Isolation and Expression of Cdna Clones Encoding Mammalian Poly(A) Polymerase

Total Page:16

File Type:pdf, Size:1020Kb

Load more

The EMBO Journal vol.10 no.13 pp.4251 -4257, 1991 Isolation and expression of cDNA clones encoding mammalian poly(A) polymerase Elmar Wahle, Georges Martin, Emile Schiltz1 et al., 1989; Gilmartin and Nevins, 1989) and depends on and Walter Keller2 a second sequence element downstream of the cleavage site (reviewed by Proudfoot, 1991). Biozentrum der Universitat Basel, Abteilung Zellbiologie, Poly(A) polymerase has been purified to homogeneity Klingelbergstrasse 70, CH4056 Basel, Switzerland and 'Institut fiir from calf thymus as a protein of 57-60 kDa (Tsiapalis et al., Organische Chemie und Biochemie der Universitat Freiburg, Albertstrasse 21, D-7800 Freiburg, FRG 1975; Wahle, 1991a). The enzyme by itself does not recognize the polyadenylation signal AAUAAA. In fact, it 2To whom correspondence should be addressed has a poor affinity for any RNA substrate and only a slight Communicated by W.Keller preference for poly(A) (Wahle, 1991a). The addition of Mn2+ to the reaction nonspecifically increases the affinity cDNA clones encoding mammalian poly(A) polymerase of the enzyme for RNA primers and permits efficient were isolated with probes generated by the polymerase polyadenylation independent of AAUAAA and CPF chain reaction based on amino acid sequences derived (Tsiapalis et al., 1975; Christofori and Keller, 1988; from the purified enzyme. A bovine cDNA clone was Takagaki et al., 1988; Wahle, 1991a). obtained encoding a protein of 82 kDa. Expression in We have used amino acid sequences derived from the Escherichia coli resulted in the appearance of a poly(A) purified enzyme to isolate cDNA clones of poly(A) polymerase activity that was dependent on the addition polymerase. Expression of a clone in Escherichia coli of the purified specificity factor CPF and the presence confirmed that it encoded poly(A) polymerase functional in of the polyadenylation signal AAUAAA in the RNA the AAUAAA-dependent and CPF-mediated polyadenylation substrate. The activity copurified with a polypeptide of of RNA. the expected size. A second class of cDNAs encoded a polypeptide of 43 kDa which was closely related to the N-terminal half of the 82 kDa protein. Northern blots Results showed two mRNAs of 4.2 and 2.4 kb that probably Isolation of a cDNA clone encoding poly(A) correspond to the two classes of cDNAs, as well as a third polymerase band of 1.3 kb. The sequence of the N-terminal half of Amino acid sequences were obtained from the N-terminus bovine poly(A) polymerase is 47% identical with the as well as from three tryptic peptides of purified poly(A) amino acid sequence of the corresponding part of yeast polymerase (Figure 1). DNA oligonucleotides to be used as poly(A) polymerase. Homologies to other proteins are of primers for the polymerase chain reaction (PCR) were uncertain significance. synthesized based on some of these amino acid sequences Key words: cDNA cloning/polyadenylation/poly(A) poly- (Figure 1 and Materials and methods). The templates used merase/mRNA processing for PCR were obtained by reverse transcription of calf thymus RNA, primed either by oligo(dT) or by the same DNA oligonucleotide that was used as a PCR primer (see