DOCSLIB.ORG

Molecular Phylogeny of Jacanas and Its Implications for Morphologic and Biogeographic Evolution

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Phylogeny of Jacanas and Its Implications for Morphologic and Biogeographic Evolution The Auk 117(1):22-32, 2000 MOLECULAR PHYLOGENY OF JACANAS AND ITS IMPLICATIONS FOR MORPHOLOGIC AND BIOGEOGRAPHIC EVOLUTION LINDA A. WHITTINGHAM, TMFREDERICK H. SHELDON,2 AND STEPHENT. EMLEN3 1Departrnentof BiologicalSciences, University of Wisconsin-Milwaukee,Milwaukee, Wisconsin 53201, USA; 2Museumof Natural Science,119 FosterHall, LouisianaState University, Baton Rouge, Louisiana 70803, USA;and 3Sectionof Neurobiologyand Behavior, Division of BiologicalSciences, Cornell University, Ithaca, New York 14853, USA ABSTRACT.--Wecompared sequences of mitochondrialcytochrome-b and ND5 genesin a phylogeneticanalysis of sevenspecies of jacanas,representing all six generaand including the GreaterPainted-snipe (Rostratula benghalensis) asan outgroup.When analyzedseparately by parsimonyand maximum-likelihoodbootstrapping, the two genesproduced consistent trees,although the ND5 tree was better resolvedthan the cytochrome-btree. When com- bined,the data from the two genesproduced a fully resolvedtree that was identicalto the ND5 tree.This tree had the followingform: ((((Irediparra,Microparra), Metopidius), Actophi- lornis),((Jacana jacana, J. spinosa), Hydrophasianus) ), Rostratula. The phylogenyconsists of two majorclades that wereknown to traditionaland phylogenetictaxonomists. It alsocontains sistertaxa that are geographicallydisjunct: the New WorldJacana and Asian Hydrophasianus, and the AfricanMicroparra and AustralianIrediparra. We postulatethat this biogeographic pattern resultsfrom the extinctionof interveningAfrican and Asian taxa, respectively.Re- ceived31 May 1998,accepted 26 April 1999. JACANASare worldwide inhabitantsof trop- Sibleyand Ahlquist1990, Chu 1995).Strauch's ical and subtropicalopen wetlands.Eight ex- (1978)character-compatibility (clique) analysis tant speciesin six generaare recognizedin the of 63 skeletal and seven muscular characters of family Jacanidae.Four genera are monotypic shorebirdsdefined two groupsof jacanagen- and occuron three continents:Microparra (Af- era: (1) Hydrophasianusand Jacana,and (2) Me- rica), Irediparra (Australia), Hydrophasianus topidius,Actophilornis, Irediparra, and Micropar- (Asia), andMetopidius (Asia). Two othergenera ra. Following a critical appraisalof Strauch's consist of two species:Actophilornis africanus shorebirdstudy (Michevichand Parenti1980), (Africa) and A. albinucha(Madagascar), and Ja- Chu (1995)reanalyzed Strauch's data using cla- canajacana (South America) and J. spinosa (Cen- distic parsimony.His reanalysisindicated the tral America).The generaof jacanasare mainly monophylyof jacanasbut was not designedto allopatric, but some co-occur in portions of resolverelationships within the family. Sibley Asia (Hydrophasianusand Metopidius)and Af- and Ahlquist's(1990) DNA-DNA hybridization rica (Actophilornisand Microparra).The two Ja- study indicatedthat Actophilorniswas much canaspecies co-occur and hybridizeonly in a closerto Irediparrathan to Jacana.Unfortunate- small area of western Panama (Wetmore 1965). ly, Sibleyand Ahlquistdid not includeother ja- Until recently,relationships of the jacanasto canataxa in their comparisons. other groupsof birds were poorly known. It is