Emphysema Aminopeptidase in the Pathogenesis of Hydrolase 4 Role

The Journal of Immunology

Role of Leukotriene A4 Hydrolase Aminopeptidase in the Pathogenesis of Emphysema

Mikell Paige,* Kan Wang,† Marie Burdick,‡ Sunhye Park,‡ Josiah Cha,‡ Erin Jeffery,x Nicholas Sherman,x and Y. Michael Shim‡

The leukotriene A4 hydrolase (LTA4H) is a bifunctional enzyme with epoxy hydrolase and aminopeptidase activities. We hypothesize that the LTA4H aminopeptidase activity alleviates neutrophilic inflammation, which contributes to cigarette smoke (CS)– induced emphysema by clearing proline-glycine-proline (PGP), a triamino acid chemokine known to induce chemotaxis of neutrophils. To investigate the biological contributions made by the LTA4H aminopeptidase activity in CS-induced emphysema, we exposed wild-type mice to CS over 5 mo while treating them with a vehicle or a pharmaceutical agent (4MDM) that selectively augments the LTA4H aminopeptidase without affecting the bioproduction of leukotriene B4. Emphysematous phenotypes were assessed by premortem lung physiology with a small animal ventilator and by postmortem histologic morphometry. CS exposure acidified the airspaces and induced localization of the LTA4H protein into the nuclei of the epithelial cells. This resulted in accumulation of PGP in the airspaces by suppressing the LTA4H aminopeptidase activity. When the LTA4H aminopeptidase activity was selectively augmented by 4MDM, the levels of PGP in the bronchoalveolar lavage fluid and infiltration of neutrophils into the lungs were significantly reduced without affecting the levels of leukotriene B4. This protected murine lungs from CS- induced emphysematous alveolar remodeling. In conclusion, CS exposure promotes the development of CS-induced emphysema by suppressing the enzymatic activities of the LTA4H aminopeptidase in lung tissues and accumulating PGP and neutrophils in the airspaces. However, restoring the leukotriene A4 aminopeptidase activity with a pharmaceutical agent protected murine lungs from developing CS-induced emphysema. The Journal of Immunology, 2014, 192: 5059–5068.

eukotriene A4 hydrolase (LTA4H) has been known as PGP, thus mitigating the influx of neutrophils into murine lungs a bifunctional enzyme. Although two enzymatic activities postinfluenza infection (20). L share an overlapping substrate site, their biological func- Pulmonary emphysema is a major manifestation of chronic tions are distinctive (1, 2). The LTA4H epoxy hydrolase (EH) obstructive pulmonary disease. It is characterized by alveolar de- converts leukotriene A4 (LTA4) to leukotriene B4 (LTB4), which is struction in patients due to infiltration of neutrophils, lymphocytes, a potent inducer of neutrophil, macrophage, and T lymphocyte and macrophages into cigarette smoke (CS)–exposed lungs (3, 8, 14, chemotaxis in human diseases (3–10). The LTA4H aminopepti- 21–23). Although a number of mechanisms were proposed to ex- dase degrades the N terminus of peptides. Several studies dem- plain the pathogenesis of emphysema, its molecular pathogenesis is onstrated that a chemotactic triamino acid peptide, proline- not yet clearly understood. Neutrophil-rich inflammation in em- glycine-proline (PGP), is produced due to breakdown of collagen physematous lungs of smokers led us to hypothesize that the LTA4H by prolyl-endopeptidase, and PGP has been shown to induce che- aminopeptidase activity and bioproduction/clearance of PGP motaxis of neutrophils by binding to CXCR2 (11–19). Recently, may play an important role during the development of CS-induced LTA4H aminopeptidase has been reported to break down and clear neutrophilic inflammation and emphysema. Our laboratory has previously reported that the LTA4H enzymatic activities make important contribution to the development of emphysematous tissue alterations (3, 24, 25). LTA4H activity *Department of Chemistry and Biochemistry, George Mason University, Manassas, was found to influence severity of emphysematous alveolar remod- † VA 22030; Center for Drug Discovery, Georgetown University Medical Center, elinginmurinelungsexposedtotransgenicallyoverexpressedIL-13 Washington, DC 20057; ‡Division of Pulmonary and Critical Care Medicine, Depart- x ment of Medicine, University of Virginia, Charlottesville, VA 22908; and Depart- (3, 24). LTA4H EH activity was found to contribute to emphyse- ment of Microbiology, Immunology, and Cancer Biology, University of Virginia, matous alveolar remodeling and neutrophilic infiltration into lungs Charlottesville, VA 22908 postexposure of intranasal elastase (3, 24). Whereas a number of Received for publication February 18, 2014. Accepted for publication March 30, studies have characterized the importance of the LTA H EH, no 2014. 4 studies have investigated the biological contributions made by This work was supported by the Flight Attendant Medical Research Institute (to Y.M.S.), National Institutes of Health Grant K08HL91127 (to Y.M.S.), and an Ivy Foundation the LTA4H aminopeptidase during the development of emphy- Biomedical Research Grant (to Y.M.S.). sema. Therefore, we first investigated the CS-induced alterations Address correspondence and reprint requests to Dr. Y. Michael Shim, Division of in the localization and enzymatic activity of the LTA4H protein. Pulmonary and Critical Care Medicine, Department of Medicine, University of Virginia, These studies demonstrated that CS significantly increased the P.O. Box 800546, Charlottesville, VA 22908-0546. E-mail address: [email protected] amount of LTA4H protein in murine lungs and led to specific Abbreviations used in this article: AA, ambient air; BALF, bronchoalveolar lavage fluid; CDX, 2-hydroxypropyl-b-cyclodextrin; CS, cigarette smoke; EH, epoxy patterns of LTA4H protein localization in lung tissues. Chronic hydrolase; KO, knockout; Lm, mean cordlength; LTA4,leukotrieneA4; LTA4H, exposure to CS also caused acidification of the bronchoalveolar LTA4 hydrolase; LTB4, leukotriene B4; MMP, metalloproteinase; PGP, proline-glycine- lavage fluid (BALF) in mice, which suppressed the enzymatic proline; WT, wild-type. activity of the LTA4H aminopeptidase in the BALF. All of these Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 events promoted exaggerated bioproduction of PGP and LTB4. www.jimmunol.org/cgi/doi/10.4049/jimmunol.1400452 5060 ROLE OF LEUKOTRIENE A4 HYDROLASE AMINOPEPTIDASE IN EMPHYSEMA