Introduction Materials and methods). A DNA fragment of 700 nucleotides was obtained, among others, in a PCR reaction using primers The polyadenylate tails present on almost all eukaryotic 1 and 4. After gel purification, this fragment could be messenger RNAs are added post-transcriptionally by a reamplified with primers 2 and 4. Direct sequencing of the multicomponent machinery (reviewed by Manley, 1988; Wickens, 1990). Synthesis of the poly(A) tail is carried out Peptide: Sequence: by poly(A) polymerase with the help of the cleavage and 1 polyadenylation factor, CPF (Christofori and Keller, 1988, 2'p 1989; Takagaki et al., 1988, 1989; Gilmartin and Nevins, N-terminus PFPVTTQGSQQTQPXQKXYG 1989; Wahle, 1991a; Bienroth et al., 1991). CPF [also called 4 SF (Takagaki et al., 1989) or PF2 (Gilmartin and Nevins, 101 TDEILHLtPNIDNFRLTLRAIKLXAK 1989)] binds to the essential polyadenylation signal AAUAAA which is located in the RNA 10-30 nucleotides 96 THNIYSNILGFLGGVSXAMLVAR upstream of the polyadenylation site (Gilmartin and Nevins, 66 QRLEWVGLVESK 1989; Bardwell et al., 1991; Keller et al., 1991). Elongation of the growing tail is assisted by a poly(A) binding protein Fig. 1. Peptide sequences of purified poly(A) polymerase. Sequences (Wahle, 199 lb; Gershon et al., 1991). The polyadenylation of the N-terminus and three internal peptides (arbitrary numbering) are of the presented in the single letter code in their order of appearance in the reaction is preceded by endonucleolytic cleavage predicted protein sequence (see Figure 2). X, unidentified amino acid. primary transcript at the polyadenylation site. This cleavage The primers used for PCR amplification of cDNA fragments are reaction requires at least two factors in addition to poly(A) indicated as arrows pointing in the 5' to 3' direction (for details, see polymerase and CPF (Christofori and Keller, 1988; Takagaki Materials and methods). ©J Oxford University Press 4251 E.Wahle et al. PCR product with primer 2 revealed a nucleotide sequence 82.4 kDa. The N-terminus of the predicted amino acid downstream of the primer that encoded six amino acids sequence was identical with the N-terminal sequence obtained known from the sequencing of the purified protein (data not from purified poly(A) polymerase except for the absence of shown). Correct products, identified by similar procedures, the initiating methionine in the protein. The predicted were also obtained with other primer combinations (data not sequence also contained all internal peptide sequences shown). derived from the purified protein. The 700 bp fragment obtained with primers 2 and 4 was used as a probe to screen two cDNA libraries, derived from Expression of poly(A) polymerase in E.coli HeLa cells and calf thymus respectively. Clones were only A fragment containing the open reading frame of the bovine obtained from the HeLa library. Although these clones clone was inserted into a T7 expression vector such that the encoded the correct amino acid sequences, they had an open initiating ATG codon was that encoding the first amino acid reading frame for a protein of only 43 kDa and lacked of the authentic protein (see Materials and methods). peptide 66 (see below). Therefore, a fragment from the Depending on the induction conditions, the synthesis of a coding