:/:/://: 4&:*D:67 + ! * (: # , - %! 9 # & #: $E $E0_ 5:/: +%7$76% + 6%+ 67+#7 4 6 + # + $ %#$ 7 6 7 :! :F9F*BD*:9 /:/FN8:6 :/:://F: #5 ://*:;7+7 $ +#7 2 2 : & +:/9):9/:(FNDF/): #5 :/:;7 $ $ + + 6 #77% $ 6 $ +7 #0 : ::-:(9D*B*:9/:/*N+-N+ /)*: % 30 $G $ ://: 7 #6 :4 :5-: :(9DDB):9 /:FN -:$ :D:/(/:)F: G&E # 0:/F: 6 $ # % . $$7 . $ # # + 8 +7 4: ::-:9B:9/:/*N+-N+-/: E ++ 4E://: % " # # 6; # + : ::-: D9)D/B)(/:9/:/*N+-N+6D: >> >; >:/:- %#+7 $ + 767%+46+6 : :7+:! :((9FB:9/:/FN8:+6 :/:/://F: % ://:! $ 96 %$ $ # : & # + :9*:9/:(FND/)*: E7 ; $;@ 73 7&G >://:$7%- $ , 54$ # 7+ 8 8 .:! :))9DB)*:9 /:/D(NF/(: > 5$. "> :/: &@9 # 7$$ # ++7 +6 # 7- # %: &-::9D: > 7> % :/: 4GG;+6A $ + # - D9+6 -+ 6 # + %: ::-:/9DDBD(/:99/:/*N+-N+//: > .04 :/: $ #+ - + $ %66#7 + 676 :E: :-:D9FFBD:9/://DN//*/*F( : > :/: 94 $ 6# 6 # +# 7 $ . %#A : # + :(9FDBF*:9 /:/*N # + N**: / > $740 - 8 7 ++ 0://:! $ ++ 6 6$% 7 7 -+9 66 +6$ +:E: ::/)9)FDB)(/:9 /://FN8+:///:): > +E4 55 ;://D:6 9 6 -# $6 $ + : # + :9/FB/(:9/:/*N # + N+/*: > 0 $ E://D:" %#67%$ + # + : %::)F9DB:9/:/(/N/F))/F/F/: 0 $5>7 > %&4 1&://:,&>%9$ N6 7 % %: # + :F9*/B*:9/:/*N # + NA)*: 00 &E5 ://:@ 7 &09 # # 7$$ 6# %$ +: +5:9D(B(*:9/:/N$ :)/: 00://(: ;9 % + #6 7 +: # + :9)B ):9/:/*N # + N (: 0 ; % 5:**D:54 9 6 $ +# +6 - # # 54$ $ + A :45:)9/*))B*F:9/:/*N N):):/*)): 0% ://(: ( ! ( ' * ' : : 6 $ 9 7: 0% I >%6 &://F: 6# %+ 54$ A + %+7 %7 + "$ A :E: %: : )9()B(D:9/:N8:))/D/(://F://F: : 3!:**D: 6 : %::F9)B)F:9/:/*N%NF::): 7&0T# 54> .04://(:& $ +- :" 9 + - + %:> .04C7 7 % :@ # , - %! 9 M 66:FBDD: $ % .% E > ://D:&+6+7 $ +A # 7 6 - + 76 % %+ * $ :!0 @:9F)/:9/:DN8 :6 :////F)/: @H 4 ://*:@4 9 $ $ + :45:D9*FB*)/:9 /:/*N N$ (*: ! & E ++ >://:4!94 %#!7%$ - 5 $ $: # + :/9(*B*/:9/:/*N # + N$: ! $M0 $& M &7 GM0:/:"4,9 - + # $ + $ +A $ 77$7% - 67: # + :(9/B(:9 /:/*N # + ND: ! :**:;74# 6 . : : ::5-:)(9BFD: 5++ $ 4 4 ` $E:/:9$7 $# -6 A 7 $ % $ + : : 7:*9DBD):9/:/(N +7:((: 57 5\ \ 5://*: 7# $7$ +$ # 76 %6# : ! : :4 : :/F9*FB*:9/:/DN6 :/*/F/F: 5 AG :/: %:9## % 67%$ # +7 $ +6 : %::F9)*B):9/:/*N%N%/*: 7> :/D: 6#% - %9 $ $ # 6 %+:! :5: :: :(9/D/DF:9/:/*(N 6:/D:/DF: 7> 5:/):$9" -- . #+ $ + 5:G : :F9):9/:(*N#+:/):/): + ;:/):, :769NN$7:+N+ N 6: 7+ ://:4 66 + % #67%$ : %::)9*B)/(:9 /:/(/N/F))/*//F**: 7+ $ ://:&@ 09# $7 # #67%$ : # + :D9FBD:9/:/*N # + ND::F: 7$7 7 . & > 7 $6 :/):;7 $+7 $ +# - - $A # $ 6+6 : +:-:D9DB:9/:/*N$N--D: :/D:;7 +# 5- ; %" &:& ::D9)F*B)D):9/:/FN8::/F::/)D: + 4:/:54 0- (9 # 67%$ % 6 %# $67%$ : # + :/9B:9/:/*N # + N/: & :/:;7-. *.+7 $ +: +:-:9FB):9 /:/*N$N- F: & ! :/F: 7 6 9 6 + :&:FF9F*BD/:9/:/FN8::/F:/F://: ; $&X :/:;7 %+ ( 4+$ % + - % - % -%#7+# :! : :4 : :/*9F/(BF:9 /:/DN6 :/*F//*: ; :*F:* :! $ + ! 9 M 769NN 7-: $N N$%# // <4@ /F=: ;7, ! & +:/):, ! 9 7# 6 # + :45:9/B:9 /:/*N N$*(*: % 4 7 3://*: 7 - # + 6 :4 :5-: :F9*BFD:9/:FN -:+ :/*/(:/D: 3 5GE &E://*: # $ +7 $ +9 7 $7 #+ $%: %:9DB):9/://N://(//F: 3 +45 :/:!4;5"&7 # + % :45: 9)(B)*:9/:/*N N$/**: 3 &7 8 E4:/:4 $# $ + % 67%$ +:!0 @: D9/((:9/:DN8 :6 :///((: M !$a!> 3#M":/:!7%$ +#6 % + 6 :!0 @ : D9F*D:9/:DN8 :6 ://F*D: :% 6 7% <54M=-: + # ++ + # 6 + 6 7 6 -7+$:5+ 6 67 -7% 6 7%R/ . ++ + 7+$7 < $7=6 % # + 6 :B !+ 67 B" + :! $7%8 77 . - 6: :@- - # $ + # 67 $6 #66 < %+ =: -. 77 - - $ 7 -# $766 77 6 : 9 $ + 6 : :54A- $ 54$ 6: :6: : . + 7 $ + 7 6- :&- $ 6 $ 7 - 7 $ + $$ $7 7 54 $ 6: : % %+6 # $ +: 77 . 6 $$ + 7 . 6 6 - @5G:& # 6 @5G 6 <$ B#?B $7=: 7 - + $ :@5G 8 $ +7 6 7 77 % 6 7 %6 6 7A %: ) :& 67%$ % # # + 6 $ + 7+ 8 +$ 6 :5 6 6- L*/K 7: 9 6 : F :4 - 6$# # ## 67%$ %< +=? - # +7466 + %, # - 6$-:7 % $ + :>% 9 0B+ ++7 B % # & B % % ! B4$ + 6 %$ B $7 $% $ + A %4B $ + 7!+ 67 " + !&B $ + # !+ 67 %>B $ + # %: :! + % # <4= $7 + + 6 <= $ + 6 % <&= :; 9 +6 # <6 UV=:G 7 # $- # 7 79# + % $7 + + 6 <#= $ + 6 %< $7=: D : 6 <+ ++ %=# <4= + 6 % <= + 6 %: 9 6 6 %:7 . 9*)K6 % - # $: 9 #%+6 6 7+ ##-66 . 7 : ( : ++ % # +7 $ +?@5G6 % ! $ :G 66: $#- $- 76 6 % 7 $ +: ! ! %% &' )* "#$ ! ( "#$ +) ', ,)-. / )+0)* 6: ):B):/ :/B): F / FBF :6: :BF: :) FB( D ) :6:0!G (:)B*: ):DB(:) B F DB) :6:0GM *:FB: :/B/:) B )B) :6:;, :DB): F:/BD:D B D DB)/ :6:,> *:) :B(: B / DBDF 6:G :*B:) :B:F FBD )B)) :6: :(B: /:DB:F BD * )/B) :6:G3 D:*B*:D ):DBD:D BF ( ) :6:;& :B:) :)B:F B ))B)F :6: D:(B(:D D:( BF F F *:* F :F / ,1* / '*)12' . 8 X*/ :D 8 X*// :/ ) * 5 * &O/)*( ):D F F 0 <7% $ += ,/)D( :D )( " _)*D /:) )) " G*/ :D )/ -. *. E((E(( D): F*:( (D . X*D/ D:) * )/ X*D/ D:D / F X*D/) D:/ * ) * 4GF/(F D: ) 4GFFF D:F )( * : ++ %# $ %$ :>%9SB6 <#+666 + 8 %=?/B ? B6$ ?B#67 < + =?5B +7+$<+ =?;B<# + 6 = ++ + 6 % +6 ; :9<= 6 $# +B 6 % +% ?<= % 2 $ + - 2 66 %+ $ 3 <6% +6$ +=?<= O # 7 6 !: ?<-=6 - 1 -. 7 1N*:#7 : & 3 3 / . .+ + ; : 1 3 S/SSS S SSS SSSSS S/SSS S SSS SSSSS S/SS<=S S /SS SSSSS 2 <= SSSSS S SSS S/SSS -. *. SSSSS SSS SSSSS 0 // /// W SSS S/SSS " S S S S S <=SSSSSSSS 5 * SSSSS SSS SSSSS SSSSS SSS SSSSS & 3 + : : + 4 4 1 7 + 3 S S S S<;= / 5<;= ; 5; / / 5<;= S S S / SS/;// <6 :=////S/S/ SSS S S/ S S/ S S / S / 2 S / S S<;= / / S S S / / -. *. SSS S S S SS<4=S S S S S 0 SSS / / S / / / S / S / " SSS S / S S / S<;= S S S S 5 SSSS/; / SS//SSSS * SSSS/S S SSSSSS / !"#!"" " $ % &% % "%' ( ( % " ' !" & % ) !"&% *+," - .# &% %("% % " !"&% %(' / " 012 " - 3 " $ 4% !"# - % 012$ 5" !"+1+ !"+6 ( % !"+ %( ! 7+ % !"++*+ 8* 4% " !"+ 9 3* "% %( % !"+ ," - 8: 8# ::*," - * . !" " 2!5;9% "%' % " " " !"&% " ..,- 4% % " 4% % ( !" ! 7 " " !"&% " ##,- *. !": % !":&% % 012 " % " 012 !"*- * " * !"*" 88,- 8 4 1!< !" 3 =8=:"" " % % 8.8" &% " " &% 4 " 4 % % "%" ! !"*7 "% % " !"*7 "%" % !"*7 "% % % " % " " "% ! 7*70 % 4 !"*7&% +# :# %* %# "% ' !"*7 " 0 % !"*7&% = """ >" 0 " !"*7 " 2!5;9% ' = &% " !"*7 " !"*&% % "" ' !"*7 % % " &%:%*" " "%1!< * ' % 5=4 " 5=4 % % )% &%'/ 5=4 5=4 2 " "% 5=4 % )5=4% 1 = % " " " % % ) " ** 5'," % %" % " %( %" % " " $ @$!=5 " % % @$!=5 " % $" % " "% % &% % "% % !=5&%A% % ) " *8 < ' "% B)%" ' = ) " C" 6"$ % $D%! % 61!<"%% 5 4>/5 $> 1!<" " " % &% & ' ( ) ) ! * *+ % $ & " "@< E E E E E E E E EEEEE ""@<9 E E E E E E E E EEEEE ""'$= EEEEE E EE EEEEE ""$=B E E E E E EEE EEEEE "# EEEEE E EE EEEEE ""> E E E E E E E EEEEE "# EEEEE E EE EEEEE ""2 E E E E E E E E EEEEE "" ) % * % ) !. !.( * $ ) ! * & ""@< E E E E ! ' !' E E E ""@<9 E E E ' !' ' !' ! E E E ""'$= E E E ' ! ' ! !' E E E ""$=B E E E ' !' ' !' !' E E E "#" E E E ! ' !' E E ""> E E E E ! ' !' ! E E "#"< E E E E !' ' !' E ' ""2 E E E E !' ' !' E ' ""EE *. E' E E E E EE ' E E>>> E > EEE E ' F EE E E E E , - EEE >F E > E E EEE E E E E>> E E E E EEE E E ' ' E E E E EEEE>E E EEE > E E E E - EEE E E E EE E E E E EEE E E E EE E E E E EEE E E E EE E E E E EEE E E E EE>> E E E E *3 0 % % " E ! %%" " G" % % ! " #$% ! " ! + ++ +#. +# " +3: +# 4"% ::. = # . .. . .. " .: .. 4"% +::. ## E ! 3 3 8 * " ++* 8 4"% 3** 8# = 3 + 8. " 8+ 8 4"% .8# 8+ *+ *# !" # $% & ' % %% ()*+, , # , '# $% & '% !-!.!0' 1*1)+ ' , 2 &3-, 4%2-% &,)*+, , 4,%% 5% & !#6'7 89 %--' - -%- ,%,' % : 8%, %& %5 %5 - & ,,8 ; < = 0% ' ,8 , 8 &< 8%, % &%> ?%, ',%8% '% ,8%8% $ 8%,%%% %, %'5& % %,% %''&,% & # &#@ 2#8 '%& 8&# 5 8 < ',% 5 %%, % :5 %% &,, %8 ,% & 5 %8% $% %, ',%-& %%% 5 %&'% ,% ' ,8 ' %% %8 %&# %,% : 8%, % ' --' %,% &' '' 8 &, % & -% % %& 4, %88 ' 8%5 ,-%, 8& % 8 8 5% :%% &% -& %,%%5 # %- 8%, % ''% ' 8%, %, 8%8 ,'' &,% 8 8 !"# #$ # % ?1 % :% !5#,8 %&,% %,%%- -% & !#6'7 89 & 8%,%%5&% %- 8!% , - % %8%5 %, %% 88 '5 & '% %& 5,- - % % 5 %& 5%8% 5!5 -, %5 % % & %, %%%8 % : 8%,%%--' - - , 8 ,%%% %% %& %- %& %, % % %7 11)9 : % 8 % %,%%5 %, &#%@ 8 ,%% %' '&,'% & # & % %74 5 11*A 11)9 -,% %8% % '% - %% ,% %, %-% ' %&8%%%%'%& -!%!%%, 79 &@&# 7< 1A - -@&# 8 5 -% # 7: 9 7 11E9 : 8 %, %& ' % 5 & - &%, ,,8 ; < =7& < 9 74 1E9 % 5% %& 8%, %, 6, % 5''8 % &%, % & 7 11DA' 1?95%, ,% % ''% ,,%,%%, %-,' , % < %%5 #6% &&#@7F F +)+9 % , %% %- 8' %%7-+EAF F +)+9 2#8 55%> < ',% -% ' , 8 '& 5% 8 $ %% 5 %, ', , %8 ,- %5 < %58 5%& 8@&# %, % &, < ',588% % &% 5#,8 & 8 %, '%%, &'% % % &# &' ? 48,%& 5 11?&,3 $ 7 491*&,:5% 67491D&,-G, 7I% 4 5 49 %' , %8- % %74 1E9 4,8 ', '-4 88 , : 4,8 %& # 5&# 7 ,9% ?J & # %,8 %5 & '7)111'*,9#%% 5% ,-88 ' 5%# 5 % :%% 7K'9 & 5', & L%% % *1M& && 3 5%,% & , 5 K '!4% - 7&: '%9 3 %,8 5%% 5 )4 8,%3 N3 7 +))9& 58 %> ' & 8 8%8- % %74 1E9 %&&, ', %> '5885 @- 2 54% ," 7 39 & 5', & L%8 %5%> % 11*188! % $ ,4>*118 &, 5%# 5 % %< 7K'9& 5', & L% 8 *M%!&5 5%% %65 @- 4>4% ,-7 39& 5', & L%8 % *18 ' %65 -%,:23%% , 85 O, , P < 4> ' 5%88&, 5 3# 2 88 &$ ,%> $ ,4>*118 &,% 118%' !% 88 %> '58&, # , ' ,7 8QNN,8' ,886 ,8' N,N9 %5 ,,&, % ,-&', %, ': %>8 % ,-%%5 > %R %' %7" &, % % ,19,87 % 1*9 :,,%5! 5 ? % %,,7- 19 3! %5%%, 5 $ ! 27 ' 194 %7- 19 8 %%, :&-'& '5% ,88' ! % '% %%, 5 ,87;&% =,9 %-,'% %%, 5 & #, %%&5 ,870 4 19 ! ,870'0 19 D4 '%5 &5 874, 1*9 %%&%''% 4 -442!