BASIC RESEARCH www.jasn.org

Podocyte-Specific Induction of Krüppel-Like Factor 15 Restores Differentiation Markers and Attenuates Kidney Injury in Proteinuric Kidney Disease

Yiqing Guo,1 Jesse Pace,1 Zhengzhe Li,2 Avi Ma’ayan,3 Zichen Wang ,3 Monica P. Revelo,4 Edward Chen,3 Xiangchen Gu,1 Ahmed Attalah,1 Yaqi Yang,1 Chelsea Estrada,1 Vincent W. Yang,5 John C. He,2,3,6 and Sandeep K. Mallipattu1,7

Divisions of 1Nephrology and 5Gastroenterology, Department of Medicine, Stony Brook University, Stony Brook, New York; 2Division of Nephrology, Department of Medicine and 3Department of Pharmacological Sciences, Mount Sinai Center for Bioinformatics, Icahn School of Medicine at Mount Sinai, New York, New York; 4Department of Pathology, University of Utah, Salt Lake City, Utah; 6Renal Section, James J. Peters Veterans Affairs Medical Center, New York, New York; and 7Renal Section, Northport Veterans Affairs Medical Center, Northport, New York

ABSTRACT Background Podocyte injury is the hallmark of proteinuric kidney diseases, such as FSGS and minimal change disease, and destabilization of the podocyte’s actin cytoskeleton contributes to podocyte dysfunction in many of these conditions. Although agents, such as glucocorticoids and cyclosporin, stabilize the actin cytoskeleton, systemic toxicity hinders chronic use. We previously showed that loss of the kidney-enriched zinc finger transcription factor Krüppel-like factor 15 (KLF15) increases susceptibility to proteinuric kidney disease and attenuates the salutary effects of retinoic acid and glucocorticoids in the podocyte. Methods We induced podocyte-specific KLF15 in two proteinuric murine models, HIV-1 transgenic (Tg26) mice and adriamycin (ADR)-induced nephropathy, and used RNA sequencing of isolated glomeruli and subsequent enrichment analysis to investigate pathways mediated by podocyte-specific KLF15 in Tg26 mice. We also explored in cultured human podocytes the potential mediating role of Wilms Tumor 1 (WT1), a transcription factor critical for podocyte differentiation. Results In Tg26 mice, inducing podocyte-specific KLF15 attenuated podocyte injury, glomerulosclerosis, tubulointerstitial fibrosis, and inflammation, while improving renal function and overall survival; it also attenuated podocyte injury in ADR-treated mice. Enrichment analysis of RNA sequencing from the Tg26 mouse model shows that KLF15 induction activates pathways involved in stabilization of actin cytoskele- ton, focal adhesion, and podocyte differentiation. Transcription factor enrichment analysis, with further experimental validation, suggests that KLF15 activity is in part mediated by WT1. Conclusions Inducing podocyte-specific KLF15 attenuates kidney injury by directly and indirectly upre- gulating genes critical for podocyte differentiation, suggesting that KLF15 induction might be a potential strategy for treating proteinuric kidney disease.

J Am Soc Nephrol 29: 2529–2545, 2018. doi: https://doi.org/10.1681/ASN.2018030324

The Centers for Disease Control and Prevention esti- Received March 27, 2018. Accepted August 2, 2018. mates that 15% of adults in the United States, approx- Published online ahead of print. Publication date available at 1 imately 30 million Americans, have CKD. Failure to www.jasn.org. maintain renal filtration is the prime indicator during Correspondence: Dr. Sandeep K. Mallipattu, Division of Ne- progression of CKD. Podocytes are terminally differ- phrology, Department of Medicine, Stony Brook University, 100 entiated epithelial cells in the glomerulus, the major Nicolls Road, HSCT17-090B, Stony Brook, NY 11780. Email: function of which is the maintenance of the renal fil- [email protected] tration barrier. Podocyte injury is implicated in many Copyright © 2018 by the American Society of Nephrology

J Am Soc Nephrol 29: 2529–2545, 2018 ISSN : 1046-6673/2910-2529 2529 BASIC RESEARCH www.jasn.org glomerular diseases, including minimal change disease (MCD), Significance Statement FSGS, HIV-associated nephropathy (HIVAN), membranous ne- phropathy, and diabetic kidney disease.2 In many of these diseased For proteinuric diseases that are characterized by podocyte injury, conditions, there is a loss in mature podocyte differentiation such as FSGS and minimal change disease, therapeutic agents are markers, and cellular phenotype is marked by destabilization of limited and have systemic toxicities that hinder chronic use. Previous studies showed that the loss of the kidney-enriched zinc finger the actin cytoskeleton, which directly contributes to podocyte transcription factor Krüppel-like factor 15 (KLF15) increases sus- dysfunction. ceptibility to proteinuric kidney disease and attenuates salutary Deciphering the mechanisms by which podocyte injury effects of retinoic acid and glucocorticoids on the podocyte. The contributes to the development and progression of FSGS is authors show that podocyte-specific induction of KLF15 amelio- under active investigation by many laboratories worldwide. rates kidney injury and improves overall survival in proteinuric mice by directly and indirectly upregulating the expression of genes Furthermore, previous reports have suggested that regulation critical for podocyte differentiation. The study’s findings provide of the podocyte transcriptome involved in maintaining evidence for a potential role of KLF15 as a therapeutic target in mature differentiation markers is critical to preventing proteinuric kidney disease. podocyte injury.3–5 Also, single-nucleotide polymorphisms in these podocyte-specific transcription factors have been directly podocyte-specific transcription factor, which is also implicated in FSGS.6–8 Along with other laboratories, we have critical in maintaining the podocyte transcriptome under previously reported the potential role of Krüppel-Like Factor 15 cell stress. (KLF15), a kidney-enriched transcription factor, in preventing the development of podocyte injury.9 KLF15 belongs to a 17-member family of DNA binding zinc finger transcription factors that play a critical role in a diverse set of cellular processes, METHODS including differentiation, mitochondrial biogenesis, cell cycle, and DNA repair.10,11 We previously showed the essential role Cell Culture of KLF15 in regulating retinoic acid–mediated podocyte differ- Conditionally immortalized human podocytes were gifts from entiation in cultured human podocytes and in proteinuric Peter Mundel (Massachusetts General Hospital, Boston, MA). murine models.9,12 In addition, we recently showed that Methods for podocyte cultivation, immortalization, and differenti- the podocyte-specific knockdown of Klf15 attenuated the salu- ation were on the basis of the previously described protocol.13 These tary effects of glucocorticoids (GCs) in the three independent cells proliferate under permissive conditions (g-IFN at 33°C) but proteinuric murine models as well as the level of KLF15 expres- differentiate under nonpermissive conditions (37°C). Podocytes at sion in human kidney biopsy specimens correlated with GC 37°C for 14 days are noted to be differentiated.13 To quantify the responsiveness in primary glomerulopathies.12 Furthermore, number of podocytes in cell culture, we followed the manufac- we observed that the knockdown of Klf15 in mice increased turer’s protocol using the Z2 Coulter Particle Counter (Beckman the susceptibility to podocyte injury in two proteinuric murine Coulter). Briefly, cells were washed with 13 PBS, trypsinized, and models and that the glomerular expression of KLF15 is reduced mixed well before addition of saline in cuvette for cell counting. in human HIVAN and FSGS.12 Conversely, overexpression of WT1 knockdowninhumanpodocyteswasperformed KLF15 in cultured human podocytes stabilized the actin cyto- using the Genecopoeia lentiviral shRNA system with the fol- skeleton and restored podocyte differentiation markers under lowing constructs: HSH01854731LVRH1MP (shRNA1,target cell stress.9,12 On the basis of these findings, we hypothesized sequence cctacagcagtgacaatttat), HSH01854732LVRH1MP that induction of KLF15 specifically in the podocytes will prevent (shRNA2, target sequence ccaacttccaagacaagatac), and the loss of podocyte differentiation markers, thereby attenuating HSH01854733LVRH1MP (shRNA3,targetsequence podocyte injury and eventual FSGS in proteinuric murine gggtgaatcttgtctaacatt). In brief, lentiviral particles were pro- models. Here, we show that, using the “tet-on” system, podocyte- duced by transfecting HEK 293T cells with a combination of specific induction of KLF15 in HIV-1 transgenic mice (Tg26, lentiviral expression plasmid DNA, pCD/NL-BH DDD pack- murine model of FSGS) abrogated podocyte injury, glomer- aging plasmid, and VSV-G–encoding pLTR-G plasmid. ulosclerosis, and tubulointerstitial fibrosis and inflammation, For human podocyte infection, viral supernatants were while improving renal function and overall survival. Enrichment supplemented with 8 mg/ml polybrene and incubated with analysis of differentially expressed genes extracted from mRNA cells for a 24-hour period. Cells expressing shRNA were se- sequencing in this model showed that podocyte- lected with puromycin for 2–3 weeks before use in all studies. specific KLF15 induction activates podocyte-specificpath- mCherry expression and Western blot were performed to ways involved in stabilization of actin cytoskeleton, focal confirm WT1 knockdown. WT1-shRNA and SC-shRNA adhesion, and podocyte differentiation. We also validated podocytes under permissive conditions were transduced with the renoprotective effects of podocyte-specific KLF15 in an LentiORF-KLF15 to overexpress KLF15,withLentiORF-EV as independent proteinuric murine model (adriamycin [ADR] control. Cells were subsequently transferred to nonpermissive treatment). Finally, we show that the salutary effects of conditions, and podocyte number was quantified after 14 days KLF15 are in part mediated by Wilms Tumor 1 (WT1), a of differentiation.

2530 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH

LentiORF-WT1 clone was purchased from Genecopoeia, and were fed with DOX in diet beginning at 4 weeks of age (unless stable WT1 overexpression was achieved by transduction human otherwise specified). podocytes using lentivirus produced from HEK 293T cells. Cells expressing GFP WT1(+KTS) were selected with puromycin ADR Treatment of Mice for 2–3 weeks before use in all studies. GFP expression and Baseline urine was collected in the PODTA and PODTA; Western blot were performed to confirm WT1 overexpression in TRE-KLF15 mice (12 weeks of age, FVB/N background). All lentiORF-WT1 compared with lentiORF-GFP human podocytes. mice were administered ADR (18 mg/kg) intravenously by tail LentiORF-WT1 and LentiORF-EV podocytes under permissive vein injection19 starting at day 7 post-DOX treatment. Urine conditions were transduced with KLF15-shRNA to knockdown was collected weekly, and all mice were euthanized at 4 weeks KLF15,withSC-shRNA as control. Cells were subsequently trans- after ADR treatment. Significant podocyte injury has been ferred to nonpermissive conditions, and podocyte number was described typically at 4 weeks after ADR treatment19;as quantified after 14 days of differentiation. such, these mice were euthanized, and kidneys were harvested for analysis at 4 weeks after ADR treatment. A schematic of the Coimmunoprecipitation ADR treatment protocol is provided (Figure 7A). We cotransfected HEK 293T cells with V5-tagged LentiORF- KLF15-V5 and LentiORF-WT1 vectors compared with LentiORF- Measurement of Urine Albumin and Creatinine EV as control. Cells were harvested 48 hours after transfection, lysed Urine albumin was quantified by ELISA using a kit from Bethyl with radioimmunoprecipitation assay buffer with protease inhibi- Laboratory Inc. Urine creatinine levels were measured in the tors, immunoprecipitated with rabbit anti-V5 antibody, and sub- same samples using the Creatinine (Urinary) Colorimetric sequently immunoblotted for mouse anti-WT1 antibody. Input Assay Kit (500701; Cayman) according to the manufacturer’s (2%) of whole-cell lysates was immunoblotted with KLF15, instruction. The urine albumin excretion rate was expressed as WT1, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) the ratio of albumin to creatinine. to detect protein expression as previously reported.14 Measurement of Serum Urea Nitrogen and Creatinine Promoter Analyses Levels Using the TRANSFAC software,15 we scanned the promoters Serum urea nitrogen levels were measured by a colorimetric of all mouse genes in the region from (22000) to the tran- detection method (Arbor Assay, Ann Arbor, MI) according to scription start site with the KLF15 position weight matrix pro- the manufacturer’s protocol. Serum creatinine levels were vided by the TRANSFAC system. Enrichment analysis was measured using the isotope dilution liquid chromatography- performed using Enrichr, and the Fisher exact test was used tandem mass spectrometer at the University of Alabama at the to determine the terms that were over-represented among the Birmingham O’Brien Core Center. genes with KLF15 binding sites.16 Isolation of Glomeruli from Mice for RNA Extraction Generation of TRE-KLF15 Mice Mouse glomeruli were isolated as described.20 Briefly, mice The TRE-KLF15 transgene contained the (TetO)7/CMV reg- were perfused with HBSS containing 2.5 mg/ml iron oxide ulatory element driving the full-length human KLF15 coding and 0.1% BSA. At the end of perfusion, kidneys were removed, sequence (CCDS 3036.1) followed by the polyadenylation decapsulated, minced into 1-mm3 pieces, and digested in signal. A map of the plasmid is provided in Supplemental HBSS containing 1 mg/ml collagenase A and 100 U/ml deoxy- Figure 1A. Transgene was purified from plasmid vector se- ribonuclease I. Digested tissue was then passed through a quences and microinjected into the pronucleus of FVB/N 100-mm cell strainer and collected by centrifugation. The pel- single-celled embryos. let was resuspended in 2 ml of HBSS, and glomeruli were NPHS2-rtTA mice (FVB/N) were acquired from Jackson collected using a magnet. The purity of glomerular was veri- Laboratory and bred with the TRE-KLF15 mice to generate fied under microscopy. Total RNA was isolated from kidney mice with both transgenes only on the FVB/N background. To glomeruli of mice using the RNAeasy kit (Qiagen). induce transgene expression, mice were fed TestDiet Modified LabDiet Rodent Diet 5001 containing 0.15% doxycycline Isolation of Primary Glomerular Epithelial Cells (DOX;El-Mel,Inc.,Florissant,MO).Experimentalmice After glomerular isolation (as described above), primary remained on DOX food continuously, as did their littermates mouse podocytes were isolated as previously described.21,22 that were analyzed for comparison. In brief, isolated glomeruli were initially cultured on collagen I–coated culture dishes in RPMI 1640 containing 10% FBS Genotyping (Cansera International) supplemented with 1% Insulin- Genotyping by Extracta DNA prep (Quanta Biosciences) from Transferin-Selenium-A liquid media supplement (Life Technolo- tails at 2 weeks of age and PCR were performed as de- gies) and 100 U/ml penicillin. Cultures were incubated in a 37°C scribed.17,18 Primers for the corresponding mice are provided humidified incubator. Subculture of primary podocytes was in Supplemental Table 5. To induce KLF15 expression, mice performed after 5 days of culture of isolated glomeruli. Cellular

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2531 BASIC RESEARCH www.jasn.org

