Spermatogenetic Defects in Mouse Hybrids

MASARYK UNIVERSITY

FACULTY OF SCIENCE

DEPARTMENT OF BOTANY AND ZOOLOGY

Spermatogenetic defects in mouse hybrids

PhD. Dissertation

Iva Martincová

Supervisor: Prom . biol. Jaroslav Piálek CSc.

Institute of Vertebrate Biology, Czech Academy of Science

Brno, 2019

Bibliographic Entry:

Aut h or: Mgr. Iva Martincová

Faculty of Science, Masaryk University

Department of Botany and Zoology

Title of Thesis: Sp ermatogenetic defects in mice hybrids

Degree programe: Biology

Field of Study: Zoology

Supervisor: Prom. biol. Jaroslav Piálek CSc.

Institute of Vertebrate Biology, Czech Academy of Sciences

Academic year: 2018/2019

Number of pages: 146

Key words: Mus musculus musculus , Mus musculus domesticus , X chromosome, Y chromosome, hybrid sterility, wild - derived strains, phenotype variation, sperm heads, Y introgression

Bibliografický záznam:

Autor: Mgr. Iva Martincová

Přírodovědecká fakulta, Masarykova univerzita

Ústav botaniky a zoologie

Název práce: Poruchy spermatogeneze u hybridních samců myší

Studinjí program: Biologie

Studijní obor: Zoologie

Školitel: Prom. biol. Jaroslav Piálek CSc.

Ústav biologie obratlovců, Akademie Věd České Republiky.

Akademický rok: 2018/2019

Počet stránek: 146

Klíčová slova: Mus musculus musculus , Mus musculus domesticus , X chromosome, Y chromosome, hybrid sterility, wild - derived strains, phenotype variation, sperm heads, Y introgr ession

Abstract

The hybrid zone between two house mouse subspecies, Mus musculus musculus and M. m. domesticus , which diverged 0.5 MY ago, is thought to be a tension zone, maintained by a balance between migration of parental genomes into the area of the hybrid zone and by selection against hybrids. The selection is driven by the decreased fertility of hybrids. Thus these two subspecies represent an invaluable model for speciation studies. In this thesis I present the results from four papers conducted both in situ in the hybrid zone and under controlled laboratory condition s . The minor part of the results is focused on the effect of chromosome X on the fertility of hybrids, which seems to be well described elsewhere . However, in our study the position and role of a new X associated locus Hstx2 and three autosomal loci, polymorphic in M. m. musculus , which contribute to asymmetric hybrid sterility are described. The main focus of the thesis is concerned with the effec t of Y chromosome to male fitness, which has been rather neglected up to now. Firstly, the behaviour of M. m. musculus Y chromosome in the hybrid zone is examined. We discovered that the asymmetric introgression of M. m. musculus Y across the hybrid zone i nto M. m. domesticus territory is not restricted only to the Czech - Bavarian hybrid zone area , but is a common phenomenon in central Europe. The possible mechanisms of the Y chromosome spread across the hybrid zone are suggested by two studies utilising exp erimental crosses of strains derived from natural house mouse populations. In both studies we found a significant difference in the sperm quality in hybrid males possessing the Y chromosome from M. m. musculus and M. m. domesticus . In general, the hybrids carrying the M. m. domesticus Y chromosome display ed a higher incidence of sperm heads dissociated from the tail. We concluded that those differences are associated with the X chromosome and modulated by interaction with the Y chromosome. Given that these effects are strengthened in promiscuous species due to male - male competition, they can contribute to reproductive barriers and thus to speciation.

Abstrakt

Hybridní zóna mezi dvěma poddruhy myši domácí, Mus musculus musculus a M. m. domesticus , které se od společného předka oddělily před půl milionem let, je považována za tenzní hybridní zónu, udžovanou migrací rodičovských genomů do oblasti hybridní zóny a selekcí proti hybridům. Selekce je asociována se sníženou plodností hybridů. To dělá z tě chto dvou poddruhů neocenitelný model pro studium speciace. V této práci představuji výsledky ze čtyř studií , které byly provedeny jak in situ v hybridní zóně, tak v řízených laboratorních podmínkách. Menší část výsledků se týká vlivu chromozomu X na ferti litu hydridů, který se jeví být dobře zdokumentován. Přesto jsme v naší studii popsali pozici a roli nového lokusu Hstx2 na chromozomu X a tří autozomálních lokusů, polymorfních v populaci M. m. musculus , které přispívají k asymetrii hybridní sterility. Vě tší část práce je věnována dosud spíš opomíjenému vlivu chromozomu Y na plodnost samců. Nejprve jsme se zaměřili na chování chromozomu Y v hybridní zóně. Zjistili jsme že asymetrická introgrese chromozomu Y M. m. musculus na území M. m. domesticus není ome zena pouze na Česko - Bavorskou část hybridní zóny. Zdá se, že k tomuto jevu dochází ve střední Evropě běžně. Mechanismus, který může přispívat k šíření chromosomu Y přes hybridní zónu, byl naznačen dvěma studiemi, využívajícími experimentální křížení kmenů odvozených z divokých populací myši domácí. V obou studiích jsme zjistili podstatné rozdíly v kvalitě spermií mezi hybridy nesoucími chromozom Y původu M. m. musculus a M. m. domesticus . Obecně lze říci, že hybridi s chromozomem Y z poddruhu M. m. domestic us trpí zvýšeným výskytem spermií s disociovaným bičíkem. Z výsledků jsme vyvodili, že tyto rozdíly jsou asociovány s chromozomem X, ale jsou modulovány jeho interakcí s chromozomem Y. V situaci, kdy jsou tyto vlivy posilovány kompeticí mezi samci u promis kuitních druhů, mohou přispívat k posílení reprodukčích bariér a ke vzniku nových druhů.

Acknowledgement

Firstly , I would like to thank to my supervisor Jaroslav Piálek , who has taught me how to be a scientist. He has also enabled me to gain invaluable skills in managing, organizing and surviving. Many thanks also belong to Miloš Macholán who helped me to carry this burden.

I want to thank the amazing collective in Stude nec, Institute of Vertebrate Biology CAS, the place which can hardly be compare d with anything else. Here I spent my best years.

I would like to thank all people who helped me with the thesis. They know.

Many thanks belong to my friends, who always accep ted all those crazy scientific things I’ve been doing. Special thanks to my family which supported me all the time.

Last but not least, great thank to all those mice which sacrificed their lives on altar of science.

The PhD thesis was supported by fundi ng of Czech Grant Agency. Project numbers: GA206/08/0640 , 17 - 25320S , and 19 - 12774S

Declaration

I declare that I elaborate the dissertation thesis on my own, with the usage of information sources, referenced in the thesis.

Brno, 14 th June 2019 Iva Martincová

Contents

Preface ...... 19 Introduction ...... 21 Speciation ...... 21 “Two rules of speciation” ...... 21 Speciation genes ...... 23 Model organisms for speciation studies ...... 24 House mouse ( Mus musculus ) ...... 25 House mouse hybrid zone ...... 25 Aims of th e thesis ...... 27 What can the house mouse hybrid zone tell us about speciation? ...... 28 The large X - effect in the hybrid zone ...... 28 Haldane’s rule in the hybrid zone ...... 29 What can laboratory experiments on mice tell us about speciation? ...... 32 The laboratory evidence of large X - effect ...... 32 Laboratory evidence of Y chromosome effect to male fitness ...... 35 Summary ...... 42 Reference s ...... 44 Paper I ………………………………………………………………………………………………………………………………… …. 5 3

Paper II ………………………………………………………………………………………………………………………… 83

Paper III ……………………………………………………………………………………… ……………………………..10 1

Paper IV ……………………………………………… ……………………………………………………………………………….. 11 7

List of conferences …………………………………………………………………………………………………… ..1 45

Preface

From the earliest time scientists start to ask a question how the animal species (including humans) came into being. During human history, many theories arose and vanished. Nowadays, the theory of evolution is generally accepted. It explains the origin of new species as a conse quence of natural selection. However simple and elegant the theory is , detailed knowledge about the mechanisms leading to new species origin still remain unclear. This thesis is addressed to research of the reproductive barriers between two European subspe cies of house mouse ( Mus musculus ), which present an invaluable model for evolutionary studies.

The presented thesis comprises of four papers P aper I ( Bhattacharyya et al., 2014 ) and paper III ( Martincová et al, 2019 ) have already been published in peer rev iew journals. P aper IV ( Martincová et al, submitted ) has been submitted and is under review process. P aper II ( Macholán et al, in preparation ) is presented in the form of manuscript in preparation , but with small improvements it will be submitted in the near future. All data were produced and analysed during the authors ’ PhD studies.

The thesis contains an introductory part concerning general knowledge about speciation. Then it refers to the house mouse and its suitability for use as a model organism for evolutionary research. Continuously the contribution of the house mouse to speciation studies is discussed, while results of the attached papers are integrated to relevant places in the text. The last part of the main t ext summarise s the results of the at tached papers. The thesis is supplemented by the presented papers, a complete list of authors publications and a list of contributions to international and domestic conferences.

List of papers included in the thesis and authors ’ contribution s

Paper I

Mac holán M., Baird S. J. B., Fornůsková A., Martincová I. , Rubík P., Munclinger P., Ďureje Ľ., Heitlinger E., Tucker P. - K., Piálek J. (manuscript in preparation for Molecular Ecology ). Scan of the house mouse hybrid zone reveals widespread introgression of the Mus musculus musculus Y chromosome in Central Europe

IM significantly participated in data collection /sampling. IM optimized the microsate llite multiplex , performed a part of micro satellite analysis and wrote the relevant part of the manuscript.

Paper II

Bhattacharyya T., Reifová R., Gregorová S., Šimeček P., Gergelitis V., Mistřík M., Martincová I. , Piálek J., Forejt J. (2014). X chromosome control of meiotic chromosome synapsis in mouse inter - subspecific hybrids. PLOS Genetics , 10(2), e1004088

IM conducted experimental crosses outside SPF breeding facility and collected sample from them.

Paper III

Martincová I. , Ďureje Ľ., Kreisinger J., Macholán M., Piálek J. (2019). Phenotypi c effects of the Y chromosome are variable and structured in hybrids among house mouse recombinant lines. Ecology and Evolution ; 9:6124 – 6137

IM performed the experimental crossing, animal maintenance, data collection, graphical visualisation, pa rt of the s tatistical analyses and prepared a major part of the manuscript.

Paper IV

Martincová I. , Ďureje Ľ., Baird S. J. E., Piálek J. (submitted in Mammalian Genome ). Sperm quality parameters are increased and asymmetric in house mouse hybrids.

IM performed data collection and graphical visualisation. IM participated in statistical analyses and manuscript preparation.

Introduction

Speciation

Species origin is nature ’s enigma which has engaged generations of scientists up to the present time . Mayr’s definition of species says that “species are groups of interbreeding natural populations that are reproductively isolated from other such groups” (Mayr, 194 2 ) . This definition indicates that speciation is driven by development of reproducti ve barriers , leading to re productive isolation . Mechanisms responsible for reproductive isolation are either prezygotic, preventing or igin of the hybrid zygote , or postzygotic, decreasing the probability that the hybrid zygote develop s in an adult and fertile individual ( Coyne & Orr, 1998) .

Postzygotic reproductive isolation in the early stage of speciation typically manifests itself as hybrid infertility . Later , with increased divergence of taxa involved in mating, it is followed by hybrid inviability, then gametes incompatibility and finally by prezygotic isolation. This thesis is aimed at research of hybrid infertility/sterility, associated with gene incompatibilities.

Although d etails of molecular mechanisms of hybrid sterility are generally still not completely understood , basic genetic princip l e s of speciation were postulated in the first half of the twentieth century. A simplified model of postzygotic isolation caused by gene incompatibilities was independently proposed by Wi l liam Bateson (Bateson, 1909) , Theodosius Dobzhansky (Dobzhans ky, 1937) and Herman n Muller (Muller, 1942) (the Bateson - Dobzhansky - Muller model of incompatibilities , BDMI model ). According to the BDMI model, different gene mutations accumulate over time in geographically isolat ed populations of one species and hence, when those populat ions come into contact again, new gene c ombinations are incompatible. Importantly, in this case , functions linked with reproduction are affected first .

“Two rules of speciation” The evolution of hybrid sterility is dominated by two “rules”. The first one is Haldane ’s rule which states that if hybrid progeny is affected by decreased fertility or sterility, the more affected sex is the heterogametic sex (Haldane, 1922) . According to Presgraves

(Presgraves, 2008) this rule holds in 95% of Drosophila species, 100% of mammalian species, 97% of bird species and 96% of butterfly species . The second rule is the large X - effect ( Co yne & Orr, 1989) referring to the disproportionately large role of the X chromosome in hybrid incompatibilities.

Almost all proposed causes of the “two rules of speciation” rest on the intriguing nature of sex chromosome s . The X chromosome has special properties which could play a role in intrinsic postzygotic isolation as it is hemizygous and commonly involved in sex determination. There are a variety of explanations for both “speciation rules”. The main ones are introduce d in the next paragra phs (for review see Coyne, 2018) .

1. According to the “dominance” or “recessivity theory” the disruption of fertility in male - heterogametic taxa results from the predominantly recessive nature of hybrid incompatibility alleles (Masly & Presgraves, 2007) . The recessive alleles, whose effect is masked in heterozygous hybrids, manifest themselves as dominant in the hemiz y gous sex with a single copy of the X ch romosome. 2. There are theories based on “di sproportional placement” of genes on the X chromosome. Evidence obtained from Drosophila showed that their X chromosome harbour a higher density of genes involved in hybrid incompatibilities (Tao et al., 2003 , Masly & Presgraves, 2007) . In such case s we see the large X - effect. The more rapid movement of ge nes between autosomes and X chromosome than between autosomes themselves was suggested by Moyle et al ( 2010) 3. The “faster - X theory” expects faster gene evolution on the X chromosome. It is caused by more frequent fixation of beneficial recessive alleles on X compare d with aut osomes due to lower effective population size of sex chromosomes (Charlesworth et al. , 1987) and hence it can lead to both the large - X effect and to Haldane’ s rule. Also, genes causing “meiotic drive” via genomic conflict evolve more often on sex chromosomes than on autosomes (Frank, 1991 , Hurst & Pomiankowski, 1991) . 4. Some theories employ the special characteristics of sex chromosomes. Those characteristics include: the degeneracy of the Y (or W) chromosome (Charlesworth & Charlesworth, 2000 , Filatov, 2018) , transcriptional inactivation of X

chromosom e during meiosis (Lifschytz & Lindsley, 1972 , Larson et al. 2017) and the dosage compensation (Brockdorff & Turner, 2015 , Lucchesi & Kuroda, 2015) . Mechanisms responsible for proper X inactivation and dosage compensation could both be disrupted in hybrids. 5. The only theory which can explain Haldane’ s rule without employing large X - effect is the theory of “faster males”. This suggests that due to intense sexual selection among males , the anticipated rate of genes participating in males reproduction features is greater than in females (Wu & Davis, 1993 , True et al. , 1996) . Gene rally, the spermatogenesis seems to be more susceptible to failure, than oogenesis (Hunt & Hassold, 2002) .

Speciation genes W hen compared with unviability, the d ecreased fertility of hybrids is observed more frequently in nature . Moreover hybrid sterility is evolving faster than hybrid unviability (Orr & Presgraves, 2000 , Coyne et al., 2004) . Genes responsible for decrease d fertility via the BDMI model are often called “speciation genes”. However, as speciation genes were described basically on Drosophila and the house mouse ( Mus musculus ) (Orr et al. , 2004 , Mihola et al , 2009) our understanding on their mechanisms and function is limited.