&+ %7K % 195 2%73'119 && -'&, 7 % 19 5% ,88'%&, %,8 %& %,% ,8%8% %%, 5 ,8 '% '' 8, %, 7 ;8,%, =95 % &, &&& -'%%, '8 - S&& &%-,'% && &D4 %> %'' %74 !"1*9 % ,88' 8,%, 5%%, 5 4 % ' %%, & 8,%, ',5% - 8 &, ', %,8 8,%, 88 %' ',% , #,&& &%-,'%D4 F& ',%% ,,% % %5,8 5 K % -? ?7 - 19 ,8 %% , 5% , 5 7 % 1*9 %' ,,8 #,5& 5 ,%5 5 $ N88 &5% , %%75 6 1?9 8 5%58 &, 8 %5 ', 7<8 19 & 5: %-1 *7<8 1D9& 5 , , %&,<3 7<% 1E95 % 8 5 <3 88 7 8QNN555 '' T8N''N,88 , %%U 1E9&,<3 @ ' ,% $ @ ' % %&< 8 %> %58 &% 8&,' 8 % 87-% +V9%7, 11+9& % &% $ 88 73!- &&1!*9 &' % % %% %5 - % ' ,7-' ! '19 %'F% @ 7& - *95%,8 , &@ 7 119 :$8T 70 , 1?9 , -% ? % , %& 8',%65' ,%,8 '7W119 &',,,%8%& 8 '% %8 ,%& %8 45,88 %, ',%%, %&, %8 -%8%7$ ',$%D1+?*+E*1 D*)?1*1*9 %',87,, , 1 +E9 %8',& 5 5 & %- * 7 1?9 %&, F <- % 7&', %88&8, %,889 ! " "# <6,% '% &5 88 5%5 &&, 7!3- 1A'1AF %1AX' 4- 19 74 88 , : 9 :%5% &,< ', %5 #8 & %@! 8 7 9< %8 7% 59 :-& %& 8! %> %5% %,8 ',% ,%8 &8'&,%,%%%, & %5 '5% &,% !%, , ',%, %8 ,%'% 2 45%% %7 %1EY197'% ,19 %', % # 7-1 ) ? +D;%% -=,97 & 1?9 4> %& 6,% 5% &,45%% , 88 ! % %, ! %& !#88 ! : % ! % ! % %& -%: % 5, % ' 5 2 <%> %&, 2&*1 % % , 74 88 , : 9 %5 % ' 6,%7 &3 ,& ' 95 # ,88'% , ',%%, & %8' 5 %&%5 %&, F <- % %' ,% ,, ' & ' 8 %% & ' $ ! F, %% &, %& %8 8 %&, :%8 %%& % 7:%%F1E974 1?9 5%%'!8 8 %8 %&'% % %5% % 74 88 , : 9 :% @F%&< % ',%& %, &! -'% ,,8 74 88 , : ?95 '5 % 87, ?? % 11+97% !%' 5 3!- R1!*Z1S,%> ZE1S -'&&%> 8, %&,7[ 1D99'% : % : % %!,,8 % - - %8 7 ' : % % & %8 %95 % 5, % %,, ,%8 5 ,,,- 17<' 119 :,8 %8 5',% %&'% % 8 :&, %8 ',5 6!, , ,% % '7495 , 4 & 8'-'7@% 97! %% ,%%111 %9 %" #, ,! 8 ' %5&&, & 5' ', %5 F% 7 119 %' U::, 5 :88#, 71 '%94! % 88 - % %-,'%&,< % % ,,8 74 88 , : ?95# ,888 ,%> %&1,%5 '5 % - ) 73'11?9 %@% 8&, 8 %%% %%& 5 &,7: 11E9 :%5 '5 %@! 8 %> %&,< %8 %@&,% % & ! #6'%, ,,8 %' % ! , '% 8 %& ! #88 ! %' 5 &, 2&*1 % % ' %> % 2 % :%5 ' 5 < , '%5 % "&" " & ,%&< %, %5&,?, ',%%, % %8' %' % - :%%,8 %8% % ,8%8%&, && ''8 %Q ?* N 4%74 88 , : 9 :%, ',%%, % ' % 5 * 187, +89 ' 5 - &', 7 '%Q)D E?,DDA*1Q * E *8, ?89 ,%6%%%, &', 88 %8%N8 8!8 74 88 , F' 9 %% ',%5 - ,8 7+ ? +? +S,+ )S9 5 , 71 E* *DS, )ES9% %-,'% & ,,8 74 88 , : *9 :',-% 5%5 !%,8 Q1+8 !'' '%5& ?',% ', , - 8 74 88 , F' 9 ',%- U ,$% @ % 7 8%QNN' T' '-N9 % %1?*?* ' & ( < &,5 !% 88 711S4! % 88 - 95 ,,8 8 ' %% %'%-8 !', '%7F' 9 : %% -% % &% ',,8 ',% 65! ( ) ' ) ,8 &%*)) %88 711S% 88 9 D4 ' 8 '58 ,% %% ' 8& # 74 1E9 < &,&& % ,8%8%&,%8 5 !% 88 8 8 % %5 #8 &< &, %8 2< %8 F5 %' %, 8 85%%% 5 5&& % 8 8%%8- % %-5 D4)4 %> % < 8 8%5 && 5 %8'% ,8%8% &% ( ! ) ! # " "# 2 8%, %5 %> ',% '%& %!*! %8%8 # %N#'%7 %@9 6,%5 8@&# 8 5%74 88 , : 95 8 % 88 % < ',% ' % %@ < %8 5%& & 5 8$"& %@&, 7F' 9 8 ?D % $" %@% %5% %@! 8 %7 %9 5 8 &# 7: 11E9 : 8%% '%& %6,%5 & %& ,% ,8 ','8 ,%5 ',%%, 5 ' 5 %%, %&, , ', % 45%% %&8 %> % -'- %& 8'%5 51 F < ,% 11!& 5 -'&'% 58% < ', %7F' 9 :-'& %@5%'%, %7 8 +F <9 ,% & % , ',% , ',7F' 9 0 %5,- ,-' & %@5% DDF <7,#) )9 %8 ,%& 58 8%749 5 %%5 %,88 :,-'& %@5%1 ) F <7,# *95 ,#, ,-'& 8'%5%R F <74 88 , F' 9 *& " " " ' < ', %% ''% 8, %,5'% 8 # & % & %%%, &,&' ,8 %7F' ?9 %, 8%,&! -'%8%7 ' + 9 < ',%4#!-%%8 5&% & # 5 5 5 %& % & , % & % &%'% %7 F11)A %,11+9 :,8 %8 & # -8%8 F1F! 8 : % % : , #' %8 5%! 8 ,#%7,8 #$"95 %5 -'#'&& #8%% ,!# %7 0 , '11?A 6 11)9 %& %& % 5,' ,% ' !#8%%'% 5%8%& 7F' *9 @# %%&%8 5 8 #8 &% %8 &88 %, %7)*',%%8 - 9 5- % & %%, ,,8 55%% V! % ' ?E &#Q V7&9 Q > 7>9# %%5 8 '> - % V,,8 5 %8 %' 8 %8 %&'% % %5 ',% 5 %#8%% %8 ,%7F' D9 -'&*? 78% ' ) S& '%5 : %958 8',&5-'&1 * %,,,% :&, %5 '% , %8',5 : !'%% 7 9% 8&, 7 + D ? %,, ' 8 ! % &, %9 8 : !8 88 %, %8 7: !:9 &, 7E * :9 % Q% ,%,8 74449&, 7 D :9 : &, %\ - % %8 7:9# N, %,8 7 49 %, N% ,%,8 7449\5 8% %' ' < ',% % & %&, %5 ' '%,%%, 88 % :%8 %&% '%5 %% 7 ' 444&, 8 98% % % &',% 8 < 7 ' 8%8 %&%%% ,&, 9 : ,&' 8 %8 %< 5%'5,8 %, 8%5 %''&,71 %,,9 "%,% % ?7D+ %,,9 ,,%, &, ) 5- '',% -, %8 %< ',% 5 % - '7F' E9 0 &,8 &'! 8 ! :&, ,,%8', 5< % ,,8 !, , ,% % ' < - 885 '&- & 8 8%, 8%7 &! -' %, 9 5,% % &, 8%, %&8!%- -%5 -&5 8 %8 %&,8 '' 8%7F' E9 < ',% ' %%73,!&&! %8 59 # 7: 9 :-% %&' %%8 - % 8%8& %58 < 88%8 !8 -% 8 - 8%8 % !8 8%8& %7 ! F<9%8 - :% 6-% % %& & ' '%% ?) % %&8 - '% ,8 # -: 58% '!#' '%5%& ,%%' ' 8%70 11?9 : -> - %&# -% 8%& : 5 % 8% , &#!8 8 - % %&#!8 ! #' % %& , % 5- % % 5% 8 & 8 -: 5%% 36,% 6 8# %'#8%% - % F#!8 8 - % %5%8% , 8 8%8',&5 '% !#8%%*E1E,F << 4%8 - 7F' *9 !8 3 #%58 %# 8 5% %' #8%%7F' *9 2 3 # %55% 8 3 #% 6%-% :' # % 5 '5 %'% 88 ,8 %, % %5%8 % % ! , %% %6&, - ! % % !"#" ! " %',% 6,%& !#88 ! 5% 8 8 5 % 8 , & #58 < : 6,%, ! %88 ! % %5% ! % % & 8 5- ,& 8 5 & %%, &'% % %7 ' % 9 , 8 %7 ! 88 ! 8 - ' # 97F %' 1?9%5%8- % 88%& %' % &7O6F %19 :%,%, %&' %% ' %5 %8 8 55% % 8 7< 19 :8 8 5% % % '% ,,-%T 8 ' % Q & # % & % ,,8 7< :%, ,8 ; =, 9 8 7 , 9 0 58- % ' -6 %& &, & # ' 8%7O6F %19'8 '%5 %5 & # - -% ''% ' %& - 88% 74 88 , F' ?9 ?+ $ $ , % & < %- 8 % 7% 8 # %7 9% N' '98%8 %7%8 8%8 9 4,'% % %%5,' ,% ' !#8%%, % '8%8 %%% 5 % && ' %8 - ! %7 97F' *9 * " "% % 8 , & %%-588% & 5', & 8% '& \< %,%%Q 8%,%%5 , ,& % % 8 % % 5##6% %, %%#' % &7 % & ,8 %9 > & 8, %, & %, %7@ ++9 $#,%, % &' %8 , - -% & &, %8 - :% & % %, %%'% '%% % 5-%%,'% % ,#6 -',%%74 88 , % %%9 '> - %> & %%, 5 ,&,% & :,8 # &% & % & > %#' # % 8 !#6% & % % , % & %% :% %%& &,%, '% %& % %&% &# % %%&8 8%8 , 6 &' ' %8 % %& ' %&#' 2# % , % & %%< & #6 % & ' , 6&% %% ' 8 8%8 %-% %' :- %% ' %%< , , % & ' '8 8%8 8% 8 %& ' '> - % & %, &&%& %, -'& '-, :%, %, %'% 8& % % # % 5 ,'% & %%&, 8' & 5% 8 % 5 %, %5 ,8- ' %& % % :% *1 % %&,&% ' ! , %5% 88%& 8%, %5 8 %%, '% 7< 1A, 1?9 % '5 %& 8' %% '% & 5%8- % %5 ,%8 7-+E9 88 ,, &%- 8 &, -, % %&'% % % :, , 588%%8 % &! -' 8%7]'% 11+A0 1D9'%,%- - ' 8%8 % ,- 73 95% 5 , 74- $ 11)9 0 - ,, %&% ' %% #8% & '#' % F#,8 ' % & ) % --# %' % - %% - 8 & % &5%8 #6 , % & 5- % %8 8%8 &'% %%, %' ' 74 64 611*A 0 1D9 $ % ' '! , '3 '%,%% % ,8 ' 8% % % % & $% % %6 &, %''&,' ', 6 #! % : # !8 % , 6 '' %8 % %6' '7$ 1?9 &+, "# ' - ? - %#8, %5 ! %5@&# < ,#, , &1 !55% 8 %, 8 7F F +)+9 - 5 &5 88 5% < ',%5% 8 %% %% 8@&# 4,@ % % &# ' 8, %, ' -8 % : $%, 8 @ &1S,& 7 6 +)A% - 11?9 $< % ' % %%&8 - &, ! # 6&#!8 8 - % %55%' #8%% ! %8 5 % , 6 % 8- %#8, %58&,5 &% ! '%,% 5 -% %% %& % %5 75 %% -'9 &, 8# % #8 & 8- % !%-?! 8 * $% 8 % - @&# 8 5%8% < ^ 8 88 5 %' # 88%7$--% ++9& %' & %-& !#88 ! % % &% 7!3- 19 @& # '6,% $--%88% %8 - % %5%' #8%%< 2 %' 5-< % 58 5% - !8 ' # , %% % 4, % < -%& 88% % ,, %% &- %' 8 %74 88 , % %%9 0 && 8, %,&< %,8%, %8 % %%,&! -' 8%5 8% % %,% 8% ',%, % 5 - 8 %%, '% % %,# 8 " "" " " " : 8%, % 8 %%;,% =8 ',8%% 88 % 8,& $ %, %&8!%- -% * )%5 % & %& ' 8 ',%, ,8 : &' 8 %8 %7: 97< 5 11EA5 11EA4- 1*A % 19 5- %88% #8 % %, % %8%%%% 8& % -''%7: 9 4,& % ' ' %% - - , 6 &% ',8 % ' 8 %8 % %'& 8%%, 7[ 1D9 :& %%8 , ,' 8%, % 5 ' 8% * )%, % 8% < 5 - %'%&,# 8 5 8, % , %5 %% L% > , %&, '% % % -, # 88 %, %- 8- % % ''% %% ' 85 ! , '% 5% % % 88 , 8%8 &8 &! -'% '& %, & 7< 11A, 1?9 $,% &! -' 8%88 ,# 8%-' 8 % * % % % 8 %8 % : & < % - ,,,'% %,8 % & #6% - ' 7 - +++A0 11+9 %%%,&! -' 8%5 , '5 % 8 %> '% % % &'5 7 % +))9 :%% ''% % - & 8 8%,%%,' 8- % ' %8 % %5 ' #8%-8 5 % '% % &% & 8& 8%, :, > , %, 8 > % % 8-%'@& # %%, %5 %> % % &7 %% ' %19 :%%, ,' % ' , -%, - -%5%%, %- ,% 8& % - ', % 5 %, %' %% 5 , - ,% %% %, % '%,% & % % % , , % % , %, %8% % ' % , % & '# - % 5!5 % -, % %-,'8 7 ' &, &,%'%%%9 8!% , -, % % % 8%' % 5!5 ,& %,%% -, 8& % 8!%%7: 9 0-%5 -%5%8 &%, % & %5 8 5%& 8@&# %8 '&% & % % :%% &% -& 8 %,%%5 '% ,% 8', % 88 8%,%% 28 &' % % %&, -, '&% 5% ,8 ''8 ,' ;,% =%,%% 8- % ' & 0 &% ' '& 5% &&& [ $% 3 %8 ,0< & ( %4A 4, %3 8',% && 5& % A%%, ' 4 & 2-% &8' F%%% %,8 4,@ -U_ U 088 U O,,,,45%4 * 0 6 %% !% < 6, F 88 %> ' # , ' F,8 % 88 F,%% %8 , % 88 3 %%: % F %FT 0 % 6 4-@ -X !T' UB'@ "- , ,,%& 4,%%8 , & %& % %%%,, % F % 88 5%8- # 4 , F F 5%8 " F % ' 6 4%5% %<:% 0 % 719 ,%> %& && -''&, 8 , ',% ! * "Q*\*) - 4 8- - -< - 4 719 4 %Q5', %%, ' , %88 % %' ! %> ' . *"#Q?**\?EE !3- 3 719 % -&&# 8 5% '> - % ./' * $ Q*\? '$ 719 3 ' %8 %& % &&& 8@&# 8 5% + / ( %%Q+*\+D ' 3%8!T%4' -%$" U! 71?9 :' & % 88 :%6 , Q, %% , % %8% 8 0 ( &Q?* &` % 71?9 F% %% -8 ', %'$ @ ! ( "'Q *+\D1 % 71*9 8 , % -'" 88 %U < 711+9 4:VQ 88 % *(*% "(Q? %%UU ' % 719 :, ,%&%, , 8, %, % 8% ' 8 % ./' *'")Q\* F 711)9 % & , %, 48'Q A5[ % , O485U F 6$ 71E9 %-&, 8 %,%% ' %85, 7- -Q:9# %5!% 8% ! + 1 !8 &8 Q1 1EN8% D1?E1? , @ %% 40:F 6<% % 71?9 :',& ,& % - -1 Q 8 & -' & %,%% *( "&Q+? *? % -'4 ! ' 719 2%' # % %&, 5% $Q" U : %% :&&7%9" )1? * ( ! 2 48'5[Q5[[ 88)\+* ' 711)9 4, -% ,, %Q &%%' ,% %% ! ( $QE*\E?1 6 !@ 4 %0 711)9 :#%% - & , (*/ '&Q*)\DD 3' 711?9 243Q, 8 %> ', 5 ' ' '8 ! + 'QE+\E+E 3' 7119 4 % '%&,' &% 4: *% '$Q?D1\ ?D F :F U 7+)+9 Q , %% 5 %, ' , (Q E*\+ F % 719 -8 5%&#&# Q$%' % - & &^+ ( $&QD\D*) F % '$ 71?9 2&, , % , %, .