Characterization of Purified Human Recombinant Cytochrome P4501A1-11E462 and -Va1â€•@2:Assessmentof a Role for the Rare Allele in Carcinogenesis'

Home , Epoxide hydrolase

[CANCERRESEARCH56,3926-3933, September1, 19961 Characterization of Purified Human Recombinant Cytochrome P4501A1-11e462 and -Va1â€•@2:Assessmentof a Role for the Rare Allele in Carcinogenesis'

Zhi-Yi Zhang, Michael J. Fasco, Lffi Huang, F. Peter Guengerich, and Laurence S. Kaminsk?

Departments of Environmental Health and Toxicology (Z-Y. 1, M. J. F., L S. K.] and Biomedical Sciences IL H.], School of Public Health, University at Albany. State University of New York@and New York State Department of Health (L S. K., M. J. F.], Albany, New York 12201, and Department of Biochemistry and Center in Molecular Toxicology. Vanderbilt University School of Medicine. Nashville, Tennessee 37232 [F. P. G.]

ABSTRACT which is in close proximity to the cysteine ligand to the heme (1 1, 12). The first and third polymorphisms are apparently linked (11, 13). The Human cytochrome P4501A1 (CYP1A1) occurs extrahepatically and is rare allele frequencies vary markedly between different racial groups polymorphic, the common form having ile at position 462 and the rare (9, 13, 14), being much higher in Asian than Caucasian populations form having VaL The rare allele has been associated with enhanced susceptibifity to lung cancer. To resolve its role in cancer we have con and intermediate in African-American populations (10, 13, 14). structed CYP1A1-Val@ cDNA by site-directed mutagenesis from The CYPJAJ-Va1462 rare allele has been demonstrated in several CYP1A1-lle@, as confirmed by sequencing and allele-specific PCR. Both studies to be more highly represented in lung cancer patients than in alleles were expressed in Escherichia coil, and CYP1A1-lle@2and -Val@2 noncancer control groups (8, 9, 14). Correlations between the occur were purified to electrophoretic homogeneity. The secondary structures of rence of the CYPJAJ-Va1462 genotype and lung cancer, particularly both forms were virtually identical, with high a helix content, as assessed Kreyberg type I lung cancer, have led to conclusions that this allelic by circular dichroism. The P450s stereoselectively and regioselectively variant conveys enhanced susceptibility to PAH lung carcinogenesis catalyzed the metabolism of (R)- and (S)-warfarin, in reconstituted sys (8, 9, 14). This relationship becomes more convincing in studies that tems, with very similar proffles. Both P450s produced (R)-6- and 8-hy correlate the combined CYPJAJ-Va1462 and glutathione S-transferase droxy-warfarin with Km values of 0.40 Â±0.06 and 0.43 Â± 0.05 mM, Ml null variant genotypes with lung cancer (15â€”17). @ respectively, and values ofS4.O Â±6.8and 137.7 Â±8.9pmollmin/nmol Clearly, characterization of the function of CYPlA1-Val@2, par CYP1A1-Val@2, respectively, 1.0 Â±0.1 and 1.0 Â±0.1 mss, respectively, and 46.7 Â±2.5 and 80.0 Â±4.4 pmol/min/nmol CYP1A1-lle@2, respec ticularly in comparison with that of CYP1A1-lleâ€•@2,is essential for lively. Reconstituted CYP1A1-Val@2catalyzed ethoxyresorufin metabo resolving this important relationship. Kawajiri et a!. (8) and Hayashi lism at a slightly but significantly higher rate than did CYP1A1-lle@'2; et a!. (18) have reported in an abstract and a review article the Vmax values were 4.4 Â± 0.6 and 3.1 Â± 0.3 nmol/min/nmol CYP1A1, expression of both CYPJAJ alleles at low levels in yeast. Neither P450 respectively. However, with the carcinogen benzo(a)pyrene as substrate, was purified or characterized, but the expressed CYP1A1-Val462 did reconstituted CYP1A1-He@ together with epoxide hydrolase produced have a 1.5-fold enhanced aryl hydrocarbon hydroxylase activity and 7,8- and 9,10-dihydrodlols at comparable rates than did CYP1A1-Valâ€•2. did potentiate greater B(a)P mutagenicity in the Ames test compared Thus, the apparenfly greater susceptibility ofthe CYPJAJ-Vaiâ€•2genotype with CYP1A1-11e462. A comparison of lymphocytes from individuals to lung cancer is probably not related to greater extents of carcinogen genotyped for CYPJAJ-Va1462 and CYPJAJ-11e462, revealed that those bioactivation. with the rare allele exhibited greater CYP1A1-mediated EROD ac tivity, after 3-methylcholanthrene induction, than those with the corn INTRODUCTION mon allele (19). These studies provide some support for a role for CYP1A13 is a member of the P450 superfamily, which in humans CYP1A1-Val't@2 in enhanced susceptibility to PAH carcinogenesis. occurs primarily extrahepatically. It has received much attention be In this study we have applied site-directed mutagenesis techniques cause of its potential to bioactivate procarcinogenic xenobiotics, such to construct CYP1A1-Val462 cDNA from CYP1A1-1le462 cDNA. as B(a)P and other PAH constituents of cigarette smoke (1â€”3).In Both P450s have been expressed in Escherichia coli and purified to humans, CYP1A1 is expressed mainly in lung and intestine, where it electrophoretic homogeneity. Comparisons of structural aspects of the has been associated with bronchogenic and colorectal cancers (4â€”6). allelic P4505 have been undertaken using spectrophotometric and CD The human CYPJAJ gene is polymorphic, and this has provided a spectrometry. Finally, the functional consequences of the mutation basis for numerous assessments of its role in chemical carcinogenesis, have been addressed using three substrates; B(a)P, ethoxyresorufin, by enhancing susceptibility of individuals, possibly through increased and (R)- and (S)-warfarin. Warfarin was used because of its well bioactivation of carcinogens (7â€”9).A T-A to C-G transition in the 3' established potential (20) to probe CYP1A1 for regioselectivity and noncoding region of the CYPJAJ gene introduces a MspI endonucle stereoselectivity of metabolism. ase site (7). Recently a second polymorphism associated with the introduction of a MspI site in the 3â€˜noncodingregion of the gene was MATERIALS AND METHODS reported in an African-American population (10). An A-T to G-C transition in exon 7 of the CYPJAJ gene creates a third rare allelic Plasmid Construction. The expression plasmid containing the human variant with an associated amino acid substitution of Val@2 for I1eâ€•@2,CYP1A1 common allele pCWICYPJAJ-11e462wasconstructed as described @@ previously (21). An 0 transition leads to the amino acid residue Received 3125/96;accepted 6/28/96. change from Ile@2, encoded by the CYP1A1 common allele, to Val@2, The costs of publication of this article were defrayed in part by the payment of page encoded by the CYP1A1 rare allele. Therefore, the expression plasmid con charges. This article must therefore be hereby marked advertisement in accordance with taimng the rare allele CYPJAJ-Va1462 was constructed by site-directed mu 18 U.S.C. Section 1734 solely to indicate this fact. tagenesis of pCW/CYP1A1-11e462, using a two-step PCR method (22), as I This work was supported by NIH Grants ES04238 (L. S. K.) and CA44353 and outlined in Fig. 1. At the first PCR step, two sets of primers, @NcoIplus@IMand ES00267 (F. P. G.). 2 To whom requests for reprints should be addressed, at New York State Department @EcoRI plus @2M' as listed in Table 1 , were used to amplify two overlapping of Health,WadsworthCenter,P.O.Box509,Albany,NY12201. fragments from the pCW/CYPlAl-Ile@2 template. @Ncotand@EcoRIweretwo 3 The abbreviations used are: CYP1AI, cytochrome P4501A1; P450, cytochrome flanking primers, whereas @Mand @2Mweretwo internal primers that were P450; PAH, polycyclic aromatic hydrocarbon; EROD, ethoxyresorufin-O-deethylase; complementary to each other and contained the mismatched bases. The PCRs 8-ALA, 8-aminolevulinic acid; IPTG, isopropyl @-o-thiogalactoside; a-NF, a-naphthofla vone; CD, circular dichroism; C,2E@,nonaethyleneglycol monododecyl ether; B(a)P, were carried out in two separate tubes, using Deep Vent DNA polymerase benzo(a)pyrene; HPLC, high-performance liquid chromatography. (New England Biolabs, Inc., Beverly, MA) and the GeneAmp PCR 9600 3926