2 outgrowths were detached with Trypsin-ethylenediaminetetra- calculated using the 2 DDCT method, and normalization was acetic acid solution (Corning) and passed through a 40-mmsieve performed against the 1:50 diluted input of DNA. to remove the remaining glomerular cores. The filtered cells were cultured on collagen I–coated dishes and processed for RNA or Luciferase Reporter Assay protein preparation. The purity of isolation was confirmed For human WT1 promoter luciferase assay, a 1.6-kb fragment of by testing for podocyte-specificmarkersbyreal-timePCRas the human WT1 promoter upstream of the ATG start codon was previously shown.9 cloned into pEZX-PG04. We cotransfected HEK 293T cells into six-well plates with pEZX-PG04-WT1 or pEZX-PG04-control Real-Time PCR and pReceiver-Lv216 (LentiORF-EV)–, pReceiver-Lv216-KLF15 Total RNA was extracted by using TRIzol (Life Technologies). (LentiORF-KLF15)–, psi-LVRH1GP-scramble–,orpsi- First strand cDNAwas prepared from total RNA (1.5 mg) using LVRH1GP-KLF15shRNA–expressing constructs. Forty-eight the SuperScript IV VILO Master Mix (Life Technologies), and hours after transfection, the Secrete-Pair Gaussia Luciferase diluted cDNA (1 ml) was amplified in triplicate using PowerUp Dual Kit (Genecopoeia) was used to determine the secreted SYBR qPCR Master Mix on an ABI QuantStudio 3 (Applied Gaussia luciferase and secreted Alkaline Phosphatase activities. Biosystems). All primers used in the studies were designed For data analysis, the values were normalized by using Gaussia using NCBI Primer-BLAST, and they were validated for effi- luciferase and secreted Alkaline Phosphatase, respectively. ciency before application (Supplemental Table 6). Light cycler analysis software was used to determine crossing points using Western Blot the second derivative method. Data were normalized to Primary mouse podocytes were lysed with a buffer containing housekeeping genes (GAPDH or b-actin) and presented as 1% Triton, a protease inhibitor cocktail, and tyrosine and serine- fold increase compared with RNA isolated from control group threonine phosphorylation inhibitors. Lysates were subjected to 2DD using the 2 CT method. immunoblotanalysisusing rabbitanti-KLF15(ABC471;Millipore), rabbit anti-WT1 (13580S; Cell Signaling Technology), rabbit Chromatin Immunoprecipitation Assay anti–b-actin (A1978; Sigma-Aldrich), and mouse anti- Before performing the chromatin immunoprecipita- GAPDH (MAB374; Millipore). Densitometry was performed tion (ChIP) assay, immortalized human podocytes with to quantify the change in expression by ImageJ. LentiORF-KLF15-V5 tag or empty vector (EV)control were differentiated at 37°C for 14 days and then treated Light Microscopy with ADR or vehicle for 24 hours. The ChIPassay was performed Mice were perfused with HBSS. The kidneys were fixed in 10% using a kit from Cell Signaling Technology as per the manufac- phosphate-buffered formalin overnight and switched to 70% turer’s protocol. Briefly, 23107 cultured human podocytes were ethanol before processing for histology. Kidney tissue was em- crosslinked with 1% formaldehyde for 10 minutes followed by bedded in paraffin by American Histolabs, and 3-mm-thick the addition of 1/10 volume of 1.25 M glycine to quench un- sections were stained with periodic acid–Schiff and Masson reacted formaldehyde. Cells were lysed using a series of lysis Trichrome (Sigma-Aldrich). buffers as per the manufacturer’s protocol. Chromatin extracted from the lysed cells was digested with Micrococcal nuclease and Transmission Electron Microscopy sonicated using a Sonic Dismembrator 550 sonicator (Fisher Mice were perfused with PBS and then immediately fixed Scientific) with microtip to generate chromatin fragments of in 2.5% glutaraldehyde for electron microscopy as previously between 150 and 1000 bp. Immunoprecipitation of KLF15- described.17 After embedding of kidney tissues in epoxy resin, crosslinked chromatin was carried out using rabbit anti-V5 ultrathin sections were stained with uranyl acetate and lead (ab15828; Abcam) antibody. To control for nonspecificIgG citrate, mounted on a copper grid, and photographed under a binding, normal rabbit IgG (Cell Signaling Technology) was Hitachi H7650 microscope. Briefly, negatives were digitized, used. After incubation of chromatin with antibody at 4°C over- and images with a final magnitude of approximately 18,500 night, protein G–coupled magnetic beads were added and were obtained. Podocyte effacement was quantified as previ- further incubated for 2 hours; then, the beads were washed sev- ously described.23 eral times, and immunoprecipitated chromatin complexes were eluted from the beads. DNA-protein crosslinks were reversed by Immunofluorescence and Immunohistochemistry incubation at 65°C for 16 hours, and then, RNAase A and pro- Specimens were initially baked for 60 minutes in a 55°C to 60°C teinase K were added sequentially to remove RNA and proteins. oven and then processed as previously described.18,24 Briefly, Purified DNA was used for the analysis of the WT1 proximal formalin-fixed and paraffin-embedded sections were deparaffi- promoter region by real-time PCR on an ABI QuantStudio 3 nized, and endogenous peroxidase was inactivated with H2O2. RT-PCR system using PowerUp SYBR Green Master Mix. PCR All kidney sections from these mice were prepared in identical primers for the KLF15 binding sites in the human WT1 pro- fashion. Similarly, all paraffin-embedded human kidney biopsy moter region are listed in Supplemental Table 7. The relative specimens were prepared in identical fashion. Immunofluores- amplification of the promoter sequence of each site was cence was performed using polycolonal rabbit anti-KLF15

2532 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH

(GenScript Inc.), mouse anti-WT1 (SC-7385; Santa Cruz), rabbit method.28 Enrichment analyses of the differentially expressed anti-Nephrin (ALX-810–016-R100; Enzo Life Sciences), goat anti- genes were performed with Enrichr.16,29 The single-cell Synaptopodin (sc21537; Santa Cruz), mouse anti–Gr-1 (RB6–8C5; RNA sequencing raw data are available in the Gene Expression Abd Serotec), mouse anti–Claudin-1 (sc81796; Santa Cruz), rat Omnibus database (accession no. GSE117987). anti-CD44 (103001; BioLegend), rabbit anti-Ki67 (Biocare), mouse anti-aSMA (A5228; Sigma-Aldrich), and rabbit antiphospho– Statistical Analyses b-catenin (Ser552; 9566S; Cell Signaling Technology). After A t test was used to compare continuous data between two washing, sections were incubated with the appropriate groups, and two-way ANOVA with Tukey post-test was used fluorophore-linked secondary antibody (Alexa Fluor 488 to compare continuous data between more than two groups. donkey anti-chicken IgG; Jackson Immune Research and Alexa Because we could not assume normality on some of the other Fluor 679 donkey anti-mouse, Alexa Fluor 568 donkey anti- datasets with smaller sample sizes, nonparametric statistical goat IgG, and Alexa Fluor 568 donkey anti-rabbit from Life tests were performed using the Mann–Whitney test to com- Technologies). After counterstaining with Hoechst (Thermo pare continuous data between two groups and Kruskal–Wallis Fisher), slides were mounted in Prolong Gold mounting test with Dunn post-test to compare continuous data between media (Thermo Fisher) and photographed under a Nikon more than two groups. The exact test used for each experiment Eclipse 90i microscope with a digital camera. is denoted in the figure legends, and data were expressed as the mean6SEM. All experiments were repeated a minimum of EdU Injection and EdU Click-iT Reaction three times, and representative experiments are shown. Statis- To label proliferated cells, a single intraperitoneal injection of tical significance was considered when P,0.05. All statistical EdU (1 mg per mouse) in sterile PBS was administered to each analyses were performed using GraphPad Prism 7.0. mouse 3 hours before perfusion. Determination of the significance of overlap between gene EdU incorporation into DNA was detected using the Click- sets was on the basis of a hypergeometric test performed using iT EdUAlexa Fluor 647 Imaging Kit (Invitrogen). The Click-iT the phyper function on R (phyper(q,m,n,k,lower.tail = kit was removed from 220°C storage and allowed to thaw in a FALSE): q = overlap between gene sets 1 and 2, m = number light-protected box. The amount of reaction cocktail needed of genes in set 1, n = total number of genes in genome or being was determined and made according to the chart. Tissues were compared, k = number of genes in set 2). then incubated in the EdU cocktail for 20 minutes at room temperature, protected from light, and subsequently rinsed Study Approval three times in TBST for 5 minutes per rinse. On completion Stony Brook University Animal Institute Committee approved of the EdU Click-iTreaction, tissues were mounted in Prolong all animal studies, and the National Institutes of Health Guide Gold mounting media onto glass slides. for the Care and Use of Laboratory Animals was followed strictly. Quantification of Immunostaining Quantification of KLF15 staining in the podocytes was deter- mined by quantifying the intensity of KLF15 staining (OD) in RESULTS +WT1+Hoechst staining using ImageJ 1.26t software (National Institutes of Health; rsb.info.nih.gov/ij). Gr-1 staining Podocyte-Specific KLF15 Induction in Mice was quantified by counting the number of Gr-1+ cells per high- Our recent findings suggest that the loss of Klf15 increases power field (30 high-power field micrographs at a final magni- the susceptibility to podocyte injury in proteinuric murine fication of approximately 320 were used). Quantification of models.12 Furthermore, we recently observed that KLF15 is Nephrin, Synaptopodin, and aSma staining was performed required to mediate the renoprotective effects of retinoic acid by measuring area staining using ImageJ.12 Quantification of and GCs.9,12 As such, we hypothesized that the induction of Claudin-1, Ki67, and EdU staining was determined by calculat- human KLF15 specifically in the podocyte might prevent ing the percentage of glomeruli with +Claudin-1, +Ki67, and podocyte injury in proteinuric murine models. Because KLF15 +EdU staining. is expressed in several cell types in the kidney,9,14 we initially generated mice with podocyte-specific expression of human RNA Sequencing and Enrichment Analyses KLF15 (KLF15)usingthe“tet-on” system on the FVB/N back- RNA sequencing data were processed as previously de- ground, where the binding of chimeric tetracycline transactivator scribed.25 Briefly, sequencing reads were first aligned to the protein (rtTA) to tet-operator and gene activation only occurs in mouse genome (mm10) using Spliced Transcripts Alignment thepresenceofDOX(SupplementalFigure1A).Webredthe to a Reference (STAR 2.4.1c).26 Aligned reads were then quan- TRE-KLF15 mice with the Podocin-rtTA (PODTA)micetogen- tified to the transcriptome (UCSC mm10 annotation) at the erate mice with podocyte-specific expression of KLF15 in the gene level using featureCounts (v1.4.6).27 Read counts were setting of DOX administration on the FVB/N background strain. normalized to count per million, and differentially expressed Real-time PCR and Western blot confirmed the increased expres- genes were identified using the Characteristic Direction sion of KLF15 in glomeruli and glomerular epithelial cells (GECs)

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2533 BASIC RESEARCH www.jasn.org

Figure 1. Podocyte-specific induction of Krüppel-like factor 15 (KLF15) attenuates kidney injury and improves overall survival in Tg26 mice. Podocin-rtTA (PODTA), PODTA;TRE-KLF15, Tg26;PODTA,andTg26;PODTA;TRE-KLF15 mice were treated with doxycycline at 4 weeks of age and euthanized at 12 weeks of age. (A) Nef and Vpr mRNA expressions were measured in glomerular fractions (n=8). ND, not determined. **P,0.01 versus PODTA and PODTA;TRE-KLF15 mice (Kruskal–Wallis test with Dunn post-test). (B) Albuminuria was measured at 4, 7, and 10 weeks of age in all four groups (n=8). *P,0.05 versus PODTA and PODTA;TRE-KLF15 mice (Kruskal– Wallis test with Dunn post-test); **P,0.01 versus all other groups (Kruskal–Wallis test with Dunn post-test). (C) Serum urea nitrogen and (D) serum creatinine were measured at 12 weeks of age in all four groups (n=8). **P,0.01 (Kruskal–Wallis test with Dunn post-test). (E) Survival curves for all four groups are shown until age 12 weeks old (log rank [Mantel–Cox] test). ***P,0.001. compared with the tubular compartment or other tissues fractions (Nef and Vpr) between DOX-treated Tg26;PODTA and Tg26; (i.e., liver lysates) (Supplemental Figure 1, B and C). Furthermore, PODTA;TRE-KLF15 mice, suggesting that the observed phe- podocyte-specific induction of KLF15 was validated notypic changes are not due to altered viral gene expression by immunostaining and colocalizing KLF15 with WT1 (Figure 1A). Before DOX treatment, both Tg26;PODTA and (podocyte-specific marker) (Supplemental Figure 1D). At base- Tg26;PODTA;TRE-KLF15 mice exhibited a significant in- line, DOX-treated PODTA;TRE-KLF15 mice were viable and crease in albuminuria at 4 weeks of age compared with PODTA showed no significant changes in proteinuria or podocyte injury or PODTA;TRE-KLF15 mice (Figure 1B). However, adminis- compared with the DOX-treated PODTA or TRE-KLF15 mice. tration of DOX significantly reduced albuminuria in Tg26; PODTA;TRE-KLF15 mice compared with Tg26;PODTA mice Podocyte-Specific KLF15 Induction Attenuates Kidney by 10 weeks of age (Figure 1B). In addition, induction of Injury in Tg26 Mice KLF15 improved renal function as determined by a reduction To assess the renoprotective role of podocyte-specific KLF15, in serum urea nitrogen and creatinine, while also improving we initially used HIV-1 transgenic (Tg26) mice. Tg26 mice are overall survival in the Tg26 mice (Figure 1, C–E). Interestingly, known to develop significant podocyte injury, extensive pro- nonsurviving Tg26;PODTA mice exhibited an increase in al- teinuria, and collapsing FSGS starting at 4–6 weeks of age.30 buminuria compared with surviving Tg26;PODTA mice at 10 Furthermore, glomerular KLF15 expression is reduced in Tg26 weeks of age, suggesting that underlying kidney disease mice compared with wild-type mice.12 We bred the PODTA; might be driving reduced survival in these mice (Supplemental TRE-KLF15 mice with the Tg26 mice to generate the PODTA, Figure 2). Periodic acid–Schiff and Masson Trichrome staining PODTA;TRE-KLF15, Tg26;PODTA,andTg26;PODTA; showed a significant increase in glomerulosclerosis, tubulocystic TRE-KLF15 (all mice on the FVB/N background). We ob- dilation with proteinaceous casts, and interstitial inflammation served no significant changes in viral gene expression and fibrosis in the Tg26;PODTA,whichweresignificantly

2534 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH

Figure 2. Podocyte-specific induction of Krüppel-like factor 15 (KLF15) attenuates glomerulosclerosis and tubulointerstitial in- flammation and fibrosis in Tg26 mice. Podocin-rtTA (PODTA), PODTA;TRE-KLF15, Tg26;PODTA,andTg26;PODTA;TRE-KLF15 mice were treated with doxycycline at 4 weeks of age and euthanized at 12 weeks of age. All mice were euthanized and renal cortex fixed for histology. Periodic acid–Schiff and Masson Trichrome staining was performed to evaluate for tubulointerstitial changes. The repre- sentative images from four mice in each group are shown. Arrowheads show sclerotic glomeruli. *Tubulocystic dilation and pro- teinaceous casts; #interstitial inflammation and fibrosis. improved in the Tg26;PODTA;TRE-KLF15 mice at 12 weeks of In combination with a loss in podocyte differentiation markers age (Figure 2). These histologic changes were also quantified by and collapsing FSGS lesions, previous studies have shown an an independent renal pathologist in a blinded fashion (Supple- increase in GEC proliferation in the Tg26 mice.32–34 Similarly, mental Table 1). we observed an increase in GEC proliferation as determined by Because initial podocyte injury is a key driver of eventual an increase in glomerular Claudin-1 expression and percentage FSGS in Tg26 mice31 and the podocyte-specific expression of of glomeruli with Ki67+ cells in the Tg26;PODTA mice com- KLF15 attenuated glomerulosclerosis in the Tg26 mice, we pared with all other groups (Figure 3D). Conversely, glomerular inspected each group of mice for the extent of podocyte injury. Claudin-1 expression and percentage of glomeruli with Ki67+ Initially, we observed a significant improvement in foot pro- cells were significantly reduced in the Tg26;PODTA;TRE-KLF15 cess effacement in the Tg26;PODTA;TRE-KLF15 mice com- mice compared with Tg26;PODTA mice, which was further val- pared with Tg26;PODTA mice (Figure 3A). Furthermore, idated with a reduction in the percentage of glomeruli with mRNA expression of mature differentiated podocyte markers EdU+ cells (Figure 3D). Because Claudin-1 can be expressed (Nephrin, Podocin, Synaptopodin,andWt1) was increased in in injured podocytes as well as activated parietal epithelial cells the Tg26;PODTA;TRE-KLF15 compared with Tg26;PODTA (PECs),35,36 we stained for CD44, a marker of activated PECs, mice (Figure 3B). In addition, Tg26;PODTA;TRE-KLF15 to show that podocyte-specific induction of KLF15 reduces mice exhibited an increase in Nephrin and Synaptopodin pro- the percentage of glomeruli with activated PECs in Tg26 mice tein expression compared with Tg26;PODTA mice (Figure 3C). (Supplemental Figure 3).