* "#'Q?\ %0, 711+9 ,% , '& 8% & # #, ' -% 0/(1( Q+++\1? -[ 4-"[2% "4 7+++9 8'5 %&,8 %& & , %' ' ,- ' 4*E '# &% & ,8 % 0/(1( - "%*Q**\D - 4- -"":% 719 K2 4:Q> %%%%, &',%%, % *% '#Q1E\1E* ]'% 4-% < U U]'% " -"%%'U 711+9 % '- &, 31(/. QD?E\D*E X' 4- 4 719 - Q 8&# + ( 1 QD\)+ $--%<% -3F [$ 7++9 8 5& 8@&# %' + ( "Q*E\D? <%F ,:4 [%,< 71E9 <3 Q58%8 -%',% 8 5%%%% '% ! + )&Q*\D <8 %%%8 719 :8 5 %8 58 ' , 1 1 &Q??\?+ <8 %% 4< ,,@'K ' 71D9 5: % -%+ 1 8 Q%& 5&8 5N',&, %%% ,% ' * %*% "%Q )EE\)+1 ** < %U 719 -' -' - &, %,% & ! #6'%, % &6 ' %& , ( "&QD\D < 0 8 : '0 6 4[ 'U 719 8 ,%&' %%, 5, %%, , ,, - % 8 5%&' % ! + 1 "(#Q3E\3) <' %%-T 4,,3 7119 ' %,,8 8 '5 -, Q88 ,8 ',% .(* (&Q*DE\*)1 < 5[%::[4,, 4%4 711E9 ',& 8 %, 8!% , )2 * "%Q))\))D 4 U%4 7119 @ Q & & '' 8%& ',% " QE)\)+ [4, <40 71?9 & %Q&& ' 8 8%8',&%%''%> % ',& % *% ,'%/) (Q+\+1 '% ,2 719 2 <5 '%Q & ' 8 " '("" !8 &8 Q1 1+N %N11+ 4 F 4- 4X' 711E9 % ' 8 ,%& %, &% 1 "&Q?E\*1 5 6"$! <46 3 88< 71?9 $ N?-%& ' , ',,8 - %%%% , ! + )'Q*D)\*E $ 4U % %3<4 % <% %4 ,!T' 71?9 a ,8 b! '',% -&,, ',%- & , -% 31(/.*QD\D? 3 5U4 44' 7+))9 : 6 &6, ,8 & D4! !''% %"Q?+\?++ %0 ,% F 4- U 7+))9 @ ' & - 6,% ! 8*)) % % + ( "&"Q*\+ 5 $ 0: ': F UF% 711E9 : ) )% , 8%, ', 1 "&Q++)\111 @%U F F < ' -'Q,, ' 8' @ U -4,F % 2 % 6 7++9 : ' % &' Q- % '- -',, %, 8 %, % ( / "'QD\E+ %$, & 4 : ' 6 :% 0 71*9 Q%%%%' > & , ',%-&,% %%' %, ',% '&Q1?\1** *D % '[ '[ 4F[ 719 $ !2Q-%%, &%' ! , ',%> ' 5 ' -8 *% '*Q?1\?) 6 7+)9 #%%, ! , ,# 8 % .* "&(Q?D\* %U<,8 !"2- % < 71D9 ,% %, %&,- , %8 & '&# ! ( 'QD+* %UO %F2 8:4& , 719 '%'% & , - %,%% ! )%$QED\)1 40 , 'U 711?9 : ,#%% * * + **+ * ) "$&&Q))\++ 4 7119 F% :\88#, ,#, ,! %& ' ', % 1,&Q+?+1 K % %%3[ ,6 U45:[6 719 :4$" %, ' %8T Q,8- 8%%'5!% % ! + )"Q*+1\*+D -$ 7+E9 .%.86> % , .8%,,8 % F .!F, 7. ,%8. > 9 ) %QD*\E) 4, 6!3%%44 < %% , " < 711D9 a :%6 , b %, ,-' ' , & + / ( %'Q1?\1 % - %U]'%%% % 711?9 2%& 8@%%, %,% & , - 8 %%% .( ( Q)\+ 4"4:,' "% , 71?9 ::%8 %%& % ! + )'Q*\*) 4-< 0 6 4 3" 71*9 #! '% ',%&& %, %&,8!% , - , %% % -%)Q1E+DD 4 64 6 711*9 '% & &, &8%8 1 (%Q?D\?) 4< !" 71*9 ' %Q$ --% 6 &, ',% 0 ( $Q?* 4<45:" U! !" 71E9 48& -% Q%' '&5%8 ! %,%% 1 **1 '*)Q1E1ED? 4,: 71*9 8 4- U$ 4 711)9 :, '&8%8 %,- - % '8%%%! % &8 .( )$Q*\? 4 5 FU5 $ - ' 711*9 ,% %,%%Q8 % #\# &% ( " Q?+\??) *E : F%:34 '844'U4 711E9 F % - & %@! % %@, '% ( (*%"Q*ED\*++ " &, %% , 719 % 0'O0 719 8 ,! - 8 ' , % (*/ (Q*)\D 0 , , @%6:% : U 71?9 :$ &, % % %%% ! + )'Q*)\*+ 0 4 ,!- "0: 4 6!"' F 3 71D9 4' ! %> '& ) - %',& # &8 ,# % 0 ( %Q+D? 0 U < 711?9 '&% , ',% Q5 %%& ' 8, 8^0/(1( '*Q*\* 0 ' 6 -, %< 3$-- 711+9 8 '!-', 8& ! )$'Q1*D\1D1 0 4 U 719 ', %%& %> %5 @ *% '*Q1\1? [ %4 4 '54 c%! c% ,40 71D9 ' 8 & ,# 8,8 31(/."(Q+?D\+*E O6UF % 719 %%, &'% % %- 8!#88 ! %' + / ( %%QD)\D)) *) % +, " #, ,! 8 '& < % ,,8 &, ', &1%-8 !','% 4 88 - %Q 4! : ' %Q4 % %8% *+ +, ' #, ,! 8 '& %@8 % ' %@! 8 &,< %8 759 D1 % +, -' , ',%&'%& 8@! &# 8 5%,8 % #,8 %& '%8% < ',%#8%%%F <- % 38 8% %%8 , ', ,8%8% + Q$% '%A ,% !! %A %@ %!D!%8%8 # %N#'%A : %A, ! %A %88 ! % %A % @!, ' ! % %A &?!# ! % D +, ) 4, % & , %,& < & %%'8 5%% %% # ,8 ,- %Q D ' %!D! 8%8 AD #%!D!8%8 AFD & %!D!8%8 AF & %!D! %8%8 A ' !!8%8 A !%8%8' A !8%8' A !8%8' A 3 8%8 8 - A3!?! %!?!8%8 A # 8%8 A4!E! %8 %!E! %8%8 A4!E! %8 %!E!8%8 A!*! %!*!8%8 A !*! %!*!8%8 A !*! %!*!%8%8 A` !*! # %!*!8%8 36,,- %Q %749!, ! N !, , ! N749! , ! %A4, % ! Q749!, ! %&%A , , ! , %A:, , ! # %&%A ,% !! %A ,% ! !? %&%A ,% !?! %A ! F<88%8 !8 8%8& %A 3 <8%8 8 - #%A <8 - 8%8 %A<@ 8! ' # % D % +, & 3#8%%&'%% & '%& 5 < 8 8%7,&%,8 %88 8F <9 , -% -%& #8%%8'%5 5 !8 4 '%% %% # A# %- -'8 - 3 , + Q ! %&%A F@8 - !&## %7W8 - % %9A 3 <8%8 8 - #%A8 ! % D +, $ 28 ! %8 &, %& < ',% 79 & @F%8',5 , % :&, %7 % 83!- R1!*Z1S, ZE1S> -'9 79#8%%7F <9 %8 ,%& < 79#8%%7F <9 %8 ,%& < 4 D? % +, % ,8%&'% % %8 %',%&< % ,,8 79 %& 8 ! %8 %7 %,, 9 -% ',%67#8%% &8'&,%9 79!,% 8 7!, , ,% % '9&',%% %& 8 ! : &, %% &, %8', ! %% , A% %%W1 1D % 88#, ',%6 % 8 %% %, ' 8% 8&, %, D* - " ,8%&, & %8 8%, ',% Q V8% A7V98% %, ',% + QF& , %A <!#' Q&## %A8 8 !#88 ! A 3 8%8 8 - A 8 # A&V! % ' Q&## %A: # - - + / . 0 . 1 - ! %@ V V V V V V %8 % V V V V V V ! %8& % V V V V V V V : 7 -'9 V 20 '% V -1 @# -: V V V V V -: 7<P VV VV F9 # % V V V - 8%8 VVVVV % 3 % % V V V V - % % V V V V V - # % V V 3 # % V V 3 #%7 : 9 V V V 6, V V V V V V 7V9 & ! 8 VV / , & V V V V V V V "! 8 : % V V V #% 8 V V V V V V V #% 8 V V V V V , ' V V V V V V V V V 8%8 % %% V V V V DD ! " #!$%& %'$ ( )!*&!%*+ , * " - &* % &- , # !&. /*.#/ * %* " - & * 0.1 ! 2 " 2 33 " % &- *"" & & & * - -$ # * *4%0! *5'$*" 6 - 7 " " " " . 89 - :*8% " "; " " /,0<;.$ , " *. 89=)!*&!% * - * " " "">&5?'$**@ " - :& A" =)! /,0 $" &" - *- * " "">&5?'$*5B* 5 & & - C$%. D C?*&?*.> %E%4 CF$" &" - C$%. ?=@/C$ 0& " & B@??0.6 0& & !%" &'$ * 5'$ '$%*" 5B'$? " + . 7 ? 4* "&& B%27 C$%. "0.6D > . - " " 0.6D & "G H * " & %" I "0& I - 0 0 + " + " " % - & "*& & " 27- ?5 + - 7 " & # & " " :D 2 %" " " > "* " - ? C$ I + > & >$ " > + " " " " * + 8 " " > " & " " & " " & * " > > *5 0E & > " " " * > " " *" " " & 0 " &" > " "$8 E & * " - " 1" " "- - *" " " " > 7 " - D- -> *@@5 * + - " /%- * 7 "" " 7 " " E & * " &" " "- 7 - 7 " - /%- * 3## > C6# ## * %$ 03 $ 0 %$ 0 " * - " " > - > " " " " 5%" % 3 0/ ..$ 0 " &" " - & %5B>J2 * - & & " "&" KCL - - " =?>J2 - " " > @>J2 *" ## + 5>J2 - * " " " - * " % " " - - " 7 " " " & * " & %55>J2 - " " = ( " " " D- ->@@5 "& 7 E & > " >" " & , & - KCL ? .& I " 322 + 7 2 , " 7 * 0 %$ 0<$8<, #- < - " ? , <$ 0 =? 5 - " " 0#<#- <8 " " " > M ?@ #" " - <0.#<# " " @ " " # " " <8 8 " " " %5@ ## > C6#<#" " - <$8C#< C6# M 5 8 5 ? " & 5? 8 <:06 %. <:06< %55 %$ 03 $ 0 %$ 0< %. <5 %5% 0/ M $ %5%" %$ 0 %= ? %$ 0 5 %5%$ %5%" %$ 0 ..$ 5 0 %$ 0<C % B= %$ 0 & 0#< <$ 0 06#<8 " " " 06# < %$ 0 %@ ! "0#<:06<$8<C6#< < , <8 :06 <06#< 8 " " " <0.#<C#<C < , %5B ?= " " " & - :<2<% & " " *"" E & " - " - " 3 7 & %=<2%4 " " % & " - <=?>J2 . " 7 0 3* " & " &" " <2%5>J2 "G - % H " " (% :<% & *"" ":06 & & :< & " E & * - & - / & * @ # "&& " 3 7 " & " - - " $ %$&% '& $ %&% '& $" () *+ ,+ =? ?5 % %BB #- " * " & 7 " "* % % - N 5) & " E. =. &" " "- /%- * D *(/$8* " > 7 " $ -%/ *" - ) %&% /%- * " " " " " *- " "- "&" * - (/$8 & " "- " $ - DE * *- " & " B; - ,& B * " ; " - " % & *"" " D *(/$8 " % * & " % & " " *F * 0 - " $" - - & -& " * 3- " " > <@>J2 -- > %55>J2 * ## > C6# <5 >J2 -## %5?>J2 " - " & %?B>J2 & " " E %5B>J2 & * & ## > , * " " 7 E " 7 & " *"" " 7 & %$ 0 - * " - - " " " " D- -> "8 " " - & *" " " * " & " * ? " 2 - C " >*@= " 7 - * " " " & +- + , " " 38 3* " 2 - OP 2" $??8@: C 7 " *@=5 *"" " * & " % $=85=:= .E * .# E " 2 - ) $ $ $ * . # $8B < # $8 < 0 # $8 C & & $8 / $??8@: %5@B # # $58 % # " & $8 % /%- 0*: *. ( 0- " " &"+ - -.35BP5 / & *" *C 7Q 7J.*.S 4 / " * - " & " ( * - % - > -/35P 5 06*#U*# 7>D*$ 65 : &" " 3 ! ".3?(P?( , " 70*: */%- 0*. ( I %% " " " # $ 0136??P6??B C " >C@= / . & : U >3: U >*:U C 7(* " C@=5 " " & " "#23@P5 D- ->(:*E > -:*, UD@@5 0 " " "$8 $ ! 233B?P .E J/* $ $ & " % # $ 143@P?B !*/ (0* :*" > 0$*(V#*C "* . " "& & & ' ! 43 ? ,J*6 > 8*6 ! &,*$-&"$. . & " ' ! #35 ? )) 5 E & $! 3C * " - > & $" >. () : &- & ". E & F :B> !& & & &* :B * " " E 6E ? )) 5#0 - & % & & " E * " & * " G& H& " & ?5 )) 5..& - & ,#E.- (/$8 " > "% & - & & - " "" * " " $!! 3D * " & F.$* %$%$ 0" F(/$8* %*%" " 2 & F0$!*0# F.* %$ 0 F#* %$ 0 " F0/*$8% " & %$ 0 " F06*% " %$ 0 " ? )) 50#" & & 5%" % E * "" & " $!! 3."* %$% $ 0" F. * %$ 02 % " %$ 02 %$ 0..$ F. * %$ 0$%$$ 0 F. "* %$%$ 0" ?B )) $ & 6)+ ) 7 $ 5$ 8 9+), ) . & ??0 0/B D F F L0 ==B': ?B' 5%=% . & ??/ 0/ D F F L0 ==B': ?B' 5%=% . & ??$ 0/ D F F L0 ==B': ?B' 5%=% . & ??6 ? D F F, - ?55': B5' 5%?% 6 . & ?? 5 D F F, - ?55': B5' 5%?% 6 . & ??, 5 D F F, - ?55': B5' 5%?% 6 . & 50 5 D F F, - ?55': B5' 5%?% !#, . & 5/ 55 D F F, - ?55': B5' 5%?% !#, . & 5$ D F F, - ?55': B5' 5%?%@ !#, . & =0 . D F F$- ?5@': =B==' %%= !,U . & =/ .? D F F$- ?5@': =B==' %%= !,U . & =$ /U? D F F$- ?5@': =B==' %% !,U . & =6 /U D F F L0 ==B': ?B' %%5 W: . & = /U D F F L0 ==B': ?B' %%5 W: . & =, /U5 D F F L0 ==B': ?B' %%5 W: . & =C /U= D F F$- ?5@': =B==' %% W:E . & = /U@ D F F$- ?5@': =B==' %% W:E . & ?50 /X5 / 7 *$ *," / " =5B': ==B'1 B%?%B ,. . & ?5/ /X / 7 *$ *," / " =5B': ==B'1 B%?%B ,. . & ?5$ /XB / 7 *$ *," / " =5B': ==B'1 B%?%B ,. . & ?56 /XB? / 7 *$ *," / " =5B': ==B'1 B%?%B C . & ?5 /X= / 7 *$ *," / " =5B': ==B'1 B%?%B C . & ?5, /X= / 7 *$ *," / " =5B': ==B'1 B%?%B C . & =0 /XB / 7 *$ *," / " =5=5': ==B='1 B%%= ,1 . & =/ /X / 7 *$ *," / " =5=5': ==B='1 B%?% ,1 . & =$ /X5 / 7 *$ *," / " =5=5': ==B='1 B%?%5 ,1 . & =6 /X5 / 7 *$ *," / " =5=5': ==B='1 B%?%5 $ . & = /XB / 7 *$ *," / " =5=5': ==B='1 B%?%5 $ . & =, /X / 7 *$ *," / " =5=5': ==B='1 B%?