NcoI EcoRI I MutationSite

I PM â€˜@&@RJ

I P&,,@@PM + It It

It pCW/CYP1A1-11e462

- lExtension

PN@,+PE@ NdeI I NcoI + Fig. 1. Scheme for the construction of the CYP1AI-Va1462 expression vector.

NcoI/EcoRI

NcoI + EcoRI

pCW/CYP1A1-Va1462

system (Perkin Elmer, Norwalk, CT). The PCR thermal cycling program was tion Kit (Qiagen, Inc., Chatsworth, CA). The full-length mutated product was as follows: an initial denaturation at 95Â°C for 1 mm, followed by 35 cycles of then obtained by extension of the overlapping fragments with Deep Vent denaturation at 94Â°Cfor 15 s; annealing at 65Â°Cfor 30 s and extension at 72Â°C polymerase at 72Â°C for 30 mm after a denaturation step at 94Â°C for 5 mm. The for 2 mm for the synthesis of the large @NcoI@@1Mfragmentand 15 s for the extended fragment was further amplified in a second-step PCR using a pair of synthesis of the small @2M@@ECoRIfragment;as well as a final extension at 72Â°C flanking primers, @Nc,1and @EcoRI'and, following 35 cycles of denaturation at for 10 mm. The PCR products were run through a 1.5% agarose gel, and the 94Â°Cfor 15 5, annealing at 65Â°Cfor 30 s and extension at 72Â°Cfor 2 mm. The overlapping DNA fragments were gel purified using a QLAEXII Gel Extrac PCR products were run through a 0.8% agarose gel. The full-length mutated fragment was then gel purified, digested with NcoI and EcoRI, and ligated into PCRPrimerTable 1 Primers for plasmid constrution and allele-specific the NcoI and EcoRI sites of pCW/CYP1A1-11e462 to make the mutated plasmid pCW/CYP1A1-Va1462.Theligated plasmid was subsequently transformed into (bp)@NcoI Sequenceâ€• Length E. coli DH5a cells (Life Technologies, Inc., Grand Island, NY), and ampicil 20@EcoRI 5'-TCCACCAGGGCCATGGGGCT-3' lin-resistant colonies were screened for positive colonies containing the cx 20@1M 5'GGCACGCTGAAT1'CCACCCG3' 5'-CGGGCAACGGTCTCACCGATACACTFC-3' 27 pression vectors by allele-specific PCR and sequencing. â€˜@2M 5'-GAAGTGTATCGGTGAGACCGTrGCCCG-3' 27 Allele-specific PCR. Allele-specific PCR was used for screening the @Comm-F 5'GAAGTGTATCGGTGAGTCCA3' 20 CYP1A1-Va1462 plasmid. Two pairs of allele-specific primers, with a common 201'IAI-R@Rare-F 5'GAAGTGTATCGGTGAGTCCG3' 20a 5'-TTCAGGCTGAATC'ITAGACC-3' reverse primer (@,A1R; Table 1), were designed. Both forward primers con tamed A â€”*T substitutions at the fourth base from the 3' end. The primer for forboth site for A â€”s G transition or allele-specific base matching; , mismatch site CYPIAI alleles. CYP1A1-Val462 contained an additional A â€”@0substitution at the 3' end, thus 3927