When the activity of the LTA4H aminopeptidase was restored by (Promega) in PBS. The trachea was tied to keep the lungs inflated and then selectively augmenting it without changing the EH activity, murine fixed in 10 ml paraformaldehyde for 18 h. The fixed lungs were stained lungs were protected from CS-induced emphysematous damage due with H&E. Alveolar size was determined by mean cordlength (Lm), as previously described (3, 24, 25, 29, 30). Sequential digital pictures (at least to reduction in the levels of PGP and neutrophilic infiltration into 10 per animal) of the entire lungs were captured by an Axiostar micro- the lungs without changes in the levels of LTB4. These studies scope (Carl Zeiss Microimaging) and then processed by NIH Image 1.63 demonstrate that the LTA4H aminopeptidase pathway is an impor- on a Macintosh computer with a macro downloaded from the National tant contributor for the CS-induced neutrophilic inflammation, PGP Institutes of Health server user-macro directory (http://rsb.info.nih.gov/ nih-image/download/contrib/ChordLength.SurfaceArea). clearance, and emphysematous alveolar remodeling independent of the LTA4HEHpathway. Measurement of PGP in BALF Quantitative analysis of PGP in the BALF by HPLC-mass spectroscopy Materials and Methods proved to be highly unreliable presumably due to the matrix effects of the Formulation of 4MDM to improve water solubility and aromatic carbons generated from exposure to cigarette combustion. These characterization of 4MDM bioavailability aromatic carbons saturated the chromatography columns and made the columns unusable even after the first run of chromatography. Therefore, The solubility of 4MDM was enhanced by formulation with 2-hydroxy- a two-step preparation of the BALF was performed, as follows. First, the propyl-b-cyclodextrin (CDX) and dextrose. The vehicle was prepared as BALF was purified by normal flow HPLC. The retention time of a standard an aqueous solution of CDX and dextrose without 4MDM. Maximum solution of PGP was determined to guide fractionation of PGP in the tolerated dose was first determined with WT mice (n = 10), and then the BALF samples. Second, the levels of PGP were quantified using a Thermo CDX-4MDM dose equal to 25% of the maximum tolerated dose was used Electron TSQ Quantum Access MAX mass spectrometer system with a in all subsequent in vivo studies. The solutions were administered as Protana nanospray ion source interfaced to a custom-packed 8 cm 3 m m drinking water for mice in cages. The levels of 4MDM in BALF were 75- m (internal diameter) Phenomenex Jupiter 10 mC18 reverse-phase m quantified first by enriching 4MDM using C18 Sep-Pak (Waters) and then capillary column. A 0.5- L aliquot of each fractionated extract was measuring the levels by using HPLC equipped with a UV detector (HPLC- injected, and the samples were eluted from the column using a reverse- UV). The HPLC setup consisted of the following: Shimadzu CBM con- phase gradient from 0 to 100% acetonitrile at a flow rate of 0.5 mL/min troller, Shimadzu LC20AD pump, Shimadzu SPD20A UV detector, Shi- over 0.5 h. The nanospray ion source was operated at +3 kV. The multiple 2 madzu CTO20A column oven, Waters C18 Symmetry HPLC column, and reaction monitoring used was 270.2 172.9, 116.1. Shimadzu SIL20A autoinjector. The Shimadzu EZStart software was used to operate the instrument and for data analysis. The HPLC method parameters In silico molecular modeling of LTA4H, 4MDM, PGP, and were as follows: binary conditions with a solvent rate of 1 ml/min for 15 min LTA4 and simultaneous UV detection at l = 237 nm. Each sample was injected The software Virtual Molecular Dynamics version 1.8.7 (VMD) was used twice. First, 100 ml unspiked samples was injected. Second, 90 mlsamples to visualize and render the final figure (31). The manual positioning of the spiked with 10 ml known amounts of 4MDM was injected. Peaks corre- ligands in the LTA H substrate-binding site was accomplished using the sponding to the 4MDM of each sample were identified by superimposing the 4 Molefracture Plugin version 1.3, which is available in the VMD package. 4MDM-spiked UV tracing onto the unspiked UV tracing of the samples. The The software GROMACS was used for energy minimization of the enzyme levels of 4MDM were assessed by calculating the area under the curve of the and ligands after solvation of the protein and ligands in a TIP3P water BALF samples to known standard curves of 4MDM. model (32). The ligands were parameterized using the SwissParam server CS-induced pulmonary emphysema (33). The minimization was carried out using the CHARMM27 forcefield, which is available in the GROMACS package (34). The E296Q mutant of The 129sv wild-type (WT) mice were purchased from National Cancer the LTA4H cocrystallized with the tripeptide Arg-Ala-Arg (Protein Data Institute. The LTA4H knockout (KO) mice were provided by B. Koller Bank: 3B7T) was used as a template to build the Pro-Gly-Pro substrate (University of North Carolina) (26). Animal use was approved by the in the peptidase-binding pocket of the enzyme (35). A crystal structure of University of Virginia Institutional Animal Care and Use Committee. WT aWTLTA4H (Protein Data Bank: 3FTV) was used for all subsequent and LTA4H KO mice, 8–12 wk of age, were exposed to CS using a Teague modeling of the protein (36). On the basis of mutation data, the C terminus TE-2 smoking apparatus. The 3R4F research cigarettes were purchased carboxylate was positioned to form a hydrogen bond with the side chain of from the University of Kentucky. Cigarettes were combusted at the rate of Arg563 (37). Hydrolysis of the peptide occurs at the N terminus. Therefore, threecigarettesevery9min,5hperday,5dperweek,over5mo.Circulating the N-terminal amine and the carboxyl oxygen were positioned to chelate 2+ air was trapped with an inline 22-mm filter attached to the air circulation with the Zn atom. The LTA4, a precursor to LTB4, was docked following system, and total particulate matters were monitored in the air. Mice were mutation data. The substrate was arranged to set two hydrogen bonds 563 studied 0, 1, 4, and 20 wk postexposure to CS. Mice were exposed to either between the Arg residue and the carboxylic acid moiety of LTA4 (37). ambient air or CS while being treated with either vehicle or a pharmaceutical Development of the LTA H ELISA agent (4MDM), which selectively augments the LTA4H aminopeptidase 4 activity without affecting the LTA4HEHactivity(25). The concentration of the LTA4H was determined by a custom-developed Premortem pulmonary physiologic assessment ELISA. Two LTA4H Abs were purchased from commercial vendors. The levels of LTA4H in the BALF and lung homogenate soup were determined Total lung volume and lung compliance were assessed by the Flexivent by using double-paired coating Ab (Novus EPR5713) and biotinylated (SCIREQ), as previously described (3, 25, 27, 28). In brief, animals were detection Ab (R&D Systems). Recombinant LTA4H was purchased from deeply anesthetized with ketamine and xylazine mixture (60/5 mg/kg Creative BioMart recombinant murine LTA4H with His-tag as a standard. weight); the trachea was cannulated using p10 tubing; the sternum was A total of 50 mL samples was used in duplicates to quantify the amount of opened; the diaphragm was cleared by opening the abdominal cavity; and the LTA4H. Samples were analyzed against the standard curve generated animals were ventilated at a respiratory rate of 120 breaths/min with from known quantities of recombinant mouse LTA4H enzyme. The ODs positive end expiratory pressure 3 cm H2O per a prewritten macro pro- were measured with a Dynex Technology TRIAD ELISA reader controlled gram. This technique ensured that the live animals’ voluntary effort could by Concert-Triad Serves software (version 2.0.0.12) at a wavelength not influence the physiologic values detected by the Flexivent. Once the 450 nm for the measurement of LTA4H. animals were acclimated to the Flexivent ventilator, the prescribed Flex- ivent algorithm was performed, as previously described (3, 25, 27, 28), and FACS analysis of whole-lung leukocyte infiltration the total lung volume and compliance were calculated using the software Whole-lung single-cell suspension was analyzed by FACS analysis. Briefly, supplied with the ventilator. Animals were sacrificed following physiologic mouse lungs were harvested and then digested in lung digestion media measurements, and tissues were harvested for postmortem physiologic and with 1.0 mg/ml collagenase A (Roche Diagnostics) in RPMI 1640 (Quality morphometric assessment. Biological), and erythrocytes were lysed with ammonium–chloride– Postmortem histological lung morphometry assessment potassium buffer (Quality Biological). Cells isolated from the lungs were stained with PerCP-labeled CD45 (BD Biosciences), allophycocyanin-Cy7– As previously described (3, 24, 25, 29), animals were anesthetized, the labeled CD11b (BD Biosciences), PE-labeled Ly6G (BD Biosciences), trachea was cannulated, and the lungs were removed en block and inflated and FITC-Labeled LTA4H (Bioss). Infiltrating leukocytes were gated high at 25 cm H2O pressure of 1% melted low–melting-point agarose gel from nonleukocytes by the expression of CD45. Next, all CD45 The Journal of Immunology 5061