%5 $ . & =C /X@? / 7 *$ *," / " =5B': ==B'1 B%?%? ./ . & = /X@= / 7 *$ *," / " =5B': ==B'1 B%?%? ./ . & =D /X@@ / 7 *$ *," / " =5B': ==B'1 B%?%? ./ . & 5?5/ 6E? 6 >*:-Y/* " BB@=': B??=' %=% 6E . & 5?5$ 6E 6 >*:-Y/* " " BB@5': BB?@?' %=%= 6E B: 055 D F F L0 ==B': ?B' 5%=% B8 055 D F F L0 ==B': ?B' 5%=% B# 0555 D F F L0 ==B': ?B' 5%=% BE D F F, - ?55': B5' 5%%= 6 B! D F F, - ?55': B5' 5%%= 6 B. D F F, - ?55': B5' 5%%= 6 )) #7E 7 " "M. # " # * W( " " W# E/ " "& 6,: * ( - " " ( %*B%" " (/$8 5@ $ -%/ 2 ( - 0# 0$! 55= ( - %$ 0 " $8% " & %$ 0 " 0/ 5@ 5% % . %$ 0 . 0BWUB@ M 5% % # %$ 0 " # I=4(C M 5% 2% % %$ 0 " 06 " 6 2%" % %$ 0 " 06 ?= )) .7! $ &% & > ! 0 " &# # , 0 " 8& " " 3#0 8#0 , 0B " 8 & " 3< 8 , 0 " . 3< . , 0? " , 3< , , 0 " : 3< : , 0 " 8 3, 0 8,0 , 0 " 3< , 05 " . .$ , * 0 " 0 3$ 0$ , 0B " 0 0 3< 00 , 0= " # # ## , 0B " # %0 %$ 7 0 #0 , 0? " #" # # ### , 0B " C "" " W > C W , 0B5 " # D "& 0 0 #" , 0B " *5%6" 7 6/% , 0B? " , " , 9 , 0 " ("7 % . $. $ , 0= " C C , 0 " C %# % C# 3$ , 05 " 0 0 %# %8& 0#$ 0?B " C 2( # C(# , 0? " !%(" (" , 0?= " $" W > !/% , 0= " C 3< C # , 0 " %E %5%6 & E & , 0 " $ %.&<3<$ . $ %$<3<$ $ . , 0 " 0#306#0 000 , 05 " $%6 W > 6 , 0 " ! # ! # , 0B " / 2$ 2$" /$$ , 0? " # % 8 & #82#( , 0 " 3 , 0 " : 3 : , 05 " 6 20 0 3$ :< < 600$ , 0 " % %$ , ?@ 0B " 0 C 3$ 0C$ , 0 " /" $"0 0 3$ !D4$ , 0? " C 3:< , 05@ " : 3$ %:$ , 0 " : 20 :0 : 3$ %:$ , 0 " $ - : $: , 0 " 20 0 0 # 000# , 0 " / 7 3 / , 0? " 6- 0 3:< 60 , 0B " C W > CW# , 0B " 0#% # (0#% , 0 " $% W > $6$ , 0 " # " # , 0? " 8 & 8# , 0= " %0 7 %& 0& , 0? " . 3:< . , 0? " , %/ ,/ , 0?5 " " $", 0 W > 0 , 0= " , 0=? " # > ( - #%(, , 0== 4 W > 4W $, , 0@B " .: 0 0 :00 , 0@ " 0 W > 0 , 0 " . W > . $ , , WD 0 " % W > # W# , 0 " # $ - $ 0$ 0 , 0 " # - 0 0 # #00# , 50 " $ " W > %$W , 50 " $ " W > %$W , 505 " # 0 0 W > #00 , 50 " " 0 0 W > 00 , 50B " # 28 2:> W > # , 50 " # 28 2#" " W > #8# , 50 " I 0 W > I0 , 50 50? 505 " 4 /W > / , 50 50? " W > , 50 50 " "W > " , . 50*50 50= 50@ " 50 " /"D /D , . 50*50= 50 50 " . " W > .W , 505 50 50B " / W > / .:U , = 50 " # - " W > "1 , 50? " [\% " " $ , 50 50 50= " I I , 50@ " . " # . %# , 505 " "# "%# , 505 " $ # /%# , 5055 " . " " .0 , 505 " "9UX , 0 " #C %C C , 0 " #, %. , , 05 " #! %:*:L%6 " % %& ! , 0 " #C C , 0B " #C C , 0 " #. %, % . , 0? " #!%0 !%0 , / " : ( :( W > # #$ , $ " , 0 C ,0 , $ " $ 8%0 $0 , @0B " # - 0& 0&1 , @0= " # W > # #W# , @05 " :2: :: , @0= " " , 0, , = )) 0C C " & & > ( & * " * " " !#:7]* @@? *- 0 D:6$ " ! '+ ( ++ 7 $ * .!% " *? $" F " " :$^=5 $ 6.= #" " " 1 & * $" F$" :$^5=B $+ $C.$$ " :4&" * $" F " " ,8C%,8C? @ $ + 6.=@? " :E *5 $" F " " :X^E/=@=%:X^E/=@=? $ *! .J5 " ! *B $" F$" !0#%!0#@ "" !/=!6 $" " " ! * " " :X^J@%:X^J? ""# $" " " ._ *? " " 0//X%0//X?@ 0" $" " " * " " !,$W%!,$W? $ " .D * C $/J%$/J ! 0$$B= " 9I @ $ :X^CC@B%:X^CC@B ! (055 " ( " *J *? ! & :$^? # " ! * " " $#55 , ! " . *? $ $#B5 , * / " . " * ! & 0JC$%0JC$ * 0$$ #" " " 60/ *5 $" F " " 0JW B@5B " .@ #" " " :4&" *? $" F " " ,#E%,#E :X^0C/C% #% #" " " E *= $" F " " :X^0C/C ' ,X6(=? " 6- * " " J848%J848@ - ! #" " " $" *5 $" F " " :$^=?=@ - ! $" " " $" F " $#= - " ! 6.? $" " " E * " " J8.!%J8.!5 6.@? #" " " 6/ * $" F$" D.C& BBB= 6.B? $" " " 1 *@ " " 0%0 @=? #" " " $" F$" D.C& BBB / " " . " :$^@?? $#?5=D.C& " / * . " B?BB@ " 6. $" " " / * " " 0/9%0/95 ! 0.!%$ " .CE 7" *5 . " :X^E/==@@B%:X^E/==@@ # ! :%5 $" " " J1 * $" F " " 008,%008,5 # 0$$@?? $" " " E 7 * $" F$" :$^?= #> $" #" " " 1 > * $" ( " % * 0U5=/ " / " *? " " $#5= 05! " C * $" F$" 0,D ! 6.==B " :E *5 $" F$" 0W6C%0W6C5? ?%= " X"& * $" F$" /0,E ! .@% " ! ` * $" F " " $#B@5 " 6.??5? $" " " :4&" * " " ,(%,(? . * !0!B $" " " :4&" * " " ,8UU%,8UU? . * ! 6. :$^@@( + F $" " " 4>" - *B $" F " " ?=? C$0^5B :X^0,14% . B= #" " " ! * $" F$" :X^0,14 . 6.@= #" " " ! * $" F$" $#5B . ! =5 #" " " 6/ * $" F$" D.C& B?=5B@ . !6 $" " " :4&" * $" F " " ,.16%,.16= . " $" " " 1> * " " JX0%JX0= . *6.5B $" " " " " J0C# . " $" " " E V *B " " 0#55 . (0X #" " " ! * $" F$" 0,1%0,1 . ! 0$$?B== #" " " ! * $" F " " 0C,6%0C,6= . ! @? #" " " ! * $" F$" :X^J55%:X^J5? . 6.BB $" " " ! * " " :X^JB5=%:X^JB5= /0" E$$ " ! *B $" F1 7" & $#B = 1 0- 0.0,, " 8" *B 9 " :$^??B 5= 1 C/B " " * 9 " :$^?B ( *F: ( "& $ 3 "" - - :$^= *? " 7 " # * 3 - - !4J1 " 7 " Ea& * 3 * ! - - .0(/ " # * 3 ,!WU 4 > 0 E" *? 3 "*- - 0#@? C5 2 1 > *FE 32 " D.C& 55B5@ " * & " 3 0 0 - *B $6$ - - - *BF# 3 - - $0/ * 3 - #"B ( *= 0,8$ - 6 > * 3 - - J(00 1 3. 3 - . 3 C " * 0,X/ - 3W :>& * 0#@?= . V )) 2 E & $ * * " & - " - > & C & " $" >. ;' 5, !21 ++ 9++)7 5+ %<& !7+ ) ++ 8;8 %')& %=)& ,5 50 C?@== !#, =? = B@ = @5= = 5/ C?@=@ !#, ?B? @ B5 B 5@@? @5B 5 5$ C?@@ !#, 5 B@@ @5? 5 =0 C?@@ !,U 5@ 5B B5B BB 55@5 @5? =@ 5555 =/ C?@@B !,U 5 B5B 5= @5= ?B =$ C?@@ !,U 5 5 B5B 5B @5= ?B =6 C? W: @@ 5 @?= 5 @@ 5 = C? W: ?@ 55 @? ? 5 @@ ? ? =, C? W: ?? 5 @? ? 5= @@ ? ? =C C?B W:E 5 B5B5 B5 @5@5 5= = C? W:E @ B5 B @5@5 5 ?50 C ,. @5 B B? B@ 55 @5B 5B 5?B ?5/ C ,. ?@ @ B B@ = @5= 5B 5?B ?5$ C ,. == B B B@ 55 @5B 5B 5?B ?56 C5 C ? ?B B 5? 5@B@ @5 5B @ ?5 C C ?5 B B 5? 5@B @? 5 ?5, CB C ?? B? 5B 5=?B @5B 5 =0 C5B ,1 5= 5B B5 B 5B @@? 5 =/ C5 ,1 B 5?? B5 5= 5B5 @5? B@ B =$ C5? ,1 B B B5 55 5@ @@ 5 =6 C5= $ B= 55 B5?5 B= 55= @5@ 5 = C5@ $ B 55B B5= 5 55 @5@ 5 =, C $ BB= 55 B5? 55B 55B @5@ 5 =C C ./ B 5== BB 5?B 5=5 @5 =? = C ./ ?5 5@ B 5= 5? @5 =? =D C? ./ ? 5@5 BB 5= 5?5 @5 =? 5?5/ C?=5? 6E B B B=? 5? B= @ B 5?5$ C?=5@ 6E B? = B=@ 5B @@ @ B ??0 C?=@ @B 5@ BBB ? 5@= @ B@ ??/ C?=@= B5 5@ BB= = 5@? @ B B ??$ C?@?= @5 5@ BBB 5@B5 @ B B ??6 C?@= 6 B?@ 5= B5B 5?B @ 5 ?? C?@=5 6 5? B5 ? 55@ @ =? ??, C?@= 6 5= B5B@ 5 @ =? )) -$ ) 7 !7+ $ 5$ 8 9+), ) ! B D F F$- ?5@': =B==' %% !5 D F F$- ?5@': =B==' %% ! D F F$- ?5@': =B==' %%? ! D F F$- ?5@': =B==' %% !5 D F F$- ?5@': =B==' %% =? == !" # $ # %&' () # * ') " # !" # $ # ( # # ) # ) +,-# # . / 0" , / ) # + 01, , , # # ) / , +# , ) // / 0 #/ ) # - #/, #/) 2 # + +,# / ) #0 3/ # ,, # + +, + ) 0 !4 # # / , # #, ) +,, #01,,, , , ) , 5# # 6 ,) #/ / , , , # , ) , ) /# ,) 01, / # , + + # / +, , + , / , #/ , # # 7 # " 801, , 3 # ## 9 ,,, ,/ , ) # , / :0 , , (,, + ) , # # # / ) # 0 / , ) ,) +,/ # # , , , , / ; ) <0 ,) #/ , # # ,=> + / #/ +, # , # , , , ?0 , # # # , # # / / # , 01, / // , , #/ # ) , ,0 ,@/ + ,# + / / # // # # ,0 9 # # # # / , #0(# , # , #, / # # # 9 + +,/ 3, #/ 01, ) ) #9 7, 3 5 / /68 #/ # +,/ # / , / 0 , ) ) # # / 3 0 @ / , , , # 0@ # # 5/ ; 65 + #6 / , # 07* , / #4 ! +,5/ ; 65/ 6 5# 6, < / ) 08A + /, / 2 , #/) # , +,,+ + 2 , # ,, + # 2 # / , , 0B,,) , , # / , / , , , , ) # 2 ) # #/ ) # /, # , C0 , , /, ) # # # /, 5 / /6, #/# , + ) 0 *# + / / , / / , 3 71 * // # 1 801, ) , / # ) 3 # /, + 3 , / # #01, ) # # , / # /, # /, , ) / , # ) 7 ) +=:C<80 * # / / # /, / # ,, 3/ # 01, *# #/ ; # +3 ) # , ,) # 01, # + / # + # + (/ / ,,# /, ) ?0%# , , ) # # +,, +, /, 3 ;$##/ # 7* , 0 # 80D + ) # , 3/ 01, / / , # # # ,) , # 7" 8 # 7( # 80 % , ,, # , + / +,, / , , # # # ) +,( # ,) / +, + , 0 (# , # , +# # #/ , ! ,, ! # # # +, #/ #, + / 0B, , , # C, / # , #9 , , ; , # # ) /# , # + # , , # # C, +, , , ) 0 1, , # # C, # /,/ #, ) # , # , ?01, # , # , , / ,) , # # # , , / ) / + , # 0% #, # 7($18, ) , ; 7D$18 # 3 / ) 4C0% , ,, ) # 2 , ,, ) 3 ) , # / / + / 0@ , # ,($1, # ,D$1 # , / , , , / #/ ,/# :0 D + ) # , D$1 +,,# / / , # ) , ) #/ D$1 ) 0 , , # D$1 #/ / 0E #/ <*&%/ # + , % , # ! 0 ,, , , , / ) 2 #/ / 3 ) /, 0 !"! 1, ,# / ) /# # /, , , ) /# / , , / # ) #0*# + , ) /# # , , # /, # 3 / 0E #/ , " # #< /0?,) ) # /, +, , # # ) , ,, , # +0*/ # /, / , ) /# ! ,) # 0% /, /# / / , , " ! , ) 3 +,,, #+,,, , + 0 1, # , , , , ) ) , # ; # , / +, ; #/ # / , / ,, # # !0 1, / # C+, , ,# C# # , # , , , , #0E #/ , # ! +, ,$ # /, #/ , 0 , / +, 7 8 ,/ # +,0D + ) +, , /3 #/ #, + + , # /, , ; 7 8, , # / 40 / # / 0 # / ) / 0 2 +, # / / 0F / / 32 #3 # ; # / ,, / / , / / # # 0 # # # # , +, , # # , # , , # , #/ , , # # 0" +, , / G 1, #/# , / # 7E 80* ) #/ ,) ) ) / , , 0* # / , ), / #, # ,# , # 0 +,,,) + , # ,) # , / , , / :0 /,7# 3 8 , ,, # / !: / ) , , 0 # ) # ,) , / # ) /, /, 0 , # , 7 + , # 8/ %1 # +,, 3/ 0 # / , , # // +,, # +,, , , # , 0 % #, , ## # , ) / # = +, , ) # , # +, , / , , G ,) / 5 6 , # # ) # 01, / !, # % ,, #/, 0D + ) % ) ) / +, / + ) , , #, H ## / <0 $ +/ 9 +/ ,, 0 , # ,, / / /, # ; ?, / , +,/ # / 01, // # ,2 ) # #/ ,# / # # 2 # , +/ # +,, # # 7 " 80 , ) # 3 ) 3) // , ) / / # # # / # ,# ,) , # ,, / / # 01,# , ## ,2 / # ) 0% # + / / , ) ) / , =% & # +, ,+ /, , # ) # +,, # + !01 + , / # ) / 3/ # , , , , 3 ) + # # , " , + ,, ,) , / ) / # # :40% , / // , )/ , + 3 +,, # +,, , ) , $ #C ! ! 