To shedmore light on intergenericrelation- now clearthat they are membersof the Char- shipsin jacanas,we comparedDNA sequences adriiformesand probablyare most closelyre- of portionsof the mitochondrialcytochrome-b lated to painted-snipes,family Rostratulidae geneand the fifth subunitof nicotinamidead- (Kitto and Wilson 1966, Strauch1978, Sibley eninedinucleotide dehydrogenase gene (ND5) and Ahlquist1990). Within the Jacanidae,there of all sixgenera. These comparisons resolve the havebeen no thoroughmodern studies of in- jacanaphylogeny and providean initial assess- tergenericrelationships. The only systematic ment of the utility of ND5 sequencesfor study- studieshave been tangentsof larger efforts to ing avian phylogeny.Knowledge of the phy- reconstructshorebird phylogeny (Strauch 1978, logenyof jacanaspermits us to speculateon the evolutionaryforces that shapedtheir morphol- 4E-mail: [email protected] ogy and distribution. 22 January2000] JacanaPhylogeny 23 METHODS proportion of transversions(Moore and DeFillipis 1997); ti:tv was also estimated via the maximum- One individual from eachof sevenspecies repre- likelihoodoption in PAUP*(Swofford 1998). Phylo- sentingall six generaof the Jacanidaewere sampled genetic relationshipswere estimated using maxi- (Table 1): African Jacana (Actophilornisafricanus), mum-likelihood (randomized heuristic search) and LesserJacana (Microparra capensis), Comb-crested Ja- maximum-parsimony(branch and bound search) cana (Irediparragallinacea), Pheasant-tailed Jacana methodswith PAUP*.Bootstrapping values (100 rep- (Hydrophasianuschirurgus), Bronze-winged Jacana licates) were determined for both maximum-likeli- (Metopidiusindicus), Wattled Jacana(Jacana jacana), hood and parsimonymethods to assesssupport for and NorthernJacana (J. spinosa). The GreaterPainted- internalbranches. Cytochrome-b and ND5 datawere snipe (Rostratulabenghalensis) was used as an out- combinedand analyzedseparately to observethe be- group becauseof its apparentclose relationship to haviorof the genes. the jacanas(Sibley and Ahlquist 1990). Laboratorymethods.--In an attempt to avoid ampli- ficationof nuclear pseudogenes,we extractedDNA RESULTS from tissue,which has a relativelyhigh mitochon- drial DNA contentcompared with blood (Sorenson Characteristicsofsequence data.--We examined and Fleischer 1996, Quinn 1997). DNA was extracted a total of 705 nucleotides(345 of cytochromeb from 0.1 g of heart, liver, or muscletissue following and 360 of ND5) for sevenspecies of jacanas the standardphenol/chloroform extraction method and the outgroup(Rostratula). Average nucle- (Hillis et al. 1990).A portionof the mitochondrialcy- otide compositionsfor both genesand all po- tochrome-band ND5 geneswas isolatedand ampli- sitions were as follows: G = 11.3%, A = 30.2%, fied via the polymerasechain reaction (PCR). We used the following primers for cytochrome b T = 24.3% and C = 34.2%. Nucleotide compo- (H16065: GGAGTCTTCAGTCTCTGGTTTACAAGAC sitionalbias was highestat third-codonposi- and L15656: AACCTACTAGGAGACCCAGA; Helm- tions, intermediate at second positions, and Bychowskiand Cracraft 1993) and ND5 (H14149: lowestat first positions(Table 2). First positions CCTATTTTGCGGATGTCTTGTTC and L 13753: CAG- were biasedslightly, being G-poor and C-rich GAAAATCCGCTCAATTCGG; Garcia-Moreno et al. for cytochromeb andslightly T-poor and A-rich 1999). Primer sequencesare listed 5' to 3' and num- for ND5 (Table2). Secondpositions were G- bersrefer to the 3' baseof the primer referencedto poor and T-rich for both cytochromeb and the completemtDNA sequenceof the chicken(Gallus ND5. Third positionsof bothgenes were most gallus;Desjardins and Morais 1990).H and L refer to primerslocated on the heavyand light strandsof the heavily biasedtoward G- and T-poor and A- and C-rich. The total number of variable and mitochondrialgenome, respectively. PCR reactionswere done in 50-•L volumes using potentiallyphylogenetically informative sites 0.5 •M of eachprimer, 2.5 mM MgCI2,10 mM of each was similar for both cytochrome-band ND5 dNTP, and 3 U of Taqpolymerase. Thermal cycling fragments(Table 3). Althoughthe numberof began with 3.0 min at 94øCfor initial denaturation, variableamino acidsappeared lower for ND5 followedby 35 cyclesof denaturation(94øC, 1 min), than for cytochromeb, the numberof poten- annealing (46 to 50øC,1.5 min) and extension(72øC, tially informative amino acidswas similar (Ta- 1 min), and a final extensionof 10 min at 72øC.PCR ble 3). The numbersof variableand informative productswere run on a 2% low-meltagarose gel that was stained with ethidium bromide, allowing the siteswere highest at third- codonpositions, in- amplifiedDNA fragmentto be visualized under UV termediateat first positions,and lowest at sec- illumination and excisedfrom the gel. PCR products ond positions(Table 2). Thesetrends were ev- were purified and concentratedwith Wizard PCR identwhether or not the outgroupwas includ- PrepsKit (PromegaA7170) and then sequenceddi- ed with the jacanas. rectly on an ABI 373 Stretchautomated sequencer. The percentdivergence (using the Tamura Sequencesare deposited in GenBank under acces- and Nei [1993] correction)among taxa for cy- sion numbers AF146616 to AF146631. tochrome b and ND5 is summarized in Table 4 Dataanalysis.--Sequences were alignedby eye rel- and Figure 1. For cytochrome-bsequences, in- ativeto the chickensequence (Desjardins and Morals group divergenceranged from 2% (Jacanaja- 1990)using the editor and translatorin MEGA (Ku- mar et al. 1993).Base frequencies, variation, pairwise canato ]. spinosa)to 17.2%(Irediparra to ]acana transition and transversion values, and distances jacana). Similarly, ND5 ingroup divergence were determined with MEGA. Overall transition to ranged from 1.7% (Jacanajacana to J.spinosa) to transversionratio (ti:tv) was estimatedby plotting 17.4% (Microparrato Actophilornisand Micro- the pairwise proportion of transitionsversus the parra to Hydrophasianus).For the combined 24 WHITTINGHAM,SHELDON, AND EMLEN [Auk,Vol. 117 TABLE1. Distributionsand collectionlocalities of jacanaspecies sampled plus the outgroup. Speciesa Distribution Samplenumber b Collectionlocality African Jacana Central and southern Africa LSUMNS B19187 Dallas Zoo (Actophilornisafricanus) Lesser Jacana Central and southeastern Africa LSUMNS B23806 South Africa (Microparracapensis) Comb-crested Jacana Malaysia, northeasternAustralia
Load more

Recommended publications
  • Phylogenetic Reanalysis of Strauch's Osteological Data Set for The