unbroken cells and inclusion bodies by centrifugation at 10,000 X g and 4Â°C Val lie HepG2@AGE-LM for 20 mm. The supematant was centrifuged at 180,000 X g and 4Â°Cfor 65 mmn,andthe reddish pellets were washed and resuspended by homogenization 21 212121 in approximately 20 ml of 50 mivi Tris-acetate buffer (pH 7.6) containing 250 mM sucrose and 0.25 nmi EDTA. The membrane preparation was stored at â€”80Â°C.Itwas thawedon ice and dilutedto 2 mg protein/mlin bufferA [50 mM Tris-HC1 buffer (pH 7.4) containing 20% (v/v) glycerol, 0.1% (w/v) C12E,@ (diluted from 10% solution), 1.2% Emulgen (w/v) 911 (diluted from 20% solution), 0.6% (wlv) sodium cholate (diluted from 20% solution), 1.0 mr@i EDTA, 1.0 mMD'VF,and 0.03 nir@icr-NF]and solubilized by stirring at 4Â°C overnight. Finally the solubilized membrane preparation was clarified by centrifugation at 80,000 X g and 4Â°C for 60 mm. Enzyme Purification. This purification procedure was modified from that ofGuo et a!., (21). A DEAE-Sephacel column (1.6 X 25 cm; Pharmacia Corp., Piscataway, NJ) was equilibrated with buffer A. The solubilized membrane preparation was loaded at 1.2 mi/mm, and the column was eluted with buffer A. CYP1A1 was collected in the void volume, which was concentrated to approximately 25 ml in an Amicon (Beverly, MA) PM-30 ultrafiltration apparatus. The concentrated sample was desalted using a Pierce desalting column (Kwik 5 X 10-mi dextran column; Pierce Corp., Rockford, IL) and diluted 4-fold with buffer B [pH 6.5, containing 20% (v/v) glycerol, 1.0 mrsi EDTA, and 1.0 mrvtD'VF].A CM-Sepharose fast-flow column (1.6 X 15-cm; Pharmacia) was equilibrated with buffer C [20 mistpotassium phosphate (pH 6.5) containing 20% (v/v) glycerol, 0.2 mr@iEDTA, and 1.0 nmi DTF]. After Fig. 2. Allele specific PCR of CYP1A1-1le462and CYPlAl-Va1â€•@'2cDNAsand the sample was loaded at 6 mllmin, the column was washed with 300 ml buffer cDNAs from 2,3,7,8-tetrachlorodibenzo-p-thoxin-treated MCF-7 and HepG2 cells. Lane 1, cDNAs amplified using a primer set designed for the CYPlAl-Ile@2 cDNA; Lane 2, C and 200 ml buffer D [100 mr@ipotassiumphosphate (pH 7.4) containing 20% cDNAs using a primer set designed for the CYPlAl-Valâ€•@2eDNA.mRNAs from (v/v) glycerol, 0.2 mMEDTA, and 1.0miviD'VF}.The column was eluted with 2,3,7,8-tetrachlorodibenzo-p-dioxin-treated MCF-7 and HepG2 cells were extracted using 160 ml of 400 mM potassium phosphate (pH 7.4) containing 0.5% (w/v) TM reagent (Molecular Research Center, Cincinnati, OH) and were reverse transcribed cholate, 0.5% Emulgen (w/v) 91 1, 0.03 mrsi a-NF, 20% (v/v) glycerol, 0.2 mrvi before PCR. PCR products were separated on a 1.5%agarose gel by electrophoresis. Other aspects of allele-specific PCR methods are described in â€œMaterialsandMethods.â€•Val, EDTA, and 1.0 [email protected] volume of eluate was reduced to less than 20 ml CYP1A1-Val462;lIe CYP1A1-1le462. using an Ammcon ultrafiltration apparatus, and the concentrated sample was dialyzed against buffer C (2 changes of 500 ml each) overnight. A HTP hydroxylapatite column (1.0 X 6 cm; Bio-Rad Laboratories, Richmond, CA) creating an additional mismatch with the CYP1A1-I1e462 cDNA. Differentia was equilibrated with buffer C and was extensively washed (120 ml) using tion between alleles was improved relative to previously used primer sets (12) buffer C to remove Emulgen 91 1 (monitored at A250) after the sample was with only a single mismatch for the allelic variant. GeneAmp PCR core loaded. The column was eluted with 100 ml of 500 mist potassium phosphate reagents, including Taq DNA polymerase (Perkin Elmer), were used. Plasmid (pH 7.4) containing 0.3% (w/v) sodium cholate, 20% (v/v) glycerol, 0.2 mM preparations were tested for CYP1A1 allele composition by amplification of EDTA, and 1.0 mM DTT. The eluate was concentrated with an Amicon split samples, with each reaction mixture containing one of the allele-specific ultrafiltration apparatus and Centricon spin columns (Centricon-30, 2 ml; primer pairs. The PCR thermal cycle program was similar to that described Ammcon)toless than 8 ml. The concentrated sample was dialyzed against 400 above, except that there were fewer templates (0.25 fmol), annealing time volume buffer D (500 ml X 2, and 1000 ml X 1) using dialysis cassettes was shorter (10 s), and @30PCR cycles were used. (Pierce) for 48 h, and the volume was reduced with a Centricon spin column, Enzyme Expression and Membrane Preparation. A single colony of if necessary, and stored at â€”80Â°C. pCW/CYPlAl-Ileâ€•@2-orpCW/CYP1A1-Va1462-transformedE. coli DH5a All chromatographic procedures excluding column desalting were per cells was grown overnight at 37Â°C in terrific broth medium containing ampi formed at room temperature. However, the processes involving sample desalt cillin (150 @g/ml).The overnight culture (4 ml) was inoculated into 4 liters of ing, concentration, and dialysis were performed at 4Â°C. Terrific-Broth medium containing ampicillin (100 @gIml), a trace element Enzyme Assays. The warfarin metabolic assay was performed as described mixture (23, 24), and thiamine (1 mr@t;Ref. 24). All concentrations are final previously (20, 25). CYP1A1-1le462 expressed in human lymphoblastoid mm concentrations in the cultures. The cultures were incubated at 37Â°C with crosomes with or without thymidine kinase was used as a control (Gentest vigorous shaking (250 rpm) until they attained an A@ of 0.5 (approximately Corp., Woburn, MA). EROD activity was determined by a fluorescence 4.5 h). 8-ALA (0.5 mM) was added, and IPTG (1 .0 mM) was added after a method, as described previously (19, 26). Fluorescence was measured at further 45 mm. Additional &ALA (1.0 m'vi)was added after another 45 mm. emission and excitation wavelengths of 585 and 550 nm, respectively (slit Cells were incubated at 28Â°Cfor72 h with vigorous shaking (200 rpm). During widths, 2.5 and 10.0, respectively) using a Perkin Elmer LS-50B luminescence this period, &.ALA was added six times (0.25 nirv@every 12 h), and 50 mg/liter spectrometer. ampicillin was added 36 h after the addition of IPTG. The cell cultures were B(a)P activities were assayed using modifications of a previously reported then chilled on ice and centrifuged at 5000 X g and 4Â°Cfor10 mm. The wet method (3). The assays were conducted under dim light. B(a)P (Sigma Chem cells were weighed and completely resuspended in 100 mi@iTris-acetatebuffer ical Co., St. Louis, MO) was dissolved in hexane and purified using a Waters (pH 7.6) containing 500 mMsucrose and 0.5 mMEDTA to 10 ml buffer/g wet CN (6-mi) Sep-Pak cartridge (Millipore Corp., Marlborough, MA). B(a)P weight cells by stirring for 30 mm. Lysozyme (1.0 mg/b ml cell suspension) was added, and an equal volume Table 2 Effect of E. coli growth conditions on the expression of human of chilled water was mixed with the sample by stirring for 15 mmn. The mixture CYPJAJ-Val462 as determined in E. coli membrane preparations was incubated on ice with occasional shaking for 1 h. The spheroplasts were pelleted by centrifugation at 10,000 x g and 4Â°Cfor 10 mm, resuspended by b-ALATemperature -b-ALA+ homogenization, and diluted by stirring in 0.05 volume (or 200 ml) of 100 (Â°C)322832282824Time mM potassium phosphate buffer (pH 7.4) containing 6 mM magnesium acetate, (days)2.53.52.52.53.53.5Protein content (mg/liter culture)â€• 20% (v/v) glycerol, and 0.10 m@vtDli'. Protease inhibitors (1.0 mist phenyl CYP1A1 activity (pmollmin/mg)â€•ND ndND nd122 rt4.093 9.8122 14.342 14.5 methylsulfonyl fluoride, 0.04 units aprotininlml, 2.0 jxMleupeptin, and 1.0 @xM a Membrane protein. ND, not determined. bestatin) were added, and the spheroplasts were sonicated 12 times in an b Determined by R-warfarin 8-hydroxylation at 1 .5 mat substrate concentration. nd, not ice-salt bath for 30 s each time at maximum speed, followed by pelleting of detected. 3928