The first identified animal s peciation gene is called Od ysseus site homeobox ( Ods ) . It is located on the chromosome X of Drosophila , en coding homeobox transcriptional factor called OdsH (Pe rez et al., 1993) . Subsequently , other genes contributing to hybrid sterility or lethality were identified: Hmr (Barbash et al. , 2000) , nucleoporins Nup160 and Nup90 (Barbash, 2007) , JYAplha (Masly et al., 2006) , Overdrive (Phadnis & Orr, 2009) , agt and taf (Liénard et al., 2016) .

In mammals, only one gene of hybrid sterility has been identified as yet. It is locus Hst1 ( Hybrid Sterility 1 ) on t he proximal part of chromosome 17 which causes the break of spermatogenesis in cross es between two house mouse subspecies, Mus musculus musculus and M. m. domesticus . Originally this locus was documented using a classical laboratory strain C57BL/10 and wild house mice caught in Prague (Iványi et al., 1969 , Forejt & Iványi, 1974) . Subsequently a candidate locus for Hst1 was identified as the

Prdm9 ( PR domain containing 9 ) gene that is expressed in testes (Mihola et al., 2009) . Prdm9 primarily controls re combination hotspots in mammals (Parvanov et al. , 2010)

Model organisms for speciation studies For determination of genes/mechanisms responsible for reduced fertility it is crucial to choose a suitable model. The reason for this is the need to distinguish gene incompatibilities that initially cont ribute to reproductive barriers from those that arise after completion of speciation. The m ain body of our knowledge about hybrid sterility was obtained from research on fruit flies of the genus Drosophila (Coyne & Orr, 2004 , Masly & Presgraves, 2007) . However, although the sexes in Drosophila fruit flies carry the same sex chromosome as mammals, t he sex - determining mechanisms in mammals and in insects such as Drosophila are very different .

To select a proper mammal model, it will be beneficial rather to focus on (sub)species, that are in an initial state of speciation. For this purpose, the house mouse ( Mus musculus ) subspecies complex represent s an invaluable subject for such speciation res earch.

House mouse ( Mus musculus ) The house mouse ( Mus musculus ) is a small mammal of the order Rodentia. Aside from being a faithful human follower and pest, it represents also one of the most widely used laboratory animals in scientific research. Advantages of mice are obvious: mice are easy to keep, they don’t have any specific nutritional requirements, breed all year around , their generation time is short, and they are tolerant to inbreeding (Silver, 1995 , Fox et al., 2006) . The first draft of the house mouse genome was published only one year after human genome sequence (Waterston et al., 2002) and high homology was discovered. All these factors determine the house mouse as an ideal model for biomedical research (Fox et al., 2006) .

In addition, house mice have also contributed substantially to evolutionary studies (Baird & Macholán, 2012) . The secondary hybrid zone between two house mouse subspecies , M. m. musculus and M. m. domesticus in Europe is, as with other hybrid zones, a “natural laboratory “ (Hewitt, 1988 ) , or a “ window on evolutionary process” (Harrison, 1990) .

House mouse hybrid zone The European house mouse hybrid zone (hereafter hybrid zone) is one of the best studied natural ly occurring hybrid zones . House mouse subspecies diverged from a common ancestor 0.5 – 1 mil years ago somewhere between Iran and Pakistan (Geraldes et al., 2008 , Duvaux et et al, 2011) . Afterwards, the two subspecies M. m. musculus ( musculus ) and M. m. domesticus ( domesticus ) colonized Europe following different routes. While m usculus migrated across the plains north of the Black Sea and now inhabit the north ern and eastern part of Europe, d omesticus moved through Asia Minor and eastern Mediterranean to the southern and western part of the continent (Cucchi et al., 2012) . Where they meet the two subspecies form a more than 2500 km long and only ~20km wide secondary hybrid zone stretching from Norway to Bulgaria (Jones et al., 2010, Ďureje et al., 2012 , Baird & Macholán, 2012 , Macholán et al. in prep aration ) (Fig. 1) . Within the hybrid zone decreased fertility of hybrids was detected manifested by low testis weight, sperm numbers and motility, and abnormal morphology of sperm heads ( Turner et al. , 2011 , Albrechtova et al., 2012) .

Fig. 1 The course of the M. m. domesticus / M. m. musculus hybrid zone in Europe ( violet line). In Scandinavia, the position is only tentative (dashed violet line). The map outline of Europe was modified from http://www.reddit.com.

The next paragraphs will discuss the contribution of house mice research to our knowledge of speciation, including papers presented as supplementary material of the thesis. The text is d ivided into chapters concern ing research performed both: directly in the hybrid zone, as well as under laboratory conditions. In each of those chapters the large X effect and Haldane’s rule are referred to separately. However, it may be difficult to distinguish their role (for detail s see Coyne, 2018) , as the precise molecul ar mechanisms are still unknown and such division is necessarily ar bitrary in many cases .

Aims of the thesis M echanisms and particular genes that cause hybrid sterility in house mice, appear to be well explored. However, a closer look reveals many gaps in our understanding . The predominance of studies, performed in this field, have focused on the effect s of chromosome X and its interactions with autosome s (e.g. with gene Prdm9 on chromosome 17) . However, the precise mechanisms are still the subject of intensive research . The effect of Y chromosome on decreased male fertility was rather neglected, with a few exceptions. The purpose of the thesis is to prov ide further information on those issues. The aims are specified as:

1. Particularise locus/loci and mechanisms of house m ouse hybrid sterility ruled by the chromosome X (Paper II). 2. Provide detailed information about a phenomenon of musculus Y chromosome intro gression in the central European part of house mouse hybrid zone (Paper I). 3. Explore possible mechanism of musculus Y chromosome spread across the house mouse hybrid zone (Papers III and IV).

What can the house mouse hybrid zone tell us about speciation?

The large X - effect in the hybrid zone As predicted by rules of speciation, sex chromosomes are expected to play a crucial role in reproductive isolation (Coyne & Orr, 200 4) . Consequently, X - and Y - linked incompatibilities will be under selection , hence the movement of sex chromosomes is expected to be impeded. Initial s tudies performed in the hybrid zone seem to verify this expectation.

For example , a s tudy performed in southern Germany and western Austria analysed differences between autosomal and sex chromosome linked loci (Tucker et al., 1992) . To describe patterns of loci mo vement across the hybrid zone, cline analysis fitting a gradient of diagnostic allelic frequencies between parental populations was used (Barton & Hewitt, 1985 , Bar ton & Gale, 1990) . Th is analysis transforms the allelic changes into zone width measures: the steeper the allele’s transition the narrower the hybrid zone. Using this approach, Tuck er et al. ( 1992) revealed that cline width differ for autosomes and sex chromosomes. When compared with autosomes showing large cline width , two X - linked loci showed a narrow abrupt cline indicating limited gene flow. A subsequent study analysed samples from the same area (Payseur et al., 2004) . This study was focused on X chromosome and 13 X - linked loci covering the whole length of the chromosome were incorporated into the analysis. Surprisingly , while the locus from the centre of X chromosome displayed a steep cline , and thus reduced gene flow, other loci showed a variety of introgression rates. Two of these loci ( Xist and Plp ) displayed high frequencies of M. m. domesticus alleles in M. m. musculus population, indicating that gene flow of the X chromosome may be asymmetrical . Results of this study pointed to the conclusion that the centre of the X chromosome can be critical for reproductive isolation of mice subspecies.

Sampling from other areas of the hybrid zone were also in agreement with the results from southern Germany. Reduction of gene flow from autosomal to centrally X - linked loci was described in the Czech - Bavarian tra nsect of the hybrid zone (Munclinger et al.,2002 , Macholán et al., 2007, 2011 , Dufková et al. , 2011) . A narrow and steep cline for locus in the centre of X chromosome ( DXPas2 ) were observed also in Denmark (Dod et al., 1993) .

In summary, these studies provide a consistent picture of the hybrid zone dynamics. Clines describing changes of allele frequencies in X chromosome are steep and narrow, especially when compare d with autosomal loci . In ad dition, markers located in the central region of the X chromosome appear to be under stronger selection than those on distal positions. Those results indicated that central part of the X chromosome may play an important role in the formation of reproductive barriers between the two house mouse subspecies.

Haldane’s rule in the hybrid zone As well as the X chromosome, the introgression of the Y chromosome was expected to be severely impeded in the hybrid zone. This expectation was confirmed by sev eral observations : the absence of Y chromosome introgression was reported in Bulgaria (Vanlerberghe et al., 1988) , northern Germany (Prager et al., 1997) and Denmark (Vanlerberghe et al., 1986 , Dod et al., 2005) .

This pattern seemed to be consistent along the whole course of the hybrid zone and partially corresponded with the behaviour of X chromosome markers. The consistency began to break up during research of the distribution of several autosomal and sex - linked markers across the Czech - Bavarian border and adjacent regions (Munclinger et al., 2002) . This study was the first to reveal gradual introgression of the musculus Y chromosome to the domesticus territory .

In a follow - up study, Macholán et al. (2008) verified this pattern using a larger dataset of samples from the same area . The authors described a triangular area of the musculus Y chromosome invasion, covering approximately 330 km 2 . This introgression was accompanied by a sex ratio change. While this ratio is female - biased in the musculus and domesticus regions wi thout Y introgression, the sex ratio is equal in the domesticus area with introgressed musculus Y chromosome. Moreover, a subsequent study, that included data from other replicates of hybrid zone, suggested this assymetric introgression might not be a rare phenomenon in Central Europe (Ďureje et al., 2012) .

The presence of musculus Y chromosome in domesticus territory was recently documented in Norway (Jones et al., 2010) . However, results i ncluding microsatellite analysis support a scenario that the invasive variant of a musculus Y chromosome in the

29 domesticus genome came from a different source than the musculus Y haplotype present in the musculus mice in the hybrid zone and consequently, c an’ t be a result of introgression across the hybrid zone (Jones & Searle, 2015) .

To elucidate the striking finding of Y chromosome introgression the reproductive ability of males with and without introgressed musculus Y chromosome was analysed in Czech - Bavarian transect (Albrechtova et al., 2012) . The authors discovered that , while sperm count was significantly reduced in hybrids, males with musculus Y chromosome on prevalently domesticus autosomal background displayed sperm count even higher than that of the “pure” parental domesticus subspecies.

Y chromosome can be transmitted only via males, but according to Haldane’s rule males should be affected by decreased fertility. Results from the Czech - Bavarian transect led to the hypothesis that the Y chromosome introgression is driven by ongoing genetic conflict between Y and X (and possibly several autosomal loci ). According to this presumption , the musc ulus Y chromosome perform successfully on the naïve domesticus background (Baird & Macholán, 2012) .

The recent data obtained in the Czech - Bavarian part of the hybrid zone begs a series of further questions. For example, how widespread is the introgression of the musculus Y chromosome on to domesticus genetic background? Are there differences in the extent of this introgression between distinct replicate s of the zone and if so, what is the reason for the se discrepancies? Or, to put it in other way, why are musculus Y´s not introgressing in other regions? Is there a single musculus Y chromosome haplotype which is advantageous and spreads in the non - native background, or vice versa is there a particular X/ autosomal background in the domesticus area that is susceptible to Y introgression?

To address these questions , a large - scale study embracing an  900 km long portion of the zone stretching from the Baltic Sea coast to the northern slopes of the Alps was conducted ( Macholán et al. in prep., Paper I ). The extensive material, consisting of 7270 mice captured at 804 localities , allowed the authors to detect a precise course of the zone as well as the extent of Y chromosome introgression throughout the whole study area. The s tudy show ed that musculus Y´s introgression into the domesticus range is overwhelming yet there are considerable differences between various regions (Fig. 2 ). Interestingly,

30 some musculus Y chromosomes were found as far as  50 km behind the zone centre. To test whether there is a single haplotype/haplogroup capable of breaking the subspecies barrier the authors employed 6 microsatellite loci and sequences of a 1,277 - bp fragment of the Sry gene including a part of the inverted repeated flanking region (see Mac holán et al., in prep aration , Paper I ). 888 males f r o m Czech - Bavarian and north - east Bavarian part of hybrid zone were analysed for microsatellites and 79 males from the whole Europe (including some classical laboratory strains) were sequenced for Sry gene. While sequencing revealed only two clusters of identical or almost identical Sry haplotypes ( musculus vs. domesticus ), the microsatellite analysis showed 353 unique h aplotypes , the commonest shared by 55 males . The domesticus part of dataset contains two wide spread main groups of ‘similar’ haplotypes , one restricted to the northern and western parts of the area u nder study and the other occurring in the central and southern parts . The musculus displayed three main groups, all of them present and merged in area of Y introgression. Other haplotypes in both po pulations were locally restricted. Thus it can be conclude d that there is no clear structuring across the study area and that there is not a single introgressing musculus Y haplotype/haplogroup distinct from others incapable of introgression. Details of th e microsatellite analysis are in Macholán et al. (in prep aration , Paper I).

Fig . 2 Map of the probability of each individual´s membership either to M. m. musculus (red colour) or to M. m. domesticus (light yellow) based on genotypes on the X chromosome and autosomal loci (a) and Y chromosomes (b) (details in Macholán et al. Paper I) . Black dots represent sampling places The level contours show the spatial changes in assignment values. The x and y coordinates are in degrees of eastern longitude and northe rn latitude, respectively. For comparison, the course of the zone inferred from the X chromosome and autosomal loci is shown as a bold blue line. The picture was created in software Geneland v. 4.0.6.

What can laboratory experiments on mice tell us about s peciation?

The l aboratory evidence of large X - effect Results obtained in the hybrid zone motivated scientists to study factors contributing to reduced fertility. D espite the hybrid zone represent ing a n excellent tool for speciation studies, the research of the hybrid zone in situ brings specific limits. F irst ly, F1 generation hybrids representing the initial phase of the secondary contact are absent or very rare in the hybrid zone, secondly, the life hi story of wil d - caught animals is unknown (e.g. age,

32 genealogy). Consequently, the main bulk of data was derived under controlled laboratory conditions.

Numerous evolutionary studies have employed classical laboratory strains. However, their usage is not ver y suitable for this purpose. Those strains, kept in laboratories for hundreds of generations, are in fact mixtures of three genomes originating from different subspecies (Yang et al., 2011) . Moreover, their haplotype diversity is low (Yang et al., 2011 , Chang et al., 2017) . More recently, scientists have begun to develop so - called wild - derived strains (WDS) ; newly derived from mice caught in nature (Bonhomme & Guénet, 1989 , Gregorová & Forejt, 2000 , Piálek et al., 2008) . This gives the possibility of including genetic diversity, present in natural populations, into crossing experiments (Guénet & Bonhomme, 2003) .

E arly evidence of the role of X chromosome in mice hybrid sterility came from crosses between strains representing two mouse species . The classical laboratory inbred strain C57BL/6J (hereafter B6, predominantly domesticus ) was used as a representative of th e house mouse. Backcrossing with Mus spretus revealed segregating hybrid sterility locus on X chromosome (Guénet et al., 1990) . Elliott et al. (2001) performed a more detailed study when they analysed the congenic strain B6.SPRET – Hprt a carrying a 17 cM segment of M. spretus X chromosome , which cause s low fertility associated with small testis weight .