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2535 BASIC RESEARCH www.jasn.org

Figure 3. Podocyte-specific induction of Krüppel-like factor 15 (KLF15) restores podocyte differentiation markers in Tg26 mice. Podocin-rtTA (PODTA), PODTA;TRE-KLF15, Tg26;PODTA,andTg26;PODTA;TRE-KLF15 mice were treated with doxycycline (DOX) at 4 weeks of age and euthanized at 12 weeks of age. (A) Electron microscopy was performed to determine the extent of foot process ef- facement. The left panel shows representative images (318,500) from each of the four groups. The right panel shows quantification of foot process width (n=6). *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 (Kruskal–Wallis test with Dunn post-test). (B) Glomeruli were isolated and RNA was extracted for real-time PCR. Nephrin, Podocin, Synaptopodin (Synpo), and Wilms Tumor 1 (Wt1)mRNAex- pression levels are shown relative to DOX-treated PODTA mice (n=6). *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 versus all other groups (Kruskal–Wallis test with Dunn post-test). (C) Immunostaining for Nephrin and Synpo was performed. The upper panel shows representative images from six mice in each group (320). The glomerular region was selected, and OD was measured and quantified as a relative fold change to DOX-treated PODTA mice for Nephrin and Synpo (lower panel; n=6). **P,0.01 versus all other groups (Kruskal– Wallis test with Dunn post-test). (D) Immunostaining for Claudin-1 and Ki67 was performed. The upper panel shows representative images from six mice in each group (320). The lower left panel shows fold change in glomerular Claudin-1 expression (n=6). The lower right panel shows the percentage of Ki67+ glomeruli (n=6). *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 (Kruskal–Wallis test with Dunn post-test). D, Inset shows the percentage of EdU+ glomeruli in Tg26;PODTA,andTg26;PODTA;TRE-KLF15 mice (n =6).**P,0.01 (Mann– Whitney test).

Because we observed an improvement in interstitial fibrosis (Supplemental Figure 4B). We subsequently evaluated the ex- and inflammation in the Tg26 mice with podocyte-specific pression of key inflammatory markers (Il-1, Tnf-a, Ifn-g, Il-6, KLF15 induction, we interrogated the change in expres- Tnfr1,andTnfr2) in the renal cortex, which were examined sion of specific fibrotic and inflammatory markers. We previously in Tg26 mice.37 Tg26;PODTA mice showed an in- observed a significant reduction in the expression of fibrotic crease in Il-1, Tnf-a, Il-6,andTnfr2, which was reduced in the markers (Fibronectin, Col1a1, Vimentin,andaSma)inTg26; Tg26;PODTA;TRE-KLF15 mice (Supplemental Figure 4C). PODTA;TRE-KLF15 compared with Tg26;PODTA mice (Sup- Furthermore, Tg26;PODTA mice exhibited an increase in plemental Figure 4A). In addition, immunostaining for aSMA Gr-1+ cells in the renal cortex, which was reduced with validated its reduced expression with induction of KLF15 KLF15 induction (Supplemental Figure 4D). Finally, previous

2536 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH studies have shown that dysregulation of Wnt/b-catenin sig- podocyte phenotype in Tg26;PODTA;TRE-KLF15 mice com- naling contributes to kidney injury observed in the Tg26 pared with Tg26;PODTA mice by real-time PCR (Supplemen- mice.38 Furthermore, we recently observed that KLF15 binds tal Figure 6). Specifically, Thrombospondin 1, a critical cell and attenuates the activation of Wnt/b-catenin signaling.14 matrix glycoprotein implicated in proteinuric kidney dis- Interestingly, we observed a significant reduction in down- ease,42–44 was markedly increased in Tg26;PODTA mice by stream Wnt/b-catenin targets (c-Myc, Tcf7l2,andLef1)as RNA sequencing and real-time PCR, but expression levels well as nuclear colocalization of active phospho–b-catenin were reduced with podocyte-specific KLF15 induction (Sup- (Ser552) in the Tg26;PODTA;TRE-KLF15 mice compared plemental Figure 6, Supplemental Table 3). These data indi- with the Tg26;PODTA mice (Supplemental Figure 5). Com- cate that the podocyte-specific induction of KLF15 rescues bined, these findings suggest that podocyte-specific induction podocytes from injury in the Tg26 mice by upregulating genes of KLF15 restored podocyte differentiation markers and im- critical to maintaining podocyte differentiation and prevent- proved glomerular and tubulointerstitial injury in Tg26 mice. ing cell detachment and effacement.

Induction of KLF15 in Tg26 Mice Activates Pathways Salutary Effects of KLF15 Are Partially Mediated Specific to Actin Cytoskeleton, Focal Adhesion, and by WT1 Differentiation Although we previously reported that KLF15 might transcrip- Because we observed that podocyte-specific induction of tionally regulate some of the mature podocyte differentiation KLF15 ameliorated kidney injury and improved overall sur- markers by ChIP studies,12 the mechanism by which these vival in the Tg26 mice, we sought to determine the changes other differentially expressed genes are regulated by KLF15 that occur at the transcriptome level mediated by KLF15 in the remains unclear. To identify additional mechanisms by which setting of podocyte injury. To investigate the renoprotective KLF15 restores genes essential to podocyte differentiation and pathways mediated by KLF15, we initially performed mRNA structural integrity, we performed ChIP enrichment analysis45 sequencing in glomerular extracts from all four groups of to identify other transcription factors that might coregulate or DOX-treated mice at 12 weeks of age (PODTA, PODTA; mediate the renoprotective effects of KLF15. The ChIP enrich- TRE-KLF15, Tg26;PODTA,andTg26;PODTA;TRE-KLF15 ment analysis output, given the 149 differentially upregulated mice). Initially, we visualized the expression profiles of 600 genes in the Tg26;PODTA;TRE-KLF15 mice compared with differentially expressed genes between Tg26;PODTA and Tg26; Tg26;PODTA mice, revealed WT1 as the most statistically sig- PODTA;TRE-KLF15 groups (Figure 4A). The ranked differen- nificant transcription factor (Fisher exact test, P value of tially expressed upregulated and downregulated genes be- ,0.001) to cobind to the promoter of the same set of genes tween the Tg26;PODTA and Tg26;PODTA;TRE-KLF15 groups (Figure 5A). To determine the genes that are transcriptionally are provided in Supplemental Tables 2 and 3. Next, we per- coregulated by KLF15 and WT1, KLF15 only, or WT1 only, we formed gene list enrichment analysis by applying the tool En- also performed TRANSFAC position weight matrix analysis46 richr16 to the list of genes differentially upregulated in Tg26; to identify which of these differentially upregulated genes PODTA;TRE-KLF15 compared with Tg26;PODTA glomerular (minimum of 1.2-fold change) possesses transcriptional bind- fractions. Enrichment analysis against the gene set libraries ing sites for KLF15 (Supplemental Table 4). We subsequently WikiPathways,39 NCI-Nature Pathway Interaction Data- compared this list of KLF15 target genes to the WT1 ChIP base,40 and KEGG pathways41 revealed a significant increase sequencing database deposited in the Sequence Read Archive in pathways involved in podocyte differentiation, Integrin sig- of NCBI (25; series GSE64063). Of the 149 upregulated tran- naling, VEGF-VEGFR signaling, Semaphorin interactions, scripts, 108 had WT1 binding sites (P value of ,0.001), and 50 and circadian rhythm signaling (Figure 4B). Furthermore, had KLF15 binding sites (P value of 0.003), with 39 genes Gene Ontology Cellular Component enrichment analysis of having both WT1 and KLF15 binding sites (P value of these differentially expressed genes identified enrichment in 0.003) (Figure 5, B–D). Furthermore, we previously showed cell-cell junction, adherens junction, anchoring junction, and that Wt1 expression is increased with KLF15 induction in the focal adhesion (Figure 4C). Interestingly, the majority of the Tg26 mice (Figure 3B), which was also confirmed with mRNA differentially upregulated genes in Tg26;PODTA;TRE-KLF15 sequencing (Figure 4D). These findings suggest that WT1 mice are markers of mature differentiated podocytes as well as might coregulate as well as mediate the KLF15 transcriptional genes critical for preventing effacement and detachment of network required to prevent glomerulosclerosis in the Tg26 podocytes (Figure 4, D and E). We also validated several of mice. these differentially expressed genes (Nephrin, Podocin, Synap- To determine whether the renoprotective effects of KLF15 topodin,andWt1) that were significantly increased in Tg26; are in part mediated by WT1, we initially generated human PODTA;TRE-KLF15 mice compared with Tg26;PODTA mice podocytes with stable knockdown for WT1 using three shRNA by real-time PCR (Figure 3B). In addition, we further vali- constructs: WT1-shRNA1, WT1-shRNA2,andWT1-shRNA3. dated several of these key upregulated (Cdkn1c, Clic5, Inf2, Although all three constructs achieved significant knockdown Plc«1, Veg fa,andPodxl) and downregulated (Neat1, Throm- in WT1 expression by real-time PCR (Supplemental Figure bospondin 1,andEgr1) genes involved in restoring the mature 7A), the WT1-shRNA1 cell line exhibited a more robust

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2537 BASIC RESEARCH www.jasn.org

Figure 4. Differentially expressed genes with enrichment analysis demonstrates upregulation of genes critical to maintaining podocyte differentiation and preventing cell detachment and effacement. Podocin-rtTA (PODTA) (lane 1), PODTA;TRE-KLF15 (lane 2), Tg26;PODTA (lane 3), and Tg26;PODTA;TRE-KLF15 (lane 4) mice were treated with doxycycline at 4 weeks of age and euthanized at 12 weeks of age. Glomeruli were isolated, and RNA was extracted for mRNA sequencing (n=3 per group). (A) Heat map analyses of all 600 transcripts differentially expressed between the Tg26;PODTA (lane 3) and Tg26;PODTA;TRE-KLF15 (lane 4) mice are shown in all four groups. (B) A combination of WikiPathway, KEGG Pathways, and NCI-Nature PID enrichment analyses of differentially expressed transcripts upregulated in the Tg26;PODTA;TRE-KLF15 (lane 4) compared with Tg26;PODTA (lane 3). (C) Gene ontology analysis of differentially expressed transcripts upregulated in the Tg26;PODTA;TRE-KLF15 (lane 4) compared with Tg26;PODTA (lane 3). (D) Heat map analysis of the average expression of differentially expressed transcripts related to podocyte-specific pathways between all four groups. (E) Heat map of the av- erage expression of differentially expressed transcripts related to integrin signaling pathways between all four groups.

knockdowninWT1proteinexpressioncomparedwith KLF15 are in part mediated by WT1, we postulated that over- EV-shRNA (control) cells by Western blot (Supplemental Fig- expression of KLF15 will not completely rescue WT1-shRNA1 ure 7B). Because WT1 expression is required for podocyte podocytes from cell death under nonpermissive conditions. differentiation,47,48 we initially interrogated the role of WT1 To assess this, we overexpressed KLF15 (lentiORF-KLF15)in under permissive (33°C) and nonpermissive (37°C) condi- WT1-shRNA1 and EV-shRNA podocyte lines and assessed for tions. Although all cell lines exhibited no significant changes cell survival under nonpermissive conditions. Validation of in survival during permissive conditions, under nonpermis- KLF15 overexpression by Western blot has been previously sive conditions, the WT1-shRNA1 podocytes exhibited a sig- reported.9 Although KLF15 overexpression partially improved nificant reduction in survival compared with EV-shRNA po- survival of WT1-shRNA1 cells, knockdown of WT1 reduced docytes (Figure 6A), suggesting that WT1 is required for cell podocyte survival compared with control cells, regardless of differentiation. We previously observed a similar phenotype KLF15 overexpression under nonpermissive conditions (Fig- with KLF15 knockdown under nonpermissive conditions.9 ure 6A). These findings show that KLF15 overexpression only Because we hypothesized that the renoprotective effects of partially rescues the detrimental effects of WT1 knockdown in

2538 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH

Figure 5. Wilms Tumor 1 (WT1) mediates the Krüppel-like factor 15 (KLF15) transcriptome. (A) Chromatin immunoprecipitation (ChIP) enrichment analysis of the differentially upregulated genes in glomerular extracts from the Tg26;Podocin-rtTA (PODTA);TRE-KLF15 mice compared with the Tg26;PODTA mice. We subsequently crossmatched with the previously experimentally validated WT1 ChIP- seq data70 with predicted KLF15 binding sites (TRANSFAC promoter analysis). (B) The Venn diagram shows the overlap in KLF15 and WT1 binding sites (BSs) in the differentially upregulated genes. In addition, the heat map shows the differentially upregulated genes (with a minimum of a 1.2-fold change) in the Tg26;PODTA;TRE-KLF15 mice compared with the Tg26;PODTA mice (C) with KLF15 binding sites and (D) without KLF15 binding sites. Genes shown in green are WT1 binding class 2 (WT1 binding sites in the promoter region). Genes shown in yellow are WT1 binding class 1 (WT1 binding sites at any location). Genes shown in black are WT1 binding class 0 (no WT1 binding sites).

podocytes under nonpermissive conditions, suggesting that the podocytes, we measured the mRNA expression of both WT1 WT1 might be required for the salutary effects of KLF15 in isoforms in the previous Tg26 model. We observed a significant the podocyte. increase in the WT1(+KTS) isoform in the DOX-treated Tg26; As we previously observed, knockdown of KLF15 contributes PODTA;TRE-KLF15 mice compared with the DOX-treated to the loss of podocyte differentiation markers and increases cell Tg26;PODTA mice (Supplemental Figure 7C). Therefore, we death under nonpermissive conditions.9 Because some of the overexpressed WT1(+KTS)(lentiORF-WT1)inKLF15-shRNA genes regulated by KLF15 might in part be mediated by WT1, and Scramble-shRNA podocyte lines and assessed for cell survival we postulated that overexpression of WT1 will partially rescue under nonpermissive conditions. Validation of WT1(+KTS) KLF15-shRNA podocytes from cell death under nonpermis- overexpression was confirmed by Western blot (Supplemental sive conditions. The most common isoforms of WT1 are Figure 7D). Under nonpermissive conditions, KLF15-shRNA; WT1(+KTS) and WT1(2KTS). To determine which isoform lentiORF-WT1 podocytes exhibited improved survival com- is involved in the maintenance of the KLF15 transcriptome in pared with KLF15-shRNA;lentiORF-EV podocytes (Figure 6B).