    TheCondor97:174-196 0 The Cooper Ornithological Society 1995 PHYLOGENETIC REANALYSIS OF STRAUCH’S OSTEOLOGICAL DATA SET FOR THE CHARADRIIFORMES PHILIP c. CHU Department of Biology and Museum of Zoology The University of Michigan, Ann Arbor, MI 48109 Abstract. Strauch’s (1978) compatibility analysisof relationshipsamong the shorebirds (Charadriifonnes) was the first study to examine the full range of charadriifonn taxa in a reproducibleway. SubsequentlyMickevich and Parenti (1980) leveled seriouscharges against Strauch’s characters,method of phylogenetic inference, and results. To account for these charges,Strauch ’s characterswere re-examined and recoded, and parsimony analyseswere performed on the revised matrix. A parsimony analysison 74 taxa from the revised matrix yielded 855 shortesttrees, each length = 286 and consistencyindex = 0.385. In each shortest tree there were two major lineages,a lineageof sandpiper-likebirds and a lineageof plover- like birds; the two formed a monophyletic group, with the auks (Alcidae) being that group’s sister taxon. The shortest trees were then compared with other estimates of shorebird re- lationships, comparison suggestingthat the chargesagainst Strauch’s results may have re- sulted from the Mickevich and Parenti decisions to exclude much of Strauch’s character evidence. Key words: Charadrilformes; phylogeny; compatibility analysis: parsimony analysis; tax- onomic congruence. INTRODUCTION Strauch scored 227 charadriiform taxa for 70 The investigation of evolutionary relationships characters. Sixty-three of the characters were among shorebirds (Aves: Charadriiformes) has a taken from either the skull or postcranial skel- long history (reviewed in Sibley and Ahlquist eton; the remaining seven involved the respec- 1990). Almost all studies used morphology to tive origins of three neck muscles, as published make inferences about shared ancestry; infer- in Burton (1971, 1972, 1974) and Zusi (1962).
    [Show full text]
  • The Birds (Aves) of Oromia, Ethiopia – an Annotated Checklist
    European Journal of Taxonomy 306: 1–69 ISSN 2118-9773 https://doi.org/10.5852/ejt.2017.306 www.europeanjournaloftaxonomy.eu 2017 · Gedeon K. et al. This work is licensed under a Creative Commons Attribution 3.0 License. Monograph urn:lsid:zoobank.org:pub:A32EAE51-9051-458A-81DD-8EA921901CDC The birds (Aves) of Oromia, Ethiopia – an annotated checklist Kai GEDEON 1,*, Chemere ZEWDIE 2 & Till TÖPFER 3 1 Saxon Ornithologists’ Society, P.O. Box 1129, 09331 Hohenstein-Ernstthal, Germany. 2 Oromia Forest and Wildlife Enterprise, P.O. Box 1075, Debre Zeit, Ethiopia. 3 Zoological Research Museum Alexander Koenig, Centre for Taxonomy and Evolutionary Research, Adenauerallee 160, 53113 Bonn, Germany. * Corresponding author: [email protected] 2 Email: [email protected] 3 Email: [email protected] 1 urn:lsid:zoobank.org:author:F46B3F50-41E2-4629-9951-778F69A5BBA2 2 urn:lsid:zoobank.org:author:F59FEDB3-627A-4D52-A6CB-4F26846C0FC5 3 urn:lsid:zoobank.org:author:A87BE9B4-8FC6-4E11-8DB4-BDBB3CFBBEAA Abstract. Oromia is the largest National Regional State of Ethiopia. Here we present the first comprehensive checklist of its birds. A total of 804 bird species has been recorded, 601 of them confirmed (443) or assumed (158) to be breeding birds. At least 561 are all-year residents (and 31 more potentially so), at least 73 are Afrotropical migrants and visitors (and 44 more potentially so), and 184 are Palaearctic migrants and visitors (and eight more potentially so). Three species are endemic to Oromia, 18 to Ethiopia and 43 to the Horn of Africa. 170 Oromia bird species are biome restricted: 57 to the Afrotropical Highlands biome, 95 to the Somali-Masai biome, and 18 to the Sudan-Guinea Savanna biome.