high high cells were gated into Ly6G and CD11b cells (neutrophils), as pre- Effects of CS on LTA4H protein viously described (3). For the purpose of detecting cells containing the Levels of the LTA H protein in the BALF and whole-lung soup LTA4H in their intracellular space, cells were permeabilized with flow 4 cytometry permeabilization buffer (R&D Systems) after being stained with increased and peaked post-4 wk CS exposure. Then levels of the CD45 Ab. Cells expressing LTA4H were separated into two groups, leu- LTA H protein in the BALF of the CS-exposed mice decreased high low 4 kocytes (CD45 ) and nonleukocytes (CD45 ). Multicolor detection of to the levels comparable to the age-matched, ambient air (AA)– the stained cells was performed on a FACScan flow cytometer (BD Bio- sciences). FlowJo (version 8.8.6.) was used to analyze the data. exposed mice by 20 wk (Fig. 2A). However, levels of the LTA4H protein in the whole-lung protein soup of the CS-exposed mice Evaluation of apoptosis in alveolar epithelial cells were still significantly elevated as compared with the AA-exposed TUNEL stain was performed with TACS 2Td-DAB in situ apoptosis de- mice by 20 wk (Fig. 2B). Significantly more LTA4H was found in 2 tection kit per manufacturer’s protocol (Trevigen). Paraffin-embedded lung intracellular staining of CD45+ and CD45 cells from the CS- blocks were at 8 mm thickness and then stained with reagents provided in exposed lungs as compared with AA-exposed lungs (Fig. 2C). the TACS 2Td-DAB kit. At least five animals in each group were studied. The LTA H protein was located in the cytosol of the airway epi- Ten adjacent pictures were taken from lungs of each animal at original 4 magnification power 340; positively stained epithelial cells (brown) were thelial cells in AA-exposed mice, but the LTA4H protein was lo- counted and then averaged to conduct statistical analyses. calized into the nuclei of the airway epithelial cells in CS-exposed mice (Fig. 2D). Levels of LTB and PGP were significantly in- LTA H immunohistochemistry 4 4 creased in the BALF of CS-exposed mice as compared with AA- Immunohistochemistry was performed according to the commercial ven- exposed mice (Fig. 3A, 3B). A significantly increased number dor’s protocol (Vectostain Elite ABC kit) with Biogenex Ag retrieval citra of CD45highCD11bhighLy6Ghigh cells infiltrated the CS-exposed plus, Biogenex power block, murine LTA4H Ab and isotype control Ab (Novus), and diaminobenzidine Vector peroxidase substrate kit. lungs as compared with AA-exposed lungs (Fig. 3C). BALF was found to be significantly more acidic in mice exposed to CS BALF collection and biochemical analysis for 20 wk (pH 6.7) as compared with mice exposed to AA for Animals were anesthetized, as described above at specified time points, and 20 wk (pH 7.2) (Fig. 3D). Enzymatic activity of the LTA4Hami- BALF was collected and processed after pH was measured per previously nopeptidase was found to be significantly suppressed in vitro at published method (3, 20, 24, 25). Concentration of the LTA4H protein was pH 6.7 as compared with pH 7.2 (Fig. 3E). determined by an ELISA developed in our laboratory. Concentrations of keratinocyte-derived chemokine and MIP2 in BALF were determined by Developing a reagent to selectively augment the LTA4H commercially available ELISA kits (R&D Systems). Quantitative analysis aminopeptidase without affecting LTA4H EH activity of PGP in the BALF by HPLC-mass spectroscopy was achieved in two steps. First, BALF was purified by HPLC and then PGP was quantified by Previously, we published the design and biological effects of a Thermo Electron TSQ Quantum Access MAX mass spectrometer sys- 4MDM with which the LTA4H aminopeptidase can be selectively tem. Levels of LTB4 were assessed by a commercially available LTB4 augmented without affecting the EH activity (25). However, its enzyme immunoassay kit (R&D Systems) (3, 24, 25). application was limited due to low water solubility. Therefore, we Assessment of the LTA4H aminopeptidase activity developed a water-soluble formulation of 4MDM by encapsulating it with CDX. The hydrophobic cavity of the CDX structure Recombinant human LTA4H enzyme was produced, and the enzymatic properties of the LTA4H aminopeptidase were assessed with a method encapsulates the water-insoluble 4MDM, whereas the hydrophilic previously published by our laboratory (25). A total of 25 mL BALF from exterior of the CDX affords a complex with improved water sol- each mouse was used to determine in vivo LTA4H aminopeptidase activity. ubility (Fig. 4A). A 4:1 molar ratio of CDX to 4MDM (CDX- Evaluation of metalloproteinase-8 and -9 4MDM) remained homogenous aqueous solution over 72 h (Table II). After CDX-4MDM was administered to mice as drinking Total RNA from lung tissue was isolated by TRIzol (3, 24, 25, 29, 30). water mixed with dextrose (1 g dextrose per mL water), 4MDM was SYBR Green real-time RT-PCR was performed and then standardized with b-actin to semiquantify the genes transcribing for metalloproteinase found in the BALF within 24 h (Fig. 4B). No mortality or gross (MMP)8 and MMP9. Primers used for PCR are listed in Table I. abnormalities were observed after oral administration of CDX- 4MDM for 5 mo (n = 33). Statistics Effects of CDX-4MDM in CS-exposed mice All data were expressed as mean 6 SEM and assessed for significance by t test or one-way ANOVA with Bonferroni subgroup comparison, as ap- Molecular mechanism of selective augmentation of the LTA4H propriate. All statistics were performed using Prism software (GraphPad). aminopeptidase by 4MDM can be rationalized with a molecular In all analyses, a p value ,0.05 was considered significant. model. In silico model of PGP and 4MDM in the substrate pocket of LTA4H is presented with LTA4 in purple and 4MDM in orange Results (Fig. 5A). The binding model for the 4MDM suggests that 4MDM CS-induced emphysematous tissue alteration in murine lungs 314 augments the LTA4H aminopeptidase by interacting with Phe The 129sv WT mice developed progressively severe emphyse- and subsequently perturbing the chelation of Glu318 to the zinc matous tissue alteration with CS exposure, and this was demon- atom and enhancing turnover of the peptide hydrolysis reaction strated by all three primary end points, premortem lung physiology (38). The long aliphatic tail of LTA4 is predicted to extend (total lung capacity and static compliance) and postmortem his- into this pocket and preclude simultaneous binding of 4MDM. tology (Lm) (Fig. 1). Therefore, 4MDM is not expected to alter LTA4H EH activity, that

Table I. Primer sets for real-time PCR

Gene AT Left Primer (59–39) Right Primer (59–39) b-actin 60˚C AGCCATGTACGTAGCCATCC CTCTCAGCTGTGGTGGTGAA MMP8 60˚C CCCACCTGAGATTTGATGCT CTGAAGACCGTTGGGTAGGA MMP9 60˚C CAATCCTTGCAATGTGGATG AGTAAGGAAGGGGCCCTGTA AT, annealing temperature. 5062 ROLE OF LEUKOTRIENE A4 HYDROLASE AMINOPEPTIDASE IN EMPHYSEMA

FIGURE 1. Assessment of the emphysema phenotype in 129sv WT mice postexposure to CS by Teague TE-2 smoking apparatus over 5 mo. (A) Premortem total lung volume measured by Sireq Flexivent. (B) Premortem quasi-static lung compliance measured by Sireq Flexivent. (C) Postmortem alveolar Lm. (D) Representative H&E histology of the lungs at low power (original magniﬁcation 32.5). Time = duration of exposure to CS. Cigarette dose = three cigarettes per 9 min, 5 h per day, 5 d per week. *Represents analysis by ANOVA. n = 9–13 animals per groups in (A)and(B). n = 5 animals per group in (C).

is, processing of LTA4 to LTB4. In vivo effects of the CDX- levels of PGP were significantly reduced in the mice treated with 4MDM were assessed by quantifying the levels of PGP and CDX-4MDM as compared with mice treated with vehicle post- LTB4. In CS-exposed mice treated with vehicle or CDX-4MDM, 20 wk CS exposure (Fig. 5C). A significantly fewer number of high high high levels of LTB4 were not significantly different (Fig. 5B). However, CD45 CD11b Ly6G cells was found in the CS-exposed