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2539 BASIC RESEARCH www.jasn.org

Figure 6. Krüppel-like factor 15 (KLF15) regulates Wilms Tumor 1 (WT1) expression. Human podocytes with WT1 knockdown (WT1- shRNA)andKLF15 overexpression (LentiORF-KLF15) along with the corresponding controls (SC-shRNA, LentiORF-EV) were gener- ated. Human podocytes were transferred from 33°C (permissive) to 37°C (nonpermissive) to induce cell differentiation. (A) Cell survival was determined by counting the number of cells at 14 days at 37°C (n=6). *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 (Kruskal–Wallis test with Dunn post-test). (B) Conversely, human podocytes with KLF15 knockdown (KLF15-shRNA)andWT1 over- expression (LentiORF-WT1) along with the corresponding controls were generated. Cell survival was determined by counting the number of cells at 14 days at 37°C (n=6). *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 (Kruskal–Wallis test with Dunn post-test). (C) Subsequently, chromatin immunoprecipitation assay was performed to show the presence of KLF15 binding in the WT1 promoter in LentiORF-EV and LentiORF-KLF15-V5 cells treated with adriamycin (ADR) compared with vehicle (VEH) treatment. Im- munoprecipitation with IgG and V5 was performed. IgG serves as control (n=6). TSS, transcription start site. *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 (Kruskal–Wallis test with Dunn post-test); ***P,0.001 (Kruskal–Wallis test with Dunn post-test). (D) Human podocytes were transfected with reporter construct directed at the WT1 promoter region (pEZX-PG04-WT1) or empty vector (pEZX-PG04-EV). Fold induction in WT1 promoter activity is shown with KLF15 knockdown (KLF15-shRNA)andKLF15 overexpression (LentiORF-KLF15) compared with their respective controls (n=6). GLuc, Gaussia luciferase; SEAP, secreted Alkaline Phosphatase. ***P ,0.001 (two-way ANOVA test with Tukey post-test).

Similar to the effects of KLF15 overexpression in WT1 knock- occupies the promoter region of WT1 (Figure 6C). We inter- down podocytes, WT1 overexpression partially attenuated the rogated regions in the WT1 promoter predicted to be occupied detrimental effects of KLF15 knockdown under nonpermissive by KLF15 using the previously reported KLF15 consensus conditions, suggesting that KLF15 and WT1 are both required binding sequence12 (Figure6C).Wealsodeterminedthat for the maintenance of podocyte differentiation markers. KLF15 binding to the WT1 promoter is reduced with ADR Todetermine the mechanism by which WT1 might mediate treatment compared with vehicle treatment, suggesting that the KLF15 transcriptome, we overexpressed KLF15 and per- cell stress might attenuate the transcriptional regulatory role formed ChIP followed by real-time PCR to show that KLF15 of KLF15 on WT1 in podocytes. To further investigate the

2540 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH mechanism by which KLF15 induces WT1 expression, we trans- required for maintenance of the mature podocyte. We previ- fected HEK 293T cells with reporter construct directed at the ously showed that the global loss of Klf15 in mice increased the WT1 promoter region (pEZX-PG04-hWT1), 1.6 kb upstream of susceptibility to podocyte injury in proteinuric murine mod- the WT1 transcription start site, and investigated the change in els.12 In addition, we recently reported that podocyte-specific WT1 promoter activity with modulation of KLF15 expression. Klf15 was required to mediate the direct salutary effects of GCs in WT1 promoter activity was significantly increased in pEZX- proteinuric murine models.9 Here, we show that podocyte- PG04-hWT1 cells with KLF15 overexpression compared with specific induction of KLF15 attenuated podocyte injury, glomer- control cells, which were attenuated in cells with KLF15 knock- ulosclerosis, and tubulointerstitial inflammation and fibrosis down (Figure 6D). We also determined that there are no signif- while improving survival in Tg26 mice. We also observed that icant protein-protein interactions between KLF15 and WT1 podocyte-specific induction of KLF15 activated pathways in- under basal conditions by overexpressing KLF15 and WT1 volved in focal adhesion, stabilization of actin cytoskeleton, and immunoprecipitating KLF15 with anti-V5 antibody and and restoration of podocyte differentiation markers. immunoblotting for WT1 (Supplemental Figure 8). Combined, The expression of several key transcription factors is critical these findings suggest that the renoprotective effects of KLF15 for podocyte development as well as maintenance of the po- under podocyte stress are in part mediated through the activa- docyte transcriptome in adult mice.5 Furthermore, recent tion of the WT1 transcriptional network. studies by Hayashi et al.50 showed that podocyte-specificin- duction of KLF4 ameliorated podocyte injury after ADR treat- Podocyte-Specific KLF15 Induction Attenuates ment. However, to date, this is the first study to show that Podocyte Injury in ADR-Treated Mice induction of a zinc finger transcription factor specifically in To validate that the renoprotective effects of KLF15 extend to the podocyte attenuated kidney injury in a murine model of other proteinuric murine models, we used the ADR-induced collapsing FSGS. Tg26 mice lose their mature podocyte differ- podocyte injury model. Although mice on the FVB/N back- entiation markers and develop significant albuminuria with ground are resistant to classic FSGS with ADR treatment,49 early FSGS lesions by 4 weeks of age, but significant glomer- previous studies have shown that treatment with ADR at 18 ulosclerosis and tubulointerstitial fibrosis do not occur until mg/kg induces albuminuria with extensive podocyte efface- later age.52 We observed that podocyte-specific induction of ment on the FVB/N background.19,50 We initially determined KLF15 at 4 weeks prevented worsening of FSGS and develop- that glomerular KLF15 expression is reduced in ADR-treated ment of tubulointerstitial fibrosis, while improving overall wild-type mice compared with vehicle-treated wild-type mice survival. We suspect that this improvement in renal disease (Supplemental Figure 9A). To assess whether podocyte- directly reduced mortality in these Tg26 mice, because induc- specific induction of KLF15 attenuates ADR-induced ne- tion of KLF15 was specific to the podocyte. Future studies will phropathy, 12-week-old PODTA and PODTA;TRE-KLF15 focus on whether induction of KLF15 in older Tg26 mice will mice were administered DOX for 7 days before treatment reverse glomerulosclerosis and tubulointerstitial fibrosis. In with ADR. A schematic of the treatment protocol is provided addition, this will also need to be tested in other FSGS murine (Figure 7A), with a detailed description of the protocol in models, such as ADR-induced nephropathy on the BALB/c Methods. At 4 weeks post-ADR administration, ADR-treated background, to determine whether podocyte-specific induction PODTA;TRE-KLF15 mice exhibited a significant reduction in of KLF15 can reverse sclerotic lesions consistent with FSGS after albuminuria and podocyte effacement compared with in ADR administration. Finally, DOX-inducible podocyte-specific ADR-treated PODTA mice (Figure 7, B–D). Finally, previously induction of KLF15 was generated using the Podocin promoter, reported expression arrays from isolated glomeruli in human because both the Tg26 and PODTA mice were on the FVB/N kidney biopsies with MCD and diabetic kidney disease also background. Additional studies will also need to be performed show a reduction in glomerular KLF15 expression compared to validate our findings with other podocyte-specificpromoters with healthy donor nephrectomies (Supplemental Figure on the FVB/N background. 9B).51 Combined, these findings suggest that the renoprotec- We previously showed that Klf15 expression is reduced in tive effects of podocyte-specific induction of KLF15 in Tg26 Tg26 mice and that the loss of Klf15 increases the susceptibility mice might extend to other proteinuric murine models. to podocyte injury.12 Here, we observed that induction of KLF15 in podocytes abrogated this injury in two proteinuric models, suggesting that KLF15 might have a therapeutic role DISCUSSION in several other glomerular diseases. Similar to HIVAN and FSGS,12 analysis of expression arrays from Ju et al.51 showed a A large body of evidence has shown that initial podocyte injury decrease in glomerular KLF15 expression in MCD and dia- and subsequent loss of mature differentiation markers directly betic kidney disease. On the basis of these data, examining the contribute to the development of FSGS. Identification of mechanisms by which podocyte-specific KLF15 ameliorates targets to ameliorate podocyte injury in proteinuric diseases these other glomerular diseases will be a focus of future inves- has focused recently on stabilizing the actin cytoskeleton and tigations. Along with other laboratories, we have shown that enhancing the expression of critical structural proteins GCs and retinoic acid are potent inducers of KLF15

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2541 BASIC RESEARCH www.jasn.org

Figure 7. Podocyte-specific induction of Krüppel-like factor 15 (KLF15) attenuates podocyte injury in an adriamycin (ADR)-induced proteinuric murine model. Podocin-rtTA (PODTA)andPODTA;TRE-KLF15 mice were initially fed doxycycline (DOX) at 12 weeks of age for 1 week before treatment with ADR (18 mg/kg). Urine was collected weekly, mice were euthanized, and renal cortex was fixed for histology 4 weeks post-ADR treatment. (A) A schematic diagram of the experimental protocol is shown. (B) Albuminuria (urine albumin- to-creatinine ratio) was measured (n=6). *P,0.05 (Kruskal–Wallis test with Dunn post-test). (C) Electron microscopy was performed to assess ultrastructural changes in podocyte morphology. The representative images from four mice in each group are shown (318,500). Red arrowheads show normal upright foot processes. Red arrows show foot process effacement. (D) Foot process width was quantified by counting the number of slits per length of glomerular basement membrane with ImageJ (n=3). *P,0.05 (Kruskal–Wallis test with Dunn post-test); **P,0.01 (Kruskal–Wallis test with Dunn post-test).

expression.9,12,53,54 In addition, we recently observed that effects of KLF15 induction in a tissue-specificmannerin the salutary effects of GCs are attenuated with podocyte- these other diseases. specificknockdownofKlf15 in multiple proteinuric murine Of particular interest in our studies is the observation that models.12 Although we did not observe any deleterious ef- the salutaryeffectsof KLF15 might in partbe mediated byWT1. fects of persistent podocyte-specific induction of KLF15 Several studies have highlighted the essential role of WT1 in from 4 to 12 weeks of age in this study, the effects of pro- kidney development, and single-nucleotide polymorphisms longed podocyte-specific as well as global induction of in WT1 have been implicated in FSGS and HIVAN.6,7,47,60–63 KLF15 in mice remain to be determined. Finally, because In addition, we observed that the majority of the transcripts the loss of Klf15 has been implicated in cardiovascular dis- critical to maintaining podocyte differentiation and prevent- ease,55–57 airway smooth muscle hyper-responsiveness,58 ing cell detachment and effacement are concurrently mediated and adipocyte differentiation,59 future studies should focus by KLF15 and WT1. We hypothesize that both KLF15 and on using these TRE-KLF15 mice to study the salutary WT1 are required to maintain mature differentiation markers

2542 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH in the setting of cell stress. Although our coimmunoprecipi- ACKNOWLEDGMENTS tation studies did not show a significant protein-protein inter- action between KLF15 and WT1 under basal conditions, this This work was supported by National Institutes of Health (NIH)/ interaction might be dynamic and depend on the activation of National Institute of Diabetes and Digestive and Kidney Diseases the transcriptional machinery under cell stress. Furthermore, grants DK078897 (to J.C.H.), DK102519 (to S.K.M.), and DK112984 similar to KLF15, the critical role of other transcription factors, (to S.K.M.); Veterans Affairs Merit grant 1I01BX003698 (to S.K.M.); including WT1, in regulating WT1 expression cannot be neglec- and Dialysis Clinic Inc. Paul Teschan Research Grant (to S.K.M.) and ted.64–67 These include SP1, EGR1, and ZHX2 as well as recip- partially supported by NIH grants U54HL127624 (to A.M.) and rocal regulation by PAX2 and isoforms of WT1, which are U24CA224260 (to A.M.). essential in regulating WT1 expression in development and dis- 64–67 ease. Additional studies are required to determine the DISCLOSURES mechanism by which these other transcription factors interact with KLF15 and WT1 in maintaining podocyte differentiation None. markers under cell stress. Other KLFs, such as KLF4 and KLF6, have also been previously reported to play a role in podocyto- REFERENCES pathies.18,50 Induction of KLF15 in our studies might regulate the expression and/or function of these other KLFs. Our RNA 1. Centers for Disease Control and Prevention: Chronic Kidney Disease sequencing was performed in isolated glomeruli, and as such, it Surveillance System Website, 2017. Available at: http://www.cdc.gov/ is difficult to interrogate podocyte-specific changes in expression ckd. Accessed March 9, 2017 of other KLFs. Nonetheless, additional studies in isolated podo- 2. Shankland SJ: The podocyte’s response to injury: Role in proteinuria cytes are necessary to determine whether the induction of KLF15 and glomerulosclerosis. Kidney Int 69: 2131–2147, 2006 regulates these other KLFs. In addition, examining the protein- 3. Miner JH, Morello R, Andrews KL, Li C, Antignac C, Shaw AS, et al.: Transcriptional induction of slit diaphragm genes by Lmx1b is required protein interactions between these KLFs at baseline and in cell in podocyte differentiation. JClinInvest109: 1065–1072, 2002 stress might provide a framework to understand the dynamic 4. Quaggin SE: Transcriptional regulation of podocyte specification and nature of the transcriptional network in podocytopathies. differentiation. Microsc Res Tech 57: 208–211, 2002 Endogenous KLF15 expression is not restricted to podo- 5. Chugh SS: Transcriptional regulation of podocyte disease. Transl Res – cytes, because previous immunostaining has shown expression 149: 237 242, 2007 14 6. Orloff MS, Iyengar SK, Winkler CA, Goddard KA, Dart RA, Ahuja TS, in tubules, endothelial cells, and renal stromal cells. We also et al.: Variants in the Wilms’ tumor gene are associated with focal recently showed that the loss of renal stromal–specific Klf15 segmental glomerulosclerosis in the African American population. exacerbated kidney injury in murine models of unilateral Physiol Genomics 21: 212–221, 2005 uretic obstruction and chronic Angiotensin II administra- 7. Woroniecki RP, Kopp JB: Genetics of focal segmental glomerulo- – tion.14 Although renal stromal– or tubule-specificinduction sclerosis. Pediatr Nephrol 22: 638 644, 2007 8. Yu H, Artomov M, Brähler S, Stander MC, Shamsan G, Sampson MG, of KLF15 might also improve kidney injury in the Tg26 mice, et al.: A role for genetic susceptibility in sporadic focal segmental we focused on the role of KLF15 induction in podocytes, be- glomerulosclerosis. JClinInvest126: 1067–1078, 2016 cause previous studies have shown that podocyte injury is the 9. Mallipattu SK, Guo Y, Revelo MP, Roa-Peña L, Miller T, Ling J, et al.: main contributing factor to FSGS and eventual tubulointer- Krüppel-like factor 15 mediates glucocorticoid-induced restoration of – stitial injury in the Tg26 mice. Interestingly, along with restor- podocyte differentiation markers. JAmSocNephrol28: 166 184, 2017 10. Bialkowska AB, Yang VW, Mallipattu SK: Krüppel-like factors in mam- ing podocyte differentiation markers, we observed a reduction malian stem cells and development. Development 144: 737–754, 2017 inactivatedPECswithpodocyte-specific induction of KLF15 11. Mallipattu SK, Estrada CC, He JC: The critical role of Krüppel-like factors in in Tg26 mice. Mechanisms by which podocyte-specificinduc- kidney disease. Am J Physiol Renal Physiol 312: F259–F265, 2017 tion of KLF15 reduces PEC activation remain to be explored, 12. Mallipattu SK, Liu R, Zheng F, Narla G, Ma’ayan A, Dikman S, et al.: Kruppel-like factor 15 (KLF15) is a key regulator of podocyte differen- but potential pathways include activated Notch and STAT3 – 22,68,69 tiation. JBiolChem287: 19122 19135, 2012 signaling as previously reported. Nonetheless, to test 13. Saleem MA, O’Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, et al.: whether the salutary effects of KLF15 extend beyond the po- A conditionally immortalized human podocyte cell line demonstrating docyte, future studies will need to focus on the role of tubule- nephrin and podocin expression. J Am Soc Nephrol 13: 630–638, 2002 and/or stromal-specificinductionofKLF15 in murine models 14. Gu X, Mallipattu SK, Guo Y, Revelo MP, Pace J, Miller T, et al.: The loss + with primarily tubulointerstitial disease. of Krüppel-like factor 15 in Foxd1 stromal cells exacerbates kidney fibrosis. Kidney Int 92: 1178–1193, 2017 To the best of our knowledge, this is the first study to show fi fi 15. Matys V, Fricke E, Geffers R, Gössling E, Haubrock M, Hehl R, et al.: that podocyte-speci c induction of a zinc nger transcription TRANSFAC: Transcriptional regulation, from patterns to profiles. Nu- factor attenuates kidney injury in a murine model of collapsing cleic Acids Res 31: 374–378, 2003 FSGS. In addition, we show that KLF15 attenuates kidney 16. Chen EY, Tan CM, Kou Y, Duan Q, Wang Z, Meirelles GV, et al.: Enrichr: injury by restoring the transcriptome required to maintain Interactive and collaborative HTML5 gene list enrichment analysis tool. BMC Bioinformatics 14: 128, 2013 mature podocyte differentiation markers, which is in part 17. Mallipattu SK, Liu R, Zhong Y, Chen EY, D’Agati V, Kaufman L, et al.: mediated by WT1. Collectively, these studies show the critical Expression of HIV transgene aggravates kidney injury in diabetic mice. need to study KLF15 as a therapeutic target in podocytopathies. Kidney Int 83: 626–634, 2013