    [Show full text]
  • Tinamiformes – Falconiformes
    LIST OF THE 2,008 BIRD SPECIES (WITH SCIENTIFIC AND ENGLISH NAMES) KNOWN FROM THE A.O.U. CHECK-LIST AREA. Notes: "(A)" = accidental/casualin A.O.U. area; "(H)" -- recordedin A.O.U. area only from Hawaii; "(I)" = introducedinto A.O.U. area; "(N)" = has not bred in A.O.U. area but occursregularly as nonbreedingvisitor; "?" precedingname = extinct. TINAMIFORMES TINAMIDAE Tinamus major Great Tinamou. Nothocercusbonapartei Highland Tinamou. Crypturellus soui Little Tinamou. Crypturelluscinnamomeus Thicket Tinamou. Crypturellusboucardi Slaty-breastedTinamou. Crypturellus kerriae Choco Tinamou. GAVIIFORMES GAVIIDAE Gavia stellata Red-throated Loon. Gavia arctica Arctic Loon. Gavia pacifica Pacific Loon. Gavia immer Common Loon. Gavia adamsii Yellow-billed Loon. PODICIPEDIFORMES PODICIPEDIDAE Tachybaptusdominicus Least Grebe. Podilymbuspodiceps Pied-billed Grebe. ?Podilymbusgigas Atitlan Grebe. Podicepsauritus Horned Grebe. Podicepsgrisegena Red-neckedGrebe. Podicepsnigricollis Eared Grebe. Aechmophorusoccidentalis Western Grebe. Aechmophorusclarkii Clark's Grebe. PROCELLARIIFORMES DIOMEDEIDAE Thalassarchechlororhynchos Yellow-nosed Albatross. (A) Thalassarchecauta Shy Albatross.(A) Thalassarchemelanophris Black-browed Albatross. (A) Phoebetriapalpebrata Light-mantled Albatross. (A) Diomedea exulans WanderingAlbatross. (A) Phoebastriaimmutabilis Laysan Albatross. Phoebastrianigripes Black-lootedAlbatross. Phoebastriaalbatrus Short-tailedAlbatross. (N) PROCELLARIIDAE Fulmarus glacialis Northern Fulmar. Pterodroma neglecta KermadecPetrel. (A) Pterodroma
    [Show full text]
  • REGUA Bird List July 2020.Xlsx
    Birds of REGUA/Aves da REGUA Updated July 2020. The taxonomy and nomenclature follows the Comitê Brasileiro de Registros Ornitológicos (CBRO), Annotated checklist of the birds of Brazil by the Brazilian Ornithological Records Committee, updated June 2015 - based on the checklist of the South American Classification Committee (SACC). Atualizado julho de 2020. A taxonomia e nomenclatura seguem o Comitê Brasileiro de Registros Ornitológicos (CBRO), Lista anotada das aves do Brasil pelo Comitê Brasileiro de Registros Ornitológicos, atualizada em junho de 2015 - fundamentada na lista do Comitê de Classificação da América do Sul (SACC).
    [Show full text]
  • BIO 313 ANIMAL ECOLOGY Corrected
    NATIONAL OPEN UNIVERSITY OF NIGERIA SCHOOL OF SCIENCE AND TECHNOLOGY COURSE CODE: BIO 314 COURSE TITLE: ANIMAL ECOLOGY 1 BIO 314: ANIMAL ECOLOGY Team Writers: Dr O.A. Olajuyigbe Department of Biology Adeyemi Colledge of Education, P.M.B. 520, Ondo, Ondo State Nigeria. Miss F.C. Olakolu Nigerian Institute for Oceanography and Marine Research, No 3 Wilmot Point Road, Bar-beach Bus-stop, Victoria Island, Lagos, Nigeria. Mrs H.O. Omogoriola Nigerian Institute for Oceanography and Marine Research, No 3 Wilmot Point Road, Bar-beach Bus-stop, Victoria Island, Lagos, Nigeria. EDITOR: Mrs Ajetomobi School of Agricultural Sciences Lagos State Polytechnic Ikorodu, Lagos 2 BIO 313 COURSE GUIDE Introduction Animal Ecology (313) is a first semester course. It is a two credit unit elective course which all students offering Bachelor of Science (BSc) in Biology can take. Animal ecology is an important area of study for scientists. It is the study of animals and how they related to each other as well as their environment. It can also be defined as the scientific study of interactions that determine the distribution and abundance of organisms. Since this is a course in animal ecology, we will focus on animals, which we will define fairly generally as organisms that can move around during some stages of their life and that must feed on other organisms or their products. There are various forms of animal ecology. This includes: • Behavioral ecology, the study of the behavior of the animals with relation to their environment and others • Population ecology, the study of the effects on the population of these animals • Marine ecology is the scientific study of marine-life habitat, populations, and interactions among organisms and the surrounding environment including their abiotic (non-living physical and chemical factors that affect the ability of organisms to survive and reproduce) and biotic factors (living things or the materials that directly or indirectly affect an organism in its environment).