FIGURE 2. Assessment of the LTA4H protein expression in 129sv WT mice postexposure to CS over 5 mo. (A) The levels of LTA4H protein in the whole-lung BALF assessed by ELISA. (B) The levels of LTA4H protein in the whole-lung protein soup assessed by ELISA. (C) Flow cytometry of the whole-lung single-cell suspension. Air, mice exposed to ambient air for 20 wk; SM, mice exposed to CS for 20 wk. (D) Immunohistochemistry with Ab speciﬁc to murine LTA4H protein in lung tissues from mice exposed to CS for 20 wk (oil original magniﬁcation 363). Positive signals appear brown and counterstained with blue. Arrowheads show nuclei with positive counterstain (blue) indicating absence of LTA4H protein. Arrows show nuclei with positive stain (grown) indicating presence of LTA4H protein. Gray bars in (A) and (B), ambient air–exposed mice with ages 26–28 wk. *Represents analysis by ANOVA, **by Bonferroni subgroup comparison, and ***by nonparametric t test. n = 5 per group. The Journal of Immunology 5063

FIGURE 3. Assessment of 129sv WT mice postexposure to CS by Teague TE-2 smoking apparatus for

5 mo. (A) Levels of LTB4 in BALF. (B) Levels of PGP in BALF. (C) Levels of CD45+CD11b+Ly6G+ cells in whole-lung single-cell suspension. Abs are with PerCP- labeled CD45, ACP-labeled CD11b, and PE-labeled Ly5G. (D) pH of BALF over 20 wk CS exposure. (E) In vitro aminopeptidase activity assay using human recombinant LTA4H at pH 6.7 and 7.2. *Represents analysis by nonparametric t test. **Represents analysis by ANOVA. ***Represents two-way ANOVA with AP activity and time as two factors. n = 5 per group. Air, ambient air exposure; SM, CS exposure.

mice treated with CDX-4MDM as compared with CS-exposed The aminopeptidase activity was augmented with positive dose mice treated with vehicle (Fig. 5D). The selectivity of 4MDM at response to 4MDM (Fig. 7A). The kcat (enzymatic turnover number) 21 the LTA4H enzyme target was conﬁrmed by demonstrating that of the LTA4H aminopeptidase increased from 17.2 s in vehicle to treatment with CDX-4MDM had no effects in mice with a null 89.8 s21 in the presence of 8.0 mM 4MDM at pH 6.7 (Table III). mutation at the LTA4H loci (Fig. 5E). After 20 wk CS exposure, Treatment with 8.0 mM 4MDM at pH 6.7 increased the aminopep- assessment by premortem total lung capacity and static compli- tidase activity by .3-fold as compared with treatment with vehicle at ance and postmortem Lm demonstrated that selective augmenta- pH 7.2 (27.5/s to 89.8/s) (Table III). Then the in vivo activity of the tion of the LTA4H aminopeptidase activity protected lungs from LTA4H aminopeptidase was measured in the BALF. The speciﬁcity CS-induced emphysematous alveolar tissue alteration (Fig. 6). of this assay on measuring the LTA4H aminopeptidase in the BALF was determined by demonstrating minimally detectable LTA H Effects of 4MDM on the enzymatic activity of LTA H 4 4 aminopeptidase activity in mice with null mutation at the LTA Hloci aminopeptidase in acidic environment 4 as compared with mice with WT LTA4H loci (Fig. 7B). The LTA4H Effects of 4MDM on the enzymatic characteristics of the LTA4H aminopeptidase activity was then found to be substantially aug- aminopeptidase at pH 6.7 were determined by using in vitro ami- mented in the BALF from CS-exposed WT mice treated with oral nopeptidase activity assay with a previously published method (25). CDX-4MDM as compared with CS-exposed WT mice treated with vehicle for 5 mo (Fig. 7C). These studies demonstrated that the loss of LTA4H aminopeptidase activity caused by reduction in pH was rescuedbytreatmentwithCDX-4MDM, which augmented the LTA4H aminopeptidase activity with minimal off-targeting effects. Recovery of enzymatic activity indicates that, at low pH, the LTA4H protein is functionally suppressed but structurally intact.

In silico molecular modeling of LTA4H, 4MDM, PGP, and LTA4

In contrast to PGP, hydrolysis of LTA4 is at the C-12 position and is stereoselective to give exclusively the R epimer. Asp375 is an es- sential residue for this process and presumably directs the addition of a water molecule to the C-12 carbon of the LTA4 molecule (37).

Table II. Stability of a water-soluble formulation of 4MDM

A FIGURE 4. ( ) Diagram of CDX encapsulating 4MDM. 4MDM is in Time (h) CDX:4MDM Ratio 4MDM Concentration (mM) the inner pocket of CDX and highlighted with an oval circle. (B) Levels of 4MDM in BALF 24, 48, and 72 h after CDX-4MDM was started to be 0 4:1 5.20 (100%) administered as drinking water in mice. *Represents column statistics 48 4:1 4.82 (92.7%) comparing the levels of 4MDM with the hypothetical value of untreated 72 4:1 4.45 (85.6%) mice, in this case, 0 ng/ml. n = 5 animals per group. Levels of 4MDM in CDX-4MDM formulation kept at room temperature up to 72 h. 5064 ROLE OF LEUKOTRIENE A4 HYDROLASE AMINOPEPTIDASE IN EMPHYSEMA

FIGURE 5. Effects of CDX-4MDM treatment on the levels of LTB4, PGP, and neutrophils in mice exposed to CS for 20 wk. (A) In silico modeling of the LTA4H-binding pocket occupied by 4MDM and PGP overlaid with the predicted binding model of LTA4. 4MDM = orange. PGP = yellow. LTA4 = purple. (B) Levels of LTB4 in BALF with oral CDX-4MDM or vehicle treatment postexposure to CS for 20 wk. (C) Levels of PGP in BALF with oral CDX-4MDM or vehicle treatment postexposure to CS for 20 wk. (D) Levels of CD45+CD11b+Ly6G+ cells in whole-lung single-cell suspension with oral CDX-4MDM or vehicle treatment postexposure to CS for 20 wk. (E) Levels of CD45+CD11b+Ly6G+ cells in whole-lung single-cell suspension of 129sv WT mice (black bars) and 129sv mice with null mutation at the LTA4H loci (gray bars) with oral CDX-4MDM or vehicle treatment postexposure to CS for 7 d. *Represents analysis by ANOVA, **by Bonferroni subgroup comparison, and ***by nonparametric t test. n = 5–6 per group.

Therefore, the LTA4 in the LTA4H substrate-binding pocket was compared with AA exposure (Fig. 8). However, selective aug- assembled by positioning the Re face of the C-12 atom opposite mentation of the LTA4H aminopeptidase significantly reduced the Asp375 residue. The 4MDM ligand was docked with the apoptosis in CS-exposed mice as compared with CS-exposed, unsubstituted phenyl ring of 4MDM positioned to form p-p vehicle-treated mice. stacking interactions with the phenyl ring of Phe314, and the 4- Effects of CDX-4MDM on KC, MIP2, MMP8, and MMP9 methoxyphenyl substituent was positioned to interact with the hydrophobic side chain of Val367 through van der Waal inter- PGP is known to bind to CXCR2 and induces chemotaxis of actions. The proposed binding mode is in accordance with the neutrophils (13, 19, 20, 40). Levels of KC in the BALF post-CS docking studies of Lai and coworkers (39) on related analogs. exposure were not significantly different between the mice treated with CDX-4MDM and vehicle (Fig. 9A). However, levels of MIP2 Effects of CDX-4MDM on alveolar epithelial apoptosis in the BALF post-CS exposure were significantly reduced in mice Mice after 20 wk CS exposure had a significantly higher number treated with CDX-4MDM as compared with mice treated with of alveolar epithelial cells staining positive in TUNEL assay as vehicle (Fig. 9B). MMP8 and MMP9 have been found to be as-