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2543 BASIC RESEARCH www.jasn.org

18. Mallipattu SK, Horne SJ, D’Agati V, Narla G, Liu R, Frohman MA, et al.: 40. Schaefer CF, Anthony K, Krupa S, Buchoff J, Day M, Hannay T, et al.: PID: Krüppel-like factor 6 regulates mitochondrial function in the kidney. J The pathway interaction database. Nucleic Acids Res 37: D674–D679, 2009 Clin Invest 125: 1347–1361, 2015 41. Kanehisa M, Goto S: KEGG: Kyoto encyclopedia of genes and ge- 19. Lee VW, Harris DC: Adriamycin nephropathy: A model of focal seg- nomes. Nucleic Acids Res 28: 27–30, 2000 mental glomerulosclerosis. Nephrology (Carlton) 16: 30–38, 2011 42. Kang DH, Joly AH, Oh SW, Hugo C, Kerjaschki D, Gordon KL, et al.: 20. Takemoto M, Asker N, Gerhardt H, Lundkvist A, Johansson BR, Saito Y, Impaired angiogenesis in the remnant kidney model. I. Potential role of et al.: A new method for large scale isolation of kidney glomeruli from vascular endothelial growth factor and thrombospondin-1. JAmSoc mice. Am J Pathol 161: 799–805, 2002 Nephrol 12: 1434–1447, 2001 21. Katsuya K, Yaoita E, Yoshida Y, Yamamoto Y, Yamamoto T: An improved 43. Thakar CV, Zahedi K, Revelo MP, Wang Z, Burnham CE, Barone S, et al.: method for primary culture of rat podocytes. Kidney Int 69: 2101–2106, 2006 Identification of thrombospondin 1 (TSP-1) as a novel mediator of cell 22. Dai Y, Gu L, Yuan W, Yu Q, Ni Z, Ross MJ, et al.: Podocyte-specificdeletion injury in kidney ischemia. J Clin Invest 115: 3451–3459, 2005 of signal transducer and activator of transcription 3 attenuates nephrotoxic 44. Zeisberg M, Tampe B, LeBleu V, Tampe D, Zeisberg EM, Kalluri R: serum-induced glomerulonephritis. Kidney Int 84: 950–961, 2013 Thrombospondin-1 deficiency causes a shift from fibroproliferative to 23. Mallipattu SK, Gallagher EJ, LeRoith D, Liu R, Mehrotra A, Horne SJ, inflammatory kidney disease and delays onset of renal failure. Am J et al.: Diabetic nephropathy in a nonobese mouse model of type 2 Pathol 184: 2687–2698, 2014 diabetes mellitus. Am J Physiol Renal Physiol 306: F1008–F1017, 2014 45.LachmannA,XuH,KrishnanJ,BergerSI,MazloomAR,Ma’ayan A: 24.ZhongY,WuY,LiuR,DengY,MallipattuSK,KlotmanPE,etal.:Roflumilast ChEA: Transcription factor regulation inferred from integrating ge- enhances the renal protective effects of retinoids in an HIV-1 transgenic mouse nome-wide ChIP-X experiments. Bioinformatics 26: 2438–2444, 2010 model of rapidly progressive renal failure. Kidney Int 81: 856–864, 2012 46. Matys V, Kel-Margoulis OV, Fricke E, Liebich I, Land S, Barre-Dirrie A, 25. Wang Z, Ma’ayan A: An open RNA-Seq data analysis pipeline tutorial et al.: TRANSFAC and its module TRANSCompel: Transcriptional gene with an example of reprocessing data from a recent Zika virus study. regulation in eukaryotes. Nucleic Acids Res 34: D108–D110, 2006 F1000Res 5: 1574, 2016 47. Morrison AA, Viney RL, Saleem MA, Ladomery MR: New insights into 26. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al.: STAR: the function of the Wilms tumor suppressor gene WT1 in podocytes. Ultrafast universal RNA-seq aligner. Bioinformatics 29: 15–21, 2013 Am J Physiol Renal Physiol 295: F12–F17, 2008 27. Liao Y, Smyth GK, Shi W: featureCounts: An efficient general purpose 48. Toska E, Roberts SG: Mechanisms of transcriptional regulation by WT1 program for assigning sequence reads to genomic features. Bio- (Wilms’ tumour 1). Biochem J 461: 15–32, 2014 informatics 30: 923–930, 2014 49. Pippin JW, Brinkkoetter PT, Cormack-Aboud FC, Durvasula RV, Hauser 28. Clark NR, Hu KS, Feldmann AS, Kou Y, Chen EY, Duan Q, et al.: The PV, Kowalewska J, et al.: Inducible rodent models of acquired podo- characteristic direction: A geometrical approach to identify differen- cyte diseases. Am J Physiol Renal Physiol 296: F213–F229, 2009 tially expressed genes. BMC Bioinformatics 15: 79, 2014 50. Hayashi K, Sasamura H, Nakamura M, Azegami T, Oguchi H, Sakamaki 29. Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, Y, et al.: KLF4-dependent epigenetic remodeling modulates podocyte et al.: Enrichr: A comprehensive gene set enrichment analysis web phenotypes and attenuates proteinuria. JClinInvest124: 2523–2537, server 2016 update. Nucleic Acids Res 44[W1]: W90–W97, 2016 2014 30. Barisoni L, Kriz W, Mundel P, D’Agati V: The dysregulated podocyte 51. Ju W, Nair V, Smith S, Zhu L, Shedden K, Song PXK, et al.: ERCB, C- phenotype: A novel concept in the pathogenesis of collapsing idio- PROBE, NEPTUNE, and PKU-IgAN Consortium: Tissue transcriptome- pathic focal segmental glomerulosclerosis and HIV-associated ne- driven identification of epidermal growth factor as a chronic kidney phropathy. J Am Soc Nephrol 10: 51–61, 1999 disease biomarker. Sci Transl Med 7: 316ra193, 2015 31. He JC, Lu TC, Fleet M, Sunamoto M, Husain M, Fang W, et al.: Retinoic 52. Ratnam KK, Feng X, Chuang PY, Verma V, Lu TC, Wang J, et al.: Role of acid inhibits HIV-1-induced podocyte proliferation through the cAMP the retinoic acid receptor-a in HIV-associated nephropathy. Kidney Int pathway. JAmSocNephrol18: 93–102, 2007 79: 624–634, 2011 32. Barisoni L, Bruggeman LA, Mundel P, D’Agati VD, Klotman PE: HIV-1 53. Asada M, Rauch A, Shimizu H, Maruyama H, Miyaki S, Shibamori M, induces renal epithelial dedifferentiation in a transgenic model of HIV- et al.: DNA binding-dependent glucocorticoid receptor activity pro- associated nephropathy. Kidney Int 58: 173–181, 2000 motes adipogenesis via Krüppel-like factor 15 gene expression. Lab 33. Shankland SJ, Eitner F, Hudkins KL, Goodpaster T, D’Agati V, Alpers Invest 91: 203–215, 2011 CE: Differential expression of cyclin-dependent kinase inhibitors in 54. Sasse SK, Mailloux CM, Barczak AJ, Wang Q, Altonsy MO, Jain MK, human glomerular disease: Role in podocyte proliferation and matu- et al.: The glucocorticoid receptor and KLF15 regulate gene expression ration. Kidney Int 58: 674–683, 2000 dynamics and integrate signals through feed-forward circuitry. Mol Cell 34. Feng X, Lu TC, Chuang PY, Fang W, Ratnam K, Xiong H, et al.: Re- Biol 33: 2104–2115, 2013 duction of Stat3 activity attenuates HIV-induced kidney injury. JAmSoc 55. Wang B, Haldar SM, Lu Y, Ibrahim OA, Fisch S, Gray S, et al.: The Nephrol 20: 2138–2146, 2009 Kruppel-like factor KLF15 inhibits connective tissue growth factor 35. Hasegawa K, Wakino S, Simic P, Sakamaki Y, Minakuchi H, Fujimura K, (CTGF) expression in cardiac fibroblasts. J Mol Cell Cardiol 45: 193– et al.: Renal tubular Sirt1 attenuates diabetic albuminuria by epige- 197, 2008 netically suppressing Claudin-1 overexpression in podocytes. Nat Med 56. Jeyaraj D, Haldar SM, Wan X, McCauley MD, Ripperger JA, Hu K, et al.: 19: 1496–1504, 2013 Circadian rhythms govern cardiac repolarization and arrhythmo- 36. Gong Y, Sunq A, Roth RA, Hou J: Inducible expression of claudin-1 in glo- genesis. Nature 483: 96–99, 2012 merular podocytes generates aberrant tight junctions and proteinuria 57. Lu Y, Zhang L, Liao X, Sangwung P, Prosdocimo DA, Zhou G, et al.: through slit diaphragm destabilization. JAmSocNephrol28: 106–117, 2017 Kruppel-like factor 15 is critical for vascular inflammation. JClinInvest 37. Bruggeman LA, Drawz PE, Kahoud N, Lin K, Barisoni L, Nelson PJ: 123: 4232–4241, 2013 TNFR2 interposes the proliferative and NF-kB-mediated inflammatory 58. Masuno K, Haldar SM, Jeyaraj D, Mailloux CM, Huang X, Panettieri RA response by podocytes to TNF-a. Lab Invest 91: 413–425, 2011 Jr, et al.: Expression profiling identifies Klf15 as a glucocorticoid target 38. Shkreli M, Sarin KY, Pech MF, Papeta N, Chang W, Brockman SA, et al.: that regulates airway hyperresponsiveness. Am J Respir Cell Mol Biol Reversible cell-cycle entry in adult kidney podocytes through regulated 45: 642– 649, 2011 control of telomerase and Wnt signaling. Nat Med 18: 111–119, 2011 59. Mori T, Sakaue H, Iguchi H, Gomi H, Okada Y, Takashima Y, et al.: Role 39. Pico AR, Kelder T, van Iersel MP, Hanspers K, Conklin BR, Evelo C: of Krüppel-like factor 15 (KLF15) in transcriptional regulation of adi- WikiPathways: Pathway editing for the people. PLoS Biol 6: e184, 2008 pogenesis. J Biol Chem 280: 12867–12875, 2005

2544 Journal of the American Society of Nephrology J Am Soc Nephrol 29: 2529–2545, 2018 www.jasn.org BASIC RESEARCH

60. Kreidberg JA, Sariola H, Loring JM, Maeda M, Pelletier J, Housman D, 67. Liu G, Clement LC, Kanwar YS, Avila-Casado C, Chugh SS: ZHX pro- et al.: WT-1 is required for early kidney development. Cell 74: 679–691, teins regulate podocyte gene expression during the development of 1993 nephrotic syndrome. JBiolChem281: 39681–39692, 2006 61. Roberts SG: Transcriptional regulation by WT1 in development. Curr 68. Sharma M, Magenheimer LK, Home T, Tamano KN, Singhal PC, Hyink Opin Genet Dev 15: 542–547, 2005 DP, et al.: Inhibition of Notch pathway attenuates the progression of 62. Nabet B, Tsai A, Tobias JW, Carstens RP: Identification of a putative human immunodeficiency virus-associated nephropathy. Am J Physiol network of actin-associated cytoskeletal proteins in glomerular podo- Renal Physiol 304: F1127–F1136, 2013 cytes defined by co-purified mRNAs. PLoS One 4: e6491, 2009 69. Gu L, Dai Y, Xu J, Mallipattu S, Kaufman L, Klotman PE, et al.: Deletion 63. Lefebvre J, Clarkson M, Massa F, Bradford ST, Charlet A, Buske F, et al.: of podocyte STAT3 mitigates the entire spectrum of HIV-1-associated Alternatively spliced isoforms of WT1 control podocyte-specificgene nephropathy. AIDS 27: 1091–1098, 2013 expression. Kidney Int 88: 321–331, 2015 70. Kann M, Ettou S, Jung YL, Lenz MO, Taglienti ME, Park PJ, et al.: Ge- 64. Dehbi M, Ghahremani M, Lechner M, Dressler G, Pelletier J: The paired- nome-wide analysis of Wilms’ Tumor 1-controlled gene expression in box transcription factor, PAX2, positively modulates expression of the podocytes reveals key regulatory mechanisms. JAmSocNephrol26: Wilms’ tumor suppressor gene (WT1). Oncogene 13: 447–453, 1996 2097–2104, 2015 65. Cohen HT, Bossone SA, Zhu G, McDonald GA, Sukhatme VP: Sp1 is a critical regulator of the Wilms’ tumor-1 gene. JBiolChem272: 2901–2913, 1997 66. Klamt B, Koziell A, Poulat F, Wieacker P, Scambler P, Berta P, et al.: Frasier syndrome is caused by defective alternative splicing of WT1 leading to an This article contains supplemental material online at http://jasn.asnjournals. alteredratioofWT1+/-KTSspliceisoforms.Hum Mol Genet 7: 709–714, 1998 org/lookup/suppl/doi:10.1681/ASN.2018030324/-/DCSupplemental.