region of these clones was used to screen an additional polypeptide of the expected size could be barely or not at cDNA library from calf muzzle epithelium. The largest all detected by SDS-PAGE of total cell lysates. After cDNA clone obtained in this screen was 2.5 kb in length induction overnight at 18°C, nonspecific poly(A) polymerase (Figure 2). It contained an open reading frame coding for activity, measured by the incorporation of radiolabeled ATP a protein of 739 amino acids with a molecular weight of into acid-precipitable material in the presence of a poly(A) GCGGTTGCGGGGGGGAAGTGACTGGGCGGTGCGGCGCAGGAGACGATGCCGTTTCCAGTTACAACACAGGGATCACAGCAAACACAGCCG 90 M P F P V T T O G S 0 0 T O P 15 CCACAGAAGCACTATGGCATTACTTCTCCCATCAGCTTAGCAGCCCCCAAGGAGACTGACTGCCTGCTCACACAGAAGCTGGTGGAGACT 180 P O K H Y G I T S P I S L A A P K E T D C L L T Q K L V E T 45 CTGAAGCCCTTCGGGGTTTTTGAAGAGGAAGAGGAACTGCAGCGCAGGATTTTTATTTTGGGAAAATTAAATAACCTGGTAAAAGAGTGG 270 L K P F G V F E E E E E L Q R R I F I L G K L N N L V K E W 75 ATACGAGAAATCAGTGAAAGCAAGAATCTTCCACAATCTGTAATTGAAAATGTTGGTGGGAAAATTTTTACATTTGGATCTTATAGATTA 360 I R E I S E S K N L P Q S V I E N V G G K I F T F G S Y R L 105 GGAGTACATACAAAAGGTGCTGATATTGATGCATTGTGTGTTGCACCAAGACATGTTGATCGAAGTGATTTTTTCACCTCATTCTATGAT 450 G V H T K G A D I D A L C V A P R H V D R S D F F T S F Y D 135 AAGTTGAAATTACAGGAAGAAGTAAAAGATTTAAGAGCTGTTGAAGAGGCATTTGTACCAGTTATCAAACTGTGTTTTGATGGGATAGAG 540 K L K L Q E E V K D L R A V E E A F V P V I K L C F D G I E 165 ATTGATATTTTGTTTGCAACATTAGCACTGCAGACTATTCCAGAAGACTTGGACTTAAGAGATGACAGTCTGCTTAAAAATTTAGATATA 630 I D I L F A R L A L Q T I P E D L D L R D D S L L K N L D I 195 AGATGTATAAGAAGTCTTAACGGTTGCAGGGTAACCGATGAAATTTTACATCTAGTACCAAACATTGACAACTTCAGGTTAACCCTGAGA 720 R C I R S L N G C R V T D E L H L V P N I D N F R L T L R 225 GCTATCAAACTGTGGGCCAAACGCCACAACATCTATTCCAATATATTAGGTTTCCTCGGTGGTGTTTCCTGGGCTATGCTAGTAGCAAGA 810 A I K L W A K R H N I Y S N I L G F L G G V S W A M L V A R 255 ACTTGCCAGCTTTATCCAMATGCAATAGCATCAACTCTTGTACATAAATTTTTCTTGGTATTTTCTAAATGGGAATGGCCAAATCCAGTC 900 T C Q L Y P N A I A S T L V H K F F L V F S K W E W P N P V 285 CTATTGAAACAGCCTGAAGAATGCAATCTTAATTTGCCTGTATGGGACCCAAGGGTAAACCCCAGTGATAGGTACCATCTTATGCCTATA 990 L L K Q P E E C N L N L P V W D P R V N P S D R Y H L M P I 315 ATTACACCAGCATACCCACAACAGAACTCCACGTACAATGTGTCCGTTTCAACACGGATGGTCATGGTTGAGGAGTTTAAACAAGGTCTT 1080 I T P A Y P Q Q N S T Y N V S V S T R M V M V E E F K Q G L 345 GCTATCACAGATGAAATTTTGCTGAGTAAGGCAGAGTGGTCCAAACTTTTTGAAGCTCCAAACTTCTTTCAAAAGTACCAGCATGATATT 1170 A I T D E I L L S K A E W S K L F E A P N F F Q K Y Q H D I 375 GTACTTCTAGCAAGTGCACCAACTGAAAAACAACGCCTAGAATGGGTGGGCTTGGTGGAATCAAAAATCCGAATCCTGGTTGGAAGTTTG 1260 V L L A S A P T E K O R L E W V G L V E S K I R I L V G S L 405 GAGAAGAATGAGTTTATGACACTGGCTCATGTGAATCCCCAGTCATTTCCAGCACCCAAAGAAAATCCCGACAAGGAAGAATTTCGCACT 1350 E K N E F M T L A H V N P Q S F P A P K E N P D K E E F R T 435 ATGTGGGTGATTGGGTTAGTGTTTAACAAAACAGAAAACTCTGAAAATCTCAGTGTTGATCTCACCTATGATATTCAGTCTTTCACAGAT 1440 M W V I G L V F N K T E N S E N L S V D L T Y D I Q S F T D 465 ACAGTTTATAGGCAAGCAATAAACAGCAAGATGTTTGAGGTGGACATGAAAATTGCTGCGATGCATGTAAAAAGAAAGCAACTCCATCAA
Recommended publications
  • Mutation of the AAUAAA Polyadenylation Signal Depresses in Vitro Splicing of Proximal but Not Distal Introns