A solvent A (38 mmn),and90% solvent A (40 mm), at a flow rate of 2.0 mi/mm. B(a)P, 3-hydroxy-B(a)P, the 7,8-dihydrodiol of B(a)P, and the 9,lO-dihydro M12 3 4 diol of B(a)P, from the National Cancer Institute Chemical Repository through the Midwest Research Institute (Kansas City, MO), were injected onto the @ kDa HPLC, and their spectra were scanned between 200 and 400 nm and were 95 - 1@. -@ stored in the computer library. The metabolites of B(a)P were identified by comparisons of both the retention times (monitored at 254 nm) and the spectra. CD Spectral Determination. The CD spectraof both purifiedCYPIA1 68- â€¢S@'@ forms were determined using a J-720 Spectropolarimeter (Jasco Co., Tokyo, Japan). The samples were diluted to 4.0 nMin 0.05 Msodium phosphate buffer (pH 7.4) and scanned between 185 and 260 nm using a 0.5-mm path length 39â€”â€¢1 sample cell. Other Studies. Proteinconcentrationsweredeterminedbyusingthe Pierce bicinchoninic protein assay reagent. Rat NADPH-P450 reductase was purified to electrophoretic homogeneity following a previously reported method (27). Rat epoxide hydrolase was prepared as reported previously (28). The ratio of 29â€”iâ€¢ CYP1A1:NADPH-P450 reductase was 1:3 in the reconstituted reaction sys tern. Polyclonal antirat CYP1A1 and CYP1A2 antibodies were prepared fol lowing previously described methods (29). SDS-PAGE (12%) and Western immunoblotting were performed as described previously (20). All primers used in this study were synthesized, and the cDNAs of both CYPIA1 alleles were sequenced in the Molecular Genetic core facility of the Wadsworth Center (Albany, NY). All enzyme kinetic data were determined by linear regression B using SigmaPlot/Stat software (Jandel Scientific, San Rafael, CA). Analysis of Ri 234 polynomial regressions revealed that linear regression best fitted the data.

RESULTS

Plasmid Construction and Enzyme Expression. The CYP1A1- aâ€” Val462 cDNA plasmid was constructed from the pCW/CYP1A I-lIe462 b' plasmid by site-directed mutagenesis. Both CYP1A1-11e462 and -Va1462 cDNAs were completely sequenced; the sequences differed only in the A -Ã·G transition at position 1384. The success of the

1.5E+04

Fig. 3. A, SDS-PAGE of purified CYP1A1-11e462 and CYP1A1-Va1462. Lane I. solubilized E. coli membrane preparation containing CYP1A1-Va1462; Lanes 2 and 3, expressed and purified CYP1AI-Va1462and CYP1Al-Ile@2, respectively; Lane 4. mi crosomal preparation of human lymphoblastoid cells transfected with CYPIA1-Ileâ€•Â° (Gentest). B. Western immunoblots of purified CYP1A1-11e462 and CYP1AI-Val462. Lane R, liver microsomal preparation from (3-naphthoflavone-treated rats; a, rat CYP1AI; b, rat CYP1A2; Lanes 1â€”4 are equivalent to those in A. Polyclonal antirat CYP1A1 antibodies, which cross-react with human CYP1AI, were used. [@]

metabolic reactions were performed in total volumes of 250 p3, containing 0.5 nrnol CYPlAl-Ileâ€•@2orCYPlAl-VaPâ€•@2,1.0nmol epoxide hydrolase, 1.5 o nmol NADPH-P450 reductase, 16nrnol dilauroylphosphatidylcholine, and 10, 40, or 100 ,.tMB(a)P in 0.05 M Tris-HC1 and 0.015 M MgC12 (pH 7.4). Reactions were initiated by the addition of 1.2 @molNADPH after incubation of the reaction mixtures for 1 mm at 37Â°C. Control reactions did not contain NADPH-P450 reductase or epoxide hydrolase. Reactions were terminated after 30 mm by the addition of ice-cold water (250 p1), and unrnetabolized B(a)P and its metabolites were extracted into ethyl acetate (2 ml) by vortexing and centrifugation at 3000 X g for 3 mm. The separated ethyl acetate solution was dried down under a N2 stream, and the residue was dissolved in methanol (25 pA), which was injected onto the HPLC. -8.OE + 03 @ A Waters column (15 X I cm, 4 pm) was used. The solvents were water 200 220 240 260 (solvent A) and a mixture of acetonitrile and isopropanol (90:10; solvent B). WAVELE H The linear gradients of eluting solvents were 90% solvent A (0 mm), 90% nm solvent A (9 mm), 50% solvent A (10 mmn),50% solvent A (19 mm), 25% Fig. 4. Circulardichroismspectraof purifiedCYP1Al-Ile@2(â€”)andCYPIAI solvent A (20 mm), 25% solvent A (29 mm), 0% solvent A (30 mm), 0% Va1462(- - -). 3929