J Am Soc Nephrol 29: 2529–2545, 2018 KLF15 in Proteinuric Kidney Disease 2545 SUPPLEMENTAL TABLE OF CONTENTS

1. Supplement Figure Legends 2. Supplement Table 1: Quantification of Histological Changes 3. Supplement Table 2: Upregulated differentially expressed transcripts (Tg26;PODTA;TRE-KLF15 vs. Tg26;PODTA mice) 4. Supplement Table 3: Downregulated differentially expressed transcripts (Tg26;PODTA;TRE-KLF15 vs. Tg26;PODTA mice) 5. Supplement Table 4: Upregulated differentially expressed transcripts with KLF15 binding sites (Tg26;PODTA;TRE-KLF15 vs. Tg26;PODTA mice) 6. Supplement Table 5: Primer Sequences for genotyping 7. Supplement Table 6: Primer Sequences for Real-Time PCR 8. Supplement Table 7: ChIP Primer Sequences for Real-Time PCR 9. Supplement Figure 1: Validation of podocyte-specific KLF15 expression in DOX-treated PODTA;TRE KLF15 mice. 10. Supplement Figure 2: Non-surviving DOX-treated Tg26;PODTA mice exhibit higher albuminuria than surviving DOX-treated Tg26;PODTA mice. 11. Supplement Figure 3: Podocyte-specific induction of KLF15 reduces activation of parietal epithelial cells in Tg26 mice. 12. Supplement Figure 4: Podocyte-specific induction of KLF15 attenuates interstitial fibrosis and inflammation in Tg26 mice. 13. Supplement Figure 5: Podocyte-specific induction of KLF15 attenuates activation of Wnt/β-catenin pathway in Tg26 mice. 14. Supplement Figure 6: Confirmation of top differentially expressed transcripts. 15. Supplement Figure 7: Modulation of WT1 expression in cultured human podocytes. 16. Supplement Figure 8: KLF15 and WT1 exhibit no protein-protein interactions under basal conditions. 17. Supplement Figure 9: KLF15 expression is reduced in human glomerular disease and mouse glomerular disease model.

SUPPLEMENTARY FIGURE LEGENDS

Supplement Figure 1: Validation of podocyte-specific KLF15 expression in DOX-treated PODTA;TRE- KLF15 mice. (A) Map of the plasmid used to generate TRE-KLF15 mice. FLAG-KLF15 DNA fragment was cloned using restriction enzyme sites EcoRI and XbaI, and plasmid was linearized by PvuI enzyme and injected into embryonic stem cells. Restriction enzyme sites (PvuI, EcoRI, XbaI), Modified Tet Response Element (TREmod). Minimal CMV promoter (PminCMVΔ). Polyadenylation (Poly A). F1, R1, F2, R2 show location of forward and reverse primers used for genotyping. (B) PODTA and PODTA;TRE-KLF15 mice were treated with DOX at 4 weeks of age and euthanized at 12 weeks of age. KLF15 mRNA expression was measured for primary glomerular epithelial cells (PGEC), glomerular, tubular, and liver fractions (n=8, **p<0.01, Mann- Whitney test). (C) Protein was also extracted and Western blot analysis for KLF15 was performed for the PGEC and tubular fraction. The representative blot of three independent experiments is shown. Bottom panel shows the quantification of KLF15 by densitometry (n=8, **p<0.01, Mann-Whitney test). (D) Immunofluorescence staining for KLF15, WT1, and Hoechst was performed. The representative images of six independent experiments are shown in the left panel (X 20). In the right panel, the intensity of podocyte-specific KLF15 expression was quantified (n=6, **p<0.01, unpaired t test). Arrows show examples of increased KLF15 expression in WT1+ cells.

Supplement Figure 2: Non-surviving DOX-treated Tg26;PODTA mice exhibit higher albuminuria than surviving DOX-treated Tg26;PODTA mice. Albuminuria was measured at 10 weeks of age in both the surviving and non-surviving Tg26;PODTA and Tg26;PODTA;TRE-KLF15 mice treated with DOX (n=4-8, **p<0.01, ***p<0.001, Kruskal-Wallis test with Dunn’s post-test). ND- No Data.

Supplement Figure 3: Podocyte-specific induction of KLF15 reduces activation of parietal epithelial cells in Tg26 mice. PODTA, PODTA;TRE-KLF15, Tg26;PODTA, and Tg26;PODTA;TRE-KLF15 mice were treated with DOX at 4 weeks of age and euthanized at 12 weeks of age. Immunofluorescence staining for CD44 and Hoechst was performed in all 4 groups. The representative images of five independent samples are shown in the top panel (X20). In the bottom panel, the percentage of CD44 positive glomeruli was quantified (n=4, *p<0.05 versus all other groups, Kruskal-Wallis test with Dunn’s post-test).

Supplement Figure 4: Podocyte-specific induction of KLF15 attenuates interstitial fibrosis and inflammation in Tg26 mice. PODTA, PODTA;TRE-KLF15, Tg26;PODTA, and Tg26;PODTA;TRE-KLF15 mice were treated with DOX at 4 weeks of age and euthanized at 12 weeks of age. Renal cortex was isolated and RNA extracted for real-time PCR. (A) Fibronectin (Fn), Col1α1, Vimentin, and αSma mRNA expression levels are shown relative to DOX-treated PODTA mice (n=6, *p<0.05, **p<0.01 versus all other groups, Kruskal-Wallis test with Dunn’s post-test). (B) Immunostaining for αSMA was performed (with Hoechst staining). Left panel shows representative images from 6 mice in each group (X 20). 30 high-power-field images were selected and percent αSMA area stained was measured and quantified as a relative fold change to DOX-treated PODTA mice (right panel) (n=6, **p<0.01 versus all other groups, Kruskal-Wallis test with Dunn’s post-test). (C) Il-1, Tnf-α, Ifn-γ, Il-6, Tnfr1, and Tnfr2 mRNA expression levels are shown relative to DOX-treated PODTA mice (n=6, *p<0.05, **p<0.01, Kruskal-Wallis test with Dunn’s post-test). (D) Immunostaining for Gr-1 was performed in all four groups and subsequently quantified by counting the number of Gr-1+ cells per HPF (n=6, *p<0.05, **p<0.01, Kruskal-Wallis test with Dunn’s post-test).

Supplement Figure 5: Podocyte-specific induction of KLF15 attenuates activation of Wnt/β-catenin pathway in Tg26 mice. PODTA, PODTA;TRE-KLF15, Tg26;PODTA, and Tg26;PODTA;TRE-KLF15 mice were treated with DOX at 4 weeks of age and euthanized at 12 weeks of age. Renal cortex was isolated and RNA extracted for real-time PCR. (A) c-Myc, Tcf7l2, and Lef1 mRNA expression levels are shown relative to DOX-treated PODTA mice (n=6, *p<0.05, **p<0.01 versus all other groups, Kruskal-Wallis test with Dunn’s post-test). (B) Immunostaining for Hoechst and Phospho-β-catenin (Ser552) were performed in all four groups. Representative images from 6 mice in each group are shown (X 20). Arrowheads show nuclear localization of Phospho-β-catenin (Ser552).

Supplement Figure 6: Confirmation of top differentially expressed transcripts. PODTA, PODTA;TRE- KLF15, Tg26;PODTA, and Tg26;PODTA;TRE-KLF15 mice were treated with DOX at 4 weeks of age and euthanized at 12 weeks of age. Glomeruli were isolated and RNA extracted for real-time PCR. Expression levels of differentially upregulated transcripts Cdkn1c, Clic5, Inf2, Plcε1, Vegfa, Podxl, Neat1, Thbs1, and Egr1 mRNA are shown relative to DOX-treated PODTA mice (n=6, *p<0.05, **p<0.01, Kruskal-Wallis test with Dunn’s post-test).

Supplement Figure 7: Modulation of WT1 expression in cultured human podocytes. WT1 knockdown in human podocytes was performed using lentiviral shRNAmir system with the following constructs, WT1- shRNA1, WT1-shRNA2, and WT1-shRNA3. SC-shRNA serves as the scramble control. (A) Real-time PCR was performed to confirm WT1 knockdown (n=3, *p<0.05, **p<0.01, Kruskal-Wallis test with Dunn’s post-test). (B) Western blot was performed to confirm WT1 knockdown with quantification by densitometry (n=3, **p<0.01, Kruskal-Wallis test with Dunn’s post-test). (C) Subsequently, we performed real-time pcr for the two isoforms of WT1 (+KTS and -KTS) in isolated glomerular extracts from PODTA, PODTA;TRE-KLF15, Tg26;PODTA, and Tg26;PODTA;TRE-KLF15 mice (n=4, *p<0.05, Kruskal-Wallis test with Dunn’s post-test). Then, we overexpressed WT1(+KTS) in human podocytes using lentiORF-WT1(+KTS) clone. (D) Western blot was performed to confirm the increased expression of WT1(+KTS) after transfection in human podocytes. Representative blot of three independent experiments is shown.

Supplement Figure 8: KLF15 and WT1 exhibit no protein-protein interactions under basal conditions. HEK 293T cells were transfected with both V5 tag KLF15 (LentiORF-KLF15-V5) and WT1 (LentiORF-WT1), or LentiORF-EV as control. 48hrs after transfection, cells were harvested, cell lysate were immunoprecipitated by anti-V5 antibody and immunoblotted for WT1. 2% Input was immunoblotted for WT1, KLF15, and GAPDH. Representative blot of three independent experiments is shown.

Supplement Figure 9: KLF15 expression is reduced in human glomerular disease and mouse glomerular disease model. (A) Gene expression level of Klf15 gene were analyzed by quantitative real-time PCR, and represented as fold change in adriamycin treated glomeruli expression levels, relative to untreated wild-type levels. (n=4, *p<0.05, Mann-Whitney test). (B) Previously reported gene expression arrays from Ju et al. 2015 were utilized to examine KLF15 mRNA expression from the microdissected glomeruli of kidney biopsies with diabetic nephropathy and minimal change disease as compared with healthy living kidney donor specimens (**p<0.01, ***p<0.001, Kruskal-Wallis test with Dunn’s post hoc test).

Supplement Table 1: Quantification of Histological Changes % FSGS lesions Tubulo-interstitium

% Global Sclerosis Fibrosis Score Inflammation Score PODTA - - 0 0 PODTA; TRE-KLF15 - - 0 0 Tg26; PODTA 50.8 ± 5.0 13.4 ± 10.9 2.5 ± 0.3 2.5 ± 0.3 Tg26; PODTA; TRE-KLF15 15.8 ± 3.1* 0.7 ± 0.4** 0.8 ± 0.3** 1.0 ± 0.0** Fibrosis and Inflammation Score: 0 (none), 1 (<10%), 2 (10-25%), 3 (25-50%) 30 glomeruli per mouse, n=6 mice per group All data are expressed as Mean ± SEM; *p<0.05, **p<0.01

Supplement Table 2: Upregulated differentially expressed transcripts Gene Symbol Description Sept11 septin 11 Aplp1 amyloid beta precursor like protein 1 Shisa3 shisa family member 3 Lmo7 LIM domain 7 Hipk2 homeodomain interacting protein kinase 2 Neat1 nuclear paraspeckle assembly transcript 1 (non-protein coding) Srrm2 serine/arginine repetitive matrix 2 Arhgap24 Rho GTPase activating protein 24 Arhgap32 Rho GTPase activating protein 32 Wt1 Wilms tumor 1 Axl AXL receptor tyrosine kinase Tef TEF, PAR bZIP transcription factor Amotl1 angiomotin like 1 Epb4.1l5 erythrocyte membrane protein band 4.1 like 5 Enpep glutamyl aminopeptidase Sema5a semaphorin 5A Adcy1 adenylate cyclase 1 Csf1 colony stimulating factor 1 Ahnak AHNAK nucleoprotein Abat 4-aminobutyrate aminotransferase Loxl2 lysyl oxidase like 2 Uaca uveal autoantigen with coiled-coil domains and ankyrin repeats Galnt10 polypeptide N-acetylgalactosaminyltransferase 10 Prex2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 Pak1 p21 (RAC1) activated kinase 1 Ablim3 actin binding LIM protein family member 3 Plcε1 phospholipase C epsilon 1 Slc26a10 solute carrier family 26 member 10 Kdr kinase insert domain receptor Dag1 dystroglycan 1 B2m beta-2-microglobulin St3gal1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 Arvcf ARVCF, delta catenin family member Abca2 ATP binding cassette subfamily A member 2 Arhgef12 Rho guanine nucleotide exchange factor 12 H2-d1 histocompatibility 2, D region locus 1 Klf13 Kruppel like factor 13 Igfbp5 insulin like growth factor binding protein 5 Arhgef18 Rho/Rac guanine nucleotide exchange factor 18 Arhgef17 Rho guanine nucleotide exchange factor 17 Nr1d1 nuclear receptor subfamily 1 group D member 1 Nr1d2 nuclear receptor subfamily 1 group D member 2 Hspa12a heat shock protein family A (Hsp70) member 12A Mafb MAF bZIP transcription factor B Pbx1 PBX homeobox 1 Lats2 large tumor suppressor kinase 2 Ehd3 EH domain containing 3 Tmem2 transmembrane protein 2 Lphn2 adhesion G protein-coupled receptor L2 Fat1 FAT atypical cadherin 1 Serping1 serpin family G member 1 Chst1 carbohydrate sulfotransferase 1 Malat1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) Ccser2 coiled-coil serine rich protein 2 Zfp106 zinc finger protein 106 Myom2 myomesin 2 Macf1 microtubule-actin crosslinking factor 1 Calcrl calcitonin receptor like receptor Fam65a RHO family interacting cell polarization regulator 1 Cdc14a cell division cycle 14A Tmtc1 transmembrane and tetratricopeptide repeat containing 1 Rasgrp3 RAS guanyl releasing protein 3 Golim4 golgi integral membrane protein 4 Helz2 helicase with zinc finger 2 Podxl podocalyxin like Hivep1 human immunodeficiency virus type I enhancer binding protein 1 Sbf2 SET binding factor 2 C1qtnf1 C1q and TNF related 1 Synpo synaptopodin Tspan2 tetraspanin 2 Tns3 tensin 3 Tmem150c transmembrane protein 150C Itga3 integrin subunit alpha 3 Heg1 heart development protein with EGF like domains 1 Agtr1a angiotensin II receptor type 1 Pard3b par-3 family cell polarity regulator beta Ptpn14 protein tyrosine phosphatase, non-receptor type 14 Parva parvin alpha Mcc mutated in colorectal cancers Mtss1 MTSS1, I-BAR domain containing Mertk MER proto-oncogene, tyrosine kinase Bmp7 bone morphogenetic protein 7 Vegfa vascular endothelial growth factor A Inf2 inverted formin, FH2 and WH2 domain containing Meis2 Meis homeobox 2 Zeb2 zinc finger E-box binding homeobox 2 Mapt microtubule associated protein tau Nes nestin Atp13a3 ATPase 13A3 Ptprv protein tyrosine phosphatase, receptor type V, pseudogene Clic5 chloride intracellular channel 5 Ptprs protein tyrosine phosphatase, receptor type S Bmpr2 bone morphogenetic protein receptor type 2 Npr3 natriuretic peptide receptor 3 Ptpro protein tyrosine phosphatase, receptor type O Ildr2 immunoglobulin like domain containing receptor 2 Pth1r parathyroid hormone 1 receptor Pcsk6 proprotein convertase subtilisin/kexin type 6 Dpp4 dipeptidyl peptidase 4 Dbp D-box binding PAR bZIP transcription factor Mecp2 methyl-CpG binding protein 2 1700025g04rik RIKEN cDNA 1700025G04 gene Marveld1 MARVEL domain containing 1 Hmbox1 homeobox containing 1 Zc3h7b zinc finger CCCH-type containing 7B Sh3bgrl2 SH3 domain binding glutamate rich protein like 2 Rhpn1 rhophilin Rho GTPase binding protein 1 Man1a2 mannosidase alpha class 1A member 2 Phactr2 phosphatase and actin regulator 2 Cd300lg CD300 molecule like family member g Clic3 chloride intracellular channel 3 Smyd1 SET and MYND domain containing 1 Mpp5 membrane palmitoylated protein 5 Tmod3 tropomodulin 3 Per3 period circadian regulator 3 Klf9 Kruppel like factor 9 Tjp1 tight junction protein 1 Nell2 neural EGFL like 2 Myo1d myosin ID Nphs1 NPHS1, nephrin Col4a3 collagen type IV alpha 3 chain Nphs2 NPHS2, podocin Per1 period circadian regulator 1 Aldh1a2 aldehyde dehydrogenase 1 family member A2 Ackr3 atypical chemokine receptor 3 Gpr146 G protein-coupled receptor 146 Angptl2 angiopoietin like 2 Acpp acid phosphatase, prostate Fryl FRY like transcription coactivator Nrp1 neuropilin 1 Hlf HLF, PAR bZIP transcription factor Cdkn1c cyclin dependent kinase inhibitor 1C Setd7 SET domain containing lysine methyltransferase 7 Ston2 stonin 2 Syne1 spectrin repeat containing nuclear envelope protein 1 Tcf21 transcription factor 21 Leng8 leukocyte receptor cluster member 8 Tenc1 tensin 2 Sema3g semaphorin 3G H2-q4 histocompatibility 2, Q region locus 4 H2-q1 histocompatibility 2, Q region locus 1 Ddn dendrin H2-q2 histocompatibility 2, Q region locus 2 Robo2 roundabout guidance receptor 2 Speg SPEG complex locus Cyyr1 cysteine and tyrosine rich 1 Mgat5 mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase Thsd7a thrombospondin type 1 domain containing 7A Colgalt2 collagen beta(1-O)galactosyltransferase 2