FIGURE 6. Effects of CDX-4MDM treatment on pulmonary emphysema in WT mice exposed to CS or ambient air for 20 wk. (A) Premortem total lung volume measured by Sireq Flexivent. Total lung volume was measured after inﬂating the lungs with 30 cm H2O pressure. (B) Premortem quasi-static lung compliance measured by Sireq Flexivent. (C) Postmortem Lm. (D) Representative H&E histology of the lungs (original magniﬁcation 310). + in the box and whisker plot represents mean, whereas horizontal bar represents median. *Represents analysis by ANOVA, and **by Bonferroni subgroup comparison. n = 9–13 animals per groups in (A) and (B). n = 5 animals per group in (C). The Journal of Immunology 5065

FIGURE 7. LTA4H aminopeptidase activity assay. (A) In vitro LTA4H aminopeptidase activity assay with human recombinant LTA4H in the presence of increasing doses of 4MDM at culture medium pH 6.7. Aminopeptidase (AP) activity is assessed by UV light absorption at l = 405. (B)LTA4H aminopeptidase activity assay with BAL ﬂuid collected from mice with WT or null mutation (LTA4H KO) at the LTA4H loci. n = 5 per group. (C)LTA4H aminopeptidase activity assay with BALF collected from mice treated with vehicle or 4MDM after exposure to CS for 20 wk. n = 6 per group. All data points are mean 6 SEM. *Represents two-way ANOVA with AP activity as the ﬁrst factor and 4MDM dose (A)ortime(B and C) as the second factor.

sociated with PGP bioproduction and subsequent infiltration of the LTA4H aminopeptidase activity was significantly more sup- neutrophils into the diseased tissues (12, 15, 18–20). Real-time pressed than pH of the AA-exposed BALF (pH 7.2). We hy- RT-PCR of the whole-lung RNA demonstrated that the levels of pothesized that breakdown and clearance of PGP occur primarily genes transcribing for MMP8 and MMP9 were significantly in- in the airspaces and that the bioproduction of LTB4 occurs pri- creased post-20 wk CS exposure as compared with 20 wk AA marily in nuclei in which all necessary molecular components are exposure (Fig. 9C, 9D). Levels of gene transcribing for MMP8 present. Localization of the LTA4H protein into nuclei and asso- were not significantly altered post-CS exposure when compared ciated induction of LTB4 bioproduction have been described by between mice treated with vehicle or CDX-4MDM. However, others in the past (51). Combination of these changes after CS selective augmentation of the LTA4H aminopeptidase significantly exposure was thought to create a cellular microenvironment in reduced the levels of gene transcribing for MMP9 post-20 wk CS which persistently elevated levels of LTB4 and PGP would occur. exposure as compared with vehicle treatment. Traditional transgenic strategies using knockins or knockouts are limited due to their inabilities to selectively modify the individual Discussion functions of the LTA4H bifunctional activities. All available An exaggerated activity of the LTA4H enzyme frequently coexists pharmaceutical agents are limited because these agents are non- with and is believed to contribute to the pathogenesis of a variety selective inhibitors of the LTA4H EH and aminopeptidase. We of diseases associated with neutrophils, including sepsis, cystic overcame this limitation by developing 4MDM, which selectively fibrosis, nonsteroid-dependent asthma, and chronic obstructive augments the LTA4H aminopeptidase without affecting the LTA4H pulmonary disease (5, 41–45). Several studies have highlighted EH activity. This tool provided us with a new ability to probe the the importance of the exaggerated LTA4H EH activity and its bifunctionality of the LTA4H enzyme. We developed a water- bioproduct, LTB4, which contribute to neutrophilic inflammation soluble formulation for chronic administration suitable for a mu- and tissue remodeling (46–50). We have previously demonstrated rine model of emphysema induced by chronic CS exposure. We that LTB4 biosynthesis plays an important role in the emphyse- then demonstrated that selective augmentation of the LTA4H matous form of COPD induced by transgenic IL-13 and intrana- aminopeptidase protects lungs from CS-induced emphysematous sally administered elastase (24, 25). However, new evidence has alveolar remodeling by enhancing the clearance of PGP and re- emerged to suggest that the second enzymatic activity of the ducing neutrophilic inflammation independent of LTB4 bio- LTA4H, namely the aminopeptidase, may play an important role production. involving its ability to break down and clear PGP, a product of collagen breakdown with chemotactic properties. Our current studies provide further evidence to suggest that the LTA4H aminopeptidase makes an important contribution to CS- induced neutrophilic inflammation and emphysema in lungs. First, we demonstrated that CS exposure alters the levels and distribu- tion of the LTA4H protein, which promote bioproduction of LTB4 and hinder clearance of PGP. After 5 mo of CS exposure, LTA4H protein accumulated in the nuclei of the airway epithelial cells with minimal accumulation in the airspaces. Examination of the pH in the BALF after 5 mo CS exposure demonstrated that CS exposure acidified the BALF significantly (pH 6.7), and, at pH 6.7,

Table III. Effect of 4MDM on LTA4H aminopeptidase activity FIGURE 8. Effects of CDX-4MDM treatment on apoptosis in WT mice pH 7.2 pH 6.7 pH 6.7 pH 6.7 exposed to CS or ambient air for 20 wk. Counting of TUNEL-positive cells 4MDM 0.0 mM 0.0 mM 0.8 mM 8.0 mM and calculating apoptosis index (percentage of cells positively stained in kcat 27.5 6 1.12 17.2 6 2.24 59.3 6 6.10 89.8 6 6.26 TUNEL assay). Ten random pictures of each animal were examined. n =5 2 6 6 6 6 KM 7.66 0.74 16.30 3.99 14.51 2.69 10.83 1.53 per group. *Represents analysis by ANOVA, and **by Bonferroni sub- 21 2 group comparison. Air, ambient air exposure; SM, CS exposure; Tx, CDX- kcat, enzymatic turnover (s ); KM , concentration at one-half maximum velocity (mM). 4MDM; Veh, CDX-containing vehicle. 5066 ROLE OF LEUKOTRIENE A4 HYDROLASE AMINOPEPTIDASE IN EMPHYSEMA