Storchová et al. (2004) used a wild - derived strain in their experiment and documented that introgression of X chromosome from PWD strain (derived from musculus ) onto B6 genetic background led to hybrid sterility, manifested by decreased testis weight, sperm count and abnormal shape of sperm heads. The strongest effect was mapped to a locus in the centre of the X chromosome which was called Hstx1 ( X - linked hybrid sterility 1 ). Nevertheless, the authors suggested that to ensure full sterility at least one proximal and/or one distal region of X chromosome must also be involved.

Based on segregation proportions, two or three factors required for hybrid sterility wer e also suggested by Britton - Davidian et al. (200 5) . Interestingly, only one direction of cross produced males with decreased fertility, indicating that at least one of those factors is present on musculus X chromosome.

The effect of cross direction (i.e. musculus × domesticus and musculus × domesticu s ) was confirmed and extended by work of Good et al. (2008a) . The authors used four WDS, two derived from each subspecies. Crosses between musculus PWK females and domesticus males of the WSB and LEWES strains produced male offspring with significantly reduced sperm count and testis weight. The r eciprocal crosses involving PWK males produced hybri d males with normal reproductive phenotype s . On the other hand, both directions of crosses involving the musculus strain CZECH displayed a severe reduction of the fertility parameters scored. This suggests that the factor/factors responsible for hybrid sterility are associated with the musculus X chromosome and that they are polymorphic in musculus population. In a follow - up study quantitative trait loci (QTL) associated with decreased fertility were mapped (Good et al., 2008 a ) . At a minimum four X - linked factors were identified, including QTLs reducing testis weight and producing abnormal sperm heads. Phenotypic effects of those factors were largely additive and resulted in complete sterility when they were combi ned . S pecific intervals responsible for sperm heads abnormalities corresponded with the finding s of Oka et al. (2004) who identified such loci ( S perm h ead a bnormalities 1, Sha 2, Sha 3 ) in a consomic strain carrying M. m. molossinus X chromosome on B6 background (Oka & Shiroishi, 2012) . Sha 2 interval also overlapped with Hstx1 locus identified by Storchová et al. (20 04) .

A s tudy conducted by Dz ur - Gejdosova et al. (2012) used intersubspecific substitution strains, created from PWD and B6, to estimate the main components ruling hybrid sterility ( Gregorová et al., 2008) . T hey excluded the effects of X - Y, Y - autosome and mitochondrial incompatibilities. Dobzhansky - Muller incompatibility of the proximal part of the PWD ( musculus ) X chromosome with autosomal genome were identified as the sole cause of asymmetry in F1 hybrid sterility. Epistatic interactions were observed between QTLs on chromosome 17 ( Hst1 locus) and X chromosome. The a uthors conclude d that both loci are necessary but not sufficient for hybrid sterility condition. They revealed that to conduct c omplete sterility , chromosome 19 and another not well defined factor in genetic background must be involved. The not well defined factor was identified after painstaking work as the critical length of conspecific homology blocks in autosomal chromosomes (Gregorova et al., 2018) . I nteractions between musculus X chromosome and domesticus

34 autosomes, leading to reduced fertility, were observed also in the study of White et al. (2011) .

Most of the studies revealed emerging pattern s of male hybrid sterility that consisted of two major factors; heterozygous state of gen Prdm9 and locus in central part of musculus X chromosome. The unexplained factor is asymmetry reciprocal crosses, docum ented in s everal studies (e. g. Britton - Davidian et al., 2005 , Good, et al., 2008 b )

Two X - linked loci define the incidence of male sterility: the Hstx1 locus causes male sterility when introgressed onto the proximal and distal regions of otherwise B6 background (Storchová et al., 2004) . The second locus, Hstx2 , controls the asymmetry of sterility in reciprocal cro sses and was localized with the Hstx1 locus to a 4.7 Mb interval on X chromosome ( B hattacharyya et al., 2014, Paper I I ). The asymmetry originates from observations that the (PWD × B6)F1 hybrids are sterile and their ( B6 × PWD )F1 counterparts display sperms in epididymis . The causality of this asymmetry was resolved by employing another musculus derived WDS, STUS, kept in a breeding facility in Studenec, so far the only one known to produce sterile hybrids with B6 mice in both directions (Vyskočilová et al. , 2009) . To map the genes involved in sterility asymmetry B6 females were mated with (PWD × STUS)F1 and (STUS × PWD)F1 females. T h ree autosomal genes located on chromosomes 3, 9, and 13 were identified as contributing to hybrid sterility ( Bhattacharyya et al., 2014, Paper I I ) .

The pattern including musculus X chromosome and gene Prdm9 , was considered to be the universal model underlying hybrid male sterility. However, using thoughtful mating design, Larson et al. (2018 ) excluded the role of the musculus X chromosome and revealed the effect of several autosomal loci , polymorphic in M. m. musculus that cause severe hybrid male infertility.

Laboratory evidence of Y chromosome effect to male fitness As reviewed above t he large contribution of X chromosome to reproductive barriers between house mouse subspecies is evident and well documented in both laboratory and hybrid zone studies. Hybrid male sterility is expected to be driven by negative epistasis between loci on musc ulus X chromosome and other loci in domesticus genome.

The e ffect of Y chromosome on phenotypes associated with reproduction is a subject of long - term debate. Unfortunately, the p otential for negative interactions between Y and other genetic components has not been assessed in most of the studies aimed at hybrid sterility. In cases of using the classical laboratory strain B6 as the domesticus representative, this had a little sense as B6 is a strain with domesticus autosomal background but musculus Y chromo some (Bishop et al. , 1985) Thus when B6 is crossed with some musculus strain s t here is no space for negative intera ctions between its genome and Y B6 chromosome (Forejt & Iványi, 1974 , Storchová et al., 2004 , Vyskočilová et al., 2005 , 2009 , Dzur - Gejdosova et al., 2012) . Moreover, since mouse Y chromosome does not recombine (except in a small pseudoautosomal region ), classical gene mapping is im possible . Another problem can arise from difficulties in Y chromosome sequencing. This chromosome harbours lots of repetitive segments , making a standard short reads approach ineffective (Soh et al., 2015) .

Despite these obstacle s , the effect of Y chromosome to reproductive parameters have recently been assessed in several st udies . Campbell et al. (2012) used four WDS representi ng both musculus and domesticus to cre ate eight introgression lines combining different X chromosome haplotypes with different Y chrom osomes on F 1 autosomal background. Their findings seemed to confirm the assumption that spermatogenetic failure is caused mainly by X - autosomes incompatibilities. Nonetheless , they found evidence for negative interaction between domesticus Y chromosome and two intervals on musculus X chromosome (14.1 – 29.5 cM and 48.5 - 60 cM) , resulting in abnormal sperm head morphology. Su bsequently, by backcrossing domesticus males (i.e. donors of Y chromosomes) to musculus females (i.e. donors of autosomes and X chromosomes) for 11 generations, Campbell & Nachman ( 2014) eliminated the effect of potential X - autosome incompatibilities. The resulting strains confirmed pre vious findings that X - Y incompatibilities have a strong influence on sperm morphology.

Hybrid male sterility was found to be associated with disruption of gene expression of sex chrom o somes during spermatogenesis. While s ex chromosomes are transcriptio nally silenced in early prophase of meiosis (meiotic sex chromosome inactivation, MSCI) in fertile males and remain repressed in round spermatids (postmeiotic sex chromosome repression, PSCR) , both t he MSCI and PSCR are disrupted in sterile males (Namekawa et

36 al., 2006 , Turner et al., 2006 , Good et al. , 2010 , Campbell et al. , 2013 , Larson et al., 2016 , 2017) . The misregula tion of gene expression can arise f rom intragenomic X - Y conflict. Sex chromosomes in mice are enriched for multicopy genes, such as Sly on the Y chromosome and Slx/Slx1 on the X chromosome and their copy numbers differ between subspecies (Scavetta & Tautz, 2010 , Ellis et al., 2011 , Soh et al., 2015) . The multicopy Sly gene , located on the long arm of mouse Y chro mosome, escapes PSCR. Moreover, this gene was identified as the PSCR regulator es sential for accurate transcriptional down regulation of the X and Y during sperm differentiation (Cocquet et al., 2009 , Reynard et al. , 2009 , Li et al., 2013) . It has been found that Sly and Slx/Slx1 have antagonistic effect and that they are involved in postmeiotic intragenomic conflict . As the copy numbers in multicopy genes differ between subspecies, their balance can be disru pted during hybridization which lead s to sperm heads deformation s and male sterility (Cocquet et al., 2010, 2012 , Larson et al., 2017)

Though the a bove mentioned laboratory studies prove the Y chromosome effect to spermatogenesis and suggest its possible mechanism , it still remains unclear to what extent those findings can be applied in natural populations . Information about the Y associated effects to phenotypic correlates in a wider geographic context of a hybrid zone are lacking, with the exception of the study of Albrechtova et al. (2012) .

To facilitate an insight into Y chromosome behaviour in the hybrid zone, a study based on 31 recombinant lines established from 8 wil d derived strains, was carried out ( Martincová et al, 2019, Paper III ). Four of the domesticus and 4 of the musculus were used. The sampling sites were chosen at different distances from the hybrid zone to mirror the increase of genetic variation with increasing distance from the hybrid zone (Fig. 3, panel A). Two strains from one locality reflected the variation within localities. The parental strains were crossed in a combinatory design as depicted in Fig. 3 . The design reflects polymorphism introduced by mating direction, geographic origin (strain and locality effects) and subspecific status of each strain . The resulti ng 240 F1 hybrid males were scored for five phenotypic traits associated with male fitness .

Fig.3 The design of recombinant crossing. The first column lists subspecies, the s econd localities and the third full names of founder wild - derived strains used for the crossing. Each wild - derived strain is also labelled with a one - letter code (fourth column) for simplicity. In all crosses the first letter stands for a female and the second letter for a male. The RL codes consist of two letters, the first on e indicating the origin of mtDNA (column mt), the second one pointing to the Y chromosome origin in each cross (column Y). Autosomal and X - linked genomes are mixtures of domesticus and musculus genomes . N gives the numbers of tested males per cross. The bo ttom line indicates levels at which Y chromosomes were tested for phenotypic effects. Inserted panel A depicts a map of trapping localities of the founders of 8 wild - derived strains studied. The violet line indicates the house mouse hybrid zone course. Pan el B shows the Neighbour - Joining tree of Y chromosome haplotypes based on 51 SNPs . The C57BL/6J strain represents a reference Y haplotype. The bootstrap values based on 100 replicates are shown at each node. The scale is in numbers of SNPs distinguishing p airs of strains .

The key question of the study was whether there are any intersubspecific differences in phenotypes associated with Y chromosome that affect male fitness. However, reducing the search for differences in phenotypic traits to the intersubspec ific level can lead to biased inference on Y spread dynamics. For example, if different localities within the subspecies display significant variation in the Y - associated phenotypes their effects can be cancelled out when averaged and hence this variabilit y will be obscured. To avoid such biased inference, the crossing design of the study was arranged to assess phenotypic effects of Y on a hierarchical scale from subspecific to local interstrain. A striking proportion, 21% (frequencies of sperm head abnorma lities) and 42% (frequencies of sperm tail dissociations), of phenotypic variation was explained by geographic origin of Y chromosome . Interestingly an increased proportion of sperm head abnorm alities occurred as an effect of one particular domesticus Y chromosome haplotype and the h ighest proportion of variation was explained on the recombinant lines/interstrain level (for details see Martincová et al., 2019, Paper III ) . By contrast the proportion of sperm tail dissociations showed the highest proport ion of explained variation on the subspecies level. In other words, all included domesticus Y chromosomes showed strong phenotypic effect when interacting with hybrid autosomal background and X chromosome. The se results can indicate a possible mechanism af fecting Y chromosome behaviour in the hybrid zone.

The previous study, conducted by Martincová et al. ( 2019) , s howed the effect of hybridization on sperm quality traits. However, the observed differentiation in sperm quality parameters could be confined to a specific experiment exploiting variation introduced by 8 different Y haplotypes (Martincová et al. 2019). To clarify the effect of hybridization on sperm quality , a large set of 29 WDS was used ( Martincová, et al. , submitted, Paper IV ) . Sixteen strains represented the domesticus and 13 strains the musculus genomes (Fig. 4) .

Fig. 4 The violet l ine show s the course of the M. m. domesticus / M. m. musculus hybrid zone in Europe. Points in the map depict the localities where the founders of wild derived strains were trapped. Blue points mark domesticus localities, red points musculus localities. From some localities, more than one strain was derived. The precise geographic coordinated of localities are available in Martincová et al. (submitted , Paper IV ). The position of the original locality of strain DOT was excluded from the map as it is located in Tahiti. The map outline of Europe was modified from http://www.reddit.com.

In total , 178 F1 males were scored (Fig 5) . They have represented proportionally 34 domesticus × domesticus , 61 domesticus × musculus ,42 musculus × domesticus and 42 musculus × musculus crosses. Neither of the observed sperm quality traits (frequency of dissociated sperm heads and frequency of abnormal sperm heads) have shown any significant difference between intrasubspecific F1 hybrids. Hybridization increased frequency of abnormal sperm heads in both types of intersubspecific hybrids, though the only difference from intrasubspecific crosses, detected in the domesticus × musculus males was significant (ASH = 10.00%) . However, the interspecific crosses displayed significant differentiation in the frequency of dissociated sperm heads, depending on cross type. T he numbers of dissociated sperm heads were ~8% in domesticus × musculus and 15% in musculus × domesticus males . Medians of DSH in those two cross types differ ed in more than 180% and became hig h ly significant (Fig.5) . The explained fraction of va riance attributed to cross type was 23.41% (for details see Martincová et al. , submitted, Paper IV ) . We concluded that most of the DSH differentiation is associat ed with the X chromosome and shaped by interaction with the Y chromosome . Y changes the direction of the response in the intersubspecific hybrids in the following manner: the domesticus Y increased the frequency while the musculus Y decreased the freque ncy of dissociated sperm heads.

Fig. 5 Boxplots show the frequency in dissociated sperm heads in intrasubspecies (Dom x Dom and Mus x Mus) and intersubspecies (Dom x Mus and Mus x Dom) crosses. The black dots represent individual values. Different l etters in dicate significan t differen ces between crosses. Medians, quartiles and 1.5 interquartile range are depicted.

Summary The presented thesis brings new findings about spermatogenetic defects in hybrids of two house mouse subspecies. The larger part of my re sults is focused on the effect of the Y chromosome, which has been rather neglected up to now. Two approaches: research in situ in house mouse hybrid zone and research in laboratory conditions were used, to provide a comprehensive insight.

The research of the enigmatic behaviour of Y chromosome in hybrid zone reveals a new pattern. We f o und out that the musculus Y chromosome introgression is not an exceptional event, limited only to the area of Czech - Bavarian transect of the hybrid zone. Contrarily, the mus culus Y introgression occurs multiple times along the hybrid zone in central Europe. Subsequent analysis of microsatellites revealed that there is not a single introgressing musculus Y chromosome haplotype/haplogroup distinct from others incapable of intro gression (Macholán et al. in prep. Paper I) . The possible mechanisms of Y chromosome spread across hybrid zone was suggested by two studies fac ilitating experimental crosses. We have found a significant variance in sperm quality in hybrid males possessing different Y chromosome. In the first study t he incidence of dissociated sperm heads frequency was consistently increased in recombinant lines acquiring all included domesticus Y chromosome , while higher frequency of abnormal sperm heads was associated with particular domesticus Y chromosome (Martincová et al., 2019 , Paper III ) . Subsequent study, fac ilitating both: intra - and intersubspecific crosses, confirmed the effect of subspecies - specific Y chromosome on dissociated sperm heads . The domesticus Y increased and musculus Y decreased its incidence in intersubspecies crosses, compared to parental str ains . On the other hand, the rate of abnormal sperm heads was consistently higher in intersubspecific hybrids (Martincová et al. , submitted, Paper IV). However, it was documented that Y chromosome effect is associated with the chromosome X. The X chromosome is one of the necessary factors , contributing to the most severe spermatoge netic defect, hybrid sterility. The new locus of hybrid sterility, Hstx2 , was identified in 4.7 Mb interval in chromosome X. We revealed that the locus is responsible for asynapsis of heterospecific homologous chrom o somes during meiosis (Bhattacharyya et al., 2014 , Paper II ) .