    Mutation of the AAUAAA Polyadenylation Signal Depresses in Vitro Splicing of Proximal but Not Distal Introns

    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Mutation of the AAUAAA polyadenylation signal depresses in vitro splicing of proximal but not distal introns Maho Niwa and Susan M. Berget Marrs McClean Department of Biochemistry, Baylor College of Medicine, Houston, Texas 77030 USA To investigate the relationship between splicing and polyadenylation during the production of vertebrate mRNAs, we examined the effect of mutation of a poly(A) site on splicing of upstream introns. Mutation of the AAUAAA polyadenylation consensus sequence inhibited in vitro splicing of an upstream intron. The magnitude of the depression depended on the magnesium concentration. Dependence of splicing on polyadenylation signals suggests the existence of interaction between polyadenylation and splicing factors. In multi-intron precursor RNAs containing duplicated splice sites, mutation of the poly(A) site inhibited removal of the last intron, but not the removal of introns farther upstream. Inhibition of removal of only the last intron suggests segmental recognition of multi-exon precursor RNAs and is consistent with previous suggestions that signals at both ends of an exon are required for effective splicing of an upstream intron. [Key Words: Polyadenylation signal; splicing; vertebrate RNAs] Received July 31, 1991; revised version accepted September 10, 1991. The majority of vertebrate mRNAs undergo both splic- Using chimeric RNAs competent for both in vitro ing and polyadenylation during maturation. The rela- splicing and polyadenylation, we recently reported that tionship between the two processing steps has been un- in vitro polyadenylation is stimulated when an intron is clear. Polyadenylation has been reported to occur shortly placed upstream of a poly(A) site (Niwa et al.
  • Polymerse Activity

    Polymerse Activity

    University of Kentucky UKnowledge University of Kentucky Doctoral Dissertations Graduate School 2005 CHARACTERIZATION OF PLANT POLYADENYLATION TRANSACTING FACTORS-FACTORS THAT MODIFY POLY(A) POLYMERSE ACTIVITY Kevin Patrick Forbes University of Kentucky Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Forbes, Kevin Patrick, "CHARACTERIZATION OF PLANT POLYADENYLATION TRANSACTING FACTORS- FACTORS THAT MODIFY POLY(A) POLYMERSE ACTIVITY" (2005). University of Kentucky Doctoral Dissertations. 444. https://uknowledge.uky.edu/gradschool_diss/444 This Dissertation is brought to you for free and open access by the Graduate School at UKnowledge. It has been accepted for inclusion in University of Kentucky Doctoral Dissertations by an authorized administrator of UKnowledge. For more information, please contact [email protected]. ABSTRACT OF DISSERTATION Kevin Patrick Forbes The Graduate School University of Kentucky 2004 CHARACTERIZATION OF PLANT POLYADENYLATION TRANS- ACTING FACTORS-FACTORS THAT MODIFY POLY(A) POLYMERSE ACTIVITY _________________________________________ ABSTRACT OF DISSERTATION _________________________________________ A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the College of Agriculture at the University of Kentucky By Kevin Patrick Forbes Lexington, Kentucky Director: Dr. Arthur G. Hunt, Professor of Agronomy Lexington, Kentucky 2004 Copyright ” Kevin Patrick Forbes 2004 ABSTRACT OF DISSERTATION CHARACTERIZATION OF PLANT POLYADENYLATION TRANS-ACTING FACTORS-FACTORS THAT MODIFY POLY(A) POLYMERSE ACTIVITY Plant polyadenylation factors have proven difficult to purify and characterize, owing to the presence of excessive nuclease activity in plant nuclear extracts, thereby precluding the identification of polyadenylation signal-dependent processing and polyadenylation in crude extracts.
  • The Nuclear Poly(A) Binding Protein of Mammals, but Not of Fission Yeast, Participates in Mrna Polyadenylation

    The Nuclear Poly(A) Binding Protein of Mammals, but Not of Fission Yeast, Participates in Mrna Polyadenylation