NF-kb. This is an intriguing hypothesis that merits further in- vestigation in the future. Second, our molecular modeling and the properties of 4MDM suggest that the aminopeptidase activity of the LTA4H is a drug- gable target. The challenge with targeting a multifunctional enzyme is modifying one activity of the enzyme without affecting the other activity. Selective augmentation of the aminopeptidase activity is possible because of the large substrate-binding pocket of the LTA4H enzyme (Fig. 5A). A number of available mutation data suggests that 4MDM would occupy the space between Val367 and Phe314 and form p-p stacking interaction with phenyl ring of Phe314 and van der Waal interactions with the hydrophobic side chain of Val367. In this model, 4MDM and PGP can simulta- neously bind to the LTA4H substrate site. Mutation data suggest that the aliphatic tail of LTA4 must extend deep into the pocket, which would prevent simultaneous binding with 4MDM (37). It appears that this model offers a plausible explanation as to why 4MDM does not cause measurable changes in the LTA4 EH activity in vivo. Further studies involving cocrystallization of 4MDM with the LTA4H is necessary to make a conclusive determination for its mechanism selective for aminopeptidase. Third, the animals treated with CDX-4MDM showed reduction in the levels of MIP2, whereas the levels of KC were unchanged. This was an unanticipated epiphenomenon. Reactive oxygen species have been found to activate macrophages, and this interaction was found to induce neutrophil chemotaxis via production of MIP2 (56). We speculate that the selective augmentation of the LTA4H aminopeptidase may alter interaction between alveolar macrophages and reactive oxygen species and reduce the levels of MIP2. This is a speculation that merits more studies in the future. Fourth, CS exposure upregulated the genes transcribing for MMP8 and MMP9, which are described to contribute to the bio- FIGURE 9. Effects of CDX-4MDM treatment on WT mice exposed to production of PGP (12, 15, 17, 57). Treatment with 4MDM selec- CS or ambient air for 20 wk. (A) Levels of KC in the BALF from WT mice tively downregulated the genes transcribing for MMP9, whereas it exposure to CS for 20 wk. (B) Levels of MIP2 in the BALF from WT mice did not for MMP8. Previously, others have reported that the MMP9 C exposure to CS for 20 wk. ( ) Levels of RNA transcribing for MMP8 in is potentially involved in a feed-forward mechanism, which per- b D whole-lung RNA isolate normalized by -actin. ( ) Levels of RNA petuates the in vitro bioproduction of PGP due to CS exposure (12, transcribing for MMP9 in whole-lung RNA isolate normalized by b-actin. 16). These findings suggest that the selective augmentation of the *Represents analysis by ANOVA and **by Bonferroni subgroup comparison. n = 5–7 animals per group. Air, ambient air exposure; SM, CS LTA4H aminopeptidase could potentially halt this feed-forward exposure; Tx, CDX-4MDM; Veh, CDX-containing vehicle. cycle as a part of its therapeutic effects. Although CDX-4MDM provided an opportunity to probe the biology of the LTA4H bifunctional activities, there are limitations Our results demonstrated several notable observations related to in our study worth mentioning. First, our current study appears the bifunctional activities of the LTA4H and pathogenesis of em- to be potentially divergent from what we have observed in the physema. First, CS exposure in pulmonary system induces com- LTA4H KO animals (3). In our previous study, we reported that plex biomolecular alterations within the bifunctional enzymatic the null mutation at the LTA4H loci led to significant protection activities of the LTA4H protein. We demonstrated that CS expo- against emphysema induced by intranasal elastase administra- sure causes distinctive localization of the LTA4H protein in lung tion. The elastase-induced model of emphysema is a one-hit tissues and acidification of the airspaces that alter the LTA4H model induced by a single-dose administration of porcine elas- aminopeptidase activity. These are, in our opinion, important tase. The CS-induced model of emphysema is repeated-insult biomolecular events that have been previously underappreciated. model (daily smoking) induced over 5 mo, and chronicity and Even though a number of animal studies showed promising repeating nature of the insults by CS most likely induced pul- pharmaceutical benefits by using LTA4H inhibitors that indis- monary responses divergent from the elastase-induced model criminately block both enzymatic activities, no agents have been of emphysema. Second, all of our analyses were observational successfully translated to the bedside as Food and Drug Admin- related to the development of emphysema and neutrophils. istration–approved therapeutics (52–55). Our studies may provide Secondaryinvivoconfirmationofourresultswouldrequire additional biological insights as to how these nonselective modi- depletion of neutrophils. Inherent limitations in available meth- fiers of the LTA4H enzymatic activities may inadvertently cause ods hindered this attempt. Mice with null mutation at the unwanted and potentially harmful biological effects. This could CXCR2 loci would alter nonneutrophil-dependent biological occur by unknowingly canceling the “good” LTA4H aminopepti- mechanisms such as angiogenesis, which make important dase while blocking the “bad” LTA4H EH with nonselective contributions to the pathogenesis of emphysema (58–60). Neu- LTA4H modifiers. Localization of the LTA4H protein into the trophil depletion with anti-Ly6G Ab was attempted in our labo- nuclei also raises a possibility that the LTA4H may potentially ratory for as long as 1-mo duration (3). However, administration behave as a regulator of transcriptional factors such as MAPK or of this Ab longer than 1 mo caused serum sickness in animals and The Journal of Immunology 5067 was determined to be unsuitable for a chronic model like that of 17. O’Reilly, P., P. L. Jackson, B. Noerager, S. Parker, M. Dransfield, A. Gaggar, and J. E. Blalock. 2009. N-alpha-PGP and PGP, potential biomarkers and therapeutic 20 wk CS exposure. targets for COPD. Respir. Res. 10: 38. In summary, our studies highlighted cellular mechanisms as- 18. Lin, M., P. Jackson, A. M. Tester, E. Diaconu, C. M. Overall, J. E. Blalock, and sociated with the perturbations in the bifunctional enzymatic ac- E. Pearlman. 2008. Matrix metalloproteinase-8 facilitates neutrophil migration through the corneal stromal matrix by collagen degradation and production of tivities of LTA4H, which is responsible for emphysematous alveolar the chemotactic peptide Pro-Gly-Pro. Am. J. Pathol. 173: 144–153. remodeling induced by CS exposure. Our studies provided mech- 19. Weathington, N. M., A. H. van Houwelingen, B. D. Noerager, P. L. Jackson, anistic insights that the development of the emphysematous de- A. D. Kraneveld, F. S. Galin, G. Folkerts, F. P. Nijkamp, and J. E. Blalock. 2006. A novel peptide CXCR ligand derived from extracellular matrix degradation struction in lungs may be ameliorated by interventions that during airway inflammation. Nat. Med. 12: 317–323. selectively regulate the LTA4H aminopeptidase. This report fea- 20. Snelgrove, R. J., P. L. Jackson, M. T. Hardison, B. D. Noerager, A. Kinloch, A. Gaggar, S. Shastry, S. M. Rowe, Y. M. Shim, T. Hussell, and J. E. Blalock. tures the unexplored bifunctional activities of the LTA4H pathway 2010. A critical role for LTA4H in limiting chronic pulmonary neutrophilic as noteworthy sites for future investigations designed to evaluate inflammation. Science 330: 90–94. disease susceptibility, disease progression, and therapeutic utility 21. Hautamaki, R. D., D. K. Kobayashi, R. M. Senior, and S. D. Shapiro. 1997. Requirement for macrophage elastase for cigarette smoke-induced emphysema in emphysema. in mice. Science 277: 2002–2004. 22. Bracke, K. R., A. I. D’hulst, T. Maes, K. B. Moerloose, I. K. Demedts, Disclosures S. Lebecque, G. F. Joos, and G. G. Brusselle. 2006. Cigarette smoke-induced pulmonary inflammation and emphysema are attenuated in CCR6-deficient mice. Two authors (Y.M.S. and M.P.) are part owners of a biotech company that J. Immunol. 177: 4350–4359. is attempting to commercialize chemical agents used in this manuscript 23. D’hulst, A. I., K. Y. Vermaelen, G. G. Brusselle, G. F. Joos, and R. A. Pauwels. for disease indications described in this manuscript (emphysema). 