    [Show full text]
  • Dieter Thomas Tietze Editor How They Arise, Modify and Vanish
    Fascinating Life Sciences Dieter Thomas Tietze Editor Bird Species How They Arise, Modify and Vanish Fascinating Life Sciences This interdisciplinary series brings together the most essential and captivating topics in the life sciences. They range from the plant sciences to zoology, from the microbiome to macrobiome, and from basic biology to biotechnology. The series not only highlights fascinating research; it also discusses major challenges associated with the life sciences and related disciplines and outlines future research directions. Individual volumes provide in-depth information, are richly illustrated with photographs, illustrations, and maps, and feature suggestions for further reading or glossaries where appropriate. Interested researchers in all areas of the life sciences, as well as biology enthusiasts, will find the series’ interdisciplinary focus and highly readable volumes especially appealing. More information about this series at http://www.springer.com/series/15408 Dieter Thomas Tietze Editor Bird Species How They Arise, Modify and Vanish Editor Dieter Thomas Tietze Natural History Museum Basel Basel, Switzerland ISSN 2509-6745 ISSN 2509-6753 (electronic) Fascinating Life Sciences ISBN 978-3-319-91688-0 ISBN 978-3-319-91689-7 (eBook) https://doi.org/10.1007/978-3-319-91689-7 Library of Congress Control Number: 2018948152 © The Editor(s) (if applicable) and The Author(s) 2018. This book is an open access publication. Open Access This book is licensed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license and indicate if changes were made.
    [Show full text]
  • Check List 4(2): 152–158, 2008
    Check List 4(2): 152–158, 2008. ISSN: 1809-127X LISTS OF SPECIES Mammals, Birds and Reptiles in Balbina reservoir, state of Amazonas, Brazil. Márcia Munick Mendes Cabral Gália Ely de Mattos Fernando César Weber Rosas Instituto Nacional de Pesquisas da Amazônia (INPA). Laboratório de Mamíferos Aquáticos. Caixa Postal 478. CEP 69011-970, Manaus, AM, Brazil. E-mail: [email protected] Abstract: The construction of hydroelectric power stations can affect the fauna, including the adaptation to the new lentic conditions, and may lead to the disappearance of some species and the colonization of others. Usually, there is a lack of information in the post-flooding phases. The present study is a preliminary qualitative survey of mammals, birds, and reptiles in the influenced area of the Balbina hydroelectric dam (01º55' S, 59º29' W). Species records were made during field trips to the reservoir with no group specific methods. The conservation status of the identified species followed the classification adopted by IUCN. Twenty-two mammals (one endangered – EN), forty-two birds and six reptiles (one vulnerable – VU) were identified. Although the list presented here is preliminary, if appropriately complemented it can be used to understand the effects of hydroelectric dams on the Amazonian fauna. Introduction The construction of large hydroelectric power et al. 2007) by the researchers of the Laboratório stations can affect the fauna by large impacts on de Mamíferos Aquáticos of the Instituto Nacional the aquatic and terrestrial environments. Wild de Pesquisas da Amazônia (LMA/INPA). Due to animals are intimately related with their the lack of information about the fauna that surroundings and can be strongly affected by currently inhabits the Balbina reservoir, and drastic alterations in the habitats.