The s permatogenesis is a tuned cascade of processes producing sperm; impairment of any ph ase of this process can affect fitness of males . T he decrease of sperm quality could appear negligible compare with hybrid sterility. However, their fitness consequences are tested in nature in the presence of male - male sperm competition, and so have the p otential to be very significant. The disruption of spermatogenetic processes in hybrids contribute to strengthening of reproductive barriers, and thus to speciation.

Reference s Albrechtova, J., Albrecht, T., Baird, S. J. E., Macholan, M., Rudolfsen, G., Munclinger, P., … Pialek, J. (2012). Sperm - related phenotypes implicated in both maintenance and breakdown of a natural species barrier in the house mouse. Proceedings of the Roya l Society B: Biological Sciences , 279 (1748), 4803 – 4810

Baird, S. J. E., & Macholán, M. (2012). What can the Mus musculus musculus/M. m. domesticus hybrid zone tell us about speciation? In M. Macholán, S. J. E. Baird, P. Munclinger, & J. Piálek (Eds.), Evol ution of the House Mouse (pp. 334 – 372). Oxford: Oxford University Press.

Barbash, D. A. (2007). Nup96 - Dependent Hybrid Lethality Occurs in a Subset of Species From the simulans Clade of Drosophila. Genetics , 552 (May), 543 – 552

Barbash, D. A., Roote, J., & Ashburner, M. (2000). The Drosophila melanogaster Hybrid male rescue Gene Causes Inviability in Male and Female Species Hybrids. Genetics , 154 , 1747 – 1771.

Barton, N. H., & Gale, K. (1990). Genetic analysis of Hybrid zones. In Hybrid Zone Pattern and Proces s (pp. 1 – 33)

Barton, N. H., & Hewitt, G. M. (1985). Analysis of Hybrid Zones. Annual Review of Ecology and Systematics , 16 (1), 113 – 148

Bateson, W. (1909). Heredity and variation in modern light. In A. C. Seward (Ed.), Darwin and modern science (pp. 85 – 101) . Cambridge, UK: Cambridge University Press.

Bhattacharyya, T., Reifova, R., Gregorova, S., Simecek, P., Gergelits, V., Mistrik, M., … Forejt, J. (2014). X Chromosome Control of Meiotic Chromosome Synapsis in Mouse Inter - Subspecific Hybrids. PLoS Genetics , 10 (2) 1004088

Bishop, C. E., Boursot, P., Baron, B., Bonhomme, F., & Hatat, D. (1985). Most classical Mus musculus domesticus laboratory mouse strains carry a Mus musculus musculus Y chromosome. Nature , 315 , 70.

Bonhomme, F., & Guénet, J. - L. (1989). Genetic Variants and Strains of the Laboratory Mouse. In The wild house mouse and its relatives. (pp. 649 – 662). Oxford University Press.

Britton - Davidian, J., Fel - Clair, F., Lopez, J., Alibert, P., & Boursot, P. (2005 ). Postzygotic isolation between the two European subspecies of the house mouse: Estimates from fertility patterns in wild and laboratory - bred hybrids. Biological Journal of the Linnean Society , 84 (3), 379 – 393

Brockdorff, N., & Turner, B. M. (2015). Dosage Compensation in Mammals. Cold Spring Harbour Perspectives in Biology , 7 , a019406.

Campbell, P., Good, J. M., Dean, M. D., Tucker, P. K., & Nachman, M. W. (2012). The contribution of the Y chromosome to hybrid male sterility in house mice. Genetics , 191 (4), 1271 – 1281.

Campbell, P., Good, J. M., & Nachman, M. W. (2013). Meiotic sex chromosome inactivation is disrupted in sterile hybrid male house mice. Genetics , 193 (3), 819 – 828

Campbell, P., & Nachman, M. W. (2014). X - Y interactions underlie sperm head ab normality in hybrid male house mice. Genetics , 196 (4), 1231 – 1240

Chang, P. L., Kopania, E., Keeble, S., Sarver, B. A. J., Larson, E., Orth, A., … Dean, M. D. (2017).

Whole exome sequencing of wild - derived inbred strains of mice improves power to link pheno type and genotype. Mammalian Genome , 28 (9), 416 – 425

Charlesworth, B., & Charlesworth, D. (2000). The degeneration of Y chromosomes. Proceedings of the Royal Society B: Biological Sciences , 333 , 1563 – 1572

Charlesworth, B., Coyne, J. A., & Barton, N. H. (19 87). The Relative Rates of Evolution of Sex Chromosomes and Autosomes. The American Naturalist , 130 (1), 113 – 146

Cocquet, J., Ellis, P. J. I., Mahadevaiah, S. K., Affara, N. a., Vaiman, D., & Burgoyne, P. S. (2012). A genetic basis for a postmeiotic X vers us Y chromosome intragenomic conflict in the mouse. PLoS Genetics , 8 (9), e1002900

Cocquet, J., Ellis, P. J. I., Yamauchi, Y., Mahadevaiah, S. K., Affara, N. a., Ward, M. a., & Burgoyne, P. S. (2009). The multicopy gene sly represses the sex chromosomes in the male mouse germline after meiosis. PLoS Biology , 7 (11), e1000244.

Cocquet, J., Ellis, P. J. I., Yamauchi, Y., Riel, J. M., Karacs, T. P. S., Rattigan, A., … Burgoyne, P. S. (2010). Deficiency in the multicopy Sycp3 - Like X - linked Genes Slx and Slxl1 causes major defects in spermatid differentiation. Molecular Biology of the Cell , 21 , 3497 – 3505.

Coyne, J. A. (2018). “Two Rules of Speciation” revisited. Molecular Ecology , 27 (19), 3749 – 3752

Coyne, J. A., & Orr, H. A. (1989). Patterns of speciation in D rosophila. Evolution , 43 (2), 362 – 381

Coyne, J. A., & Orr, H. A. (2004). Speciation . Sunderland.

Coyne, J. a, Elwyn, S., Kim, S. Y., & Llopart, A. (2004). Genetic studies of two sister species in the Drosophila melanogaster subgroup, D. yakuba and D. santom ea. Genetical Research , 84 (1), 11 – 26

Cucchi, T., Auffray, J. - C., & Vigne, J. - D. (2012). On the origin of the house mouse synantrophy and dispersal in Near East and Europe: zooarcheological review and perspectives. In M. Macholán, S. J. E. Baird, P. Munclin ger, & J. Piálek (Eds.), Evolution of the House Mouse (pp. 65 – 93). Oxford: Oxford University Press.

Dobzhansky, T. (1937). Genetic nature of species differences. The American Naturalist , 71 (735), 402 – 420.

Dod, B., Jermiin, L. S., Boursot, P., Chapman, V. H ., Nielsen, J. T., & Bonhomme, F. (1993). Counterselection on sex chromosomes in the Mus musculus European hybrid zone. Journal of Evolutionary Biology , 6 (4), 529 – 546

Dod, B., Smadja, C., Karn, R. C., & Boursot, P. (2005). Testing for selection on the andr ogen - binding protein in the Danish mouse hybrid zone. Biological Journal of the Linnean Society , 84 (3), 447 – 459

Dufková, P., Macholán, M., & Piálek, J. (2011). Inference of selection and stochastic effects in the house mouse hybrid zone. Evolution , 65 (4), 993 – 1010

Ďureje, L., Macholán, M., Baird, S. J. E., & Piálek, J. (2012). The mouse hybrid zone in Central Europe: From morphology to molecules. Folia Zoologica , 61 (3 – 4), 308 – 318.

Duvaux, L., Belkhir, K., Boulesteix, M., & Boursot, P. (2011). Isolation and gene flow: Inferring the speciation history of European house mice. Molecular Ecology , 20 (24), 5248 – 5264.

Dzur - Gejdosova, M., Simecek, P., Gregorova, S., Bhattacharyya, T., & Forejt, J. (2012). Dissecting the Genetic Architecture of F 1Hybrid Sterility in House Mice. Evolution , 66 (11), 3321 – 3335.

Elliott, R. W., Miller, D. R., Pearsall, R. S., Hohman, C., Zhang, Y., Poslinski, D., … Chapman, V. M. (2001). Genetic analysis of testis weight and fertility in an interspecies hybrid congenic strain for Chromos ome X. Mammalian Genome , 12 (1), 45 – 51

Ellis, P. J. I., Bacon, J., & Affara, N. A. (2011). Association of Sly with sex - linked gene amplification during mouse evolution: A side effect of genomic conflict in spermatids? Human Molecular Genetics , 20 (15), 3010 – 3021.

Filatov, D. A. (2018). The two “ rules of speciation ” in species with young sex chromosomes. Molecular Ecology , 27 , 3799 – 3810

Forejt, J., & Iványi, P. (1974). Genetic studies on male sterility of hybrids between laboratory and wild mice ( Mus musculus L.). Genetical Research , 24 (2) , 189 – 206.

Fox, J. G., Barthold, S., Davisson, M., Newcomer, C. E., Quimby, F. W., & Smith, A. (2006). The mouse in biomedical research: normative biology, husbandry, and models (3rd ed.). San Diego: Elsevier.

Frank, S. A. (1991). Divergence of meiotic drive - suppression systems as an explanation for sex - biased hybrid sterility and inviability, 45 (2), 262 – 267.

Geraldes, A., Basset, P., Gibson, B., Smith, K. L., Harr, B., Yu, H. T., … Nachman, M. W. (2008). Inferring the history of speciation in house mice from autosomal, X - linked, Y - linked and mitochondrial genes. Molecular Ecology , 17 (24), 5349 – 5363.

Good, J. M., Dean, M. D., & Nachman, M. W. (2008 a ). A complex genetic basis to X - linked hybrid male sterility between two species of house mice. Genetics , 179 (4), 2213 – 2228.

Good, J. M., Giger, T., Dean, M. D., & Nachman, M. W. (2010). Widespread Over - expression o f the X chromosome in sterile F1 hybrid mice. PLoS Genetics , 6 (9), 30 – 32.

Good, J. M., Handel, M. A., & Nachman, M. W. (2008 b ). Asymmetry and polymorphism of hybrid male sterility during the early stages of speciation in house mice. Evolution , 62 (1), 50 – 6 5

Gregorová, S., Divina, P., Storchova, R., Trachtulec, Z., Fotopulosova, V., Svenson, K. L., … Forejt, J. (2008). Mouse consomic strains: Exploiting genetic divergence between Mus m. musculus and Mus m. domesticus subspecies. Genome Research , 18 (3), 509 – 5 15

Gregorová, S., & Forejt, J. (2000). PWD/Ph and PWK/Ph inbred mouse strains of Mus m. musculus subspecies -- a valuable resource of phenotypic variations and genomic polymorphisms. Folia Biologica .

Gregorova, S., Gergelits, V., Chvatalova, I., Bhattachar yya, T., Valiskova, B., Fotopulosova, V., … Forejt, J. (2018). Modulation of Prdm9 - controlled meiotic chromosome asynapsis overrides hybrid sterility in mice. ELife , 7 , 1 – 21

Guénet, J. L., & Bonhomme, F. (2003). Wild mice: An ever - increasing contribution t o a popular mammalian model. Trends in Genetics , 19 (1), 24 – 31

Guénet, J. L., Nagamine, C., Simon - Chazottes, D., Montagutelli, X., & Bonhomme, F. (1990). Hst - 3: An X - linked hybrid sterility gene. Genetical Research , 56 (2 – 3), 163 – 165.

Haldane, J. B. S. (1922). Sex ratio and unisexual sterility in hybrid animals. Journal of Genetics ,

Harrison, R. G. (1990). Hybrid zones: windows on evolutionary process. Oxford Surveys in Evolutionary Biology , 7 , 69 – 128.

Hewitt, G. M. (1988). Hybrid zon es - natural laboratories for evolutionary studies. Trends in Ecology & Evolution , 3 (7), 158 – 167

Hunt, P. A., & Hassold, T. J. (2002). Sex matters in meiosis. Science (New York, N.Y.) , 296 (5576), 2181 – 2183

Hurst, L. D., & Pomiankowski, A. (1991). Causes of S ex Ratio Bias May Account for Unisexual Sterility in Hybrids :

Iványi, P., Vojtísková, M., Démant, P., & Micková, M. (1969). Genetic factors in the ninth linkage group influencing reproductive performance in male mice. Folia Biologica , 15 (6), 401 – 421.

Jon es, E. P., & Searle, J. B. (2015). Differing Y chromosome versus mitochondrial DNA ancestry, phylogeography, and introgression in the house mouse. Biological Journal of the Linnean Society , 115 , 348 – 361.

Jones, E. P., Van Der Kooij, J., Solheim, R., & Sear le, J. B. (2010). Norwegian house mice ( Mus musculus musculus/domesticus ): Distributions, routes of colonization and patterns of hybridization. Molecular Ecology , 19 (23), 5252 – 5264

Larson, E. L., Keeble, S., Vanderpool, D., Dean, M. D., & Good, J. M. (2017 ). The Composite Regulatory Basis of the Large X - Effect in Mouse Speciation. Molecular Biology and Evolution , 34 (2), 282 – 295

Larson, E. L., Vanderpool, D., Keeble, S., Zhou, M., Sarver, B. A. J., Smith, A. D., … Good, J. M. (2016). Contrasting levels of mo lecular evolution on the mouse X chromosome. Genetics , 203 (4), 1841 – 1857

Larson, E. L., Vanderpool, D., Sarver, B. A. J., Callahan, C., Keeble, S., Provencio, L. L., … Good, J. M. (2018). The evolution of polymorphic hybrid incompatibilities in house mice. Genetics , 209 (3), 845 – 859

Li, H. Y. J., Sugawara, A., Yamauchi, Y., Ruthig, V., Ellis, P. J. I., Riel, J. M., … Cocquet, J. (2013). Deficiency of the multi - copy mouse Y gene Sly causes sperm DNA damage and abnormal chromatin packaging. Journal of Cell Sci ence , 126 (3), 803 – 813.

Liénard, M. A., Araripe, L. O., & Hartl, D. L. (2016). Neighboring genes for DNA - binding proteins rescue male sterility in Drosophila hybrids. Proceedings of the National Academy of Sciences , E4200 – E4207

Lifschytz, E., & Lindsley, D. L. (1972). The role of X - chromosome inactivation during spermatogenesis (Drosophila - allocycly - chromosome evolution - male sterility - dosage compensation). Proceedings of the National Academy of Sciences of the United States of Am erica , 69 (1), 182 – 186

Lucchesi, J. C., & Kuroda, M. I. (2015). Dosage Compensation in Drosophila. Cold Spring Harbour Perspectives in Biology , 7 , a019398.