Supplement Table 3: Downregulated differentially expressed transcripts Gene Symbol Description Egf epidermal growth factor Eml1 echinoderm microtubule associated protein like 1 Dkk2 dickkopf WNT signaling pathway inhibitor 2 Col1a2 collagen type I alpha 2 chain Col1a1 collagen type I alpha 1 chain Hnrnpl heterogeneous nuclear ribonucleoprotein L Marcks myristoylated alanine rich protein kinase C substrate Spint2 serine peptidase inhibitor, Kunitz type 2 Serbp1 SERPINE1 mRNA binding protein 1 Cd9 CD9 molecule Hspa1a heat shock protein family A (Hsp70) member 1A Vim vimentin Tek TEK receptor tyrosine kinase Uqcrc1 ubiquinol-cytochrome c reductase core protein 1 Sparcl1 SPARC like 1 Myl9 myosin light chain 9 Hspa1b heat shock protein family A (Hsp70) member 1B Cyfip2 cytoplasmic FMR1 interacting protein 2 Sgms2 sphingomyelin synthase 2 Serpine2 serpin family E member 2 Hnrnpu heterogeneous nuclear ribonucleoprotein U Atp5a1 ATP synthase F1 subunit alpha Ghitm growth hormone inducible transmembrane protein Gls glutaminase Slc5a3 solute carrier family 5 member 3 Adcy6 adenylate cyclase 6 Zmiz1 zinc finger MIZ-type containing 1 Capns1 calpain small subunit 1 Wls wntless Wnt ligand secretion mediator Raly RALY heterogeneous nuclear ribonucleoprotein Jund JunD proto-oncogene, AP-1 transcription factor subunit Jag1 jagged 1 Gabarapl1 GABA type A receptor associated protein like 1 Napsa napsin A aspartic peptidase Mcam melanoma cell adhesion molecule Fosl2 FOS like 2, AP-1 transcription factor subunit Ehd2 EH domain containing 2 Ptp4a2 protein tyrosine phosphatase type IVA, member 2 Hspg2 heparan sulfate proteoglycan 2 Bcam basal cell adhesion molecule (Lutheran blood group) Tcn2 transcobalamin 2 Prkar1a protein kinase cAMP-dependent type I regulatory subunit alpha Lgmn legumain Hyou1 hypoxia up-regulated 1 Cryab crystallin alpha B Ogdh oxoglutarate dehydrogenase Gabarap GABA type A receptor-associated protein Rpl4 ribosomal protein L4 Cfh complement factor H Ctbp1 C-terminal binding protein 1 Tril TLR4 interactor with leucine rich repeats Atp5c1 ATP synthase F1 subunit gamma Abca13 ATP binding cassette subfamily A member 13 Rpl8 ribosomal protein L8 C3 complement C3 Hsph1 heat shock protein family H (Hsp110) member 1 Alkbh5 alkB homolog 5, RNA demethylase Prdx5 peroxiredoxin 5 Gja5 gap junction protein alpha 5 Ier2 immediate early response 2 Serpinh1 serpin family H member 1 Junb JunB proto-oncogene, AP-1 transcription factor subunit Trp53inp2 Tumor Protein P53 Inducible Nuclear Protein 2 Dusp6 dual specificity phosphatase 6 Jun Jun proto-oncogene, AP-1 transcription factor subunit Anxa2 annexin A2 Tpi1 triosephosphate isomerase 1 Dusp1 dual specificity phosphatase 1 Jup junction plakoglobin Anxa5 annexin A5 Emp1 epithelial membrane protein 1 Fn1 fibronectin 1 Glud1 glutamate dehydrogenase 1 Gprc5c G protein-coupled receptor class C group 5 member C Col3a1 collagen type III alpha 1 chain Fxyd2 FXYD domain containing ion transport regulator 2 Gas6 growth arrest specific 6 Hoxd8 homeobox D8 Btg2 BTG anti-proliferation factor 2 Tinagl1 tubulointerstitial nephritis antigen like 1 Tfcp2l1 transcription factor CP2 like 1 Rpn1 ribophorin I Cltc clathrin heavy chain Acat1 acetyl-CoA acetyltransferase 1 Iqgap1 IQ motif containing GTPase activating protein 1 Litaf lipopolysaccharide induced TNF factor Aebp1 AE binding protein 1 Hsd11b2 hydroxysteroid 11-beta dehydrogenase 2 Ldhd lactate dehydrogenase D Ldhb lactate dehydrogenase B Epcam epithelial cell adhesion molecule Ldha lactate dehydrogenase A Csrp1 cysteine and glycine rich protein 1 Timp3 TIMP metallopeptidase inhibitor 3 Mdh2 malate dehydrogenase 2 Stat3 signal transducer and activator of transcription 3 Fos Fos proto-oncogene, AP-1 transcription factor subunit Bgn biglycan Aes amino-terminal enhancer of split Tm9sf3 transmembrane 9 superfamily member 3 Tmem59 transmembrane protein 59 Ddb1 damage specific DNA binding protein 1 Tm9sf2 transmembrane 9 superfamily member 2 Col4a1 collagen type IV alpha 1 chain Col4a2 collagen type IV alpha 2 chain Adam15 ADAM metallopeptidase domain 15 Fosb FosB proto-oncogene, AP-1 transcription factor subunit Dld dihydrolipoamide dehydrogenase Eng endoglin Oat ornithine aminotransferase Grn granulin precursor Rplp0 ribosomal protein lateral stalk subunit P0 Prss23 serine protease 23 Slc8a1 solute carrier family 8 member A1 Mdh1 malate dehydrogenase 1 Tnks1bp1 tankyrase 1 binding protein 1 Tpm4 tropomyosin 4 Gpr56 adhesion G protein-coupled receptor G1 Hnrnpab heterogeneous nuclear ribonucleoprotein A/B Ppp1cb protein phosphatase 1 catalytic subunit beta Slc25a39 solute carrier family 25 member 39 Ly6a lymphocyte antigen 6 complex, locus A Ly6e lymphocyte antigen 6 family member E Plxnb2 plexin B2 Pkp4 plakophilin 4 Sqstm1 sequestosome 1 Fkbp4 FK506 binding protein 4 Agrn agrin Rhcg Rh family C glycoprotein Gtf2i general transcription factor IIi Slc27a2 solute carrier family 27 member 2 Aldh1l1 aldehyde dehydrogenase 1 family member L1 Dlst dihydrolipoamide S-succinyltransferase Ucp2 uncoupling protein 2 Clu clusterin Papss1 3'-phosphoadenosine 5'-phosphosulfate synthase 1 Defb1 defensin beta 1 Hsp90b1 heat shock protein 90 beta family member 1 Ctgf connective tissue growth factor Cdh5 cadherin 5 Zfp36 ZFP36 ring finger protein Tubb5 tubulin beta class I Lamp2 lysosomal associated membrane protein 2 Lamp1 lysosomal associated membrane protein 1 Cdh1 cadherin 1 Flna filamin A Cfl1 cofilin 1 Flnb filamin B Spp1 secreted phosphoprotein 1 Rps3 ribosomal protein S3 Slc38a2 solute carrier family 38 member 2 F2r coagulation factor II thrombin receptor Igfbp4 insulin like growth factor binding protein 4 Igfbp3 insulin like growth factor binding protein 3 Eef2 eukaryotic translation elongation factor 2 Kifc3 kinesin family member C3 Mal mal, T cell differentiation protein Ncl nucleolin Arpc2 actin related protein 2/3 complex subunit 2 Esam endothelial cell adhesion molecule Eif4g2 eukaryotic translation initiation factor 4 gamma 2 Notch3 notch 3 Clstn1 calsyntenin 1 Tacstd2 tumor associated calcium signal transducer 2 Fgf1 fibroblast growth factor 1 Bag1 BCL2 associated athanogene 1 Igfbp7 insulin like growth factor binding protein 7 Efhd1 EF-hand domain family member D1 Kl klotho Gpx1 glutathione peroxidase 1 Slc14a2 solute carrier family 14 member 2 Gpx3 glutathione peroxidase 3 Angpt2 angiopoietin 2 Kcnj16 potassium voltage-gated channel subfamily J member 16 Cdc42bpb CDC42 binding protein kinase beta Cd24a CD24 molecule Cpe carboxypeptidase E Itga9 integrin subunit alpha 9 Pecam1 platelet and endothelial cell adhesion molecule 1 Itga8 integrin subunit alpha 8 Aco2 aconitase 2 Tmbim6 transmembrane BAX inhibitor motif containing 6 Cd248 CD248 molecule Serinc3 serine incorporator 3 Eif4b eukaryotic translation initiation factor 4B Slc25a4 solute carrier family 25 member 4 Slc25a3 solute carrier family 25 member 3 Clcnkb chloride voltage-gated channel Kb Kng2 kininogen 2 Cyr61 cysteine rich angiogenic inducer 61 Lbh limb bud and heart development Atp5d ATP synthase F1 subunit delta Atp5b ATP synthase F1 subunit beta Psap prosaposin Cox4i1 cytochrome c oxidase subunit 4I1 Emilin1 elastin microfibril interfacer 1 Eif4h eukaryotic translation initiation factor 4H Mcl1 MCL1, BCL2 family apoptosis regulator Slc13a3 solute carrier family 13 member 3 Eif3a eukaryotic translation initiation factor 3 subunit A Limch1 LIM and calponin homology domains 1 Cpt1a carnitine palmitoyltransferase 1A Cyp4b1 cytochrome P450 family 4 subfamily B member 1 Cdc42 cell division cycle 42 Klf2 Kruppel like factor 2 Pkm pyruvate kinase M1/2 Klf6 Kruppel like factor 6 Ppap2a phospholipid phosphatase 1 Txnip thioredoxin interacting protein Kap cyclin dependent kinase inhibitor 3 P4hb prolyl 4-hydroxylase subunit beta Pi16 peptidase inhibitor 16 Met MET proto-oncogene, receptor tyrosine kinase Kctd12 potassium channel tetramerization domain containing 12 Slc25a5 solute carrier family 25 member 5 Itgb1 integrin subunit beta 1 Wdr1 WD repeat domain 1 Hsp90ab1 heat shock protein 90 alpha family class B member 1 Furin furin, paired basic amino acid cleaving enzyme Nckap1 NCK associated protein 1 Dysf dysferlin Syne2 spectrin repeat containing nuclear envelope protein 2 Thbd thrombomodulin Ednrb endothelin receptor type B Adamts1 ADAM metallopeptidase with thrombospondin type 1 motif 1 Itgav integrin subunit alpha V Kcnj1 potassium voltage-gated channel subfamily J member 1 Hnrnpa0 heterogeneous nuclear ribonucleoprotein A0 Slc25a25 solute carrier family 25 member 25 Ephb4 EPH receptor B4 Slc12a3 solute carrier family 12 member 3 Tmem52b transmembrane protein 52B Actn4 actinin alpha 4 Slc12a1 solute carrier family 12 member 1 Slc12a2 solute carrier family 12 member 2 Cnbp CCHC-type zinc finger nucleic acid binding protein Amfr autocrine motility factor receptor Krt7 keratin 7 Sepp1 selenoprotein P Tm4sf1 transmembrane 4 L six family member 1 Sfrp2 secreted frizzled related protein 2 Calm2 calmodulin 2 Tln1 talin 1 Pfn1 profilin 1 Calm1 calmodulin 1 App amyloid beta precursor protein Lrp2 LDL receptor related protein 2 Tagln transgelin Lrp5 LDL receptor related protein 5 Eltd1 adhesion G protein-coupled receptor L4 Aqp6 aquaporin 6 Aqp3 aquaporin 3 (Gill blood group) Sfrp1 secreted frizzled related protein 1 Aqp1 aquaporin 1 (Colton blood group) Aqp2 aquaporin 2 Actb actin beta Bsg basigin (Ok blood group) Egr1 early growth response 1 Insr insulin receptor Arrdc3 arrestin domain containing 3 Slc34a1 solute carrier family 34 member 1 Wnk4 WNK lysine deficient protein kinase 4 Mep1a meprin A subunit alpha Ezr ezrin Itm2b integral membrane protein 2B Itm2c integral membrane protein 2C Sparc secreted protein acidic and cysteine rich Slc22a6 solute carrier family 22 member 6 Pcdh12 protocadherin 12 Acsm2 acyl-CoA synthetase medium chain family member 2A Pcbp1 poly(rC) binding protein 1 Wfdc2 WAP four-disulfide core domain 2 Pttg1ip PTTG1 interacting protein Tns1 tensin 1 Pkhd1 PKHD1, fibrocystin/polyductin Tspan9 tetraspanin 9 Pcbp2 poly(rC) binding protein 2 Fth1 ferritin heavy chain 1 Atp6v0a4 ATPase H+ transporting V0 subunit a4 Glul glutamate-ammonia ligase Apoe apolipoprotein E Cd14 CD14 molecule Sec62 SEC62 homolog, preprotein translocation factor Rps14 ribosomal protein S14 Ctsb cathepsin B Rhoa ras homolog family member A Tsc22d1 TSC22 domain family member 1 Akr1a1 aldo-keto reductase family 1 member A1 Gnb2l1 receptor for activated C kinase 1 Rhob ras homolog family member B Ptprf protein tyrosine phosphatase, receptor type F Id3 inhibitor of DNA binding 3, HLH protein 2310022b05rik RIKEN cDNA 2310022B05 gene Pabpc1 poly(A) binding protein cytoplasmic 1 Rab1 ribonuclease A family member 4 Calr calreticulin Aldob aldolase, fructose-bisphosphate B Aldoa aldolase, fructose-bisphosphate A Sgk1 serum/glucocorticoid regulated kinase 1 Ptpru protein tyrosine phosphatase, receptor type U Clic4 chloride intracellular channel 4 Slc44a2 solute carrier family 44 member 2 Cited2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 Klk1 kallikrein 1 Acy3 aminoacylase 3 Sdc4 syndecan 4 Tmprss2 transmembrane serine protease 2 Csde1 cold shock domain containing E1 Umod uromodulin Cx3cl1 C-X3-C motif chemokine ligand 1 Ptprg protein tyrosine phosphatase, receptor type G Socs3 suppressor of cytokine signaling 3 Nnt nicotinamide nucleotide transhydrogenase Rap1b RAP1B, member of RAS oncogene family Ctsl cathepsin L Mlec malectin Lmcd1 LIM and cysteine rich domains 1 Pck1 phosphoenolpyruvate carboxykinase 1 Sptbn1 spectrin beta, non-erythrocytic 1 Ctsd cathepsin D Tmem176a transmembrane protein 176A Tmem176b transmembrane protein 176B Ap2b1 adaptor related protein complex 2 beta 1 subunit Sorbs2 sorbin and SH3 domain containing 2 Ppp2ca protein phosphatase 2 catalytic subunit alpha Fkbp1a FK506 binding protein 1A Hnrnpa2b1 heterogeneous nuclear ribonucleoprotein A2/B1 Canx calnexin Dync1h1 dynein cytoplasmic 1 heavy chain 1 Gdi2 GDP dissociation inhibitor 2 Ctnnb1 catenin beta 1 Ptms parathymosin Crip2 cysteine rich protein 2 Nudt4 nudix hydrolase 4 Gnai2 G protein subunit alpha i2 Cst3 cystatin C Rn45s 45S pre-ribosomal RNA Ftl1 ferritin light chain 1 Acadm acyl-CoA dehydrogenase medium chain Camk2n1 calcium/calmodulin dependent protein kinase II inhibitor 1 Stab1 stabilin 1 Ctnna1 catenin alpha 1 Rac1 Rac family small GTPase 1 4833439l19rik RIKEN cDNA 4833439L19 gene Sptan1 spectrin alpha, non-erythrocytic 1 Ankrd13a ankyrin repeat domain 13A Cct5 chaperonin containing TCP1 subunit 5 Car2 carbonic anhydrase 2 Cd74 CD74 molecule Aplp2 amyloid beta precursor like protein 2 Shisa5 shisa family member 5 Lifr LIF receptor alpha Atp1b1 ATPase Na+/K+ transporting subunit beta 1 Gdf10 growth differentiation factor 10 Sdha succinate dehydrogenase complex flavoprotein subunit A Eef1a1 eukaryotic translation elongation factor 1 alpha 1 Mir6236 microRNA 6236 Myadm myeloid associated differentiation marker Amotl2 angiomotin like 2 Lrp10 LDL receptor related protein 10 Ivns1abp influenza virus NS1A binding protein Plvap plasmalemma vesicle associated protein Cd81 CD81 molecule Scnn1a sodium channel epithelial 1 alpha subunit Zfp36l1 ZFP36 ring finger protein like 1 Hdlbp high density lipoprotein binding protein Gimap6 GTPase, IMAP family member 6 Atp1a1 ATPase Na+/K+ transporting subunit alpha 1 Ndrg1 N-myc downstream regulated 1 Cox6a1 cytochrome c oxidase subunit 6A1 Fbln5 fibulin 5 Nt5e 5'-nucleotidase ecto Efnb2 ephrin B2 Car12 carbonic anhydrase 12 S1pr3 sphingosine-1-phosphate receptor 3 Myh11 myosin heavy chain 11 Pdia4 protein disulfide isomerase family A member 4 Pdia3 protein disulfide isomerase family A member 3 Cyp2j5 cytochrome P450, family 2, subfamily j, polypeptide 5 Cd93 CD93 molecule Idh2 isocitrate dehydrogenase (NADP(+)) 2, mitochondrial Dstn destrin, actin depolymerizing factor Pdia6 protein disulfide isomerase family A member 6 Picalm phosphatidylinositol binding clathrin assembly protein Prpf8 pre-mRNA processing factor 8 Gnb1 G protein subunit beta 1 Gnb2 G protein subunit beta 2 Gnas GNAS complex locus Uba1 ubiquitin like modifier activating enzyme 1 Cdh16 cadherin 16 Mfge8 milk fat globule-EGF factor 8 protein Vcl vinculin Atp6v1a ATPase H+ transporting V1 subunit A Ddx5 DEAD-box helicase 5 Wwc1 WW and C2 domain containing 1 Lpl lipoprotein lipase Plau plasminogen activator, urokinase Plat plasminogen activator, tissue type Ltbp4 latent transforming growth factor beta binding protein 4 Ltbp1 latent transforming growth factor beta binding protein 1 Nr4a1 nuclear receptor subfamily 4 group A member 1 Tgm2 transglutaminase 2 Cald1 caldesmon 1 Rgs2 regulator of G protein signaling 2 Cobll1 cordon-bleu WH2 repeat protein like 1 Ggt1 gamma-glutamyltransferase 1 Hspa9 heat shock protein family A (Hsp70) member 9 Cbx6 chromobox 6 Hspa5 heat shock protein family A (Hsp70) member 5 Mmp2 matrix metallopeptidase 2 Msn moesin Cav1 caveolin 1 Lamb2 laminin subunit beta 2 Lamb1 laminin subunit beta 1 Tapbp TAP binding protein Acta2 actin, alpha 2, smooth muscle, aorta Mmrn2 multimerin 2 Chpt1 choline phosphotransferase 1 Acox1 acyl-CoA oxidase 1 Alpl alkaline phosphatase, liver/bone/kidney Myh9 myosin heavy chain 9 Ndufs2 NADH:ubiquinone oxidoreductase core subunit S2 Plec plectin Rtn3 reticulon 3 Rtn4 reticulon 4 Ddx3x DEAD-box helicase 3, X-linked Nid1 nidogen 1 Ywhae tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon Lamc1 laminin subunit gamma 1 Ehhadh enoyl-CoA hydratase and 3-hydroxyacyl CoA dehydrogenase Chd4 chromodomain helicase DNA binding protein 4 Hk1 hexokinase 1 Calb1 calbindin 1 Cyp26b1 cytochrome P450 family 26 subfamily B member 1 Lasp1 LIM and SH3 protein 1 Ywhaz tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta Twsg1 twisted gastrulation BMP signaling modulator 1 Vdac1 voltage dependent anion channel 1 Keg1 glycine N-acyltransferase-like protein Keg1 Lama5 laminin subunit alpha 5 Ybx1 Y-box binding protein 1 Atp2a3 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 3 Atp2a2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 Thbs1 thrombospondin 1 Slc4a4 solute carrier family 4 member 4 Atp5g3 ATP synthase membrane subunit c locus 3 Pkd2 polycystin 2, transient receptor potential cation channel Arhgdia Rho GDP dissociation inhibitor alpha Gpi1 phosphatidylinositol glycan anchor biosynthesis class Q Oxct1 3-oxoacid CoA-transferase 1 Eps8l2 EPS8 like 2