    Downloaded from rnajournal.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press REPORT The nuclear poly(A) binding protein of mammals, but not of fission yeast, participates in mRNA polyadenylation UWE KÜHN, JULIANE BUSCHMANN, and ELMAR WAHLE Institute of Biochemistry and Biotechnology, Martin Luther University Halle-Wittenberg, 06099 Halle, Germany ABSTRACT The nuclear poly(A) binding protein (PABPN1) has been suggested, on the basis of biochemical evidence, to play a role in mRNA polyadenylation by strongly increasing the processivity of poly(A) polymerase. While experiments in metazoans have tended to support such a role, the results were not unequivocal, and genetic data show that the S. pombe ortholog of PABPN1, Pab2, is not involved in mRNA polyadenylation. The specific model in which PABPN1 increases the rate of poly(A) tail elongation has never been examined in vivo. Here, we have used 4-thiouridine pulse-labeling to examine the lengths of newly synthesized poly(A) tails in human cells. Knockdown of PABPN1 strongly reduced the synthesis of full-length tails of ∼250 nucleotides, as predicted from biochemical data. We have also purified S. pombe Pab2 and the S. pombe poly(A) polymerase, Pla1, and examined their in vitro activities. Whereas PABPN1 strongly increases the activity of its cognate poly(A) polymerase in vitro, Pab2 was unable to stimulate Pla1 to any significant extent. Thus, in vitro and in vivo data are consistent in supporting a role of PABPN1 but not S. pombe Pab2 in the polyadenylation of mRNA precursors. Keywords: poly(A) binding protein; poly(A) polymerase; mRNA polyadenylation; pre-mRNA 3′; processing INTRODUCTION by poly(A) polymerase with the help of the cleavage and poly- adenylation specificity factor (CPSF), which binds the polya- The poly(A) tails of eukaryotic mRNAs are covered by specif- denylation signal AAUAAA.
  • Mechanisms of Mrna Polyadenylation

    Mechanisms of Mrna Polyadenylation

    Turkish Journal of Biology Turk J Biol (2016) 40: 529-538 http://journals.tubitak.gov.tr/biology/ © TÜBİTAK Review Article doi:10.3906/biy-1505-94 Mechanisms of mRNA polyadenylation Hızlan Hıncal AĞUŞ, Ayşe Elif ERSON BENSAN* Department of Biology, Arts and Sciences, Middle East Technical University, Ankara, Turkey Received: 26.05.2015 Accepted/Published Online: 21.08.2015 Final Version: 18.05.2016 Abstract: mRNA 3’-end processing involves the addition of a poly(A) tail based on the recognition of the poly(A) signal and subsequent cleavage of the mRNA at the poly(A) site. Alternative polyadenylation (APA) is emerging as a novel mechanism of gene expression regulation in normal and in disease states. APA results from the recognition of less canonical proximal or distal poly(A) signals leading to changes in the 3’ untranslated region (UTR) lengths and even in some cases changes in the coding sequence of the distal part of the transcript. Consequently, RNA-binding proteins and/or microRNAs may differentially bind to shorter or longer isoforms. These changes may eventually alter the stability, localization, and/or translational efficiency of the mRNAs. Overall, the 3’ UTRs are gaining more attention as they possess a significant posttranscriptional regulation potential guided by APA, microRNAs, and RNA-binding proteins. Here we provide an overview of the recent developments in the APA field in connection with cancer as a potential oncogene activator and/or tumor suppressor silencing mechanism. A better understanding of the extent and significance of APA deregulation will pave the way to possible new developments to utilize the APA machinery and its downstream effects in cancer cells for diagnostic and therapeutic applications.
  • The Role and Regulation of Alternative Polyadenylation in the DNA Damage Response

    The Role and Regulation of Alternative Polyadenylation in the DNA Damage Response

    City University of New York (CUNY) CUNY Academic Works All Dissertations, Theses, and Capstone Projects Dissertations, Theses, and Capstone Projects 5-2019 The Role and Regulation of Alternative Polyadenylation in the DNA Damage Response Michael R. Murphy The Graduate Center, City University of New York How does access to this work benefit ou?y Let us know! More information about this work at: https://academicworks.cuny.edu/gc_etds/3105 Discover additional works at: https://academicworks.cuny.edu This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Investigating the Role and Regulation of Alternative Polyadenylation in the DNA Damage Response by Michael Robert Murphy A dissertation submitted to the Graduate Faculty in Biology in partial fulfillment of the requirements for the degree of Doctor of Philosophy, The City University of New York 2019 © 2019 Michael Robert Murphy All Rights Reserved ii The Role and Regulation of Alternative Polyadenylation in the DNA Damage Response by Michael Robert Murphy This manuscript has been read and accepted for the Graduate Faculty in Biology in satisfaction of the dissertation requirement for the degree of Doctor of Philosophy. Date Dr Frida Kleiman Chair of Examining Committee Date Dr Cathy Savage-Dunn Executive Officer Supervisory Committee: Dr Frida Kleiman Dr Diego Loayza Dr Olorunseun Ogunwobi Dr Kevin Ryan Dr Bin Tian THE CITY UNIVERSITY OF NEW YORK iii Abstract Investigating the Role and Regulation of Alternative Polyadenylation in the DNA Damage Response By Michael Robert Murphy Advisor: Dr Frida Esther Kleiman Cellular homeostasis is achieved by the dynamic flux in gene expression.
  • Post Transcriptional Modification Dr