Macholán, M., Baird, S. J. E., Dufková, P., Munclinger, P., Bímová, B. V., & Piálek, J. (2011). Assessing multilocus introgression patterns: A case study on the mouse X chromosome in central Europe. Evolution , 65 (5), 1428 – 1446.

Macholán, M., Baird, S. J. E ., Munclinger, P., Dufková, P., Bímová, B., & Piálek, J. (2008). Genetic conflict outweighs heterogametic incompatibility in the mouse hybrid zone? BMC Evolutionary Biology , 8 , 271.

Macholán, M., Munclinger, P., Šugerková, M., Dufková, P., Bímová, B., Boží ková, E., … Piálek, J. (2007). Genetic analysis of autosomal and X - linked markers across a mouse hybrid zone. Evolution , 61 (4), 746 – 771

Martincová, I., Ďureje, Ľ., Kreisinger, J., Macholán, M., & Piálek, J. (2019). Phenotypic effects of the Y chromosome ar e variable and structured in hybrids among house mouse recombinant lines. Ecology and Evolution , (9), 6124 – 6137

Masly, J. P., Jones, C. D., Noor, M. A. F., Locke, J., & Orr, H. A. (2006). Gene Transposition as a Cause of Hybrid Sterility in Drosophila. Sci ence , 282 (5393), 1501 – 1504.

Masly, J. P., & Presgraves, D. C. (2007). High - resolution genome - wide dissection of the two rules of speciation in Drosophila. PLoS Biology , 5 (9), 1890 – 1898.

Mayr, E. (1942). Systematics and the Origin of Species . New York: Co lumbia Univ. Press.

Mihola, O., Trachtulec, Z., Vlcek, C., Schimenti, J. C., & Forejt, J. (2009). A Mouse Speciation Gene Encodes a Meiotic Histone H3 Methyltransferase. Science , 323 (5912), 373 – 375.

Moyle, L. C., Muir, C. D., Han, M. V, & Hahn, M. W. (201 0). The contribution of gene movement to the “ two rules of speciation .” Evolution , 64 (6), 1541 – 1557. Muller, H. J. (1942). Isolation mechanisms, evolution and temperature. Biol. Symp. , 6 , 71 – 125.

Munclinger, P., Božíková, E., Ugerková, M., & Piálek, J. (2002). Genetic variation in house mice ( Mus , Muridae , Rodentia ). East , 51 (2), 81 – 92.

Namekawa, S. H., Park, P. J., Zhang, L. F., Shima, J. E., McCarrey, J. R., Griswold, M. D., & Lee, J. T. (200 6). Postmeiotic Sex Chromatin in the Male Germline of Mice. Current Biology , 16 (7), 660 – 667

Oka, A., Mita, A., Sakurai - yamatani, N., Yamamoto, H., Takagi, N., Takano - shimizu, T., … Shiroishi, T. (2004). Hybrid breakdown caused by substitution of the X chro mosome between two mouse subspecies. Developmental Biology , 924 (February), 913 – 924.

Oka, A., & Shiroishi, T. (2012). The role of the X chromosome in house mouse speciation. In M. Macholán, S. J. E. Baird, P. Munclinger, & J. Piálek (Eds.), Evolution of the House Mouse (pp. 432 – 454). Oxford University Press.

Orr, H. A., Masly, J. P., & Presgraves, D. C. (2004). Speciation genes. Current Opinion in Genetics and Development , 14 (6), 675 – 679

Orr, H. A., & Presgraves, D. C. (2000). Speciation by postzygotic isola tion: Forces, genes and molecules. BioEssays , 22 (12), 1085 – 1094

Parvanov, E. D., Petkov, P. M., & Paigen, K. (2010). Prdm9 controls activation of mammalian recombination hotspots. Science , 327 (5967), 835

Payseur, B. a, Krenz, J. G., & Nachman, M. W. (2004) . Differential patterns of introgression across the X chromosome in a hybrid zone between two species of house mice. Evolution; International Journal of Organic Evolution , 58 (9), 2064 – 2078

Perez, D. E., Wu, C. I., Johnson, N. A., & Wu, M. L. (1993). Geneti cs of reproductive isolation in

the Drosophila simulans clade: DNA marker - assisted mapping and characterization of a hybrid - male sterility gene, Odysseus (Ods). Genetics , 134 (1), 261 – 275.

Phadnis, N., & Orr, A. H. (2009). Report A Single Gene Causes Both Male Sterility and Segregation Distortion in Drosophila Hybrids. Science , 323 (5912), 376 – 379.

Piálek, J., Vyskočilová, M., Bímová, B., Havelková, D., Piálková, J., Dufková, P., … Forejt, J. (2008). Development of unique house mouse resources suitable for evolutionary studies of speciation. Journal of Heredity , 99 (1), 34 – 44

Prager, E. M., Boursot, P., & Sage, R. D. (1997). New assays for Y Chromosome and p53 pseudogene clines among East Holstein house mice. Mammalian Genome , 8 (4), 279 – 281.

Presgraves, D. C. (2008). Sex chromosomes and speciation in Drosophila . Trends Genet. , 24 (7), 336 – 343

Reynard, L. N., Cocquet, J., & Burgoyne, P. S. (2009). The Multi - Copy Mouse Gene Sycp3 - Like Y - Linked (Sly) Encodes an Abundant Spermatid Protein That Inte racts with a Histone Acetyltransferase and an Acrosomal Protein1. Biology of Reproduction , 81 (2), 250 – 257.

Scavetta, R. J., & Tautz, D. (2010). Copy number changes of CNV regions in intersubspecific crosses of the house mouse. Molecular Biology and Evolut ion , 27 (8), 1845 – 1856.

Silver, L. M. (1995). Mouse genetics: concepts and applications. Mouse Genetics: Concepts and Applications .

Soh, Y. Q. S., Alföldi, J., Pyntikova, T., Brown, L. G., Minx, P. J., Fulton, R. S., … Page, D. C. (2015). Sequencing the mouse Y chromosome reveals convergent gene acquisition and amplification on both sex chromosomes, 159 (4), 800 – 813.

Storchová, R., Gre gorová, S., Buckiová, D., Kyselová, V., Divina, P., & Forejt, J. (2004). Genetic analysis of X - linked hybrid sterility in the house mouse. Mammalian Genome : Official Journal of the International Mammalian Genome Society , 15 (7), 515 – 524

Tao, Y., Chen, S., Hartl, D. L., & Laurie, C. C. (2003). Genetic Dissection of Hybrid Incompatibilities Between Drosophila simulans and D . mauritiana . I . Differential Accumulation of Hybrid Male Sterility Effects on the X and Autosomes, Genetics (164), 1383 – 1397

True, J. , Weir, B., & Laurie, C. (1996). Genome - Wide Survey of Hybrid Incompatibility Factors by the Introgression of Marked Segments of Drosophila mauritania chromosomes into Drosophila simulans. Genetics , 142 , 819 – 837.

Tucker, P. K., Sage, R. D. D., Warner, J., Wilson, A. C., & Eicher, E. M. (1992). Abrupt cline for sex chromosomes in a hybrid zone between two species of mice. Evolution , 46 (4), 1146 – 1163.

Turner, J. M. a., Mahadevaiah, S. K., Ellis, P. J. I., Mitchell, M. J., & Burgoyne, P. S. (2006). Pachytene asynapsis drives meiotic sex chromosome inactivation and leads to substantial postmeiotic repression in spermatids. Developmental Cell , 10 (4), 521 – 5 29

Turner, L. M., Schwahn, D. J., & Harr, B. (2011). Reduced male mertility is common but highly variable in form and severity in a natural house mouse hybrid zone. Evolution , 443 – 458

Vanlerberghe, F., Boursot, P., Catalan, J., Gerasimov, S., Bonhomme, F., Botev, B. A., & Thaler, L. (1988). Analyse génétique de la zone d’hybridation entre les deux sous - espèces de souris Mus musculus domesticus et Mus musculus musculus en Bulgarie. Genome , 30 (3), 427 – 437.

Vanlerberghe, F., Dod, B., Boursot, P., Bellis, M., & Bonhomme, F. (1986). Absence of Y - chromosome introgression across the hybrid zone between Mus musculus domesticus and Mus musculus musculus . Genetical Research , 48 (3), 191 – 197.

Vyskočilová, M., Pražanová, G., & Piálek, J. (2009). Polymorphism in hybrid male sterility in wild - derived Mus musculus musculus strains on proximal chromosome 17. Mammalian Genome , 20 (2), 83 – 91

Vyskočilová, M., Trachtulec, Z., Forejt, J., & Piálek, J. (2005). Does geography matter in hybrid sterility in house mice? Biological Jou rnal of the Linnean Society , 84 (3), 663 – 674.

Waterston, R. H., Lindblad - Toh, K., Birney, E., Rogers, J., & ... (2002). Initial sequencing and comparative analysis of the mouse genome. Nature , 420 (6915), 520 – 562.

White, M. a., Steffy, B., Wiltshire, T., & Payseur, B. a. (2011). Genetic dissection of a key reproductive barrier between nascent species of house mice. Genetics , 189 (1), 289 – 304.

Wu, C. I., & Davis, A. W. (1993). Evolution of postmating reproductive isolation: the composite nature of Haldane’s r ule and its genetic bases. The American Naturalist , 142 (2), 187 – 212.

Yang, H., Wang, J. R., Didion, J. P., Buus, R. J., Bell, T. A., Welsh, C. E., … De Villena, F. P. M. (2011). Subspecific origin and haplotype diversity in the laboratory mouse. Nature Genetics , 43 (7), 648 – 655.

Paper I

Scan of the house mouse hybrid zone reveals widespread introgression of the Mus musculus musculus Y chromosome in Central Europe

manuscript in preparation for Molecular Ecology

Macholán M., Baird S. J. B., Fornůsková A., Martincová I. , Rubík P., Munclinger P., Ďureje Ľ., Heitlinger E., Tucker P. - K., Piálek J

Scan of the house mouse hybrid zone reveals w idespread introgression of t he Mus musculus musculus Y chromosome in Central Europe

Miloš Macholán, 1,2 Stuart J. E. Baird, 3 Alena Fornůsková, 3 Iva Martincová , 3 Pavel Rubík , 4 Pavel Munclinger , 4 Ľudovít Ďureje , 3 Emanuel Heitlinger , 5 Priscilla K. Tucker , 6 and Jaroslav Piálek 3

1 Laboratory of Mammalian Evolutionary Genetics, Institute of Animal Physiology and Genetics, Czech Academy of Sciences, Brno , Czech Republic

2 Department of Botany and Zoology, Masaryk University, Brno

3 Institute of Vertebrate Biology, CAS, Brno, Research Facility in Studenec, Czech Republic

4 Department of Zoology, Faculty of Sciences, Charles University in Prague, Czech Republic

5 Institute for Biology, Department of Molecular Parasitolo gy, Humboldt University Berlin, Germany

6 Department of Ecology and Evolutionary Biology, University of Michigan, Ann Arbor, Michigan, USA

Correspondence : Miloš Macholán, Laboratory of Mammalian Evolutionary Genetics, Institute of Animal Physiology and Genetics, Czech Academy of Sciences, Brno, Czech Republic, e - mail: [email protected]

A bstract

The house mouse hybrid zone (HMHZ) in Europe is believed to be a tension zone maintained by a balance between dispersal and intrinsic selection against hybrids fo llowing expectations of the Large X - effect and Haldane´s rule. However, the HMHZ course contradicts the prediction that tension zones should minimise their length. Moreover, introgression of Mus musculus musculus Y chromosomes into M. m. domesticus territo ry violates Haldane´s rule. Here we use a large set of  7300 mice and a battery of molecular markers to analyse (i) the precise HMHZ course, (ii) the geographic extent of Y introgression, and (iii) genetic structure of Ys over a large area embracing a  900 km long portion of the HMHZ from the Baltic Sea to the Alps. We show, first, that the HMHZ across the study area is rather complicated even at the global scale and this can be explained by presence of geographic barriers only in some places. Second, the u nidirectional introgression of musculus Ys into domesticus range is widespread. Finally, this introgression is not limited to a single type of Y. These results are discussed in the context of intragenomic conflict accompanied with sex ratio perturbations.

K ey words: house mouse, hybridisation, sex ratio, tension zone, Y chromosome

FUNDING INFORMATION

This work was supported by the Czech Science Foundation (grant No. 15 - 13265S and 17 - 25320S to MM and SJEB , and 16 - 23773S to JP and MM ).

ACKNOWLEDGEME N TS

We thank all anonymous farmers who allowed us to catch mice in their properties and numerous students who helped with trapp ing the mice. Václav Janoušek is acknowledged for development of Y microsatellite primers. This work is dedicated to the memory of th e late Jan Zima who has aroused our interest in the house mouse hybrid zone.

1 INTRODUCTION

More than three decades ago Barton and Hewitt, in their seminal review of hybrid zones (Barton & Hewitt , 1985), concluded that the majority of hybrid zones are likely to be tension zones . According to theory , tension zones are maintained by a balance between dispersal and intrinsic selection against hybrids (Key , 1968) . Th is has two consequences. First , population pressure on either side of the zone minim i s es it s length and second, since selection against hybrids is i ndependent of any particular habitat , the tension zone is free to move until being trapped by a geographical barrier or in an area of low population density (a ‘ density trough ’ ; Barton , 1979; Hewitt, 1975, 19 8 9 ). This opens, on the other hand, room for geographic features t o affect the zone course on a local scale. For example , it was shown that geographical complexity increase s variation of a hybrid zone position partitioning it in seve ral segments with different orientation in 2 - dimensional space ( Bridle, Baird & Butlin, 2001) . However, most hybrid zone analyses rely a priori on th e theoretical prediction o f tension zone linearity . This may lead to a severe bias of the results as shown, for example, by Baird & Macholán (2012) and Dufková, Macholán, & Piálek (2011). The picture gets even worse at large scales when we need to infer systematic (driven by selection) and random effects forming or breaking barriers to gene flow . For that reason, usually two or more replicates are analysed and those loci whose behaviour is consistent among the replicates is considered as systematic ; conversely, those loci that differ among the replicates a re thought to be more affected by random effects (e.g. Vijay et al. 2016). This situation parallels inference on genomic structure retrieved from scans of few loci or full genome scans.

H ybrid zones can be viewed as semi - permeabl e boundaries between differentiated genomes across which alleles thriving on hybrid background move quickly whereas introgression of mutations reducing hybrid fitness or engendering conspecific mating preferences is strongly counterselected . A third group of variants is equall y fit in hybrids and parental populations . T hese alleles are expected to diffuse stochastic ally across the zone in both directions ( Barton, 1979; Barton & Bengtsson, 1986; Barton & Gale, 1993; Barton & Hewitt, 1985; Bazykin , 1969; Harrison , 19 8 6; Piálek & Barton , 1997 ). Restricted introgression is expected especially in sex - linked loci, in agreement with the ‘ two rules of speciation ’ (Coyne & Orr , 1989) . The first is Haldan e ´s rule stating that when hybrids of

one sex suffer from impaired viability or fert ility, it is usually the heterogametic sex (Haldane , 1922), and the second one is the L arge X - effect pointing to the fact that hybrid incompatibilities often map to the X chromosome (Charlesworth , Coyne & Barton, 1987; Coyne , 1992 ; Coyne & Orr, 1989 ). Howe ver, these three theoretical predictions were either neglected in zones analysed or assumed a priori its linearity (see Baird & Macholán (2012) for biases due to 2D and 3D zone analyses) or have never been tested along a continual front completing much wider scale related to dispersal ability of the organism under study.