2005. Time course of cigarette smoke-induced pulmonary inflammation in mice. Eur. Respir. J. 26: 204–213. 24. Shim, Y. M., Z. Zhu, T. Zheng, C. G. Lee, R. J. Homer, B. Ma, and J. A. Elias. 2006. Role of 5-lipoxygenase in IL-13-induced pulmonary inflammation and References remodeling. J. Immunol. 177: 1918–1924. 1. Thunnissen, M. M., B. Andersson, B. Samuelsson, C. H. Wong, and 25. De Oliveira, E. O., K. Wang, H. S. Kong, S. Kim, M. Miessau, R. J. Snelgrove, J. Z. Haeggstro¨m. 2002. Crystal structures of leukotriene A4 hydrolase in Y. M. Shim, and M. Paige. 2011. Effect of the leukotriene A4 hydrolase ami- complex with captopril and two competitive tight-binding inhibitors. FASEB J. nopeptidase augmentor 4-methoxydiphenylmethane in a pre-clinical model of 16: 1648–1650. pulmonary emphysema. Bioorg. Med. Chem. Lett. 21: 6746–6750. 2. Andersson, B., F. Kull, J. Z. Haeggstro¨m, and M. M. Thunnissen. 2003. Crys- 26. Byrum, R. S., J. L. Goulet, J. N. Snouwaert, R. J. Griffiths, and B. H. Koller. tallization and X-ray diffraction data analysis of leukotriene A4 hydrolase from 1999. Determination of the contribution of cysteinyl leukotrienes and leukotriene Saccharomyces cerevisiae. Acta Crystallogr. D Biol. Crystallogr. 59: 1093–1095. B4 in acute inflammatory responses using 5-lipoxygenase- and leukotriene A4 3. Shim, Y. M., M. Paige, H. Hanna, S. H. Kim, M. D. Burdick, and R. M. Strieter. hydrolase-deficient mice. J. Immunol. 163: 6810–6819. 2010. Role of LTB₄ in the pathogenesis of elastase-induced murine pulmonary 27. Jonasson, S., G. Hedenstierna, H. Hedenstro¨m, and J. Hjoberg. 2009. Compar- emphysema. Am. J. Physiol. Lung Cell. Mol. Physiol. 299: L749–L759. isons of effects of intravenous and inhaled methacholine on airway physiology in 4. Stockley, R. A., D. L. Bayley, I. Unsal, and L. J. Dowson. 2002. The effect of a murine asthma model. Respir. Physiol. Neurobiol. 165: 229–236. augmentation therapy on bronchial inflammation in alpha1-antitrypsin defi- 28. Martin, E. L., T. A. Sheikh, K. J. Leco, J. F. Lewis, and R. A. Veldhuizen. 2007. ciency. Am. J. Respir. Crit. Care Med. 165: 1494–1498. Contribution of alveolar macrophages to the response of the TIMP-3 null lung 5. Hubbard, R. C., G. Fells, J. Gadek, S. Pacholok, J. Humes, and R. G. Crystal. during a septic insult. Am. J. Physiol. Lung Cell. Mol. Physiol. 293: L779–L789. 1991. Neutrophil accumulation in the lung in alpha 1-antitrypsin deficiency: 29. Zhu, Z., R. J. Homer, Z. Wang, Q. Chen, G. P. Geba, J. Wang, Y. Zhang, and spontaneous release of leukotriene B4 by alveolar macrophages. J. Clin. Invest. J. A. Elias. 1999. Pulmonary expression of interleukin-13 causes inflammation, 88: 891–897. mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and 6. Rios-Santos, F., C. F. Benjamim, D. Zavery, S. H. Ferreira, and Fde. Q. Cunha. eotaxin production. J. Clin. Invest. 103: 779–788. 2003. A critical role of leukotriene B4 in neutrophil migration to infectious focus 30. Zhu, Z., B. Ma, T. Zheng, R. J. Homer, C. G. Lee, I. F. Charo, P. Noble, and in cecal ligation and puncture sepsis. Shock 19: 61–65. J. A. Elias. 2002. IL-13-induced chemokine responses in the lung: role of CCR2 7. Pace, E., M. Profita, M. Melis, A. Bonanno, A. Paterno`,C.H.Mody, in the pathogenesis of IL-13-induced inflammation and remodeling. J. Immunol. M. Spatafora, M. Ferraro, L. Siena, A. M. Vignola, et al. 2004. LTB4 is present 168: 2953–2962. in exudative pleural effusions and contributes actively to neutrophil recruitment 31. Humphrey, W., A. Dalke, and K. Schulten. 1996. VMD: visual molecular dy- in the inflamed pleural space. Clin. Exp. Immunol. 135: 519–527. namics. J. Mol. Graph 14: 33-38, 27-28. 8. Marian, E., S. Baraldo, A. Visentin, A. Papi, M. Saetta, L. M. Fabbri, and 32. Van Der Spoel, D., E. Lindahl, B. Hess, G. Groenhof, A. E. Mark, and P. Maestrelli. 2006. Up-regulated membrane and nuclear leukotriene B4 recep- H. J. Berendsen. 2005. GROMACS: fast, flexible, and free. J. Comput. Chem. 26: tors in COPD. Chest 129: 1523–1530. 1701–1718. 9. Young, R. E., M. B. Voisin, S. Wang, J. Dangerfield, and S. Nourshargh. 2007. 33. Zoete, V., M. A. Cuendet, A. Grosdidier, and O. Michielin. 2011. SwissParam: Role of neutrophil elastase in LTB4-induced neutrophil transmigration in vivo a fast force field generation tool for small organic molecules. J. Comput. Chem. assessed with a specific inhibitor and neutrophil elastase deficient mice. Br. J. 32: 2359–2368. Pharmacol. 151: 628–637. 34. Bjelkmar, P., P. Larsson, M. A. Cuendet, B. Hess, and E. Lindahl. 2010. 10. Grespan, R., S. Y. Fukada, H. P. Lemos, S. M. Vieira, M. H. Napimoga, Implementation of the CHARMM force field in GROMACS: analysis of protein M. M. Teixeira, A. R. Fraser, F. Y. Liew, I. B. McInnes, and F. Q. Cunha. 2008. stability effects from correction maps, virtual interaction sites, and water models. CXCR2-specific chemokines mediate leukotriene B4-dependent recruitment of J. Chem. Theory Comput. 6: 459–466. neutrophils to inflamed joints in mice with antigen-induced arthritis. Arthritis 35. Tholander, F., A. Muroya, B. P. Roques, M. C. Fournie´-Zaluski, Rheum. 58: 2030–2040. M. M. Thunnissen, and J. Z. Haeggstro¨m. 2008. Structure-based dissection of the 11. Overbeek, S. A., S. Braber, P. J. Koelink, P. A. Henricks, E. Mortaz, A. T. LoTam active site chemistry of leukotriene A4 hydrolase: implications for M1 amino- Loi, P. L. Jackson, J. Garssen, G. T. Wagenaar, W. Timens, et al. 2013. Cigarette peptidases and inhibitor design. Chem. Biol. 15: 920–929. smoke-induced collagen destruction; key to chronic neutrophilic airway in- 36. Davies, D. R., B. Mamat, O. T. Magnusson, J. Christensen, M. H. Haraldsson, flammation? PLoS One 8: e55612. R. Mishra, B. Pease, E. Hansen, J. Singh, D. Zembower, et al. 2009. Discovery of 12. Xu, X., P. L. Jackson, S. Tanner, M. T. Hardison, M. Abdul Roda, J. E. Blalock, leukotriene A4 hydrolase inhibitors using metabolomics biased fragment crys- and A. Gaggar. 2011. A self-propagating matrix metalloprotease-9 (MMP-9) tallography. J. Med. Chem. 52: 4694–4715. dependent cycle of chronic neutrophilic inflammation. PLoS One 6: e15781. 37. Rudberg, P. C., F. Tholander, M. Andberg, M. M. Thunnissen, and 13. Jackson, P. L., B. D. Noerager, M. J. Jablonsky, M. T. Hardison, B. D. Cox, J. Z. Haeggstro¨m. 2004. Leukotriene A4 hydrolase: identification of a common J. C. Patterson, B. Dhanapal, J. E. Blalock, and D. D. Muccio. 2011. A CXCL8 carboxylate recognition site for the epoxide hydrolase and aminopeptidase receptor antagonist based on the structure of N-acetyl-proline-glycine-proline. substrates. J. Biol. Chem. 279: 27376–27382. Eur. J. Pharmacol. 668: 435–442. 38. Jiang, X., L. Zhou, Y. Wu, D. Wei, C. Sun, J. Jia, Y. Liu, and L. Lai. 2010. 14. Braber, S., P. J. Koelink, P. A. Henricks, P. L. Jackson, F. P. Nijkamp, J. Garssen, Modulating the substrate specificity of LTA4H aminopeptidase by using chem- A. D. Kraneveld, J. E. Blalock, and G. Folkerts. 2011. Cigarette smoke-induced ical compounds and small-molecule-guided mutagenesis. ChemBioChem 11: lung emphysema in mice is associated with prolyl endopeptidase, an enzyme 1120–1128. involved in collagen breakdown. Am. J. Physiol. Lung Cell. Mol. Physiol. 300: 39. Jiang, X., L. Zhou, D. Wei, H. Meng, Y. Liu, and L. Lai. 2008. Activation and L255–L265. inhibition of leukotriene A4 hydrolase aminopeptidase activity by diphenyl ether 15. Gaggar, A., S. M. Rowe, H. Matthew, and J. E. Blalock. 2010. Proline-glycine- and derivatives. Bioorg. Med. Chem. Lett. 18: 6549–6552. proline (PGP) and high mobility group box protein-1 (HMGB1): potential 40. Hardison, M. T., M. D. Brown, R. J. Snelgrove, J. E. Blalock, and P. Jackson. mediators of cystic fibrosis airway inflammation. Open Respir. Med. J. 4: 32-38. 2012. Cigarette smoke enhances chemotaxis via acetylation of proline-glycine- 16. O’Reilly, P. J., M. T. Hardison, P. L. Jackson, X. Xu, R. J. Snelgrove, A. Gaggar, proline. Front. Biosci. (Elite Ed.) 4: 2402–2409. F. S. Galin, and J. E. Blalock. 2009. Neutrophils contain prolyl endopeptidase and 41. Martin, T. R., B. P. Pistorese, E. Y. Chi, R. B. Goodman, and M. A. Matthay. generate the chemotactic peptide, PGP, from collagen. J. Neuroimmunol. 217: 51–54. 1989. Effects of leukotriene B4 in the human lung: recruitment of neutrophils 5068 ROLE OF LEUKOTRIENE A4 HYDROLASE AMINOPEPTIDASE IN EMPHYSEMA