Table 3 Rates of CYPJA1-Va1462-and CYPJAJ-11e462-mediated(R)-and mutation. However, kinetic analysis of (R)-warfarin metabolism by (5)-warfarin hydroxylation the two P450s in reconstituted systems (Fig. 6, A and B, and Table 4) (pmol/min/nmol)â€•6-OH8-OH7-OH6-OH/8-OHCYPIRate revealed that the Vmax for R-6- and R-8-hydroxylation was increased by 80%, and the Km decreased by 60% when CYP1A1-Va1462 was A 1-Val462 compared with CYP1A1-11e462. Vmaxand Km values for (R)-warfarin 3.40.6S-warfarmn21.7R-warfarin58.6 Â±81b16.115.5 Â± 6- and 8-hydroxylations were 4.0â€”4.5-fold higher with the Va1462 0.91.3R-andS-warfarin Â±3.316.3 Â±0.73.8 Â± form than the 11e462form. [email protected] The rates of EROD metabolism (Fig. 7A) and the kinetic analysis of 3.70.5S-warfarin14.1 Â±9.773.9 Â±21.110.4 Â± 0.21.2R- Â±0.112.0 Â±3.12.8 Â± this metabolism (Fig. 7B) catalyzed by reconstituted CYP1A1-11e462 and S-warfarmn2.76.23.7 and -Va1462 are presented in Fig. 7. The Km values for the two a The rates were determined using 1.5 mi@i substrate concentration. 6-OH, 6-hydroxy reactions were not significantly different, 2.4 Â±0.4 p@Mforthe lie462 lation; 8-OH, 8-hydroxylation; 7-OH, 7-hydroxylation. form and 2.8 Â±0.7 @Mforthe Val462 form. However, the Va1462 form b Mean Â± SD for triplicate reactions. did exhibit a slightly and significantly higher Vmax value than the Ile'@2form for EROD activity, 4.4 Â±0.6 versus 3. 1 Â±0.3 nmoL/min/ site-directed mutagenesis was confirmed by allele-specific PCR (Fig. nmol CYP1A1. At 10 ,.LMB(a)P, 3-hydroxy B(a)P was the only 2). The use of primers designed with two mismatches for one allele metabolite detected by HPLC from either CYP1A1. However, both and only one for the other allele clearly differentiated between the two the 7,8-dihydrodiol and the 9,10-dihydrodiol, as well as the 3-hydroxy alleles. Thus CYP1A1-1le462 cDNA and CYP1A1-Va1462 cDNA each metabolite of B(a)P, were clearly detected at both 40 and 100 j@M yielded a product on PCR only when using the primer set designed for B(a)P. The rates are provided in Table 5. At these substrate concen amplification of that fragment and not with primers designed for the trations, CYP1A1-1le462 exhibited comparable rates of 7,8- and 9,10- other allele (Fig. 2). The PCR product from CYP1A1-11e462 cDNA dihydrodiol formation. CYP1AI-1le462 yielded an average 3-fold corresponded to that from HepG2 cells, which are homozygous for higher rate of 7,8-dihydrodiol formation than CYP1A1-Va1462 at both CYPJAJ-11e462, whereas the CYPJAJ-Va1462 PCR product corre substrate concentrations and an average 1.5-fold higher rate of 9,10- sponded to the CYPIAJ-Va1462 form from heterozygous MCF-7 cells dihydrodiol formation. The rates of 3-hydroxy-B(a)P formation were (20). approximately the same for both enzymes. The expression levels of mammalian P450s in E. coli have been reported to vary by approximately 35-fold (30), a consequence of differing efficiencies of expression for the different P450 forms and of variable conditions. The effects of varying conditions on the extent of expression of CYP1A1-Va1462 are shown in Table 2. The highest 140 expression occurred with incubation at 28Â°Cfor 3.5 days and required the addition of 6-ALA (31), as described in â€œMaterialsandMethods.â€• 120 Variation of the concentration of IPTG from 0.1 to 1.0 nmi did not 100 affect the expression of either CYP1AI form. Because less than 20% of E. coli-expressed P450s were recovered after purification (24, 31, 80 32), the levels of purified CYP1A1-Va1462 and -11e462obtained from 16.4 nmollliter E. coli growth medium probably represented a much â€” 60 greater expression level. e- 40

Enzyme Purification and Characterization. The absorption >- maximum of reduced and CO-bound, purified CYP1A1-11e462 and C.) 20 -Val462 occurred at 446 nm. Both purified P450s were electrophoreti 0 E 0 cally homogeneous (Fig. 3A). Western immunoblots using antirat C 6-OH 8-OH 7-OH CYP1A1 yielded single bands for both P450s, which aligned with C E human CYP1A1 and rat CYP1A2 (Fig. 3B). The CD spectra of purified CYP1A1-I1e462 and -Va1462 are compared in Fig. 4. The .@ 140 spectra were virtually identical and indicated a high a helix content of ,@ 120â€¢S-Warfarin both CYP1A1 forms. Activities of Purified and Reconstituted CYP1A1-Ile@2 and l@ 100 -Va]462 The catalytic consequences of the 11e462â€”*Val'@2mutation 80 were assessed by comparing activities of the purified and reconsti tuted CYPlAl-Ile'@2 and -Val'@2 using (R)- and (S)-warfarin, B(a)P, 60 and ethoxyresorufin as substrates. Both P450s catalyzed the metabolism of (R)- and (S)-warfarin to 40 yield 6-, 7-, and 8-hydroxywarfarin, in reactions that are stereoselec @ 2:. tive for (R)-warfarin and regioselective for (R)-8-hydroxywarfarin (Fig. 5). In Table 3, the rates of formation of 6-, 7-, and 8-hydroxy warfarin from (R)- and (S)-warfarin at 1.5 m'vi as catalyzed by both 6-OH 8-OH 7-OH P4505 are provided, together with the ratios of 6- and 8-hydroxylation Metabolite rates and ratios of rates of formation of each metabolite from (R)- and (S)-warfann. The close similarity of the corresponding ratios for the Fig. 5. Rates of metabolism of (R)- and (S)-warfarin individually, catalyzed by @ reconstituted CYP1 A I-lIe462 (LI) and CYP1 A 1 462 The concentration of (R)- and two P450s suggests that the regioselectivity and stereoselectivity of (S)-warfarin was I.5 mM. Rates are means of triplicate experiments. Bars, SD. 6-OH, warfarin metabolism has not been altered by the Ile'@2 â€”@Val462 7-OH. and 8-OH, 6-, 7-. and 8-hydroxywarfarin. respectively. 3930

Table 4 Kinetic parameters of(R)-wa,farin 6- and 8-hydroxylation by purified CYP1A1-Val@2and CYP1A1-1le@2expressedin E. coli and microsomal preparations of lymphoblastoid containing human CYPIAI-Ile@2

CYPlA1@'6-OHKm (mM)â€• Vmax(pmol/min/nmol

8-OHCYPlA1-Val@2 8-OH 6-OH 8.7CYP1A1-I1e462 0.4 Â±0.1 0.4 Â±0.1 84.0 Â±6.8 137.7 Â± 4.4CYPlAl-Ile@' 1.0Â±0.1 1.0Â±0.1 46.7Â±2.5 80.0Â± 77,5Ca 1.1Â±0.4 1.6Â±0.4 164.0Â±35Af 442.5Â±

@ 6-hydroxylation;8-OH,Determined from Lineweaver-Burk plots, with correlation coefficients: ? 0.980 (P 0.001); mean Â± SE estimated from linear regression analyses. 6-OH, 8-hydroxylation. transfectants.Cb Microsomal preparations of human lymphoblastoid

Estimated from the expression levels (40 pmol CYPIA1/mg protein) reported by the vendor.