    [Show full text]
  • Zambia and Zimbabwe 28 Ovember – 6 December 2009
    Zambia and Zimbabwe 28 ovember – 6 December 2009 Guide: Josh Engel A Tropical Birding Custom Tour All photos taken by the guide on this tour. The Smoke that Thunders: looking down one end of the mile-long Victoria Falls. ITRODUCTIO We began this tour by seeing one of Africa’s most beautiful and sought after birds: African Pitta . After that, the rest was just details. But not really, considering we tacked on 260 more birds and loads of great mammals. We saw Zambia’s only endemic bird, Chaplin’s Barbet , as well as a number of miombo and broad-leaf specialties, including Miombo Rock-Thrush, Racket-tailed Roller, Southern Hyliota, Miombo Pied Barbet, Miombo Glossy Starling, Bradfield’s Hornbill, Pennant-winged ightjar, and Three-banded Courser. With the onset of the rainy season just before the tour, the entire area was beautifully green and was inundated with migrants, so we were able to rack up a great list of cuckoos and other migrants, including incredible looks at a male Kurrichane Buttonquail . Yet the Zambezi had not begun to rise, so Rock Pratincole still populated the river’s rocks, African Skimmer its sandbars, and Lesser Jacana and Allen’s Gallinule its grassy margins. Mammals are always a highlight of any Africa tour: this trip’s undoubted star was a leopard , while a very cooperative serval was also superb. Victoria Falls was incredible, as usual. We had no problems in Zimbabwe whatsoever, and our lodge there on the shores of the Zambezi River was absolutely stunning. The weather was perfect throughout the tour, with clouds often keeping the temperature down and occasional rains keeping bird activity high.
    [Show full text]
  • Namibia & the Okavango
    Pel’s Fishing Owl - a pair was found on a wooded island south of Shakawe (Jan-Ake Alvarsson) NAMIBIA & THE OKAVANGO 21 SEPTEMBER – 8 OCTOBER 2017 LEADER: STEVE BRAINE For most of the country the previous three years drought had been broken and although too early for the mi- grants we did however do very well with birding generally. We searched and found all the near endemics as well as the endemic Dune Lark. Besides these we also had a new write-in for the trip! In the floodplains after observing a wonderful Pel’s Fishing Owl we travelled down a side channel of the Okavango River to look for Pygmy Geese, we were lucky and came across several pairs before reaching a dried-out floodplain. Four birds flew out of the reedbeds and looked rather different to the normal weavers of which there were many, a closer look at the two remaining birds revealed a beautiful pair of Cuckoo Finches. These we all enjoyed for a brief period before they followed the other birds which had now disappeared into the reedbeds. Very strong winds on three of the birding days made birding a huge challenge to say the least after not finding the rare and difficult Herero Chat we had to make alternate arrangements at another locality later in the trip. The entire tour from the Hosea Kutako International Airport outside the capital Windhoek and returning there nineteen days later delivered 375 species. Out of these, four birds were seen only by the leader, a further three species were heard but not seen.