One of the best studied hybrid zones is the zone of secondary contact between two house mouse subspecies in Europe, eastern Mus musculus musculus ( Mmm ) and western M. m. domesticus ( Mmd ) . This zone is more than 2500 km long and runs from Scandinavia through Central Europe to the Black Sea coast (Fig ure 1 a ) . Following the pioneering works of Degerbøl (1949) and Ursin (1952) from Jutland and Zimmermann (1949) from Central Europe , the European house mouse hybrid zone (HMHZ) has been studied in a number of replicates (for a recent review see Baird & Macholán , 2012). The HMHZ is a mixture of late - generation hybrids and backcrosses with F1 hybrids being either missing or extremely rare . F or most markers intermediate genotypes and lowest fitness values appear in the zone centre ( Albrechtová et al., 2012; Baird et al., 2012 ; Macholán et al. , 2007; Raufaste et al., 2005 ). The zone was repeatedly reported to be in compliance with the Large X - effect: although t he zone width varies among markers , in general it is lower for X chromosome than for autosom al markers ( Dod et al. 1993; Macholán et al. 2007; Tucker, Sage, Warner, Wilson, & Eicher, 1992 ), with most incompatibilities local i s e d in the central X ( Dufková, Macholán, & Piálek, 2011; Janoušek et al., 2012; Macholán et al., 2011; Payseur , Krenz, & Nachman , 2004; Teeter et al. , 20 10).

Consistent with Haldane´s rule, Y chromosome s are expected to be strongly counterselect ed o n alien genetic background . Reports of the a bsence of Y introgression across the HMHZ from De nmark (Dod, Smadja, Karn, & Boursot, 2005; Vanlerberghe, Dod, Boursot, Bellis, & Bonhomme, 1986 ) , Bulgaria (Vanlerberghe et al., 1986), and southern Bavaria (Tucker et al. , 1992) seem to be consistent with this expectation. However, Munclinger , Božíková, Šugerková, Piálek, and Macholán (2002) found Mmm Y chromosomes deep in the Mmd range in western Bohemia (Czech Republic) and north -

58 eastern Bavaria (Germany) and this finding was later confirmed by Macholán et al. (2008) on a much larger data set . The se authors also revealed this phenomenon to be accompanied by differences in the census sex ratio (SR) : this wa s significantly female - biased in the Mmm territory and in Mmd localities without the introgressed Mmm Y, whereas in the Mmd area with the introgres sed Mmm Y i t wa s not significantly different from parity so that there was a clear and significant difference between ‘introgressed’ vs. ‘non - introgressed’ regions. This led Macholán et al. (2008) to hypothesi s e that introgression of Mmm Y chromosomes is a consequence of a genetic conflict between the X and Y ( with some autosomal elements likely also involved) . According to this hypothesis, the Mmm Y is thriving on the naïve Mmd background (or, if the Y introgression had been preceded by another, enabling, factor, the Mmm Y thriving on the altered Mmd background) and hence spreads at the expense of the Mmd Y . Though often viewed rather as an exception than a rule ( Campbell & Nachman , 2014; Jones & Searle , 2015), a r ecent study of Ďureje , Macholán, Baird, and Piálek (2012) has suggested that the Y introgression may not be limited to the Czech - Bavarian portion of the HMHZ. (Presence of the Mmm Y in western Norway far behind the zone in Mmd territory, reported by Jones, Van Der Kooij, Solheim , & Searle [2010], does not seem to be consistent with movement of the chromosome across the zone .)

Here we present results of an unprecedentedly vast continual scan of a hybrid zone covering a much wider scale related to the dispersal ability of the organism under study. The power of this scan is illustrated by introgression of Y chromosome and sex ratio perturbations along the zone of secondary contact between the two house mouse subspecies . Specifically, we ask (1) I s Y introgression an exceptional/ local or a more widespread phenomenon? (2) I s this introgression a property of a particular Y chromosome or is inherently characteristic for Mmm Ys (in terms of advantage gain)? (Even if all Mmm Ys have advantage their benefit might not be universally the same, but can be ordered along a scale, and hence only the most fit will introgress.)

Figure 1 (a) A sketch of the HMHZ course in Europe (grey curve) redrawn from Baird and Macholán (2012) ; the study area is depicted with black rectangle; (b) detail of the area with sampling localities.

Before answering these two questions, we have first to determine the HMHZ course. Contrary to the southern parts of the HMHZ (from Austria to Bulgaria) where the zone position can be mostly explained by the presence of mo untain ridge s (e.g., Dinaric Alps, Balkan Mts . ) keeping the mouse genomes separate ( Macholán, Kryštufek, & Vohralík, 2003; Vanlerberghe et al. 1988 ), no such clear geographic barriers are seen in the area between the Baltic Sea and the Al p s Notwithstanding the course of the European HMHZ is believed to be at least roughly known (Boursot, Auffray, Britton - Davidian, & Bonhomme, 1993; see Baird & Macholán, 2012, for review), we are still largely lacking data on precise geographic position of th e HMHZ in Central Europe. Yet this knowledge is a prerequisite (i) for future studies that will avoid biases in cline analyses due to unknown zone orientation; (ii) for differentiating between systematically uniform, polymorphic and

stochastic effects on a continual scale; and (iii) for setting up a reference geo - coordinated position of the zone centre in order to detect cline movement in future.

To address the abovementioned tasks , we scanned over 7300 individuals across a huge geographic area covering 266 ,539 km 2 between the Baltic Sea and North Tyrol using a set of diagnostic loci. We show that the HMHZ across the study area is rather complicated even at the global scale, and the unidirectional introgression of the Mmm Y chromosome into Mmd territory is w idespread – at least in Central Europe.

2 MATERIAL AND METHODS

2.1 Sampling

Th is study cover s a 266,539 km 2 area ( 377 km × 7 07 km) embracing an  900 km long portion of the HMHZ running from the Baltic Sea coast through former East Germany and western Bohemia ( Czech Republic) to the northern slopes of the Alps in southern Bavaria and Lower Austria (Fig ure 1 b ). The total sample consisted of 7440 mice ( 3522 males and 3918 females). Genetic analyses were carried out in 7 270 mice ( 3431 males and 3839 females) captured at 804 localities . As a Y chromosome marker , we used an 18 bp deletion in the Zfy2 gene located in the non - recombining region of the chromosome ( N = 32 86 ) which is fixed in Mmm and absent in Mmd (Nagamine et al. , 1992; Orth et al. , 1996) . For comparison and to precisely detect the HMHZ course across the study area, we scored up to 4 4 autosomal and X - linked markers ( N = 7 270 ) . Since these diagnostic loci we re used for calculating a hybrid index (HI = the proportion of Mmm alleles ) we refer to them as ‘ HI markers ’ . HI quantifies the level of genomic admixture ranging from 0 ( parental Mmd ) to 1 ( parental Mmm )

To de scribe and depict the Y chromosome introgression pattern we employed the spatially explicit Bayesian model - based clustering software Geneland v. 4.0.6 ( Guillot, Mortier, & Estoup, 2005 ). We simplified the analysis by limiting the number of clusters to K = 2, i.e. the number of subspecies present in the study area. At least t hree independent MCMC runs with 5,000,000 iterations were carried out for individual genotypes . In all cases , the first 25% iterations were discarded as burn - in . The spatial model included no uncertainty ascr ibed to geographic coordinates and no null alleles were allowed. Both

correlated and uncorrelated allele frequency models were applied ; however, the results were invariant to this aspect of the model .

A previous study of the Czech - Bavarian portion of the HMHZ indicated introgression of the Mmm Y is accompanied by differences in the census sex ratio (Macholán et al. , 2008). In the current study we define an ‘ introgressed population ’ in two ways. First, w e follow a rather extreme position considering as introgressed each Mmd population sample (i.e. of HI less than 0.5) harbouring at least one Mmm Y chromosome. The second approach is based on combination of the curves of the Geneland - estimated centre based on the HI markers and that of the Y chromosome (i.e. , areas assigned to Mmd with the HI markers

and to Mmm based on the Y marker). In this way we delimit three regions: (i) the ‘ DY D region ’ , defined either as all areas with prevalence of Mmd alleles and n o Mmm Y present or as all areas assigned with Geneland to Mmd based on both the HI and Y markers; (ii) the ‘ M region ’ , i.e. all areas with prevalence of Mmm alleles (HI > 0.5) or those assigned

with Geneland to Mmm based on both types of markers; and (iii) the ‘ DY M region ’ defined as described above. Within these regions we calculated sex ratios . The total sample used for this task comprised 7396 individuals (3497 males, 3899 females). The e xact binomial test was us ed to detect deviations of census sex ratios from parity. Symmetry of Y chromosome introgression in both directions across the HMHZ was tested using G - test with the Yates correction The tests were performed in R statistical environment (R Co r e Team, 2018). Variances of sampling sizes within regions and hybrid zone partitions were tested with Kruskal - Wallis test using Statistica (TIBCO Software Inc. , 2018).

2.2 Sry sequencing

I n total , we sequenced 79 males : 30 Mmm , 31 Mmd , 14 Mmd with introgressed Mmm Y chromosome, four ‘ classical laboratory strains ’ , namely A/J, C57BL6/J, C3Ha, and C3Hb , and two laboratory strains derived from M. spretus (SMON) and M. macedonicus (SBX), respectively, which were used as outgroups ( see https://housemice.cz/en for details) . We amplifie d a 1,277 - bp fragment upstream of the HMG box of the Sry gene (Gubbay et al. , 1990) including a part of the inverted repeated flanking region (Gubbay et al. , 1992), using primers F6685 and R7920 published in Nachman and Aquadro (1994). DNA was amplified in 35 cycles following a 15 - min pre - heating stage at 95  C. Each cycle consisted of 30

second s at 94  C, 1.5 min at 57  C, and 2 min at 72  C. The total volume per sam ple

contained 5 µl of 2x Qiagen master mix, 0.3 µl of each primer (10 mM), 2.4 µl of H 2 O, and 2 µl of DNA.

W e removed the (CA) n microsatellite from the data since ascertaining accurate sequence of this highly variable repeat appeared unreliable. Hence, after including the outgroup sequences the final aligned sequences were 1,054 bp long. P hylogenetic trees were inferred using MEGA 7.0.26 ( Kumar, Stecher, & Tamura, 2016). For the maximum likelihood analysis , we employed the HKY model ( Hasegawa , Kishino, & Yano, 1985 ) selected with jModelTest 2 v2.1.6 ( Darriba, Taboada, Doallo, & Posada, 2012; Guindon & Gascuel , 2003 ) under AICc (Hurvich & Tsai , 1989 ; Sugiura, 1978 ), BIC (Schwarz , 1978), and decision theory selection ( Minin, Abdo, Joyce, & Sullivan, 2003) . The CIPRES Science Gateway ( Miller, Pfeiffer, & Schwartz, 2010) was employed for running jModelTest program. To improve searching for the best tree, an extensive subtree pruning and regrafting procedure (Felsenstein , 2004) was applied . A moderate stringency of optimi s ation with respect to branch lengths and improvements in log likelihood values (branch swap filter) was used as a compromise between explored search space and computation burden.

2.3 Microsatellites

In total, 888 males from a rea of Czech - Bavarian and north - eastern Bavaria area were scored for 6 microsatellite loci using primers designed by Václav Janou š ek (Pavel Rubík, unpublished thesis). Forward primers were labelled with fluorescent labels on 5’ ends (primer sequences and t ype of labelling available in Supplementary Table S1). DNA amplification was performed using the Qiagen Multiplex PCR kit. All reactions were carried out in 5  l final volumes using 10 ng of DNA template. Microsatellites were analysed in one multiplex. The PCR conditions were: 95 °C for 15 min followed by 30 cycles of 95 °C for 30 s, 51 °C for 90 s, 72 °C for 30 s and the final extension at 60°C for 30 min. Fragment sizes were genotyped using 3130x/Genetic Analyzer (Applied Biosystems) and manually scored u sing GeneMapper v. 3.7 (Applied Biosystems).

Since all the scored loci are located in the nonrecombining region of the Y chromosome and hence they are not independent, common approaches such as ordination analysis

(principal component or coordinate analysis, multidimensional scaling etc. ) or clustering using STRUCTURE or similar programs are inappropriate for our data . Another problem with these methods is the absence of any model of allele relatedness. For example, alleles 100 and 102 are likely to be more related than alleles 100 and 120 yet all are treated as completely independent by both PCA - like and STRUCTURE - like programs .

Therefore, we adopted an alternative approach to processing the microsatellite data in which we treat each Y chromosome as a single haplotype: hence, for example, the {80,96,82,100,120,108} haplotype is considered one step different from the {80,96,82,100, 120,110} haplotype. For all 888 Y chromosomes we found 353 unique encodings (haplotypes). The commonest Y haplotype was shared by 55 males. In the following step we computed all pairwise Euclidean distance s between the haplotypes scaled relative to the var iance of each microsatellite and taking into account structure. The distances not exceeding a threshold value, dY , then represent edges joining sets of vertices (haplotypes). For dY = 0 each unique Y haplotype forms its own cluster. As dY increases, a haplotype is allowed to cluster with ‘similar’ haplotypes (e.g., ones that differ by one repeat at one locus). As dY further increases, more and more distant haplotypes are allowed to cluster together and thus the number of distinct clusters drops , eventually leading to over - merging. The microsatellite data were processed using Mathematica v. 11.3 (Wolfram Research Inc., 2018).

3 R ESULTS

3.1 The course of the HMHZ

Although the global pattern of the HMHZ course across the area under study s eems to roughly coincide with the pattern inferred in previous studies (Fig ure 1a), zooming in points to substantial differences. The first deviation appears south of the 52 nd degree of latitude (north of the 5700th y coordinate in Figure 1) where the zone curves westwards to bend sharply southwards around the 51 st parallel (south of 5700) reaching the slopes of the Ore Mountains ( Kr ušné hory in Czech, Erzgebirge in German ) on the border between north - western Bohemia and southern Saxony (Fig ure s 1b and 2 a ). The second departure from the global pattern appears on the border between Bohemia and north -

eastern Bavaria where the zone first follows the Upper Palatine Forest (Český les/Oberpfälzer Wald) ridge up to its south - east ern margin and then makes an almost right - angle turn to the south - west (Fig ure 2 a ). As a result, instead of a smooth, more - or - less linear course between an area east of Berlin in the north - east and Munich in the south - west, the zone makes two elbow - like deflections , one westward and one eastward.

Figure 2 Map of the probability of each individual´s membership either to M. m. musculus (red colour) or to M. m. domesticus (light yellow) based on genotypes at the HI markers (a) and Y chromosomes (b). The level contours show the spatial changes in assignment values. For comparison, the course of the zone inferred from the HI markers is shown as bold blue line.

3.2 Y chromosome introgression

As shown in Fig ure 2 b , introgression of Mmm Y chromosomes into Mmd territory is overwhelming : while of 700 sampled sites only 5 Mmm localities harbour ed at least one Mmd Y , 192 Mmd localities harboured at least one Mmm Y and this asymmetry is highly

significant (G - test = 221.49, p < 2.2e - 16 ). Invasion of the Mmm Y is not homogenesous along the HMHZ course inferred with the HI markers , the largest being in Saxony, Thuringia, and Saxony - Anhalt (the central part of Fig ure 2 b ; cf. also Fig ure 1b ) and west of the Czech - Bavarian border , respectively . In the former area, for example, as many as 26 Mmm Y chromosomes , contrasting with on ly a single Mmd Y , were found in Gniebitz near Trossin (Nordsachser District), about 36 km west of the zone centre, and one Mmm Y appeared even 39 km west of the centre ( Starkenberg, Altenburger Land Distr.). A similar degree of introgression was revealed within the Czech - Bavarian part of the study area: the most distant site with introgressed Mmm Y chromosomes was Plössen (Bayreuth Distr.), a locality as far as 49 km west of the zone centre, where all seven genotyped males possessed the Mmm Ys .