DISCUSSION A â€”@Ttransversion relative to the previously published sequence (34). Such a transversion gives rise to a Leu substitution for lie at No well-defined mechanism is available for the apparently in position 171. We have previously demonstrated that these changes in creased susceptibility to lung cancer in individuals with the CYPJAJ residue did not affect the regioselectivity and stereoselectivity of Va!462 genotype (8, 9, 14). A possible mechanism is that this poly warfarin metabolism by CYP1A1-1le462 (20). morphism, which is linked to a MspI polymorphism (11, 13), is only a marker for another casually related polymorphism. Alternatively, @ the rare CYP1A1-Val@2 allelic variant may be capable of bioactivat- 5 ing procarcinogens to a greater extent than is the P450 encoded by the common CYPJAJ-11e462 allele, thereby enhancing their carcinogenic potential. This alternative is supported by reports of increased sus @ ceptibility to lung carcinogenesis for individuals that have a combi- 0.4 nation of the CYPIAJ-Va1462 and the null glutathione S-transferase Ml genotypes (15â€”17).The latter enzyme acts to protect the organism 0 @ from bioactivated carcinogens, and its absence would facilitate the potential carcinogenicity of such agents. The preliminary reports that CYP1A1-Val@2 enhances B(a)P metabolism and its mutagenicity to .E @ a limited extent (8, 18) further support a mechanism for this P450 .@ 2 @ producing greater levels of bioactivated carcinogens than CYPIA1- Ile@2. The current study was designed to test the poten tial of CYPlAl-Val't@2 to produce greater levels of bioactivated @ carcinogens. 0.1 Reports of great variability in levels of expression of P450s in E. coli (30) prompted us to improve the levels of expression of the common and rare alleles of CYPJAJ over that reported previously for 0.0 the common allele (21). We incorporated approaches used by -4 0 4 8 12 16 20 24 Lehnerer et a!. (33), involving addition of the heme precursor &.ALA, 1/s(1/mM) and Kempf et a!. (31), involving decreased IPTG concentrations to enhance the expression of truncated CYP2D6 in E. coli. 6-ALA markedly enhanced expression levels of both CYP1A1s to a greater extent than did the addition of heme. However, the effect of added IPTG was independent of concentration over the range of 0. 1â€”i.0mM. Incubation temperature was also shown to be important. At temper atures 30Â°C,the expressed P450s exhibited diminished activity relative to incubation at temperatures <30Â°C, possibly due to en hanced proteolysis or premature termination of the P450 during biosynthesis. A key step in the purification of these expressed P450s was the solubilization of the E. coli membrane-bound protein. The effects of several detergents were investigated: Triton N-l0l, Emulgen 911, cholate, and [email protected] best solubilization of the membrane-bound P4505 was achieved by overnight exposure to 1.2% Emulgen 91 1 and 0.6% cholate. C12E9 (0.1%) was used in subsequent stages of the purification, based on a report (31) that it stabilizes P450s and prevents denaturation to P420s. The procedures improved the extent of CYP1A1 solubilization to >50% compared with <20% using -5 0 5 10 15 20 25 published procedures (21). vs (1/mM) The pCW/CYP1A1-11e462 vector used in these studies had been previously modified to permit expression in E. coli (21). The second Fig.6. Lineweaver-Burkplotsofthemetabolismof(R)-warfarinto6-hydroxywarfarin .. . . . (0) and 8-hydroxywarfarin (â€¢) catalyzed by reconstituted CYPIA1-lleâ€•2 (A) and codon was replaced by GCT, which gives nse to a leuclne-to-alamne CYPlAl-Val@2(B).(R)-w@n concentrationswerevariedfrom0.05to 3.0msi.Each change. Additionally, we determined that in codon 171 there was an datapointrepresentstheaverageofduplicateexperiments. 3931

The CD spectra of the two purified P450s exhibited negative Table 5 Rates of CYPJA 1- and epoxide hydrolase-mediated B(a)P 7,8- and maxima at 222 and 208 nm and a strong positive maximum at 190 nm, 9, 10-dihydrodiol formation catalyzed by CYPIAI-Va1462 and CYPJA 1-lIe462 which are consistent with a high a helix content (35, 36). Although no RateCYPIAI),â€•BlaiP (nmol/min/nmol crystal structures of mammalian P450s have been reported, the X-ray (jsM)CYP1A1 Concentration derived crystal structures of bacterial P450s also exhibit high a helix 100CYP1A1-Val462 Metabolite 10 40 content (37, 38). The identity of the CD spectra of CYP1A l-11e462and -Val462 indicate that the introduction of Val462 for 1le462in CYP1A1 0.29,10-Dihydrodiol7.8-Dihydrodiol nd 0.2 nd 0.6 1.2 does not alter the secondary structure of the protein. CYPlA1-Ile'@2 0.69,10-Dihydrodiol7,8-Dihydrodiol nd 0.6 The major conclusion from this study is that although a change nd 1.0 1.7 CYP-Val462/-Ileâ€•t'21'0.39.10-Dihydrodiol 7,8-Dihydrodiol NA 0.3 from I1e462to Val@2 in CYP1A1 affects the function of this protein, 0.7a NA 0.6

when reconstituted, the alterations are not major. Thus, the Km for NA,notapplicable.Each rate was determined from a single experiment. nd, not detected: (R)-warfarin metabolism to 6- and 8-hydroxywarfarin was decreased by approximately 60% for CYPlAl-Val'@2 relative to CYP1A1- I, Ratios of the rate of metabolite formation catalyzed by CYPIA1-Va146/epexide hydrolase to that catalyzed by CYPlAI-I1e46@/epoxide hydrolase. 11e462,and the Vm@was correspondingly increased by 1.9-fold. In the case of EROD activity, the Km was not altered for the Val'@2 versus the Ile'@2 form, whereas the Vm@was increased by 1.4-fold. These CYP1AI proteins are consistent with our results, which demonstrated relatively minor differences in kinetic behavior between the two that the regioselectivity and stereoselectivity of CYP1AI-11e462 for warfarin metabolism was not affected by mutation to the Va1462 form. In the case of B(a)P metabolism, the rates of 7,8- and 9,10- dihydrodiol formation were comparable when CYP1A1-1le462 cata lyzed the reconstituted reaction compared with CYPIAI-Va1462. These metabolites, which arise from epoxide hydrolase-catalyzed hydrolysis of the corresponding CYPIA1-catalyzed B(a)P epoxides, are associated with the carcinogenicity of B(a)P. The reason for the