into the alveolar spaces without a change in protein permeability. J. Clin. Invest. type II alveolar epithelial cells in normal and fibrotic lung. Am. J. Physiol. Lung 84: 1609–1619. Cell. Mol. Physiol. 289: L224–L232. 42. Bailie, M. B., T. J. Standiford, L. L. Laichalk, M. J. Coffey, R. Strieter, and 52. Schmitt-Grohe´, S., and S. Zielen. 2005. Leukotriene receptor antagonists in M. Peters-Golden. 1996. Leukotriene-deficient mice manifest enhanced lethality children with cystic fibrosis lung disease: anti-inflammatory and clinical effects. from Klebsiella pneumonia in association with decreased alveolar macrophage Paediatr. Drugs 7: 353–363. phagocytic and bactericidal activities. J. Immunol. 157: 5221–5224. 53. Roberts, W. G., T. J. Simon, R. G. Berlin, R. C. Haggitt, E. S. Snyder, 43. Wardlaw, A. J., H. Hay, O. Cromwell, J. V. Collins, and A. B. Kay. 1989. W. F. Stenson, S. B. Hanauer, J. E. Reagan, A. Cagliola, W. K. Tanaka, et al. Leukotrienes, LTC4 and LTB4, in bronchoalveolar lavage in bronchial asthma 1997. Leukotrienes in ulcerative colitis: results of a multicenter trial of a leu- and other respiratory diseases. J. Allergy Clin. Immunol. 84: 19–26. kotriene biosynthesis inhibitor, MK-591. Gastroenterology 112: 725–732. 44. Friedrich, E. B., A. M. Tager, E. Liu, A. Pettersson, C. Owman, L. Munn, 54. Hawkey, C. J., L. M. Dube, L. V. Rountree, P. J. Linnen, and J. F. Lancaster. A. D. Luster, and R. E. Gerszten. 2003. Mechanisms of leukotriene B4-triggered 1997. A trial of zileuton versus mesalazine or placebo in the maintenance of monocyte adhesion. Arterioscler. Thromb. Vasc. Biol. 23: 1761–1767. remission of ulcerative colitis. Gastroenterology 112: 718–724. 45. Fretland, D. J., D. L. Widomski, C. P. Anglin, T. D. Penning, S. Yu, and 55. Usery, J. B., T. H. Self, M. P. Muthiah, and C. K. Finch. 2008. Potential role of S. W. Djuric. 1993. Leukotriene B4-induced granulocyte trafficking in guinea leukotriene modifiers in the treatment of chronic obstructive pulmonary disease. pig dermis: effect of second-generation leukotriene B4 receptor antagonists, SC- Pharmacotherapy 28: 1183–1187. 50605 and SC-51146. Inflammation 17: 353–360. 56. Kawamura, H., T. Kawamura, Y. Kanda, T. Kobayashi, and T. Abo. 2012. Ex- 46. Izquierdo, J. L., C. Almonacid, T. Parra, and J. Pe´rez. 2006. [Systemic and lung tracellular ATP-stimulated macrophages produce macrophage inflammatory inflammation in 2 phenotypes of chronic obstructive pulmonary disease]. Arch. protein-2 which is important for neutrophil migration. Immunology 136: 448– Bronconeumol. 42: 332–337. 458. 47. Kostikas, K., M. Gaga, G. Papatheodorou, T. Karamanis, D. Orphanidou, and 57. Kong, M. Y., A. Gaggar, Y. Li, M. Winkler, J. E. Blalock, and J. P. Clancy. 2009. S. Loukides. 2005. Leukotriene B4 in exhaled breath condensate and sputum Matrix metalloproteinase activity in pediatric acute lung injury. Int. J. Med. Sci. supernatant in patients with COPD and asthma. Chest 127: 1553–1559. 6: 9–17. 48. Beeh, K. M., O. Kornmann, R. Buhl, S. V. Culpitt, M. A. Giembycz, and 58. Matsuo, Y., M. Raimondo, T. A. Woodward, M. B. Wallace, K. R. Gill, Z. Tong, P. J. Barnes. 2003. Neutrophil chemotactic activity of sputum from patients with M. D. Burdick, Z. Yang, R. M. Strieter, R. M. Hoffman, and S. Guha. 2009. COPD: role of interleukin 8 and leukotriene B4. Chest 123: 1240–1247. CXC-chemokine/CXCR2 biological axis promotes angiogenesis in vitro and 49. Woolhouse, I. S., D. L. Bayley, and R. A. Stockley. 2002. Sputum chemotactic in vivo in pancreatic cancer. Int. J. Cancer 125: 1027–1037. activity in chronic obstructive pulmonary disease: effect of alpha(1)-antitrypsin 59. Belperio, J. A., M. P. Keane, M. D. Burdick, B. Gomperts, Y. Y. Xue, K. Hong, deficiency and the role of leukotriene B(4) and interleukin 8. Thorax 57: 709–714. J. Mestas, A. Ardehali, B. Mehrad, R. Saggar, et al. 2005. Role of CXCR2/ 50. Hill, A. T., E. J. Campbell, D. L. Bayley, S. L. Hill, and R. A. Stockley. 1999. CXCR2 ligands in vascular remodeling during bronchiolitis obliterans syn- Evidence for excessive bronchial inflammation during an acute exacerbation of drome. J. Clin. Invest. 115: 1150–1162. chronic obstructive pulmonary disease in patients with alpha(1)-antitrypsin de- 60. Addison, C. L., T. O. Daniel, M. D. Burdick, H. Liu, J. E. Ehlert, Y. Y. Xue, ficiency (PiZ). Am. J. Respir. Crit. Care Med. 160: 1968–1975. L. Buechi, A. Walz, A. Richmond, and R. M. Strieter. 2000. The CXC che- 51. Brock, T. G., Y. J. Lee, E. Maydanski, T. L. Marburger, M. Luo, R. Paine, III, and mokine receptor 2, CXCR2, is the putative receptor for ELR+ CXC chemokine- M. Peters-Golden. 2005. Nuclear localization of leukotriene A4 hydrolase in induced angiogenic activity. J. Immunol. 165: 5269–5277.