There is an interesting area of ambiguity just south of the Czech - Bavarian introgression region (i.e., roughly south of the 5500th y coordinate in Fig ure 2 b). This area is a mosaic of pure Mmd localities interspersed with polymorphic sites with both types of Y chromosome. This suggests a different, more diffuse and stochastic, introgression pattern.

3.3 Sex ratio

As expected, the more stringent definition of the DY M region as a group of Mmd localities with introgressed Mmm Ys ma d e this category to embrace higher numbers of individuals than that based on the Gen e land estimate . Nevertheless, both methods revealed similar results pointing to female - biased SR in the non - introgressed region s (DY D , M) contrasting

with more balanced SR in the DY M region ( Geneland based results not shown ). Wh ile the

census sex ratio was significantly female - skewed in the DY D and M regions the DY M region was not significantly differe nt from parity (Table 1).

Table 1 Census s ex ratio s (SR) , expressed as proportion of males, in the whole data set . M, F = number of males and females, respectively; C.I. = 95% confidence intervals. A s DY M we consider any population of predominately Mmd background, i.e. with hybrid index HI < 0.5, harbouring at least one Mmm Y chromosome (see Material and Methods for details on the definition of all th re e regions).

Region M F SR C.I. p

DY D 734 916 0. 4448 0.421 – 0.469 8.19E - 06

DY M 1256 1271 0. 4970 0.477 – 0.517 0.7806

M 1507 1712 0. 4681 0.451 – 0.486 0.0003

However, it could be argued that the data are dominated by the large sample collected from the Czech - Bavarian portion of the HMHZ which represent s more than 5 0% of all individuals under study and so the results can be biased . Therefore, we partitioned the data to the ‘ Czech ’ and ‘non - Czech’ parts; the latter was then divided into northern and southern part. In this way we divided the total data set to three parts: ‘Northern’, ‘Central’ , and ‘S outhern’ . Since the sample sizes dropped substantially due to this partitioning, especially in the ‘ N orthern’ and ‘ S outhern’ part, the deviations from parity in

the DY D and DY M , regions appeared insignificant except of that in the DY D region in the ‘Southern’ partition; nevertheless, the trend remained the same as in the whole data set, the only exception being the ‘ S outhern’ Mmm region with higher number of males than females (Table 2).

Table 2 Census sex ratios (SR) in three partit ions: ‘ N orthern’, ‘ C entral’, and ‘ S outhern’ (see Material and Methods); M and F = number of males and females, respectively; C.I. = 95% confidence intervals.

Area Region M F SR C.I. P

DY D 205 241 0.4596 0.413 – 0.507 0.0974

North ern DY M 264 273 0.4916 0.449 – 0.535 0.7300 M 390 443 0.4783 0.444 – 0.512 0.2177

DY D 425 534 0.4432 0.411 – 0.475 0.0005

Central DY M 737 738 0.4997 0.474 – 0.525 1.0000 M 869 1059 0.4507 0.428 – 0.473 0.0000

DY D 104 141 0.4245 0.362 – 0.489 0.0213

South ern DY M 255 260 0.4951 0.451 – 0.539 0.8601 M 248 210 0.5415 0.497 – 0.588 0.0837

Another source of bias can be sample size . We can, for example, expect males , as the more dispersing sex in house mice , to dominate smaller samples. Indeed, we found the proportion of males to be significantly negatively correlated with sample size ( R 2 = 0.0050; p = 0.0455) . However, no significant differences in sample sizes were revealed among the regions within each par tition (Kruskal - Wallis test: p  0.05 for all three partitions ). We can thus conclude that varying sample sizes are unlikely to be responsible for the differences in SR between the regions.

3. 4 S equencing

As shown in the maximum likelihood tree inferred from Sry sequences (Supplementary Figure S2) , the males form two clusters, Mmm and Mmd . As expected, the Mmm clade also includes the predominantly Mmd - derived classical laboratory strains A/J, C57BL , and C3H known to bear Mmm - type Y chromosome and males of predominately Mmd background carrying introgressed Mmm Ys. Both clusters are highly homogeneous, revealing no internal phylogenetic structure.

3. 5 M icrosatellites

When all 353 unique haplotypes a re allowed to merge into two clusters the resulting groups more or less correspond to Y chromosome types discriminated with the diagnostic Zfy2 gene: only  1% of haplotypes assigned to the ‘eastern’ group had Mmd Ys and  2%

68 of haplotypes assigned to the ‘western’ group had Mmm Y chromosomes (data not shown) . With decreasing dY more and more clusters appear, the process starting within Mmm territory. Figure 3 depicts geographic distribution of 12 haplo type groups. In Mmd , there are two main groups, one restricted to the northern and western parts of the area under study (‘blue haplotypes’) and the other occurring in the central and southern parts (‘cyan haplotypes’). Other haplotypes are local l y restricted. In Mmm , there are three dominant groups . While the most widespread ‘red’ and a bit less common ‘orange’ haplotypes are introgressing far to the south in Mmd territory, the ‘yellow’ haplotypes are, with few exceptions, restricted to the invasion salient stretching between the northerly Ore Mts. and the southerly Upper Palatine Forest (cf. Figure 2a). Again, o ther haplotypes are either locally restricted or do not show a clear geographic pattern (Figure 3)

Figure 3 The border area between western Bohemia, Czech Republic, and north - eastern Bavaria, Germany (insert); large figure depicts position of Y chromoso mes clustered into 12 haplo groups . Grey lines = state borders; b lack line s = hybrid zone centre.

4 DISCUSSION

4.1 HMHZ course

As introduced above, tension zones should tend to minimi s e their lengths ( Barton 1979; Barton and Hewitt 1985; Key 1968). So why the HMHZ does not follow a straight line across Europe? One possible explanation is that the zone is affected also by extrinsic selective forces. For example, ranges of the two mouse subspecies can be influenced by climatic conditions, namely by the bounda ry between oceanic and continental climate zones (Boursot et al. 1984; Hunt & Selander, 1973; Klein, Tichy, & Figueroa, 1987 ; Serafi ń ski, 1965; Thaler, Bonhomme, & Britton - Davidian, 1981; Zimmermann, 1949 ). However, the scale of the climatic transition seems to be too wide to maintain such a narrow hybrid zone ( Boursot et al. , 1993) . Moreover, the two gradients, ecological and genetical, are not coincident as pointed out already by Kraft (1985) and further discussed by Baird and Macholán (2012). Hence al though we cannot a priori rule out a potential influence of some climatic factors on house mouse populations, especially in northern areas, in the absence of convincing evidence we should search for other causes shaping the HMHZ course in Europe.

Another t heoretical prediction is that inasmuch as tension zones are not located at a particular environmental gradient, they can move until being trapped by a geographical barrier or in an area of low population density ( Barton, 1979; Hewitt , 1975, 19 8 9). Hence th e current position of the zone could reflect either presence of physical barriers, a consequence of historical contingencies or simply represents a transitional stage. All three possibilities may contribute to the zone dynamics on a global scale and even ( intricately interweaved) on a local scale. In the context of the present study the most obvious physical barriers are forested mountain ridges along the border between Germany and Czech Republic. Larger forests are known to hamper house mouse dispersal (Ze jda , 1975). This barrier was further strengthened by a drastic decrease of human population densities in these areas after the World War II and sealing off the frontier after 1948. In o ther parts of the HMHZ the factors affecting its position are less clear and will be analysed elsewhere.

4.2 M. m. musculus Y chromosome introgression

Here we showed that, in downright contradiction to theoretical expectations, introgression of the Mmm Y chromosomes into the Mmd range is almost ubiquitous (at leas t) in Central Europe. Given the magnitude of this phenomenon it is interesting to look at areas with no introgression. One apparent example seems to be the area north of Munich (bottom left part of Fig. 2 b ). Indeed, absence of any Y chromosome introgression in this region was reported by Tucker et al. (1992). This could be explained by the barrier effect of the Moosach River (not the ‘ floodplains of the Isar River ’ suggested by Sage, Whitney, and Wilson [19 86]) and the vast forest area west of Freising. However, a closer look reveals a scatter of previously studied localities (Sage et al. 1986; Teeter et al. 2008; Tucker et al. 1992) with Mmm Y chromosomes introgressing up to about 7 km into the Mmd range (E bertspoint, Geselthausen, Giggenhausen, Massenhausen, Neufahrn, Thalhausen). Moreover, at more recently sampled sites west and south of Munich the Mmm Y introgression was found to be even deeper. So, the only regions with no Y chromosome introgression appe ar in northern parts of the study area, most notably those south of Berlin (ca. 52 nd parallel ; coordinate 5750 in Fig. 2 b ) and north of Berlin (ca. 53 rd parallel ; coordinate 5850 in Fig. 2 b ).

However remarkable this may seem, the glaring differences in th e degree of Mmm Y introgression are, in fact, not astounding. We may hypothesi s e that either different Mmm Y chromosomes encounter the same Mmd genetic background in different p ortions of the HMHZ or vice versa (we cannot rule out a third possibility of me eting both different Mmm Y ’ s and different Mmd backgrounds either). Yet the discordant introgression pattern may not require genetic differences between local consubspecific populations. If a genetic element (notwithstanding if selfish or unselfish) is adv antageous on the alien genetic background, upon secondary contact it is predicted to quickly introgress across the hybrid zone and spread far away from it ( Barton & Bengtsson, 1986; Barton & Gale, 1993; Barton & Hewitt , 1985; Piálek & Barton , 1997). However, if these loci are tightly linked to barrier genes , they may be unable to quickly recombine or segregate away from their background. Then it is just a matter of time when these ‘ ticking bombs ’ disengage themselves from linkage and launch th eir introgressive spread. And because recombination is random introgression is not expected to be homogeneous in space along

71 the whole zone of contact. Instead, advancing alleles may form spatial irregularities like the s alients we see in Fig. 2 b ( Ibrahim, Nichols, & Hewitt, 1996; Macholán et al. , 2008, 2011).

The role of geographic features as barriers to Y chromosome introgression is most conspicuous in the hilly and forested frontier area between western Bohemia and north - eastern Bavaria ( Upper Palatine Forest Mts. ) . Due to this barrier Mmm Y chromosomes can only intrude into th e area west of these mountains either from the south or the north or from both directions . While Figure 3 appears to reject the first possibility in favour of the second, according to the Geneland - based results ( Figure 2b ) Mmm Ys introgress from both directions. The microsatellite data point to an interesting difference in t he Mmm Y introgression pattern in north - eastern Bavaria (Figure 3): while the transition is very stee p in the northern part, between the Ore and Upper Palatine Forest Mts. (see also Macholán et al. 2008) , it is rather diffuse southwards. This contrast appears to be coincident with the distribution of two widespread Mmd Y chromosome types (blue vs. cyan haplotypes in Figure 3 ) .

4.3 Causes and phenotypic correlates of the introgression

Macholán et al. (2008) showed that in localities without introgressed Y chromosomes (DY D and M regions both in the cited and present papers) sex ratio is si gnificantly female biased while in Y - introgressed localities the ratio is close to parity and significantly different from other two regions. These differences were explained as a result of an ongoing arms race between sex chromosomes (with some autosomal elements likely to be also involved). The SR perturbations were confirmed in this study on a much larger data from the same portion of the HMHZ comprising almost twice as many individuals than the original set used by Macholán et al. (2008). In other areas sample sizes were smaller which could explain the lack of significance in most comparisons (Table 2). However, as indicated by the male - biased SR close to the 5% significance level in the non - introgressed Mmm (M) region the genetic conflict may not be a u niversal or sole trigger of the Y introgression . This finding seems to be in agreement with a study evidencing phenotypic polymorphism

expressed diversely in different phenotypic traits and varying across the different hierarchical geographic scales ( Martincová, Ďureje, Kreisinger, Macholán, & Piálek, 2019).

The massive and widespread introgression is surprising since it violates Haldane´s rule predicting that it is the heterogametic sex that is preferentially affected by hybrid incompatibilities. Resu lts of the study by Britton - Davidian, Fel - Clair, Lopez, Alibert, and Boursot (2005) from Denmark seem to be consistent with this prediction. However, the same study revealed that the homogametic sex may be affected as well since females were significantly underrepresented in the sex ratio at birth in crosses between Danish Mmm and Mmd mice (231 males, 180 females; SR ratio = 562; p = 0.562; Pr(Bin) = 0.007; see Macholán et al. [2008] for details on recalculation). The crossing data of Britton - Davidian et al . (2005) suggest, however, that both sexes are adversely affected, although in different ways. Moreover, as pointed out by Macholán et al. (2008) crosses between inbred Czech Mmm and inbred French Mmd , also described in Britton - Davidian et al. (2005), reve aled that F1's sired by Czech males were not infertile. These crosses may have involved genetic backgrounds more similar to the current Czech - Bavarian contact than the Danish crosses, and raise the possibility of a unidirectional breakdown of Haldane's rul e facilitating Mmm Y introgression.

The unidirectional Y chromosome introgression can be facilitated in several ways. For example, Albrechtová et al. (2012) found that whereas natural hybrids from the Czech - Bavarian transect possessing Mmd Ys have signific antly lower sperm count and motility this handicap is more than rescued in Mmd hybrids with introgressed Mmm Y chromosomes. Likewise, studies focusing on sperm quality parameters in 31 recombinant inbred lines (Martincová , Ďureje, Kreisinger, Macholán, & Piálek, 2019) and F1 hybrids between 29 wild derived strains (Martincová, Ďureje, Baird, & Piálek, 2019) showed decreased frequency of dissociated sperm heads (DSH) in males carrying Mmd X (or mtDNA) and Mmm Y chromosomes and, conversely, increased DSH fre quency in males with Mmm X (mtDNA) and Mmd Ys. This results are consistent with the spread of the Mmm Y chromosome across the HMHZ.

AUTHOR CONTRIBUTION

The study was designed by MM and JP; the data were gathered by MM, AF, IM, PM, PR, ĽĎ, EH, and PKT, and analysed by MM, SJEB, IM, and JP. MM , SJEB, JP, and IM contributed to writing the paper.

REFERENCES

Albrechtová, J., Albrecht, T., Baird, S. J. E., Macholán, M., Rudolfsen, G., Munclinger, P. ... Piálek, J. (2012). Sperm related phenotypes implicated in both maintenance and breakdown of a natural species barrier in the house mouse. Proceedings of the Royal Society B – Biological Sciences , 279 , 4803 – 4810. doi: 10.1098/rspb.2012.1802

Baird, S. J. E., & Macholán, M. (2012). What can the Mus musculus musculus/M. m. domesticus hybrid zone tell us about speciation? In M. Macholán, S. J. E. Baird, P. Muncinger & J. Piálek (Eds.), Evolution of the house mouse (pp. 334 – 372), Cambridge, UK: Cambridge University Press.