    [Show full text]
  • Species and Sex Divergence in Vocalizations Between Hybridizing Role-Reversed Shorebirds, Northern Jacana
    bioRxiv preprint doi: https://doi.org/10.1101/757336; this version posted September 6, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Species and sex divergence in vocalizations between hybridizing role-reversed 2 shorebirds, Northern Jacana (Jacana spinosa) and Wattled Jacana (Jacana 3 jacana) 4 5 Evan J. Buck1, Toni Brown2, Gina Zwicky2, Elizabeth P. Derryberry1,2, Sara E. Lipshutz1,2,3* 6 1Department of Ecology and Evolutionary Biology, University of Tennessee, Knoxville, TN, 7 USA 8 2Department of Ecology and Evolutionary Biology, Tulane University, New Orleans, LA, USA 9 3Department of Biology, Indiana University, Bloomington, IN, USA 10 * Corresponding author: [email protected] 11 12 ABSTRACT—Species-specific vocalizations can act as a reproductive isolating mechanism 13 between closely related populations. We analyzed vocal divergence between two hybridizing 14 species of sex-role reversed polyandrous shorebirds, the Northern Jacana (Jacana 15 spinosa) and Wattled Jacana (Jacana jacana). We found that J. spinosa calls have higher peak 16 frequency and fundamental frequency than J. jacana calls. We also compared calls 17 between males and females, as both jacana species are sex-role reversed and females compete for 18 male mates. Males produce calls with a higher peak frequency, exhibit shorter note lengths and 19 emit a greater number of notes within a calling bout than females, which could relate to mate 20 attraction. These results suggest that vocal divergence could act as a behavioral barrier to limit 21 hybridization between the species and vocalizations may function differently between male and 22 female jacanas.
    [Show full text]
  • Wildlife Ecology Provincial Resources
    MANITOBA ENVIROTHON WILDLIFE ECOLOGY PROVINCIAL RESOURCES !1 ACKNOWLEDGEMENTS We would like to thank: Olwyn Friesen (PhD Ecology) for compiling, writing, and editing this document. Subject Experts and Editors: Barbara Fuller (Project Editor, Chair of Test Writing and Education Committee) Lindsey Andronak (Soils, Research Technician, Agriculture and Agri-Food Canada) Jennifer Corvino (Wildlife Ecology, Senior Park Interpreter, Spruce Woods Provincial Park) Cary Hamel (Plant Ecology, Director of Conservation, Nature Conservancy Canada) Lee Hrenchuk (Aquatic Ecology, Biologist, IISD Experimental Lakes Area) Justin Reid (Integrated Watershed Management, Manager, La Salle Redboine Conservation District) Jacqueline Monteith (Climate Change in the North, Science Consultant, Frontier School Division) SPONSORS !2 Introduction to wildlife ...................................................................................7 Ecology ....................................................................................................................7 Habitat ...................................................................................................................................8 Carrying capacity.................................................................................................................... 9 Population dynamics ..............................................................................................................10 Basic groups of wildlife ................................................................................11
    [Show full text]
  • ETHIOPIA: Birding the Roof of Africa; with Southern Extension a Tropical Birding Set Departure
    ETHIOPIA: Birding the Roof of Africa; with Southern Extension A Tropical Birding Set Departure February 7 – March 1, 2010 Guide: Ken Behrens All photos taken by Ken Behrens during this trip ORIENTATION I have chosen to use a different format for this trip report. First, comes a general introduction to Ethiopia. The text of this section is largely drawn from the recently published Birding Ethiopia, authored by Keith Barnes, Christian, Boix and I. For more information on the book, check out http://www.lynxeds.com/product/birding-ethiopia. After the country introduction comes a summary of the highlights of this tour. Next comes a day-by-day itinerary. Finally, there is an annotated bird list and a mammal list. ETHIOPIA INTRODUCTION Many people imagine Ethiopia as a flat, famine- ridden desert, but this is far from the case. Ethiopia is remarkably diverse, and unexpectedly lush. This is the ʻroof of Africaʼ, holding the continentʼs largest and most contiguous mountain ranges, and some of its tallest peaks. Cleaving the mountains is the Great Rift Valley, which is dotted with beautiful lakes. Towards the borders of the country lie stretches of dry scrub that are more like the desert most people imagine. But even in this arid savanna, diversity is high, and the desert explodes into verdure during the rainy season. The diversity of Ethiopiaʼs landscapes supports a parallel diversity of birds and other wildlife, and although birds are the focus of our tour, there is much more to the country. Ethiopia is the only country in Africa that was never systematically colonized, and Rueppell’s Robin-Chat, a bird of the Ethiopian mountains.
    [Show full text]