40 () / + 9 , ,# , , # # +, / # / # / 0 / # / 3/ #+,, , / ) #,) ) , + , , 0 + + / , , / # :0 " , /, ) , A ,// // 9 + / 3/ # # /, =5 # / #, + # # , + ,# +,, # ) 06:1, / / , ) +# / , + + 0D + # / 2 +, + / , 2 0 %& '() * + " , 1, ,/ , ,5, ,, 3 )) 6 + / # / / # 0D + ) , , # I G 1 ,,/ , # ,+ ,) # ) # / / ) # +, ,, / # / +, # / , 0E #/ ,,) 5, / 6 # : , # # , 5# 6 ) # ::: 0$) ,/ + 2 # / , # /, / / #/ + , # 0D + ) ,,3, ,/ # , # # / // ,2 0E #/ + # , / +,,&+,/# / # + / # / # :<:?J 3 # ## #/ ,) # / / # 75 #68+,, , ) # / !< # / ::!0 -(.. . " , *# , ; +, , ) +, , # / ) / , , # # 0E #/ // )#" , /, , 01, / , #+ #, / # , +, , / 7 , ,/ /, ' 8 / # 3 J 3 ,) # , / 40$) , ,, , , # #5 6# # G ) / # # + , + G1, ) , ) , , /01, 5 6) , / , ,, , ,# # , # # , , # , + # / , , H +, 7 " 80D + ) , ,# ## ## , ) # , # ) / , / +,, ,, ,) ) ) / , ##/ , 5/ , ) # , / 6 , ) / # / 0 /( " . , + 3 ,) # # =,#/ , 3/ 5 6 # , ) / ## ,/G1, ) / / , # 2 / # 0 , /, #%/ #/ , # + # / # +, / : / ,)# / # ) #/ 0, , # // < +,# # , / ,, # 3, / # / 0 !? + +, , , /, # #/ , 2 # # 0"#// / # , + # + ,2 0 0() . , 3, # ,,) , # + , # +, /, 3 ;7, /,8 / # # #, 3# 01, /, # ) # /, ) ) # <0* ) # # ,) 2 , + ) / ) 3/ , , , # ?0%# , / , /,# ,) + /, 7* , 0/ /08 # , #0 #/) # # # ,# / , + , +,, , ,,) // 0 *# + / + / , / + 0@; + /, , / , / +, , +, ) # ) 0 ,# + # 3 # , / ) # # , +, , /, 0% , , , ) /# ,) # , , # / # ,+ # , # ,) ) ) 0 1, ## , # / # / # , , H+ // , ; , + + 0 . B ," * // >; ,*) % , @ ) KL 0"* , * , $ " E , ,$"E 0 ! 01 # # # C% + + # / , C@# )# +, , , # /, # / , , , 0 C& / ) # , ) , , , ) , , I 0 C* # 3 # 7 ) 8 / ) ) #/ / , / +, 5# 6 # 5# #60 C@ , # , # 5# 6+, #/ ,/?:0 C1, ## # # +,/ , , 0 ) #5 6 #/, # #5# 65# 60 C@ # 5# 6 , , # , ) # , # 7 5 # 6, ,5 # 68?!40 C%, # # ) ? 01, 5 6) , , / ,, , , 0 C1, ) # , # 0 C%, # # ??J 2 , 5, 60 C, / / # , ,) / ) 00 ?0$ # + / 0 !! 01 , ) # # ## #/ , + +, , # # ) 0D + ) ) 3 / ,2 #, / # , 7&8 ,; 7E*D8 , ) H # , / # ) 3# #/ , ; ) + , 3 ) 0 ! "# 1, / # 7 8 + 3 # , + # 0 # , , +9 , + #/ , ## 0 # # 2 # 5 6 /, 3, # # ) # , # / # ## 0 / #&%&% 3 ; / +,/ 0$ # ) # / /,+ + ) / ) 3 +# / 00 :0 $% & ' # # # ) , , 0% # 'N3%+ ) # 2 , / ? 0$ # # +3 # + # , + ,, # /, /, , ; ?<01, , + ) ) /# /, , , # +3 # 3 ,; + 3 #3/ # # / / # , +,, #, # 0% ) 5 # 6/ # / # # 0E #/ , ) (+ ,) # & # / ) 3/ , / # , ) + & 2 ?40 44 ( 0* #/ / 3/ # 0& 3/ , 3, ; #/ + , #, # * // # 1 0 ( %# ; =1 ) /0E*D 1( ! %# ; = 1, 5#6# +, +,# / # +,* <4 @/, =D ; , , " ! , # , # , 3,/ @/, = " # # + 0 # / # +,, / / , + < *%&=*# / " / , # , , # ,/ # , ) < *%&=% ) " / , $ # / , , < *%&=&,; # # ) ) # / <: %, / = /, 75, 68/ , / # +, # ) ! ()= / # &! " !/ ) , , +,)# , < 4 ) 0 / # , , + ## 0& = : << 4 1 0 $ *0E0*//K0O1 %00%# ) + =B ,) ) ) 0-. **+, C :7480 0 $ *0E0" ,100$0O> P3& 0( 3() 3 ) = ) /# # ) /# / ) 0+ ./ -,<C<74 80 0 (; +R0@0$ 00 0B0 0OS) K0"0%# ,) , # # 0" ..*,!C!!7480 :0 */ %0A @0O> &0') , , ) # , / , # # 0+ .% /,?!C!47480 0 A;>0%0@) 0& .% --,:C:?7480 <0 " 0K0( ) , ( 0 !0*, C?74 80 ?0 *>0@, # 00 *1, C?:7! 0 N D0*0 " #/ # 0*%$**,:74480 !0 >0B0 " #/ # + 3 ) 0" *0/, C 74480 40 >0B0>, 0K0$0A %0D0OA;>0%0(#, # ) +,# # 0 + & " 2*, <:C <!7480 0 D 0 % ) , 0 * 1,:< C:?474:80 0 % *00 1, +,, ) +, #/, , # / 00$ % 0 , !!C: 744 80 0 % *00 1, ) 00$ % 0/,:!C :7480 :0 $&0K0* &0B0O 0%0( / , # ,/+,/ # 0 % +, < C 0 & &0 1 7 0ATD0 D0OR#%08:!C: < 7*/ " D 4480 <0 +(000O 0( # +,/ 0 ." * *" .-0, ?0 ( #R00 / # ; @3 / # # = ) # , 3 ) 0'"%$00, C: 7480 0 0*0 * / ) ) " # , 3+ # 7A # 80$ % ,4C 74480 !0 E 30 %# + +#/ ) , 0 + & " 2, !C <74 80 40 A 0K0O # K0 0D ; ) 0+ ./ /,<4 C< 74480 0 % K0@0$ ) # 0& .% -.,??C 4 ! 744!80 0 % #0 / /# 0 /*1,&!74 80 0 #/ K0 1, , = / / ) # 0 $ $ /, C !74:80 :0 A 0 ( # 0+ 0 1,:?C: 74 80 0 * 10 ) # # ) , , / , # 0'"%$0*,44C4!74:80 <0 > "0*0OA 0K0*# ) , # " # #00$ % 0,!C 44744:80 ?0 A ) 01, C #= ) ## #+,/ # 2 G+ 0* , C7!80 0 % &0%0 % / # ) /# , ) ) # 0$, 444 7480 !0 N0#+D0,;+0O*,; N0 # /, # # #0" .2+, !C !744 80 40 * # 0&0 &0K0A &0O K01, K 33D , # ! 0+ ., C 7480 0 F # $0%0" # / #/ 0" 02, ?C?!7!< 80 0 A 0> "0B0A0F, F0*0OD 0F / / /, / 3 , 2 2 # 03$%"% ( .2., C<474480 0 *, ;E0OD 0 = , 0 * 0, !C :<74 80 :0 E *00O$T;D03 0$ 7 0E 9,#08 ,<C!!7*/ " D 44!80 0 E , 10OE "0K01, 3 ) 0$ 0 -,4C 7!!80 <0 0 > 3 # )) / % ! =/ , / ; # 0' ' +.,4C <744 80 ?0 * )&0* 0 >0A0O 0 4 0 /0 )0=1, # # , ; /, # )0+ / / / # +- /, .0("5+$*, ! < 74 80 0 @B0 , ) #, "R ; 0' 0 " $% - ,: C: 7480 !0 K 10K0OK A0B0$ +,& # 00" 4: +, C : 744:80 :40 D #(0E0N0O %0B0, # / 3 # #0" .10,!:C!74:80 :0 ,K0@0 %0D00O 0K0*0 $ ,) G0$ % -., C ?74<80 :0 A ,%01, / /, 0&0/2,: C 7!!80 : 0 " ,K00" A0&0E# 0%0O" + *0*01, *""# 0 + 12.,??C4744480 ::0 E *00E 2 ) # / ) , # /, 0 $ 0 1*, C:7480 : 0 @B0,) *0R.UW0" ,K00O( #R00 ) / ,/ + 3 / # + #03 % .,7480 :<0 ;3$0 ') + # / , , 2 0'"%$0-,?4 C?4?7480 :?0 E D001 3A A0%0OF ,K00 + / /, , / + 03 % +, !74<80 :0 0 3 # , % @ ) ,, ) , 3 ) / 03 % +,<:!74<80 :!0 >#3 ;$0 # ## , / # 0" .1*,<4? C<4? 74 80 40 B 3 T 0 1, #/ # 2 , # = ,,, . , 0'"%$01,<C??744!80 0 " *0&0O1, A0&0D , , # # =1 // , , # 0(5"*., 44<74 80 0 0%0O* 0"01, D # /=D / D +G(5"*., 44 74 80 0 $T;D03 0OE *00$ 7 0E 9,#08 , C<47*/ " D 44!80 :0 * 0"0 %00& 0O* # )0D0+ / #/ # # # 0 + & " 2+,<!4C<! 74480 0 1 00$0 , ) , &!" ! / #, # +,, / +/ / # / # 0 - , 4 C :7480 <0 0" 0O> 0*# ) # # =, , , # , 0+ .% -,? C?:474480 ?0 A 0 K00O 0 ) ) ) # # 3 ;# , , ; 0 5 % 0,<C< 7480 4 0 & 0 - 1, ; ,# . # # ) , # 6 0& $ % + ,4:C4744<80 !0 *, ;E0 > , = # , # 0'"%$0*,< :C<::74:80 <40 * ) *0 * , / 3## # 0 + & " ,( 4!C( 4 ?74 80 <0 *0* , 00" #K0E0*,+ 0O ,10X 3Y3 =, # + /0 #> F ,+, 3 # 0 -0,?: C? 74:80 <0 %#*0%0 + # / /, / 0+ 0 ,!C474 80 < 0 $0*/*0*, A03D0R E0O& $0 ) ) # $ 7 /, 8, # 3 R # 0 + & " /+, C?744480 <:0 " ,K00( #R00 A0>0 )0&0O" 0K0 ; # # 0'"%$0 -,! C!<47480 < 0 A 00 " , )# #3, / # / , # ) # 0("5+$*, ?!?<74 80 <<0 *,#%0300( , # 7" /, 800* 3 / = % % #/ # # / , , / 00 ./,C 744 80 <0 " ,K00$ *010O" + *0*0% 3 # * ,,# / + = 3 / /,,0$ % 744!80 =40I90:<3!4044!044? 0 ?40 D#(0 () # " ) , # & / 0+ 0.1, :C 74<80 ?0 %0(0 07 ') 4480 ?0 B (0@0 07" / D)') !?80 ? 0 0D0 ' , #0 " . +, C :74480 ?:0 K0@0 / / ) , 3 # 7 / # # 800 , . , ? C ?<7! 80 ? 0 & (0OF 3& 0! 0 74 80 4< ?<0 F ,K00 $ ) 3 , #0" . ,4C74480 ??0 " ,100$0OE 30K0 #, + 06!1, C!47480 ?0 * 0"0 # #+, =B /# 0"1,?C 7!!80 ?!0 ( K0B, , ## # # G%+, # #G% / 00 *$ 74 80 40 > K0O%010.@# + . #3% + 0" 0, 74480 0 1, #/ %0B0 ' ## +, 3 0" ..+, : 0 * %010 # =%# #00 ,.1,::?C: 7!?80 0 & , %0F0 > ;/ #/ / , # , #0 + & " 2,<< C<<74 80 :0 @, #0 % #D/ @ # / , # 3 / 0 + & " ,4:C4 474 80 0 AT, 10 ,0*, ,&0D0O" %0D,3 ) # # ) #/# , + 3 ,, # 7+ //080& $ % +*,: 4? ! " ! # $ % & '( )*+ , - . " %/ 0 12 345 4674 7677 8678 592: ;67 ; <( 6=/ 2!( !( / : : 2 ! > - 4(!7?4 ; 0 1& " ! < !( 9 @ 0#A 592: $1 ,))' 0;671 )B A "-+ 024(1 24( 24( + 767 !( 9 = = 6=/ , 592: 9 "- > !( 04671 592: 9 !( &-- 0()1 ()" 592: 9 !( 0= 1 6=/ "" 9 , "< 9 , !" !( 9 "% # " 4 %4 467 !( 9 5 592: !( 592: 7 467 5 "& % 8 % 6 % > % ! % 9 4 8 " 5 % 6 % % 8 = $ !( 9 "-, "' 9 , & 9 8 % C 4 592: 9 0 !( = 1 4 9 0;671 --D ") & 9 C " : % <( ! % "B " " & <( ! "+ " " 2 " < % 8 ' 9 , % 9 , ( 9 , % = 0467 592: 9 767 = ",%- 7 1 4 0 4/71 % # $ %"%% 6 6=/ 9 592: 07671 !( %& = 6=/ 9 592: 6 0# $1 %' 04671 592: 9 4 !( %) "- 0+,( 1%B 07 1 %+ 2 %, 6=/ 9 !( &-& 04671 592: 9 6 !( EF!"' 0= 1 = &"*&& 592: 9 !F 07671 !( &' 0= 1 G &) 7 !( 9 G <( 7 4 &B 0;671 & 9 = 4 " ! " ( ' # <( ! # $ 2 +B'&+ ' # 4 ; 45!( 9 ; &, % 9 ( "6 ) 4 !( 2 7 <(45 '- &,''" ) ) <(9 !( '% ; * !( 9 '& ( 6 !( 9 '' # = " 6 " 6 " = 5 2 " 9 2 ( 2 # $ # $0 1 8 <( 5 # $ ') + 07671'B " 9 8 9 ) 9 , 4 , 9 , 2H4(A+ 592: 9 > !( = H H4(A+0;671 --D ") -692: I>4 : " 5 % ( % = " 9 % / % 9 " 4 " = " = %= # # # 9 ! # 0 1 "" 07 1 '+ # !( 9 ', 9 , ) % 4 " ( 0> 1 > " 592: ! ! 0;671 ) 07671 )- ! <( 6 ! ) 04671 !( 6=/ <(! !( )" ;67467 C 867 )% 9 5 <(! !( )& " 5 " / " 5 0> 1 -24/ 2 " % 6 % !( ! )')) !( 9 )B " 7 + 6 !( 6 )+ "% ), + 6 !( 7 # + ' $ ), " 7 !( 9 B- " 6 " < % < % % 9 < " : % 4 % : % / " 6 <( 2 B 4 0 "1 G B" B% % 9 6 " 4 " 7 " = 5 E 6=/ E G B& % = <( ! B' # "& !( 9 B) % = 6 <( # # $BB % = 6 <( / # $ # B+ % = 9 , % : % - !( 9 B, " 2 !( 6 +- 0 1 # " 8 % 8 % 6 % / " ! " 6 % 6 % 2 " 6 % 6 % 6 " 6 " / & !( 9 ' -D + " / 9 , " 2 ' 9 , " A % % C !( 9 +" " 6 02 #4 $1 % 4 % 8 % 8 % 8 "' % ! % =6 ; 6 G % 04671 @ G +% & 9 ! % 5 %9 % < % > % % / % 2 % 2 % 2 % 2 % " 2 " 8 ; 0 @ 13+& ' +' % = <(6=/ 9 0= 1 +) & 6 & ( & = & 4 & / !" ! 9 9 !( +B 0= 1 & = % 7 & ( ( 9 ! <( 05 1 ++ ") & 7 ! 92: 9 +, # 0= 1 6=/ 0# $1 " 9 ! % 04671 ,- ! #2 !( 9 $ , !( E <( !( , " 9 ! 2 # 0= 1 #(42 %$ ," (42 % G ,% . 0,& 4 " 6 % = % = % 6 % -) 2!( 6 !2 ,' % 2 " 8 % > !( 9 ,) # $ ,B % 8 & ; 2 ' 9 ! ' 0;671 +' /" !( 6 ,+ "B ' & & ' 9 ! 8;+B, & 0;671 + ,, 04 1 ' 9 4 0;671 0 7" -- ' & & 767=57 !( 9 592: 767 =57- ' I ' 6 ' 7 ' ' 2 & 6 ' ; - . 