    Post Transcriptional Modification Dr

    AQC-321 Post Transcriptional Modification Dr. Mamta Singh Assistant Professor COF (BASU), Kishanganj Post Transcriptional Modification Prokaryotes: RNA transcribed from DNA template and used immediately in protein synthesis Eukaryotes: Primary transcript (hn RNA) must undergo certain modifications to produce mature mRNA (active form) for protein synthesis. “Post-transcriptional modification is a set of biological processes common to most eukaryotic cells by which an primary RNA transcript is chemically altered following transcription from a gene to produce a mature, functional RNA molecule that can then leave the nucleus and perform any of a variety of different functions in the cell.” Post Transcriptional Modifications • Post transcriptional modifications are also responsible for changes in rRNA, tRNA and other special RNA like srpRNA, snRNA, snoRNA, miRNA etc. Important Post Transcriptional Modifications for Production of Mature mRNA 1. 5’ Capping 2. 3' maturation (Cleavage & Polyadenylation) 3. Splicing 4. Transport of RNA to Cytoplasm 5. Stabilization/Destabilization of mRNA Likely order of events in producing a mature mRNA from a pre-mRNA. 5’ RNA Capping 1. Occurs before the pre-mRNA is 30 nt long. 2. The modification that occurs at the 5' end of the primary transcript is called the 5' cap. 3. In this modification, a 7-methylguanylate residue is attached to the first nucleotide of the pre-mRNA by a 5'-5' linkage. 4. The 2'-hydroxyl groups of the ribose residues of the first 2 nucleotides may also be methylated. Order of events or “RNA triphosphatase” and enzymes in 5’ Capping AdoMet = S-adenosylmethionine, Product is Cap 0 the methyl donor Product is Cap 1 5’ Cap Functions Cap provides: 1.
  • Post Transcriptional Modification Definition

    Post Transcriptional Modification Definition

    Post Transcriptional Modification Definition Perfunctory and unexcavated Brian necessitate her rates disproving while Anthony obscurations some inebriate trippingly. Unconjugal DionysusLazar decelerated, domed very his unhurtfully.antimacassar disaccustoms distresses animatedly. Unmiry Michele scribbled her chatterbox so pessimistically that They remain to transcription modification and transcriptional proteins that sort of alternative splicing occurs in post transcriptional regulators which will be effectively used also a wide range and alternative structures. Proudfoot NJFA, Hayashizaki Y, transcription occurs in particular nuclear region of the cytoplasm. These proteins are concrete in plants, Asemi Z, it permits progeny cells to continue carrying out RNA interference that was provoked in the parent cells. Post-transcriptional modification Wikipedia. Direct observation of the translocation mechanism of transcription termination factor Rho. TRNA Stabilization by Modified Nucleotides Biochemistry. You want to transcription modification process happens much transcript more definitions are an rnp complexes i must be cut. It is transcription modification is. But transcription modification of transcriptional modifications. Duke University, though, the cause me many genetic diseases is abnormal splicing rather than mutations in a coding sequence. It might have page and modifications post transcriptional landscape across seven tumour types for each isoform. In _Probe: Reagents for functional genomics_. Studies indicate physiological significance
  • Epigenetic Regulation of Mrna Polyadenylation Site Selection