>- disparity between our results and those from the preliminary studies of 0 Kawajiri et a!. (8) and Hayashi et a!. ( I8) are not obvious. They 0 E reported very low levels of expression, and their enzymes were not C purified or characterized. C E Taken together, the results of the comparisons of the metabolic capabilities of the two CYP1A1 forms with B(a)P indicate that it is 0 E unlikely that associations between the CYPJAJ-Va1462 genotype and C lung cancer are a consequence of higher extents of B(a)P bioactiva > tion by the Va1462 allelic variant. Similar conclusions may apply to other carcinogens that are activated by CYPIA1, but until the meta bolic comparisons are undertaken, a more general conclusion cannot be drawn. Possibly, CYP1A1-Val462 is more readily inducible than 2 4 6 8 10 CYP1A l-1le462, thereby producing greater carcinogen bioactivation S(pM) because of the consequent more highly elevated levels of the rare allelic variant. This is most likely to occur through linkage of the lie462 â€”Val@2polymorphism to another, possibly the MspI mutation 2.0 in the 3' noncoding region (I I, 13). However, there has been a single report that the MspI mutation is not linked to the induction phenotype in a small population (39). This hypothesis is supported by the 0@ observation that CYP1A1 activity is more readily inducible in lym >- @ 0 phocytes of CYPJAJ-Va1462 genotypes than with CYPJAJ-11e462 gen 0 otypes (19). The high-inducibility phenotype has similarly been cor E C related to the MspI polymorphism (40, 41), which further supports this C hypothesis. Additional studies are underway to resolve the mechanism ! 1,0 of the putative role of CYP1A1-Va1462 in lung cancer. 0 E C ACKNOWLEDGMENTS @ 0.5 We thank Dr. X. Ding for helpful discussions and assistance with tech niques. We gratefully acknowledge the use of the Wadsworth Center Biochem istry and Molecular Genetics core facilities. J. Colfels is also gratefully acknowledged for secretarial assistance. 0.0 -1.0 -0.5 0.0 0.5 1.0 1.5 2.0 1/S(1/pM) REFERENCES 1. Shimada, T., Yun, C-H., Yamazaki, H., Gautier, J-C., Beaune, P. H., and Fig. 7. A, effect of substrate concentration on rates of EROD activity catalyzed by Guengerich, F. P. Characterization of human lung microsomal cytochrome P-450 reconstituted CYPlA1-1le@2 (â€¢)and CYP1A1-Valâ€•t'2 (0). B, Lineweaver-Burk plots of lAl and its role in the oxidation of chemical carcinogens. Mol. Pharmacol.. 41: the EROD activity catalyzed by CYP1A1-l1e462 (â€¢) and CYP1A1-Va1462 (0). 856â€”864,1992. Ethoxyresorufin concentrations were varied from 0.05 to 10 saM. Each data point repre 2. McManus, M. E., Burgess, W. M., Veronese, M. E., Huggett. A., Quattrochi, L. C., sents the average of triplicate experiments. and Tukey. R. H. Metabolism of 2-acetylaminofluorene and benzo(a)pyrene and 3932