9 #8 8;;! $ 0;671 G 0;671 -" ) !( ! 0 8469 -% ' 6 467;67 !( 9 -& 592: !( 9 -' !( ' 9 ! (-&-04671 <( 08(261 -) G / ( 9 0/(91 -B ' 6 & 8 = !( 9 9:= -+ - ! , - "+ # 0= 1 ! , 8 = 7 -, & 6 9 ! 0 85<"04671 7" G 0 1 -= "- H : 0 1"% !( ! 2!( & % 9 8 " 4 % 4 & : & 6 !( 9 ' % = & = ' 4 '! & ; ' 4 ' ! ! 0) "1 & # !( 9 # <( B ' > ' 9 ", ; & = % 9 4 3 4 % 9 4 3 6 % 9 4 3 ## # % 9 !( 9 4 3 592: +, " = ; G "- ; """ "%*"' % 6 & I $ I !( ! <( ") 2!("B & 8469 ! "' & 8469 ! "' & & ( 8469 ! "' ( " 867 592: 9 7 "+ ! & : * !( ! 2!( : # $ ", 2 #8 2 "$ %- 8469 9 27 % ""- <(! !( 8 %" 867 <( ! !( 592: 8 %" %% <(9 !( %& = <( 9 # !( = / %& %9 & ) ) 2!( ! = 7 G %' & 2 ' 6 ' 6 ' 6 ' < ' ! % C 592: ! !( 0# 2!( $1 6=/ %)%B % ; 9 % = 07671 0# $1 %+ % 8 592: 9 # 04671 !( <( %, % 7 592: 7 % 1 10 % !( % F % 04671 1 % 7 07671 &- % 592: 9 #= 4 !( ( $ 04671 6=/ / & = 04671 % #! 9 "" $ "" % 2 9 0 4671 "" ' / <( 9 046710#6 !( &"&% $1 ' = = !( 9 9:= -+ ': !( 9 # && / 592: 9 04671 !( # $&' 6=/ & 4 ' 4 ' 4 592: 9 <( &)&B 4 &+ ' 867 592: ! %% ' 2!(! ' !( 8 %" <( ' ' 592: 9 04 1 &+&, ' ' # !( 9 04 1 592: 0( 1 0= 1 '- + 4 45 9 &) 2!(! !( <( 8 %" 4 867 45 9 &) !( ! 867 592: 592: %% """ 4 45 9 &, ' = & < ': .) 8469 ! # "' . 4 45 9 # &)&, . 4 45 9 &, ' / ' & = ' 6 ) 2 ) = ) = ) / ) 2 !( 6 ' ' > ! !( 9 '" ) 04671 592: ' = ) 6 ) 7 ) = ) = '6 . # 4 45 9 &, '6 ) 6 # 4 45 9 &) # 4 45 9 &, ) <(9 2!( 8 !( %" 8469 ! "' ""% ( ' 45 9 !( 5 &)'% 04 1 592: 5 ) ' !( 9 2!( 8 %" 4 45 9 &) % ) 4 45 9 &, ' ) 6 #: $ <(!( 9 0 592: 4671 @ '&'' . 04671 9 # $3 06 J6 ,+" ')1 #= $ !( 9 0 6=/ / # $3 467;671 592: 0#I $1 'B #= $ '+ <(!( 9 04671 ""') ( 04671 !( 9 2 592: ', 0= 81 7 !( 9 7 0 592: / 1 6=/ 5 # $5 0( 1 04671 )- ) 2 8469 ! "' 2 4 45<( 9 # ) ""& # <(!( ! &) # 4 45 9 &, #A $ <(!( 9 )" G )% 592: ! : 6=/ 6 )& 04 1 ) : 2 / 592: 9 )' 04671 2 07 1 2 ( 6=/ 9 + 04673 ( / 1 % & 2 # $ )) ) 4 ) 6 3 <(!( ! 592: 0;671 )B! 3 0 "1 3 > <(!( ! # 592: * = )+ <( ! ), ) 4 " 9 4 3 ! " 9 4 3 / " = E / 6=/ 6 ""' 04671 G B& % = !( 9 B- 9 , % 6 % ; 5 592: 9 B 04671 - # 5 592: 9 B 04671 % % ( % ; & = ' 9 = % & 6 ' 6 ' 6 ' 6 ' 6 & = ' / ' 6 & C & ! & 9 3 = ' 9 = & 9 % 9 & 2 ! 9 , & > & ( = !( 9 0 1 B" & 2 ' "") ) ( !( 9 B% ) 6 ' ! ) ! ) 4 ) ) = ) 6 #= 6 $ 4 = +B& ) 9 ! & 9 9 % = % C % 6 % 5 % ; % 4 & : & 6 & = & 6 % 9 = 3 6 % 9 = 3 C " / % 5 ! 0 1 ""B B'B) & #( $ #4 8469 9 2 $ 7 7% & #( $ #= <$ 6 592: 9 I 0;671 592: !( 2 7 BB & ' ( ' 2 ' 4 & ; ' / + 2!( ! 2 7 7B+ # !( 9 # B, 27 7+- H > > ? B, + 45!( 9 2 7 7% * 4# !( ! # "- ( 7 + !( 9 +" ' ; ' / ' '= & 9 5 % 4 & = & : & 2 & 4 & ""+ % 6 & 2 # = !( 9 9:= -+ & > & = " 9 /3 ; " 9 / - 4/=:4! 6<42984 +%*+B ; > 0# $1 0#= $1 ++ / 02 #4 $1 " = " / " 2 " 6 9 4 0;671 0 7" -- " = " 7 " 5 % : % > % = % 4 % / ! 6=/ 9 04671 592: +, = 02 #4 $1 " = ( % E E 9 4 4 # $ "", % ,- 4 " 2 0;67 9 4 467 6=/ 7 5 1 , 4 9 ! 04671 ," "- 04671 % 9 2 % .4 04 1 # 0;671 04:<1G # % 4:< 4:< ,% ' 7 9 6 ) 7 ,& 4 % ,' + 2 592: 4 8;;! ,) 6=/ % + 592: ! 6 6=/ !( 04671 ,B % = ' " 6=/<( = ==46 04671 # $ 7" ,+ . ' " 9 5 04671 7",+ ) !( 9 ,,"-- ) <( ! "%- "- / 8469 9 5 04671 !( 592: "-" / / 0-)D )2 />41"-% / 8469 9 04671 592: %' !( / 5 = "-% 9 ! 1 0;671 "-& & 9 = % 6 % > % ( % 6 % = % 6 " = % = % ( % I % 6 & ? & = & 2 ' = ' ! 0> 1 - !A=4C44 ( " 5 % 8 & : "% & ; & !( 9 : # $"-' % / %K K " 6 ( "-)*"-, 0 1 . 0 1 2= 6 " 592: 9 # 07 1 !( "- % ( !( 9 02 1 592: " + 7 ; ! 07 1 29( 2 "" % ( ' 9:=<( 9 ' # ( ' "% %: % % = ') ( <(!( ! # ) 02 1 592: $ 7 ( 9 7 : "&"'( ') ) 592: ! !( 02 1 ") "B , 2 !( 9 "%" 0 6=/ "+ 7 592: ! 2 1 2!( ! 4 6=/ 4 592: )2/>4 07 1 ! 9 ! ! ", % ( !( 9 ! 592: 0-)L 1 0! 1 ""-*"""; 0( 1 8>4 ""%5 ""& 7 2!( 9 592: 0 6=/ 1 6 ""' ( 9 08671 "")9 > > 0C ""B 1 5 !( ! C 2!( 592: 07 1 ""+"", % 2 " 6 % 592: ! 2 # $ 07 1 "%- -) 7 2!( ! 6=/ 592: ","% ) 2!( ! ) "%" "%% % "%% ( 8 " H % H % : & 9 : % 4 % 9 H " 8 % : & 6 & 4 45 9 9 "%&*"%) # <(!( 9 "%B # #FI4$ !( 9 6=/ 0;671 "%+ % ! & ! ' : <( 9 # "%, 6=/ />4 G "&-C 6=/592:"&- 2 0"& "&"1 !( 9 "&% ' ! ) / ) ! % 2 0467 8469 ! ;67 !( 7" / "%& ' 1 6=/ "&& / 04671 ) ! B 6 <(9 !( "&' . <(9 !( "&' B ! %# 2!( ! "&) %# !( 9 ."&B %# <(9 # !( "&' ( # ( <(! # 2!( # $ + "&+ ' 4 & 8 & 2 # !( ! # 27 7%"&, 592: ! 0!671 !( 6=/ 27 "&""'-"' + 592: ! 0!671 !( 6=/ "&""' & I ' 6 ' ( ) > ! 9 , ! !( 9 "'" ) 6 ! , ) ! + # 9 , + + "%' ) # 6=/ ( # I # !( $02:1 07671 0# 6 "'% ! "'& $1 "'' "')*")- ' 9 I " ( - 9 !EI4/M4 4 4 7 . <(!( ! 0!671 592: ") = ' / 2 = " = !( 9 ")" #= $ <( 4# $ 0 2!( 1 / # $ ")% 9 , "%) # / ")& " ; " I : " 6 " 6 2 ' ' 0;671 +' % 6 ! + 4 # 1 0= 1 ")'")) 0#E=M> 4$1 % 6 % 9 % ) 9 % ) # 04671 # 0 1* #H : $ ")B >7> # . % ) % = / 6 0 !(<( 6 1 5 ")+ = " 4 !( 9 "), ) !( ! "B- " : !( 9 "B " / ( ( !( 9 "%B "B" !( ( "B% 4 2( , % ' &",*'&0"-"1 " 8 / 7 !),%* !),,0"-'1 % I :H 6 " # 0 = ;> J2 5(1--,*%0= E 6 ,&1 & 7 ;: 6 ! "# ')'*B+06 6 ,),1 ' < HH 6 , "%,*&-% 0,+'1 ) ;/H2 /FJ= 84! ( '')%*'),0"--,1 B ;N: 8J7 9 1 %',*%)+0,,+1 + > !=(J( (! ( ! + + ),,*B"0"--1 , 8CI 242 4CJ/(26 " %*"0,,B1 - 8 H= 2J5 /46 ' 0 22: 2>J> 51&)'*'--02 H"-'1 4 /< 3 " *-0"-"1 " / /4 / 0 IN:= : JC41&",*&')02 7 : "--1 % 2 5J: (9 3 ( +%%,*%&)0"-'1 & H IF6 ( 0 8 ( 5 2/ !2 I :J2 !1-"+*-%B02 > M "--)1 ' H IFJ< 9HE %) ! "%)*"&-0,)B1 ) H IF; , % ''-"*'-+0"--&1 B 6(M2I(2=HJ496 . # A 3 P < @ Q % ' "'"*")%0"--&1 "%+ + H HJH IF; , '%'*'&%0"--&1 , = 8( /F H(R I 8J; ; 04 3< 3: 1 P ( Q0= 36 1% , +)*,' 0"--1 "- 2 5 < 3 2'% ,)%&*)&&0"-&1 " 8 C2 < 47 8( <J:SM2 3() % ' ! ,B-*,B+0"-'1 "" : ( 06 1 ' ! %# "%*"%,0"---1 "% 2 4> !5HJ6 H!" # 04 1 < < 0C 9 > F /1 < % , "'*"',0"--,1 "& I H7 6?U :;N=JIV (5 04 4 1# 0"--+1 "' 4 /5 2 2 , " %B-*%B)0,BB1 ") 2 5 ( ; ! %%+0"-'1 "B 7 F!5 % 7 J8 ,+& 0! 6 1# "-'*""0,+)1 "+ 6(2 HJ6 / & 6,)' 06 / 1# ")'*"+'0,BB1 ", : (JF (7 , % ''-,* '&0"--&1 %- 2 ! 2 8 % ' '+""*'+%0"--+1 % 2 6/ ! "&-B*"&&0"-&1 %" ; ;J/ 8( ' ! &%* &%%0"--&1 %% ( =5 6 !J/ 8; *%' ' ! "+*",&0"--1 %& : ( 6 3 P 6 Q 2 , % ' "%, ',,*)-'0"--"1 %' : (5 /; /I2 I:JF (> % '%'B*%)B0,,,1 %) : ( ( = 5 7 3 P 4 Q% '&&-*&&,0"--1 %B 2 ! 2 # 4 $ , + -&'*-'B0"--1 %+ 2 ! 26 24J: (4 92 4 +' % +"B-0"-1 %, : 9 , + %+%*%,"0"-%1 &- 7 /H P Q 2 , % ' )%*B"0"---1 & ; I( ( 4< 6/ =J/ 86 - / # 6 ! - "&+'B0"-1 &" = 4 P 6 Q 2 , % '+)%*+))0"--'1 &% 5 / 6 = % ' ")%*"),0"---1 && : ( 9 B"+*B%-0"--&1 &' : ! 4 % ')-&*)-,0"--B1 &) (R 4F HF (J2 ! 24 % , "*"'0"-)1 &B ( M 8 P 7 G QP 7 Q 2 , % ' '%)*'&0"-)1 &+ = <C( 4J5 4W( ' # 2 +B' 04 6 1X(# '+*)'0"-"1 &, 7 HH2=I?I7JC ;8! ' # *%' ' %+B*,"0,+'1 '- ; H<5 ) , "%--*%'0,++1 "&- ' ; ;8 G ' 82(%)%B ) , + ),)B*),)+0"-"1 '" 7 HH2=IJC ;82 ' +,*,'0,+%1 '% 5 4=@ <CJ; 4C4 ) 06 6 1# "%%*"&0"--&1 '& I 4F =2 (F HJ( /E 22E/>4 G * 2 ,")04 1 "*&-0"--,1 '' 2 5F; 2=J5 H/ ; 6 0! 193 6 ; 6 ; , % ' '*''0,,&1 ') 7 848 !Y 8=J2H!6 %,%*%,)0"-1 'B 82 2 + !'-",*!'-%B0"-'1 '+ 4 /4 4 % ---%0"-"1 ', F =I 24( 464 /JHR I! 7 2 +' '"B0"-"1 )- 8 22 ((7 H52 (J6 (S Z 3 < ? B&'*B'+0"-&1 ) 8 V9C V(5 9(V V7J6 V: 05 1 0! 1 * 7 8)*B-0"--%1 )" =H6 05 34 1, "%,"*%,)0,+)1 )% 8 2J6 6 G > 0 1*%' ' % -'0"-)1 3--,%. . -' )& =H6J6 5= \4 > 05 34 1 *9 "")*"&-0,B,1 )' ;H>6S !]:J(_ 8_25 4 " 4 % , %&%*%'-0"---1 )) 6 8HJ8 G 7<H 02 1 . . 04 343: 1 Y 4 , " &&,*&''0,,-1 "& )B ;H>J= I88 2!( !(3 #% , +*+,0,,)1 )+ ? =:J:! + %) &""*&%-0,B)1 ), 2 8HJ7 65<7 + 2 , &B*&,0,,&1 B- ; <=S 8 ( H7 2( 22MJC 8 # # 0: 13 %+%*%,+0,,,1 B ? ;47 B+*B,0,)'1 B" I 6< 7FI? ?2J: =? " G *%' ' . ''*)-0"--1 B% I !( * - + B'*+0"-&1 B& ( ;( E G 2'% , B-%*B-B0"-"1 B' 7 H:J2 !(5 # 34 *9 "'*""-0,B)1 B) 6 :/J: 8HC* 0= 1 , + "B,*"+'0,+&1 BB ! 44= 0= 1 + ),*B&0,+"1 B+ ; <2 = 7 7 R R = ; + 3 %--*%"& 0,&+1 B, 8 :J C H- 34 # # +,*,+0,+%1 +- : 2 # 02 : 13 G "BB*",%0"--B1 + : 69 & 0= 1, "* ""0,B+1 +" 8F! 0A 13 +'*,&0,B,1 +% 82( ; P 6 Q!%" 4 G * & "& 0"-&1 "&" +& 4246 (2J4 !C9 ' ' + ! ))B*)+&0"-"1 +' 424 6 * * B-B*B-B)0"--,1 +) = !HJH 29 07 1, '&-*'&&0"---1 +B C 4< !" ! ' %B*%"0,,-1 ++ :(424J4 !CE G 2'% ,%*&"0"-B1 +, 6 H9 ! # ' + % &BB*&+0"--&1 ,- 424 9 ,+*-0"-'1 , 24 ((! 07 192 384698>4 , ""*%+0"--%1 ," 7I/J7 F>4 # . ' + %&,*%''0,,+1 ,% ;U 5( 87 IJ ,& ;U 52a <<E</6J< /( . 07 1 # # ")'*"B%0"-)1 ,' < / 4 !2 -) +' & ""0"-&1 ,) <94> ( 0! 108 1 , ! &-*&-,0,+"1 ,B 2 4F 4J2R=8 6 ' %"",*"%'0"--1 ,+ F <F6 /" B*B,0,+)1 ,, 7 =H22 4J; 8: & 08 1 G , --,*-""0"-1 -- = (< 48/ 8 !F (HJ24;4 G 7" ,-*,%0"--'1 "&% - 4 !7 9I ;< HJ522 & 0; 8 1 % , '"%*'%-0"--"1 -" 4 (/ F; >2J /= - () &,*&"&0"--%1 -% < HI ;52J4 !7 3 ) 0; 8 1 # "+-*"+'0"--1 -& 2 (J( 7= BB*+&0"--1 -' = H(J= !/2 06 1, ",*",+0,+)1 -) ( /J7 /( (-&- % ')&+*)',0"--)1 -B 2 6J7 /4 ! 9 , + )%B*)&)0"-%1 -+ 5 /4= !HJ7 7E 3 , &'%*&)%0"--)1 -, I =< 6C b=J( E ;> *> +' % +''0"--B1 - 6 8 M 3G 2'% ,""B&*""+)0"-%1 F 8N 9 G 3 Q 2'% , )*BB0"--,1 " F: HH (JF 8N 94 / * '%0"-&1 % F: 9 H : * ' ")"0"-'1 & =/;S( <2 ; ( J!8 % , %+*%")0,,'1 ' = 4 / 0C; 2 ,-B104 3 6 1 % , +*,)0"--+1 ) 8 9S HJCS=4 S S c 3 = 0=S8S 1# )*),0,BB1 B ( =JF (:7 & # # 0! 