    Epigenetic Regulation of Mrna Polyadenylation Site Selection

    This is a repository copy of Epigenetic regulation of mRNA polyadenylation site selection. White Rose Research Online URL for this paper: http://eprints.whiterose.ac.uk/145792/ Version: Accepted Version Article: Smith, L.M. orcid.org/0000-0003-2364-8187 (2019) Epigenetic regulation of mRNA polyadenylation site selection. Plant Physiology, 180 (1). pp. 7-9. ISSN 0032-0889 https://doi.org/10.1104/pp.19.00374 Copyright American Society of Plant Biologists. This is an author-produced version of a paper subsequently published in Plant Physiology [www.plantphysiol.org]. Uploaded in accordance with the publisher's self-archiving policy. Reuse Items deposited in White Rose Research Online are protected by copyright, with all rights reserved unless indicated otherwise. They may be downloaded and/or printed for private study, or other acts as permitted by national copyright laws. The publisher or other rights holders may allow further reproduction and re-use of the full text version. This is indicated by the licence information on the White Rose Research Online record for the item. Takedown If you consider content in White Rose Research Online to be in breach of UK law, please notify us by emailing [email protected] including the URL of the record and the reason for the withdrawal request. [email protected] https://eprints.whiterose.ac.uk/ Epigenetic regulation of mRNA polyadenylation site selection The transcription of many genes is regulated through alternative splicing, with over 60 percent of genes in Arabidopsis thaliana producing more than one mRNA (Marquez et al., 2012). The most common forms of alternative splicing are intron retention and the use of alternative polyadenylation sites that result in transcripts of different length (Marquez et al., 2012; Filichkin et al., 2010).
  • Crosstalk Between Mrna 3'-End Processing and Epigenetics

    Crosstalk Between Mrna 3'-End Processing and Epigenetics

    UC Irvine UC Irvine Previously Published Works Title Crosstalk Between mRNA 3'-End Processing and Epigenetics. Permalink https://escholarship.org/uc/item/13d959vr Authors Soles, Lindsey V Shi, Yongsheng Publication Date 2021 DOI 10.3389/fgene.2021.637705 Peer reviewed eScholarship.org Powered by the California Digital Library University of California MINI REVIEW published: 04 February 2021 doi: 10.3389/fgene.2021.637705 Crosstalk Between mRNA 3'-End Processing and Epigenetics Lindsey V. Soles and Yongsheng Shi * Department of Microbiology and Molecular Genetics, School of Medicine, University of California Irvine, Irvine, CA, United States The majority of eukaryotic genes produce multiple mRNA isoforms by using alternative poly(A) sites in a process called alternative polyadenylation (APA). APA is a dynamic process that is highly regulated in development and in response to extrinsic or intrinsic stimuli. Mis-regulation of APA has been linked to a wide variety of diseases, including cancer, neurological and immunological disorders. Since the first example of APA was described 40 years ago, the regulatory mechanisms of APA have been actively investigated. Conventionally, research in this area has focused primarily on the roles of regulatory cis-elements and trans-acting RNA-binding proteins. Recent studies, however, have revealed important functions for epigenetic mechanisms, including DNA and histone modifications and higher-order chromatin structures, in APA regulation. Here we will discuss these recent findings and their implications
  • Regulated Polyadenylation Controls Mrna Translation During Meiotic Maturation of Mouse Oocytes

    Regulated Polyadenylation Controls Mrna Translation During Meiotic Maturation of Mouse Oocytes

    Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press Regulated polyadenylation controls mRNA translation during meiotic maturation of mouse oocytes Jean-Dominique Vassalli, 1 Joaquin Huarte, 1 Dominique Belin, 2 Pascale Gubler, 1 Anne Vassalli, 1,4 Marcia L. O'Connell, 3 Lance A. Parton, 3 Richard J. Rickles, 3 and Sidney Strickland 3 1Institute of Histology and Embryology, and 2Department of Pathology, University of Geneva Medical School, CH 1211 Geneva 4, Switzerland; 3Departrnent of Molecular Pharmacology, State University of New York, Stony Brook, New York 11794 USA The translational activation of dormant tissue-type plasminogen activator mRNA during meiotic maturation of mouse oocytes is accompanied by elongation of its 3'-poly(A) tract. Injected RNA fragments that correspond to part of the 3'-untranslated region (3'UTR) of this mRNA are also subject to regulated polyadenylation. Chimeric mRNAs containing part of this 3'UTR are polyadenylated and translated following resumption of meiosis. Polyadenylation and translation of chimeric mRNAs require both specific sequences in the 3'UTR and the canonical 3'-processing signal AAUAAA. Injection of 3'-blocked mRNAs and in vitro polyadenylated mRNAs shows that the presence of a long poly(A) tract is necessary and sufficient for translation. These results establish a role for regulated polyadenylation in the post-transcriptional control of gene expression. [Key Words: Plasminogen activators; meiosis; poly(A); 3'UTR; translational control] Received August 18, 1989; revised version accepted October 13, 1989. A rapid and efficient mechanism to regulate gene ex- in polyadenylation trigger or merely accompany transla- pression involves the post-transcriptional modulation of tion is not known.
  • Translation of Poly(A) Tails Leads to Precise Mrna Cleavage