activation of food-derived heterocyclic amine mutagens by human cytochromes Expression of modified human cytochrome P4501A1 in Eseherichia coil: effects of P-450. Cancer Res., 50: 3367â€”3376.1990. 5' substitution, stabilization, purification, spectral characterization. and catalytic 3. Bauer. E., Guo, Z., Ueng, Y-F., Bell. L. C.. Zeldin, D.. and Guengerich. F. P. properties. Arch. Biochem. Biophys., 3/2: 436â€”446, 1994. Oxidation of benzo(a)pyrene by recombinant human cytochrome P450 enzymes. 22. Ho., S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease. L. R. Site-directed Chem. Res. Toxicol., 8: 136â€”142,1995. mutagenesis by overlap extension using the polymerase chain reaction. Gene (Amst.), 4. Kawajiri, K., Eguchi, H., Nakachi, K.. Sekiya, T., and Yamamoto, M. Association of 77: 51â€”59,1989. CYPIAI germ line polymorphisms with mutations of the p53 gene in lung cancer. 23. Bauer, S., and Shiloach, J. Maximal exponential growth rate and yield of E. eoli Cancer Res., 56: 72â€”76,1996. obtainable in a bench-scale fermentor. Biotechnol. Bioeng.. 16: 933â€”941,1974. 5. Bartsch, H., Castegnaro, M., Rojas. M.. Camus. A-M.. Alexandrov.. K.. and Lang, M. 24. Sandhu, P., Guo. Z.. Baba, T., Martin, M. V., Tukey, R. H.. and Guengerich. F. P. Expression of pulmonary cytochromc P4501Al and carcinogen DNA adduct forma Expression of modified human cytochrome P450 lA2 in Eseherichia coli: stabiliza tion in high risk subjects for tobacco-related lung cancer. Toxicol. Lett. (Amst.), lion. purification, spectral characterization, and catalytic activities of the enzyme. 64/65: 477â€”483.1992. Arch. Biochem. Biophys.. 309: 168â€”177,1994. 6. White,T. B.,Hammond.D.K..VÃ¡squez,H..andStrobel.H.W.Expressionoftwo 25. Kaminsky, L. S., Fasco, M. J., and Gucngerich, F. P. Production and application of cytochromes P450 involved in carcinogen activation in a human colon cell line. Mol. antibodies to rat liver cytochrome P-450. Methods Enzymol., 74. 262â€”272,1981. Cell. Biochem., 102: 61â€”69,1991. 26. Thompson, C. L., McCoy, Z., Lambert, J. M., Andries, M. J., and Lucier, G. W. 7. Kawajiri, K., Nakachi, K., Imai, K., Yoshii, A.. Shinoda, N., and Watanabe, J. Relationships among benzo(a)pyrene metabolism, benzo(a)pyrene-diol-epoxide, Identification of genetically high risk individuals to lung cancer by DNA polymor DNA adduct formation, and sister chromatid exchanges in human lymphocytes from phisms of the cytochrome P450/Al gene. FEBS Lett.. 263: 131â€”133,1990. smokers and nonsmokers. Cancer Res., 49: 6503â€”6511,1989. 8. Kawajiri. K., Nakachi, K., Imai, K., Watanabe, 1., and Hayashi, S. The CYPIAI gene 27. Ardies, C. M., Lasker, J. M., Bloswick, B. P., and Lieher, C. S. Purification of and cancer susceptibility. Crit. Rev. Oncol. Hematol., 14: 77â€”87.1993. NADPH: cytochrome c (cytochrome P.450) reductase from hamster liver microsomes 9. Hamada,G. S., Sugimura,H., Suzuki,I., Nagura,K.. Kiyokawa,E.. Iwase,T., by detergent extraction and affinity chromatography. Anal. Biochcm.. 162: 39-46. Tanaka, M., Takahashi, T., Watanabe, S., and Kino, I. The heme-binding region of 1987. CYPIAI, rather than the Rsa polymorphism of CYP2EI, is associated with lung 28. Guengerich. F. P.. Wang, P., Mitchell, M. B., and Mason, P. S. Rat and human liver cancer in Rio de Janeiro. Cancer Epidemiol., Biomarkers & Prey., 4: 63â€”67,1995. microsomal epoxide hydratase. Purification and evidence for the existence of multiple 10. Crofts, F., Cosma, G. N., Cume, D., Taioli. E.. Toniolo. P., and Gate, S. J. A novel forms. J. Biol. Chem., 254: 12248â€”12254, 1979. CYPIAI gene polymorphism in African-Americans. Carcinogenesis (Lond.), 14: 29. McKinney, M. M., and Parkinson, A. A simple, non-chromatographic procedure to 1729â€”1731,1993. purify immunoglobulins from serum and ascites fluid. J. Immunol. Methods, 96: I I . Hayashi. S-I., Watanabe, J., Nakachi, K., and Kawajiri. K. Genetic linkage of lung 271â€”278,1987. cancer-associated MspI polymorphisms with amino acid replacement in the heme 30. Gonzalez, F. J., and Korzekwa, K. R. Cytochrome P450 expression systems. Annu. binding region of the human cytochrome P450/A I gene. J. Biochem., I 10: 407â€”411, Rev. Pharmacol. Toxicol., 35: 369â€”390,1995. 1991. 3 1. Kempf. A. C., Zanger, U. M., and Meyer, U. A. Truncated human P450 2D6: 12. Hayashi, S-I., Watanabe. J.. Nakachi, K., and Kawajiri, K. PCR detection of an A/G expression in Escherichia coil, Ni2tchelate affinity purification, and characteriza polymorphism within exon 7 of the CYPIA I gene. Nucleic Acids Res.. /9: 4797. tion of solubility and aggregation. Arch. Biochem. Biophys.. 321: 277â€”288,1995. I99 I. 32. Gilliam, E. M. J., Baba, T., Kim, B-R., Ohmori, S., and Guengerich, F. P. Expression 13. Hirvonen, A., Husgafvel-Pursiainen, K.. Karjalainen, A.. Antilla, S., and Vainio, H. of modified human cytochrome P450 3A4 in Escherichia coli and purification and Point-mutational MspI and Ile-Val polymorphisms closely linked in the CYP1AI reconstitution of the enzyme. Arch. Biochem. Biophys.. 305: 123â€”131.1993. gene: lack of association with susceptibility to lung cancer in a Finnish study population. Cancer Epidemiol.. Biomarkers & Prey., 1: 485â€”489, 1992. 33. Lehnerer, M., Schulze, J., Petzold, A., Bernhardt, R., and Hlavica, P. Rabbit liver 14. Drakoulis. N.. Cascorbi. I., BrockmOller, J., Gross. C. R.. and Roots, I. Polymor cytochrome P-450 2B5: high-level expression of the full-length protein in Esche phisms in the human CYPIAJ gene as susceptibility factors for lung cancer: exon-7 ricl,ia coli, purification. and catalytic activity. Biochim. Biophys. Acta, 1245: 107â€” mutation (4889 A to G), and a Tto C mutation in the 3-flanking region. Clin. Invest., 115, 1995. 72: 240â€”248,1994. 34. Jaiswal, A. K., Gonzalez, F. J., and Nebert, D. W. Human dioxin-inducible cyto 15. Hayashi, S., Watanabe, J.. and Kawajiri, K. High susceptibility to lung cancer chrome P1-P450: complementary DNA and amino acid sequence. Science (Washing analyzed in terms of combined genotypes of P45OIAI and es-class glutathione ton DC), 228: 80â€”83, 1985. S-transferase genes. Jpn. J. Cancer Res.. 83: 866â€”870,l992. 35. Woody. R. W. Circular dichroism. Methods Enzymol., 246: 34â€”71,1995. 16. Nakachi, K.. Imai, K., Hayashi. S., and Kawajiri, K. Polymorphisms of the CYPIAI 36. Sreerama, N., and Woody, R. W. A self-consistent method for the analysis of protein and GST genes associated with susceptibility to lung cancer in relation to cigarette secondary structure from circular dichroism. Anal. Biochem.. 209: 32â€”44,1993. dose in a Japanese population. Cancer Res., 53: 2994â€”2999, 1993. 37. Cupp-Vickery, J. R., and Poulos, T. L. Structure of cytochrome P45OeryF involved in 17. Kihara, M., Kihara, M., and Noda. K. Risk of smoking for squamous and small cell erythromycin biosynthesis. Struct. Biol.. 2: 144â€”153.1995. carcinomas of the lung modulated by combinations of CYPIAI and GSTMI gene 38. Lewis, D. F. Three-dimensional models of human and other mammalian microsomal polymorphisms in a Japanese population. Carcinogenesis (Lond.). 16: 233 lâ€”2336. P450s constructed from an alignment with P450102 (P450bm3). Xenobiotica, 25: I995. 333â€”366,1995. 18. Hayashi, S-I.. Watanabe, J., and Kawajiri. K. Expression of two types of CYPIA 39. Wedlund, P. J., Kimura, S., Gonzalez, F. J., and Nebert, D. W. 1462V mutation in the cDNAs in yeast cells. Proceedings of the Japanese Biochemical Society 64th Annual human CYPIA 1 gene: lack of correlation with either the Msp I I.9 kb (M2) allele or Meeting, Tokyo, p. 997, 1991. CYPIA I inducibility in a three-generation family of east Mediterranean descent. 19. Cosma, G., Crofts, F., Taioli, E.. Toniolo, P., and Garte, S. Relationship between Pharmacogenetics. 4: 21â€”26,1994. genotype and function of the human CYPIA! gene. J. Toxicol. Environ. Health, 40: 40. Petersen, D. D., McKinney, C. E., Ikeya, K., Smith, H. H., Bale, A. E., McBride, 309â€”316,1993. 0. W., and Nebert,D. W. HumanCYPIAIgene: cosegregationofthe enzyme 20. Zhang. Z., Fasco, M. J., Huang, Z., Guengerich. F. P., and Kaminsky, L. S. Human inducibility phenotype and an RFLP. Am. J. Hum. Genet., 48: 720â€”725, 1991. cytochromes P4501A1 and P4501A2: R-Warfarin metabolism as a probe. Drug 41. Landi, M. T., Bertazzi, P. A., Shields, P. G., Clark, G., Lucier, G. W., Garte, S. J., Metab. Disp.. 23: 1339â€”1345. 1995. Cosma, G.. and Caporaso, N. E. Association between CYP/Al genotype. mRNA 21. Guo, Z., Gilliam, E. M. J., Ohmori, S., Tukey. R. H.. and Guengerich. F. P. expression and enzymatic activity in humans. Pharmacogenetics. 4: 242â€”246.l994.

3933

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 1996 American Association for Cancer Research. Characterization of Purified Human Recombinant Cytochrome P4501A1-Ile 462 and -Val462: Assessment of a Role for the Rare Allele in Carcinogenesis

Zhi-Yi Zhang, Michael J. Fasco, Lili Huang, et al.

Cancer Res 1996;56:3926-3933.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/56/17/3926

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/56/17/3926. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.