6 1 ( ! %%*%,0,B,1 "&& + 2 (72 39 > ' +",*",)0,,-1 , 2 (7(= 4(/ =J2 =: ),-*),'0"--1 "- 8 =4 (( (J; : 64 \ G * '0"-"1 " 5 297 = 2 ! +*"&,0"--&1 "" 2 (5@(J;N: 82 ( 0 / !8 < !5< 22 !J 51&"B*&)% 02 7 : "-%1 "% F= 2CQeg67 H(J! C66 * '0"-"1 "& 5 295 G = % , %+*&+0"-"1 "' ! 227 84J5 F:! , % ' )&*B-0,,+1 ") 5 J5 7H$ 34 - B'*,%0,+,1 "B 5 F$ 0= I 1 3 $ 05S 5 ,'-1 *9 )'*B,0,,'1 "+ ! C6< !/7 F7 8J7 H(2 3 h* '0"-1 ", I 4IH 25S ;J; 56 05 1 H 5/ ' %)%* B0"--B1 %- 6 4< = 8 = 9 ( = ( 8 ( 2 ! * ' 0"-B1 % 7 H(7I/5 (4J7 22 27 7 BB*+-0"---1 %" 5 6 J 44 , " '&*)%0,BB1 %% 5 J/>79 )2/>4 '%,&*%,B0,,"1 %& 5 292 (;N: 8J5@(7 = 8 % , &B'*&+-0"--%1 "&' %' F = = = 7C 2 , % ' &"'*&%%0"-"1 %) 6 ;222 I :C 5J/ ;8 %0= 1 C +%*+B0"---1 %B / ;! ' + ,B*'02 "--)1 %+ 7 C +',-*+','0"-%1 %, C=2 4C 5J/ ;% # 0= : 1 Q 8 6 ' % ,*"+0"--&1 &- 2 (CA 4 \8 % 12G0= ! 1 2 7 ' % '-'*'B0"-'1 & C= P=4 QP== Q % 0= 2 1 % ' &-&B*&-'&0"--1 &" 5 J7 =! *%' ' . "*"'0,,%1 &% 5 J7 =4 %--0,,%1 && M2J:/! & , % ' 7( 8 '-*)"0,B-1 &' C=6 ;C 5J/ ;4 / 0= : 1' % &%&*&&"0"--'1 &) 5 J5 7H % , "-*"' 0,,1 &B ! (J5 7H2 . 1 ")*"B0,,%1 &+ >>I74C>J( C7' @ ' ! ' )--*)-B0"--,1 &, 5 7H= IHC !J( (/4 2% , &+*',0,,1 '- :M 9 ' ' %%%'*%%+0"-'1 ' =4J7 /87 +,* "-%0,B'1 "&) '" 5 5 # = $4> ! ) 0= > 1, % ' ,*", 0"--,1 '% 2 > 6 ( ' % )"B*)%)0"--B1 '& 8 :I25@(J2:8 G 0 # 1 *%' ' . )*+0"-&1 '' 5 29J;N: 88 % 0 5@(1)*,,02 7 : "--,1 ') ;N: 8J5 298 % 0 5@(1%*)-02 7 : "--,1 'B 2 (J2 ( 9 % 0 5@(1""B*"&)02 7 : "--,1 '+ 7 =< / 04 1 * 0; 1 % ' )-&%*)-'-0"--"1 ', ; HYM; AJF 4#=2 $ 8 6 0= 1 '%'*&0"-&1 )- 2 5 8 / 0# 7 $# 5 $1 % '4!(-""+& )0"-)1 3-"+.4!(-""+& ) ) ! ;J5 7H4 *9 %'-*%')0,,&1 )" 2 4 9 34 , " &&B*&'0,+B1 )% 2 47 24J<5 8>4 , & '%B*%"'0,+%1 )& 5 2 #=: $0: 1 6 '"&&*"' 0"-&1 )' 2:M ! 2 % ' B&&'*B&'"0"--,1 )) ? I! 8 E ! / 56 9 * '0"-B1 )B 7(! : @ 2< 9JC H ( 3 3 "&B * '&'0"-&1 )+ 2 <J7(4 3 # 0= 1 > .- - % -)"+%&0"-)1 ), HJ7( 1 (1 0 + " 0> ( > : 2 9 "--&1 B- = 2JI 24 = = &B*B'0"-"1 B : 224J( (= P=5 Q0/ 4 1> ! C 4 0= /1 % '0"-'1 3-"+.4!(-")+- ' B" ==! :HJ< 72( 3 6 0= 1+' '"%0"--+1 B% I 245 ( 0 1 # "%)*"&&0"-1 B& > !=( * + %+B*%,B0"-&1 B' < HHJ4 /2 +# 0 < HHJ 4 /1'B*""-04 6 ,,1 B) < HH<3 &+,*'-)02 "--"1 BB 7 H(! C6= I<(9 (/J7 8H8 2'% , ,'*,)-0"-"1 B+ 7 H(; 2J7 224 + 3 % ' 0"--,1 3-.@&)" ","-"--,-"-B% B, ( = # #05 1, % ' &'&*&),0"-'1 +- 7 H(6 +)*+)0"--%1 + 7 H(7I/J7H6( 7 34 ! 2 ""%%*""&,0"--1 +" > : > @ . - #+B,*+++0"-&1 +% !2 3 * *%' ' ! &)"*&B)0"-%1 +& ; 5< 4F HJ9 H5= ' % # ")B*",,0"--1 "&+ +' : H< 5= 8JF 4F 3 * *%' ' %*)0"-%1 +) 2/6J/ =/I2 * 3 *%' ' %"%*"%-0"-&1 +B 2/6J/ =/IE 5 ( ( * ' 0"-)1 ++ : FJ= ;E ) I , +''*')%0,)%1 +, 4 H7J; <H( % ' %-"&*%-%-0"---1 ,- 6 <J6 9H7 4 0= 1, ,)*"-0,+-1 , ( IH 9= (!J= H4! 4 " ' %%-"*%-0"--)1 ," / 8 < 4 % 'B+&&*B+'"0"--B1 ,% H 9 = "-B* "-B0"--"1 ,& ( M2(I:2MJ:29 ' ) % '"'*%'0"--%1 ,' ( M9:>(J2M9 ',+*',+0"--'1 ,) : H F h! + 07 = 1. - % ")&'+0"-1 ,B M 4 + ! -&)B0"-'1 ,+ I! ( 7" 34 7"% ' &))*&B)0"-"1 ,, < F 27JI ;7 ) 0= 1, ,&*,B0,B)1 "-- I ;J <F! ) ( ' &B' 0,B-1 "- : 77 ) ! *9 ' ",*%-0,'+1 "-" > :I :(JI 5 0C = 1 # "'"*")B0,+,1 "&, "-% I I: M:@J> :( .- - % %B&,0"-"1 "-& I < !:MJ= M % ' "&%,*"&&0,,'1 "-' 5 8!= 8;:!<J! 2<E & , " '*'+0,++1 "-) / /5 38 % +%*,)0,,,1 "-B 8 (52 3 2 ' "-%*"-+ 0"--1 "-+ 7 4J2 E6 3 ' %,*)-02 "--)1 "-, 7 4J8 = 3 ! ' '-B"-,-)&'---0"-'1 "- : M ; >" -+*-,0"--+1 " ( 4 :" =" -""&*-"%-0"-'1 "" C ; % '4!(--) )0"-)1 3-"+.4!(--) ) "% 8 8 < ' ( # 3 2 2 +-* +)0"--'1 "& = </J; 4C ') ) 9 ! . + + ))+*)+)0,)&1 "' F (/ /7 ;JIN:9 ') ) % , *"%0"--%1 ") : M 9 P2 Q % ')"B-*)"B)0"--B1 "B Q4 E8 (F 4(J( <8 0#/ $13 % , %"B*%%B0,,,1 "+ 2 H5:8 (2/ /J7 49 , '# "-)+*"-B,0"--1 ", 8 (2 2 7 0I 1% '""-*"%"0"--1 "'- ""- : M = ; 4 ''''*'')-0"--+1 "" 9 FJ7 4= 3 P=! Q' %%%"*%&"0"--,1 """ 2 E/ /M:J7 4P! Q3= % '&B%*&B,0"--'1 ""% 9I = # ! $ G 8>4& + %%-,,*%-B 0"-)1 ""& ? :8 =/ /J7 4! ! 0 ! 1* ; 9C % ',*"-&0"-)1 ""' > 2 = 06 1 ' % "'B*"))0"--B1 "") 2 8 ( # % '--B*-'0"--,1 ""B 2 9 2'% ,--+*-,0"-&1 ""+ 8 (5F 4(( :F H:J( <= 5 I % , "'B*")&0"--&1 "", 2 E(4/ /J7 42 2 @ > 7 3 P=C Q' ! %#""",*""%'0"--&1 "%- : M 2 3 7 % '")%*")%'0"--B1 "% > 2I(>@:I J(9 + -) ' %)*""0"--)1 "%" < 72JI 6H2 ) ), % '",*%--0"--&1 "%% 8 78JI 2 ) ) + ),*+-0,,%1 "%& 7 =4(( @ ::(2 H=2=IJC ;82 6 ( % , ,+*-' 0,,%1 "%' 7 =4(2=IC ;8J7 ; % , %),*%+-0,,-1 "' "%) 7 =42=IJC ;8( *%' ' . '* +0,,"1 "%B F H( H84 :J( /4 # H ,,& " %-*%-0"--'1 "%+ = 8(R I 8J( /( %) %+%*%,- 0"-%1 "%, 2 !2 9J: 8 # 0! 1 3G # '%*'B0"--"1 "&- I! = # # 2'% , -+*"-0"--1 "& F I 2@ 6 # *9 B'*B+0,,'1 "&" 7 24M >: (J< 72E 3+ 02 1+' '&'0"--1 "&% / <!4 , " -B*)0,',1 "&& I /=J<2! % < 9 2 )-*B&0"-%1 "&' < ;5 ; + 3 "B,*",& 0,),1 "&) < 72J5 (4! %# 07 1< % , &-'*&%0"---1 "&B 2F7 2(J5<! %# 0! 13 # ,+*"-%0"--%1 "&+ / H/J< F; ( # 0! 1 , -"*-""0,,&1 "&, 2 4;7C8 : H7 =7 :/J6 8H # # 5 *9 "%*""'0,,B1 "'- M >! C67 H(J< 72E 3 +' ')0"--,1 "' ! C6 9 " 3 2'% ,"%*"&%0"-1 "'" 8CH i HI 6HJ( 46 "'" 22E/>4 G 0I !1, % '. .0"-'1 3-.@ ""B "'% ((; 6 # # '-%*'"&0"-1 "'& 4 H(6 9 . - % "%'+0"-1 "'' I == 7 . - % B,B+)0"-%1 "') 4 H(6 ; I # # & + % %%+*%'- 0"-%1 "'B =I 6J F> '%*'%"0,B&1 "'+ 8M(< ;J=I6)2 8>4 G , + %-+*%-+&0,,&1 "', ;:>J! />P= Q 0# 1 %*&0,)'1 ")- ( (=(! - , %,*&B0"--1 ") :! ! 7 "'&*"'+ 0"-)1 ")" 2 !J( (7 0= 1 # %%+*%&%0,,-1 ")% I 8 * 3 G h , ++%*++0,+"1 ")& MI4JI: / = 4 = : / 7 6 6 9 67 6 , ' % &B*'B0"-"1 ")' 4F E '&)*''-0"-"1 ")) 4 ; E=M> 4 % ' %"%+*%"&,0"-&1 ")B 2 (/= /HI /J= H H : # %%*%%'0"-1 ")+ 2 /2 >( <IJ( ( 5 3 6 P6 Q. - % ',')'0"-%1 "'% "), 6 8HJ8R(2 35 h% , '*''0,+B1 "B- 6 8H ) 4 , ""&*"&)0,+'1 "B 8R(J6 8H4 ( %)'*%B)0,+B1 "B" I 82 I :4! FJH I2( 2 , % '"','* ")-&0"--'1 "B% M 4! FIJ6 8H5 ( ; ,%34 G '')*'),0"-%1 "'& !" # $ $ %$ $ !" & #' $ !" (#) $ * $+ !" # , , $ + " ! $ $ $" -#. + , / $ 0 12 3 "45 $ $ $ "42 $ $ "4!67 9:# /$ % "4 5"4& !+ :;-:<+0 9:&<. :;(-<0 99(#, 2 + !" # / $ - / $ $ , $ = !$ /# "4 ! # > = !? 9::< 5@ 6$ 9::# % "4 5"4& "4% 6 $ $ $ $ ! %A$ 9:< 9::# 0 ="4 $ $ % !" #6 "4 :;&9 5 0 !+ = :;BB<+ 99# $ "$ % "4 "2 !: :#4 A :C 5-9 D !? = 9:# E & + : F $GG2F 4 G2)FGF %(H:( $ F $GG544 GF %&-H FAF & G2%" 2GE " 2GF $G G:B-H:& $ 4= ( G2 = :%!%F %)% #%% G:(&HB % %(%= = B $ !: $ %" 2 $% !6 0 :;B-#? $ !: (# , $ !I 9:# !6 9:-< 9:-#. $$ ) $ 12 $ $ $ $ $ !0 + :;--# $ "4 $ ? "4 "4 $ "4 4 $ = 5 $ "4 !C 9::# "4 J) K!)"?# = ? ' 2 )"? /$ :%&L = !E 9:9#5 $ C )"? ! "4 #)'2 /! # ; !) 9:<M 99B< N 9::<6 9::#5 $ $ "4 !5 99<N O 9::<6 9:&<Q SU $V 99<I $ 9:(#A "4 $ $ $ !5 99<E $ 99(# , "4 $ !? 99B# ? %$ $ $ ! " :# %$ C 6 % ) $ % " $ + " 5 $ W %$ / $ , $ $ 4 %$ :BN) 0 !# / "4 "4 E "4 " = !6 :;B:#N !# E "4 $ !' :;BB#, 9 !) 9:-# E "4 !,C 9B9:9(-# $ . $ $ !5X 99; 9:9 + W 99- 9:# ? "4 !5X 99;# 6$ %$ $ $ 6.F9 % $$ !6$ 9:# !C C 9:2 E "4 / !C C 9:#2 % $$ 5 : $ , !' 9:(# 0 " ? $ + 4 )6C:- ! # 0 ! $ :;;;# !,C :-9;&9:# $ !C (-- # E "4. + 6 = 2 ! # !6 99:# 2 $ CA : !,C (9;&9# = !$6 # E "4 2 % = J KD NC)B:::! J) K!6 99:## " = ! + :;BB# / ? %$ $ , !F52# + $ % $ 6 $ > ? $ = !4 :;;;# ? % $ $$ ! % #!6= 6= 99#2 % , = = 0 = !6= 6= 99# 5 $ $ ? &? = F52 5 $ = F52 ! #!6 9:# $ 2 %+ $ 2 $ %$ ! F52# !" # ! " # $ + % $ !" #N $ $ = !5 # " ! ,C " #!C 9:&<CY 99-<0 9:#C ? 5 $ " + 5 " , $ " $ &% % !" # ! AFE $ % % % !F24 # $ !' 9:<6$ C, 99B#6F24 2 ! # & " + AFE 2 !9:#+G <% <G>% <1 $ !" # $ % && $ $ "2 GGGGGG % G G G G % !A%C % GGGGGG F # !A %) # % G>% % % % % "$ % % G 1 G>% % " &5F G 1 1 G 1 ' $( % &)* GGGGGG F52 GGGGG% F G G G G G G 5%F !F # G G G G G G N F !F# % % % G>% G G $ ( * ' G>% G G G G>% G ' ' %G>%% %G>%% ' ! # % G>% G % G G ' ! # % G>% G G G>% % ' % G>% G G G>% % !F52#, F24 % AFE % ! 24 # " ! # F24 = ' F24 24 $ $ 0 AFE + &% %!&5F#! " # 4 = " &5F " ! ( + # F " " 2 ! " #!" #0 $ $ $ $ $ $" # %& N AFE + !# AFE $ 5 $ $ $ + , + 24 F24 0 F24 $ %F !F %6 # % F!F # 24 + $ F F24 24 + F24 AFE 24 F24 $ $ ? $ + 2 " = " &5F $ W " ' %& + AFE 2+ ) %6 AFE + ! # AFE $ 2 AFE "$% % !"# $ !2 9:# "4 2 " + " AFE $ + C $ !'# !2 9:#, + > )= !' # W == AFE " + AFE $ $ 5 $ $ $ AFE $ $ $> ! 6 6 6 # $'G !C, 9:(#4 "2 , + $ !" # + $ 666 % 2F%" !2"# 2F% F !E2F# = $2F $ ( %& C AFE AFE / + !# $ / !# > !# > &5F $ ) # !" * +, J K J K !) 99B<6 99# / 1 $ $ % = 6 % $$ = $ "2!" #5 $ W $ / $ , $ 0 , J K = $ # " # 2 $ ? 5 $ $ 6 6 $ = "4 , - / 4 !" 9::# % A$ $$ $! # = !2 99:# C 6 $ $ $ ( - " "" , 2 + "4 " = %: % > !E "4#5 $ " $ $ !+ 9: 9:#A= = " % : % %: -% $ % = % !FF%F?+#FF%F?+ " = !E $ 99B# " $ !+ 9:#, "$ "$ !5 $ % 5G% W FF%F?+? FF%F?+ 2F $$ % $ 2F $ B +E "$% % !"# ! # :C 5-9 D !? = 9:#? > $ % %& Z [%! G> %# G> % > $ [B&:(\:9 M %:+%:[;&+ ( , $"$) $-$*.&/ $ & :2 %: % G54 %BH:( ;;\:9 %: % " %% G : %: % G G((H:( 9:- FF%F?+ %% G & 2 %: -% G54 %-H( (B\:9 %: -% " %-% G %: -% G GH( 99B FF%F?+ %-% G &2 %% G2F % %::H( 9 " : % G2)F & %% G %H( ; FF%F?