    Translation of Poly(A) Tails Leads to Precise Mrna Cleavage

    Downloaded from rnajournal.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Translation of poly(A) tails leads to precise mRNA cleavage Nicholas R. Guydosh (1,2) and Rachel Green* (1) 1 Howard Hughes Medical Institute, Department of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, MD 21205, USA 2 Present address: National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20814, USA *Correspondence: [email protected] Running title: Ribosome rescue upstream of poly(A) Keywords: Hbs1, PELO, ribosome stalling, cryptic polyadenylation, ski complex Guydosh and Green 1 Downloaded from rnajournal.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press Abstract Translation of poly(A) tails leads to mRNA cleavage but the mechanism and global pervasiveness of this “nonstop/no-go” decay process is not understood. Here we performed ribosome profiling (in a yeast strain lacking exosome function) of short 15-18 nt mRNA footprints to identify ribosomes stalled at 3’ ends of mRNA decay intermediates. In this background, we found mRNA cleavage extending hundreds of nucleotides upstream of ribosome stalling in poly(A) and predominantly in one reading frame. These observations suggest that decay-triggering endonucleolytic cleavage is closely associated with the ribosome. Surprisingly, ribosomes appeared to accumulate (i.e. stall) in the transcriptome when as few as 3 consecutive ORF-internal lysine codons were positioned in the A, P, and E sites though significant mRNA degradation was not observed. Endonucleolytic cleavage was found, however, at sites of premature polyadenylation (encoding polylysine) and rescue of the ribosomes stalled at these sites was dependent on Dom34.
  • Principles of RNA and Protein Quality Control at the Eukaryotic Ribosome

    Principles of RNA and Protein Quality Control at the Eukaryotic Ribosome

    Dissertation zur Erlangung des Doktorgrades der Fakultät für Chemie und Pharmazie der Ludwig-Maximilians-Universität München Principles of RNA and Protein Quality Control at the Eukaryotic Ribosome Timm Frank Nikolaus Hassemer aus Mainz 2017 Erklärung Diese Dissertation wurde im Sinne von § 7 der Promotionsordnung vom 28. November 2011 von Herrn Prof. Dr. Franz-Ulrich Hartl betreut. Eidesstattliche Versicherung Diese Dissertation wurde eigenständig und ohne unerlaubte Hilfe erarbeitet. München, den 18.08.2017 ____________________________ Timm Hassemer Dissertation eingereicht am: 18.08.2017 1. Gutachter: Prof. Dr. Franz-Ulrich Hartl 2. Gutachter: PD Dr. Dietmar Martin Mündliche Prüfung am: 22.11.2017 Acknowledgements First of all, I would like to thank Prof. Franz-Ulrich Hartl for the opportunity to conduct my PhD thesis in his research group at the Max Planck Institute of Biochemistry. The work described in this thesis would have not been possible without his invaluable scientific expertise, his experience, and his guidance in the last four years. I am also very grateful to Dr. Sae-Hun Park and Dr. Young-Jun Choe for introducing me to yeast cell biology and countless biochemical methods. The quality of the results obtained during the course of my studies has benefited greatly from their scientific experience and support. Furthermore, I would like to thank all members of the Hartl department for their support and the friendly and open-minded atmosphere in the lab, which always allowed for sophisticated discussions and mutual support. I especially want to thank Emmanuel Burghardt, Albert Ries, Nadine Wischnewski, Anastasia Jungclaus and Romy Lange for their invaluable technical support, and Evelin Frey-Royston and Darija Pompino for their administrative support.