Supplement Table 4: Upregulated differentially expressed transcripts with KLF15 binding sites (Tg26;PODTA;TRE-KLF15 vs. Tg26;PODTA mice) Gene Description Binding Symbol Sites Meis2 Meis Homeobox 2 19 Nphs1 Nephrin 15 Arhgef18 Rho/Rac Guanine Nucleotide Exchange Factor 18 8 Hivep1 Human Immunodeficiency Virus Type I Enhancer Binding Protein 1 7 Wt1 Wilms Tumor 1 7 Cdkn1c Cyclin Dependent Kinase Inhibitor 1C 6 Inf2 Inverted Formin, FH2 And WH2 Domain Containing 6 Nell2 Neural EGFL Like 2 4 Cdc14a Cell Division Cycle 14A 3 Hmbox1 Homeobox Containing 1 3 Neat1 Nuclear Paraspeckle Assembly Transcript 1 (Non-Protein Coding) 3 Npr3 Natriuretic Peptide Receptor 3 3 Tenc1 Tensin 2 3 Aplp1 Amyloid Beta Precursor Like Protein 1 2 Clic5 Chloride Intracellular Channel 5 2 Hipk2 Homeodomain Interacting Protein Kinase 2 2 Ildr2 Immunoglobulin Like Domain Containing Receptor 2 2 Per1 Period Circadian Clock 1 2 Per3 Period Circadian Clock 3 2 Phactr2 Phosphatase And Actin Regulator 2 2 Robo2 Roundabout Guidance Receptor 2 2 Serping1 Serpin Family G Member 1 2 Speg SPEG Complex Locus 2 St3gal1 ST3 Beta-Galactoside Alpha-2,3-Sialyltransferase 1 2 Abat 4-Aminobutyrate Aminotransferase 1 B2m Beta-2-Microglobulin 1 Clic3 Chloride Intracellular Channel 3 1 Ddn Dendrin 1 Fam65a RHO Family Interacting Cell Polarization Regulator 1 1 Hlf HLF, PAR BZIP Transcription Factor 1 Kdr Kinase Insert Domain Receptor 1 Klf13 Kruppel Like Factor 13 1 Lats2 Large Tumor Suppressor Kinase 2 1 Leng8 Leukocyte Receptor Cluster Member 8 1 Lmo7 LIM Domain 7 1 Mafb MAF BZIP Transcription Factor B 1 Malat1 Metastasis Associated Lung Adenocarcinoma Transcript 1 (Non-Protein Coding) 1 Man1a2 Mannosidase Alpha Class 1A Member 2 1 Mecp2 Methyl-CpG Binding Protein 2 1 Mertk MER Proto-Oncogene, Tyrosine Kinase 1 Nphs2 Podocin 1 Nr1d1 Nuclear Receptor Subfamily 1 Group D Member 1 1 Plce1 Phospholipase C Epsilon 1 1 Rhpn1 Rhophilin Rho GTPase Binding Protein 1 1 Sema5a Semaphorin 5A 1 Setd7 SET Domain Containing Lysine Methyltransferase 7 1 Sh3bgrl2 SH3 Domain Binding Glutamate Rich Protein Like 2 1 Synpo Synaptopodin 1 Tef TEF, PAR BZIP Transcription Factor 1 Tspan2 Tetraspanin 2 1

Supplement Table 5: Primer Sequences for genotyping Gene Forward primer Reverse primer TRE-KLF15-1 AATAGGCGTATCACGAGGCCCTTCG TTCTCGTCCACTGGAAGTAAG TRE-KLF15-2 ACTCAGGTGTGAAGCCGTAC CTCGAGGCAGTGAAAAAAATGC NPHS2-rtTA GAACAACGCCAAGTCATTCCG TACGCAGCCCAGTGTAAAGTGG Tg26 AGAATCGCAAAACCAGCCG TATCAGCACTTGTGGAGATGGGGG

Supplement Table 6: Primer Sequences for Real-Time PCR Gene Forward primer Reverse primer HsKLF15 GTTGGGTATCTGGGTGATAGGC TGAGAGTCGGGACTGGAACAG Klf15 AGAGCAGCCACCTCAAGGCCCA TCACACCCGAGTGAGATCGCCGGT Nef CAGTATCTCGAGACCTAGAA TAGCTTGTAGCACCATCCAA Vpr TGAAACTTACGGGGATACTTGG GTCGAGTAACGCCTATTCTGC Nephrin GTGCCCTGAAGGACCCTACT CCTGTGGATCCCTTTGACAT Podocin CCATAAGGCCAGATGAGGAA GATTCTCTTCACTGCCACCG Synaptopodin CTTTGGGGAAGAGGCCGATTG GTTTTCGGTGAAGCTTGTGC Wt1 GAGAGCCAGCCTACCATCC GGGTCCTCGTGTTTGAAGGAA Fn ATGGTACAGCTGATCCTGCC GCCCTGGTTTGTACCTGCTA Col1a1 GCTCTTTTTAGATACTGTGGTGAGGAA GTTTCCACGTCTCACCATTG Vimentin GGATCAGCTCACCAACGACA GGTCAAGACGTGCCAGAGAA α-Sma GAGGCACCACTGAACCCTAA CATCTCCAGAGTCCAGCACA Il-1 CAGGATGAGGACATGAGCACC CTCTGCAGACTCAAACTCCAC Il-6 GACAAAGCCAGAGTCCTTCAGAGAG CTAGGTTTGCCGAGTAGATCTC Tnf-α ATGAGCACAGAAAGCATGATC TACAGGCTTGTCACTCGAATT Ifn-γ TCAAGTGGCATAGATGTGGAAGAA TGGCTCTGCAGGATTTTCATG Tnfr1 TGAGTGCGTCCCTTGCAGCCA AACCAGGGGCAACAGCACCGCA Tnfr2 TGGGGGCCATCCCCAAGCAAGA TGACGTGGGTCCCGTGGCTT Cdkn1c GCGCAAACGTCTGAGATGAGT AGAGTTCTTCCATCGTCCGCT Clic5 AACACCGTGCAAAAGAGAGGC GACAGTTGCCAATGCTTTCCC Inf2 GGCTGTGTGTGATCCAGTGA ACGGAGTTTGGGTTTCTCGG Plce1 AAGCTGTCCCATGTACCAGAAG TTTCGATGGATGGGTTTTGTGC Vegfa CACAGCAGATGTGAATGCAG TTTACACGTCTGCGGATCTT Podxl TCCTAAGGCCGTGTATGAGC GATGCCATGCAGACGATG Thbs1 GGCGATGCCTGTGCTGT TGTTGTCACAAGTGTCCCCT c-Myc GAGCTCCTCGAGCTGTTTGA GCATCGTCGTGGCTGTCT Tcf7l2 TCGCCAGCACACATCGTT AGATATCTGGAGGCTGCGGA Lef1 AGCCTGTTTATCCCATCACG TGTTACAATAGCTGGATGAGGG Neat1 TGGAGCCCCTGCCAGTGTGA AGGCCGCTGTCTCCTCCAGG Egr1 GACGAGTTATCCCAGCCAAA GGCAGAGGAAGACGATGAAG Gapdh GCCATCAACGACCCCTTCAT ATGATGACCCGTTTGGCTCC β-actin GTTCCGATGCCCTGAGGCTCTT CGTCACACTTCATGATGGAATTGA

Supplement Table 7: ChIP Primer Sequences for Real-Time PCR ChIP Primers Forward Reverse WT1 ChIP Primer set 1 GACCTCTGGAACCCACAAAG TTGAGTCTGGCTCTTGCTTC (-584 to -485 bp)* WT1 ChIP Primer set 2 CCGGAATATACGCAGGCTTT GTTTCCCTTTCCAGTGAGGAATA (-857 to -740 bp)* WT1 ChIP Primer set 3 AGAAGATCCAAAAACCAAACCA TTCGCTAAATCTGACTCCCTTC (-1224 to -1115 bp)* * Distance to transcription start site (TSS) of WT1

SIGNIFICANCE STATEMENT

For proteinuric diseases that are characterized by podocyte injury, such as FSGS and minimal change disease, therapeutic agents are limited and have systemic toxicities that hinder chronic use. Previous studies showed that the loss of the kidney-enriched zinc finger transcription factor Krüppel-like factor 15 (KLF15) increases susceptibility to proteinuric kidney disease and attenuates salutary effects of retinoic acid and glucocorticoids on the podocyte. The authors show that podocyte-specificinduction of KLF15 ameliorates kidney injury and improves overall survival in proteinuric mice by directly and indirectly upregulating the expression of genes critical for podocyte differentiation. The study’s findings provide evidence for a potential role of KLF15 as a therapeutic target in proteinuric kidney disease.