+ %: % G ( G54 %&;H9( 9;\:9 % " , " $ $ % : % %: -% FF%F?+ $ $ "4% !0 999#, $ $ $J K $ > $ & 5 $ $ " / $ / , %: % %: -% !& ; :# %% ! &# %9( M %: $ # $ E : & $ $Z , $ $ ! % # $ ]9:- C]99BC : $5 $ $ Z &! %::G9BG>% ( M %: % $ % 2 2 " % !& :2# % ! 2# $ $ ! &2#? $ $+ " , $ $ % + !9:# % ' % !& :22# % $ ! :# FF%F?+ $ $ 5 " / :9%:9%! :C #" :9% Z [%( M %: :%& M %: % /$ ! :22# -9 6 % 5G 'G 2 5G% $ :9 ^ $ !C 9:9# $ %:: M %:5G2/ :9%( " 2F $ $ $ $$ . ) " # #, , !: " # = $ $ "2 $ $ = = $ !(# $ " $ $ $, $=!FF%F?+# " $ & ' $ $J K "2 = $"2 $ "2 $ J K $ $ 5 $ "2 $ %" 22 / $ $ "2 C -: 0" $ !2# $ !# + 2 $ "C <? < N > <"2 ' _ + ` " ,")1$- !" .&/$ :2 2FG)% % 2)FG)% %:9H:& (&9 % N %: % _ & :2 %: % G54 % %BH:( ;;\:9 %: % N ` % G !" #$% : G)% % %((H:( ; % N G)% %: % _ 2 "4GF $G54 %&-H -\:9 FAF "C 4 G4 "4G )FGF $ G(&H- 9:B FAF "C 4 G F ! )F% # G &2 '2) G" 2GF $'2)5G"4G %&&H( :\:9 $ "C 2%" 2 %& & "4G2%" 2GE G:B-H:& 9&\:9 $? "C " 2GF $G4= !" &$% (2 '2)GG" 2G%4 '2)5G %-H-- ;\:9& % "2 "4G6%" 2 ( 6%" 2G"4GE G:9H:&; 99:( ?% % "2 %4 G4= G " 2!" '$% 2 6G./ ? G %:H-: ;\:9& "2 ./ ? G % 6G !1# "2 % $ $ !2 %6$ 99B#. "2 $ $ $ $"2 $ ( - ( ' $ $ !( &# % % ! (# '2)5 / ? '2)5!%(:B$ %&&^ $# 2 '2)5 $ + '2)5 $ =$ $ / 4 'G% '2)5 !E # '2)5 'G ! 9::#E !" :# $ 2 $ $ !:C 5-#, = $ % $ / = a99 C $ % $ "4 % " '2)!F#5 $ / 5$ % $ %$ " !#" / '2)!F#5 !# " = $ "2 - " b 6 % $ / -& "4 $ "!' :;BB<6 :;B:#" AFE $ % $ !2 9:# , $ "$ $ /$ '2)G !2 # "4 $ $ )C64 " !C+5 9:9< 999# C $ !I 9:#C ' $ $ 2 " % $ $ $ = E "4!6 99#5 $ "4 $ $ !c 9:# % $ / "4 " < 2 "4 /$ 5 $ $ " % " $ $ $ E "4, "4 -( " # 2 "4 /$ 6 E $ )C643 $ $ G 5 5$ 3, $ $ !F 9::# ? 3' = + 5 $ $ $ 6 !F52# %" 2 $ / $ $ $ )= ' % $ = = $$ % ! 9:# $ = !+7 9:<F 9:# E ! #6 d J K $ F52 5, !6 :;B-<6 - 9:# $ ( !2 99:<) 99(# " = $ % / ? = $ C = = =$ , $ $ "2 $ !' 99B<6$ 9:# . " ) , A $ " $ "2! "2# "4 !C 99-< 9:# "2 %$ !0 9:#,A "2 $ $ $= "2" !C 99-#5 $ = 2F !2"N# ,2"N " A ! # ,,2"N ) !5@ 6$ 9::# "2 = $"2 = / $ ! 9::# = $ $ $ "2 % % < $ - 2 $"2!:2# $"2!::"# ,")1$- .&/$ :2 2%" 2G4 G54" 2G %&(H9; :\:9 " "2 " : 2FG" 2G" 2)FG %B;H9; & 2F "2 4 G2%" 2G 4 :" 2FG" 2G" 2)FG %-H:& :B " %" 2 "2 4 G!&*#%" %" 2 :" !&*#%" %" 22%" 2G %:-H:& 9 " %" 2 "2 4 $ , $ $"2 = = 2F !2"N# % " 2 %" 2 !""6>""N# + A !: " # )* "2 $2"N ""6>""N / $ $"2!# > $ "2 $ "2$ $ $ " $ $ % = $ $ E "4 A "4 C "2 $ % % !: " #2 $ $ $"2 -- N " "2$ / = ! 9::# $= % "2 / )* , "2 $ / 1E / A " "2 $ $ "4 1 F "2 A $ " !6 9: !F 9:, " 5 $ A = $ % F 4 "$ "2 $ "2 / '2)5 /$ / '2)5 / ? % % $ / ' $ ! $# % $ % ! 9::# 2 b $ -B # " / " 4 * $ =JF K $ 5 $ $ $ $ , % %$ $ , % !5 9:<C %6$ 9:-#6 $ = E "4"5 $ % = 4 /$ $ !4 9:9#6 % $ !2 9:-# +$ 0 $ / $ $ / -; . # #, 4 + e 1, / $ $ !F N # + ? $ " ) # , F $ $ $ % ! " :# + $ 6 / $ $ % + " !E 99B# $ $ $ $ $ 0 ", + $ $ % !" # $ + , = $ 14 $ !C F 99(#5 $ + %$ !" # $ !" # $ $ B9 2 C C, 6M 6 %W C + 6C ' F5!9:#J F $ K2 $ % $ , ) - :9&&B;>9:9:9&& 2 'I) N M ) 2A!9:-#" $ % % $ :;; 99B-%: :9::B>M99B-% : 2 " ? ? 5!99:#2 9( -(:3-9 2 %6$ " N M%F ? 5!99B#A -. * - ::;3:- :9;B&>9-&9% B999!99B#-f::;A2,g9"4< %A$ 2 ? = 2 ' A C E!9:# /$$0 :B:- :(3:; :9:9:>W 9:999 ,2!9::#A "4 $ " ) -- :;3:;& :9::B>2AC9(-&%:9 A 6 6 =V= MC C@ ^!9::# $ E $ % $ ) *B :&3&( :9:99-> 999:B%9:9%9%B ) F E0 E N!9:#C % = C $ ) ( ;:3;- :9:9:>W9:9-99 " MM FE!9::# :( &:3& :9:(>W9(;9& ) ' " N "!99B#6 $ 1") -3-(9 :9:9&B> :;; ) 6$$$ 2 4 $ C $ A ^ 6 $ C!9:-# $ */ " ) - :;-39( :9:9;;>W 999:B( ) CE c 0 4 " 2 E M ? 5!99(#E = ( !$$N#$ " ) -9 (:((3(:9 :9::B>2AC-9-(:((%(:999( ) 6 + ? C 5 + C ) C 2 !9:#./ *) :9 :;&;3:;& :9:9&B> W9:- ? 6 0 NI +h C + 6E 67 C E 55!99B# :& ) "4 2 ( ( :& B: :"F " ) :9 :(:3:: :9::::>W:(%;999B9:-& ? !9::#2 $ , $ 1 $ ") &:3B :9::(> $% %9;9::9%:9B9: FM? + M !:;BB# D $) :9 ::-3: $ CI C C6 N$ ^I . ^6 ) 2!:;;;# N )6C:- , )*) :-B :3:: 5 A %^ 5 + C 5A E ) N 6 !9:# A$ $ $ 1&( (3B :9:9&B> :B;- 5 C ' MN E $ F ' F5!99#, :( $ "4$ " ) -: (3 :9::B>2AC-:(%99 5X 6 ' MN ' NF!9:9#) ) , )*) -& ::93:9 :9::::>W:-(%;(:9:999B-B 5X 6 E$ 'F + M MX ^2 $^ M !99;#F $ *) & (-3- :9:9&B> W99;:- 5@ C 6$ 6C!9::# "$2 $ ")*& :3B; :9::(> $% %:9-9;%:(-: M c $ C^ I $ A N = C M@ +!99B#5 "4 6 + & :(3 :9(&:;> 99B&:99:( + )F!:;-:#2 " $ " ) :--3:9 :9::(> $:99:-:99::(: + )F 0 2F!9:J" F K2(/ A E A?)N 6N A6 ? !6 5 # -3 B- :9:99->;-B%&%(%&9:&%9i& + C F MC ) '!9:#" $ $ $ % = = + ) : :3&: :9:9:>W9:9;99& + C 0 " N " 5 0= 6 I M !9:#C $ 21 $ *:9; A::-&3A::B :9:9-&> ::::;B:9; B + W 5 ' W ? C!99-#" = % , )*) ; &3&: :9::::>W:-(% ;(:99999: + W 5 4 I I ' C 5 0 !9:#A $ / $ *) ; ::3::- :9:9&B> W9:(9; +7 6 4 5 6A 5= @ 2 F 2 !9:#' 1) ::;& :9:9&B> 9::;& + = N4!:;BB#) $ = *:& :3 :( :9:9:>9;B%999(!BB#;99-%B + ' 6 E) 5 EN!99# $ 5 0 B9 :3: N 6 2 M c W + C ' 2 E CY C!9::#' $ " ) :& -B3--( :9::::>W:(%;99:99&B9 N O C 2 %6V= N ? F 2 2 4 " A4 !9::#2$ , )*) -- &-93&B( :9::::>W:-(%;(:9::9:::- C M M? 2!9:C %4 !J C K# A$ " $ " ) -; &;-(3&;B :9::B>2AC9&B:%: C 6 2 " ? 5 ) 6$ 6C 5@ C !99-#F / * &: (-39 :9::> ::&;:& C + C EC!9:, = 6.F9>2 ;)% :;*) - (3( :9:9&B> W9:-B C + C EC!9:# / J K F6: 6.F9 $ & 9::%: :9::B> 29::%: C, 6M 2 C 2 A+ 6 2C + E 6 %W C !9:(#j " *% $ $ $ *) B :&3( :9:9&B> W9:&: C+ M 5 "6!9:9#" 21 $ *:9- ::;3::- :9:9-&> :99:-:9- C MM!9::#" /&B N(9( :9:9;>9:: N9(;- C E M F C . 0 6 C!9:9# ' %% 1 $ &B )-9%-& :9:9;&> > BB; B& C %6$ N )k=%^$ " A $ 2, M C !9:-#, 3 $ % *) :: ::3: :9:9&B> W9:- C '2 F E!99(# + 3":( -3&& :9:9:>W99(9;99& CY C 5 ?c E C ) F 2 MX !99-#, $ 2* &9 :9:&-:>W 999&9 ' )" 0 "2 ? 2 6$ MC!:;BB#4 "$ = % $) :: :3:; ' ,N FE "$ "C!99B#" $ $ !$$C # ) ; B :9::B>:(-:%:(%;%B ' F5 6 2C 5 22 N F ' MN!9:#C $ $ $ e $ + & (3(; :9:9:>W 9::::9- ' I += 5 + M 6 6 C 5 !9:(#F $ % = $ $ $2+*+1 ; :9(;; :9:&-:>W 9:9(;; 4 M) , F m!9:9#0 11 B (3(B 4 6 + M ' NF F 50 c M 6= 5' !:;;;#' $ " ) &:(B3&:- F MC + 2 %^ 5 " . $ C + C !9:# " $ 1) ::; :9:9&B> 9::; F MC c ?. F 6 E C " 2 E !9::#5 $ 1(- :-3:B9 :9:9&B> :9& F M " % $ C%2 c C N M 2 " N !9:, $ % *) - ;3:9; :9:9&B> W9:B- E $2 5C 5 M!9:9#CW ' 2* 3*2* + - :-3:B9 :9:9:>W 9:999& E $ 26 E = $ 4' + ^' C $ ,, 2F C M" !99B#" = % % )/ , )*) BB 93:9 :9::::>W:-(%;B99B9:& B( E $ F N C MX ) 5 C!99(#. "4 $ ) ) ; &B:3&;& :9:9:>W99(9B99 E " =W 2 N " N 2 A n " ) '!99B#C % C " ) :9 &(9(3&(: :9::::>W:(%;999B9:-B 6 M E2 6 ?M ) A? FE!9:C $ $ *) - :3:- :9:9&B> W9:&( 6 2N $ ) = " $ N A %F 2!9:) 2 2+*+1 B B:& :9:&-:>W 99B:& Q SU $V 5 C, A $V ) ' $V M F Q C !99#5 "4 ) (; :B3 :9:99-> 99(B%99(%9:(% 6$ N + C F E 0= 6 F A ^ !9:#2 % % $ ( 9-; :9-(>N9-; 6 C 2 " I F A 6 0E!:;B-#6 :; (3(- 67 F 0 C 0?!9:#4 ) ( :3 :9:9:>W9::999& 6= 5' 6= 5)!99#N * &9- (:3(:B :9::> ::9&9; 6 2 + = 2%" F N 6=%^ 5'!9:#6 , ) :9&&B;>9::99- 6 C%2 " C ' ?!9:-#C $ 4 9 (3& :9::::>:-:( 6$ EM C, 6!99B# $$ % ) ( ::3:( :9:99-> :-%99B%99:%9 6 M6 0 0!:;B-#F :; &-3&; 6 6 +h F 6 +5!99:# $ $ $ % = */ " ) : :(&3:(-9 :9:9;;>999--:&%:%(%:(& 6 ?M ' ,N "$ "C!99#" 3 ) :& (&;3((B :9:9:>W999-99- 6 0E " " 6$ MC @ 5 5 N2 N "C !:;B:#5 :(B -3B& B 6 + C =% C F "C 6= 2 0 N ) !9::#F / * &&& :;3:&99 :9::> :9&;9 E F 2N N 22%I 4 ^M 5 + " )2!9:-#2 / *) :9:9&B> W9:-B ^ 5@ C @ C 5, h 2 6W E !9:#0 N $ C 6, ) & (& :9&&B;>9:99(& C2 ?E!999#C "$% % $) :-( &3&&& :9:99-> 999&99999; . 00!:;(-#F ":: :-3: 0 )!999#/ / /(/'I 4 .$ F 0 E + )F!:;--#2 * ) */- :3:(; 0 C 6%" $ ^ 0 E C 6=%^ 5' ? A !9:# 6% / $ , ) - ;( :9&&B;>9:99;( 0 2F 2 MF + )F!99(#2 : 1, )*) "B &&3& :9:9:>W 99&:99: I $ CC N" ^ 6 ? " ? 2 A N C !9:(#5 $ = 5 C 6 " ) -9;3- :9::::>:-B%;::; I 2F 2 6 6 6 F F O %2O " " 60!9:# *) :9 ;(3;- :9:9&B> W9:( c M!9:#)$ $ $ % = B ! "# $%&'()% * $+ * +, $+ $$ $ * $$ % -./01230)435-%2 ('%('()67%$" #%&'()%'5%''3 2 "* "$$++ *% $ # 8 49 :; 8$ * $< " %&'()%$" $# 4,*$" $+ ; $ # + *+, % &2()(.=%2 ('%('-56 %&'()%(.= 2 "* "$$++ *% %* $% #$266* % 6$ 6*44 $ 8*;$ />1$ # 3 % % #$266* % 6$ 6 * ##/ 1$ # = 8 49 > $$? %#"! $% #$266* % 6 >896#"! $ > #$ * $$+ + > $+ 8 $/ 1 2@# A4+ $ $ # + ##% %* % #$266* % 6$ 6* $ 4 $ *;$ + */ ; $ # 1 % $$& % #$266* % 6$ 6 $$& 6 "$$+ $ $$$# " />1 &50 &55 @$ +*##2 +% % + ++ * $# 7 + $ # + " $## * # $ " $ @ ; *" $ * ## % % 8 49 + " $# ;$ ; # $ $ ;$ $$$+" # % +% % * +% % $ + * " $$ " ; $ $+ " + " * % +% % ! +% %: !$ * + $ ;*", $$% % A* %A! % + $ ;*"# $ $$ % " $ $ # $ ; #$$2 % % " % 4 9 %A $ % $$ %?$ % $ 9 , ! + * $% ++ $+ B>@$ ? + ; "$ $ &'(-$# " % +< $ % ++ "+$ * &'(=+$ $2 $C * % +% % $$> + * :; $ "+# *+ $ *" # *$ &'()% *$@D;+ #$ * " $2 % C % % ## $ # > B %4 $ $ %, 8 % *** >$ % " A + 7 $ $ ? + # * *$ +* *$% EA 7+ * 8 $ " + $ $% &5. # $6 2+" $# ? * + $ " $ $# $ + $ @ G *$ ;# $ #$ 6 $ *$2 % $$H? $ $A 8$ 8 > $ * % $ % % ! $ % "@$ % +% %J *L %L; 4 7 %, $* % L++ + $ + $ $$$ * ; $# $ * "% $+ $$+&'(=+ + $# $$% % " ; + $ $$$D; ; "D;*;+ *$ "+" + $ + " + $#% L; M + $ ;*", $$ */%% # " 4 *1 8 $ " $D;* 6 * * + * $ * + % @ $$ "+ " ;$+ ; # * " * $ $+ % &.'