Baird, S. J. E., Ribas, A., Macholán, M., Albrecht, T., Piálek, J., & Goüy de Bellocq, J. (2012). Where are the wormy mice? A reexamination of hybrid parasitism in the European house mouse hybrid zone. Evolution , 66 , 2757 – 2772. doi: 10.1111/j.1558 - 5646.2012.01633.x

Barton, N. H. (1979). Gene flow past a cline. Heredity , 43 , 333 – 339.

Bart on, N. H., & Bengtsson, B. O. (1986). The barrier to genetic exchange between hybridising populations. Heredity , 56, 357 – 376.

Barton, N. H., & Gale, K. S. (1993). Genetic analysis of hybrid zones. In R. G. Harrison (Ed.), Hybrid zones and the evolutionary process (pp. 13 – 45), Oxford, UK: Oxford University Press.

Barton, N. H., & Hewitt, G. M. (1985). Analysis of hybrid zones. Annual Review of Ecology and Systematics, 16 , 113 – 148.

Bazykin, A. D. (1969). Hypothetical mechanism of speciation. Evolution , 23 , 68 5 – 687.

Boursot, P., Auffray, J. - C., Britton - Davidian, J., & Bonhomme, F. (1993). The evolution of house mice. Annual Reviews of Ecology and Systematics , 24 , 119 – 152.

Boursot, P., Bonhomme, F., Britton - Davidian, J., Catalan, J., Yonekawa, H., Orsini, P., .. . Thaler, L. (1984). Introgression différentielle des génomes nucléaires et mitochondriaux chez deux semi - espèces européennes de Souris. Comptes Rendus de l’Académie des Sciences – Series III – Sciences de la Vie , 299 , 365 – 370.

Bridle, J. R., Baird, S. J. E., & Butlin, R. K. (2001). Spatial structure and habitat variation in a grasshopper hybrid zone. Evolution 55 , 1832 – 843. doi: 10.1111/j.0014 - 3820.2001.tb00832.x

Campbell , P., & Nachman , M. W. (2014). X - Y interactions underlie sperm head abnormality in hybrid male house mice. Genetics , 196 , 1231 – 1240. doi: 10.1534/genetics.114.161703

Charlesworth , B., Coyne, J. A., & Barton, N. H. (1987). The relative rates of evolution of sex chromosomes and autosomes. The American Naturalist , 130 , 113 – 146.

Coyne, J. A. (1992). Genetics and speciation. Nature , 355 , 511 – 515. doi: 10.1038/355511a0

Coyne, J. A., & Orr, H. A. (1989). Two rules of speciation. In D. Otte & J. Endler (Eds.), Speciation and its consequences (pp. 180 – 207.) Sunderland, MA: Sinauer Associates.

Darriba, D., Taboada, G. L., Doallo, R., & Posada , D. (2012). jModelTest 2: more models, new heuristice and parallel computing. Nature Methods , 9 , 772. doi: 10.1038/nmeth.2109

Degerbøl, M. (1949). Gnavere, vol. 1. Copenhagen: Vort Lands Dyrel iv.

Dod, B., Jermiin, L. S., Boursot, P., Chapman, V. H., Nielsen, J. T., & Bonhomme, F. (1993). Counterselection on sex chromosomes in the Mus musculus European hybrid zone. Journal of Evolutionary Biology , 6 , 529 – 546. doi: 10.1046/j.1420 - 9101. 1993.6040529.x

Dod, B., Smadja, C., Karn, R. C., & Boursot, P. (2005). Testing for selection on the androgen - binding protein in the Danish mouse hybrid zone. Biological Journal of the Linnean Society , 84 , 447 – 459. doi: 10.1111/j.1095 - 8312.2005.00446.x

Dufk ová, P., Macholán, M., & Piálek, J. (2011). Inference of selection and stochastic effects in the house mouse hybrid zone. Evolution , 65 , 993 – 1010. doi: 10.1111/j.1558 - 5646.2011.01 222.x

Ďureje, Ľ., Macholán, M., Baird, S. J. E., Piálek, J., (2012). The mouse hybrid zone in Central Europe: from morphology to molecules. Folia Zoologica , 61(3 – 4) , 308 – 318. doi : 10.25225/fozo.v61.i3.a13.2012

Felsenstein, J. (2004). Inferring phylogenies . Sunderland, MA: Sinauer Associates, Inc.

Guillot, G., Mortier, F., & Estoup, A. (2005). Geneland: a program for landscape genetics. Molecular Ecology Notes , 5 , 712 – 715. doi: 10.1111/j.1471 - 8286.2005.01031.x

Guindon, S., & Gascuel, O. (2003). A simple, fa st and accurate method to estimate large phylogenies by maximum - likelihood. Systematic Biology , 52 , 696 – 704.

Gubbay, J., Collignon, J., Koopman, P., Capel, A., Economou, A., Munsterberg, A., ... Lovell - Badge, R. (1990). A gene mapping to the sex - determinin g region of the mouse Y chromosome is a member of a novel family of embryonically expressed genes. Nature , 346 , 245 – 250.

Gubbay, J., Vivian, N., Economou, A., Jackson, D., Goodfellow, P., & Lovell - Badge, R. (1992). Inverted repeat structure of the Sry locus in mice. Proceedings of the National Academy of Sciences of the USA , 89 , 7953 – 7957.

Haldane, J. B. S. (1922). Sex ratio and unisexual sterility in animal hybrids. Journal of Genetics , 12 , 101 – 109.

Hardouin, E. A., Chapuis, J. - L., Stevens, M. I., van Vuuren, J., Quillfeldt, P., Scavetta, R. J., … Tautz, D. (2010). House mouse colonization patterns on the sub - Antarctic Kerguelen Archipelago suggest singular primary invasions and resilience against re - invasion. BMC Evolutionary Biology , 10 , 325.

Harriso n, R. G. (1986). Patterns and process in a narrow hybrid zone. Heredity , 56 , 337 – 349.

Hasegawa, M., Kishino, K., & Yano, T. (1985). Dating the human - ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution , 22 , 160 – 174.

Hewitt, G. M. (1975). A sex - chromosome hybrid zone in the grasshopper Podisma pedestris (Orthoptera: Acrididae). Heredity , 35 , 375 – 387.

Hewitt, G. M. (1989). The subdivision of species by hybrid zones. In D. Otte & J. A. Endler (Eds.), Speciation and its c onsequences (pp. 85 – 110). Sunderland, MA: Sinauer Associates.

Hunt, W. G., & Selander, R. K. (1973). Biochemical genetics of hybridisation in European house mice. Heredity , 31 , 11 – 33.

Hurvich, C., & Tsai, C. (1989). Regression and time series model selecti on in small samples. Biometrika , 76 , 297 – 307.

Ibrahim, K. M., Nichols, R. A., & Hewitt, G. M. (1996). Spatial patterns of genetic variation generated by different forms of dispersal during range expansion. Heredity , 77 , 282 – 291. doi: 10.1038/sj.hdy.6880320

Janoušek V., Wang, L., Luzynski, K., Dufková, P., Vyskočilová, M., Nachman, M. W., ... Tucker, P. K. (2012). Genome - wide architecture of reproductive isolation in a naturally occurring hybrid zone between Mus musculus musculus and M. m. domesticus . Molecu lar Ecology , 21 , 2032 – 3047. doi: 10.1111/j.1365 - 294X.2012.05583.x

Jones, E. P., & Searle, J. B. (2015). Differing Y chromosome versus mitochondrial DNA ancestry, phylogeography , and introgression in the house mouse. Biological Journal of the Linnean Society , 115 , 348 – 361. doi: 10.1111/bij.12522

Jones, E. P., Van Der Kooij, J., Solheim, R., & Searle, J. B. (2010). Norwegian house mice ( Mus musculus musculus / domesticus ): distributions, routes of colonization and patterns of hybridization. Molecular Ecology , 19 , 5252 – 5264. doi: 10.1111/j.1365 - 294X.2010.04874 .x

Key, K. H. (1968). The concept of stasipatric speciation. Systematic Zoology , 17 , 14 – 22.

Klein, J., Tichy, H., & Figueroa, F. (1987). On the origin of mice. Anales de la Universidad de Chile , 5 , 91 – 120.

Kraft, R. (1985). Merkmale und Verbreitung der Hau smäuse Mus musculus musculus L., 1758, und Mus musculus domesticus Rutty, 1772 (Rodentia, Muridae) in Bayern. Säugetierkundliche Mitteilungen , 31, 1 – 13.

Kumar, S., Stecher , G., & Tamura, K. (2016). MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution , 33 , 1870 – 1874. doi: 10.1093/molbev/msw054

Macholá n, M., Baird, S. J. E., Dufková, P., Munclinger, P., Vošlajerová Bímová, B., & Piálek, J. (2011). Assessing multilocus introgression patterns: a case study on the mouse X chromosome in Central Europe. Evolution , 65 , 1428 – 1446. doi: 10.1111/j.1558 - 5646.2011 .01228.x

Macholán, M., Baird, S. J. E., Munclinger, P., Dufková, P. Bímová, B., & Piálek, J. (2008). Genetic conflict outweighs heterogametic incompatibility in the mouse hybrid zone? BMC Evolutionary Biology , 8 , 271. doi: 10.1186/1471 - 2148 - 8 - 271

Macholán, M., Kry š tufek, B., & Vohralík, V. (2003). The location of the Mus musculus / M. domesticus hybrid zone in the Balkans: clues from morphology. Acta Theriologica , 48, 177 – 188.

Macholán, M., Munclinger, P., Šugerková, M., Dufková, P., Bímová, B., Božíková, E., ... Piálek, J. (2007). Genetic analysis of autosomal and X - linked markers across a mouse hybrid zone. Evolution , 61 , 746 – 771. doi: 10.1111/j.1558 - 5646.2007.00065.x

Martincová, I., Ďureje Ľ., Baird, S. J. E., Piálek, J. (2019). Sperm quality parameters are increased and asymmetric in house mouse hybrids . bioRxiv 666511 . doi: 10.1101/666511

Martincová I., Ďureje Ľ., Kreisinger J., Macholán M., Piálek J. 2019. Phenotypic effects of the Y chromosome are variable and structured in hybrids among house mouse recombinant lines. Ecology & E volution, 9 , 6124 – 6137. doi: 10.1002/ece3.5196

Miller, M. A., Pfeiffer, W., & Schwartz, T. (2010). Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In Proceedings of the Gatew ay Computing Environments Workshop (GCE), New Orleans, LA , pp. 1 – 8.

Minin, V., Abdo, Z., Joyce, P., & Sullivan, J. (2003). Performance - based selection of likelihood models for phylogeny estimation. Systematic Biology , 52 , 674 – 683. doi: 10.1080/10635150390235494

Munclinger P., Božíková, E., Šugerková, M., Piálek, J., & Macholán, M. (2002). Genetic variation in house mice ( Mus , Muridae, Rodentia) from the Czech and Slovak Republics. F olia Zoologica , 51 , 81 – 92.

Nachman, M. W., & Aquadro, C. F. (1994). Polymorphism and divergence at the 5’ flanking region of the sex - determining locus, Sry , in mice. Molecular Biology and Evolution , 11 , 539 – 547. doi: 10.1093/oxfordjournals.molbev.a040133

Nagamine, C. M., Nishioka, Y., Moriwaki, K., Boursot, P., Bonhomme, F., & Lau, Y. F. C. (1992). The musculus - type Y chromosome of the laboratory mouse is of Asian origin. Gene tics , 3 , 84 – 91.

Orth, A., Lyapunova, E., Kandaurov, A., Boissinot, S., Boursot, P., Vorontsov, N., & Bonhomme, F. (1996). L’espece polytypique Mus musculus in Transcaucasie. Comptes Rendus de l’Académie des Sciences – Series III – Sciences de la Vie , 319 , 435 – 441.

Payseur, B. A., Krenz, J. G., & Nachman, M. W. (2004). Differential patterns of introgression across the X chromosome in a hybrid zone between two species of house mice. Evolution , 58 , 2064 – 2078.

Piálek, J., & Barton, N. H. (1997). The spread of a n advantageous allele across a barrier: The effects of random drift and selection against hetrozygotes. Genetics , 145 , 493 – 504.

Raufaste, N., Orth, A., Belkhir, K., Senet, D., Smadja, C., Baird, S. J. E., ... Boursot, P. (2005). Inferences of selection and migration in the Danish house mouse hybrid zone. Biological Journal of the Linnean Society , 84 , 593 – 616. doi: 10.1111/j.1095 - 8312.2005.00457.x

R Core Team (2018). R: A language and environment for statistical computing. R Foundation for Statistical Comput ing, Vienna, Austria. URL https://www.R - project.org/.

Sage, R. D., Whitney, J. B., III, & Wilson, A. C. (1986). Genetic analysis of a hybrid zone between domesticus and musculus mice ( Mus musculus complex): hemoglobin polymorphisms. Current Topics in Micro biology and Immunology , 127 , 75 – 85.

Schwarz , G. E. (1978). Estimating the dimension of a model. Annals of Statistics , 6 (2) , 461 – 464.

Serafi ń ski, W. (1965). The subspecific differentiation of the Central European house mouse ( Mus musculus L.) in the light of their ecology and morphology. Ekologia Polska, Seria A , 13 , 305 – 348.

Sugiura, N. (1978). Further analysis of the data by Akaike’s information criterion and th e finite corrections. Communication in Statistics – Theory and Methods , A7 , 13 – 26.

Teeter, K. C., Payseur, B. A., Harris, L. W., Bakewell, M. A., Thibodeau, L. M., O’Brien, J. E., ... Tucker, P. K. (2008). Genome - wide patterns of gene flow across a house m ouse hybrid zone. Genome Research , 18 , 67 – 76.

Teeter, K. C., Thibodeau, L. M., Gompert, Z., Buerkle, C. A., Nachman, M. W., & Tucker P. K. (2010). The variable genomic architecture of isolation between hybridizing species of house mice. Evolution , 64 , 472 – 485. doi: 10.1111/j.1558 - 5646.2009.00846.x

Thaler, L., Bonhomme, F., & Britton - Davidian, J. (1981). Processes of speciation and semispeciation in the house mouse. In R. J. B erry (Ed.), Biology of the house mouse (pp. 27 – 41). London, UK: Acadademic Press.

TIBCO Software Inc. (2018). Statistica (data analysis software system), version 13. http://tibco.com.

Tucker, P. K., Sage, R. D., Warner, J., Wilson, A. C., & Eicher, E. M. ( 1992). Abrupt cline for sex chromosomes in a hybrid zone between two species of mice. Evolution , 46 , 1146 – 1163. doi: 10.1111/j.1558 - 5646.1992.tb00625.x

Ursin, E. (1952). Occurre nce of voles, mice and rats (Muridae) in Denmark, with a special note on a zone of intergradation between two species of the house mouse ( Mus musculus L.). Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i Kjøbenhavn , 114 , 217 – 244. Vanlerberghe, F., Boursot, P., Catalan, J., Gerasimov, S., Bonhomme, F., Botev, B. A., & Thaler, L . (1988). Analyse génétique de la zone d’hybridation entre les deux sous - espèces de souris Mus musculus domesticus et Mus musculus musculus en Bulgarie. Genom e , 30 , 427 – 4 37.

Vijay, N., Bos su, C. M., Poelstra, J. W., Weissensteiner, M. H., Suh, A., Kryukov A. P., & Wolf, J. B. W. (2016). Evolution of heterogeneous genome differentiation across multiple contact zones in a crow species complex. Nature Communications 7:13195. doi: 10.1038/ncomms13195

Wolfram Research, Inc. (2018). Mathematica, Version 11.3, Champaign, IL.

Zejda, J. (1975). Habitat selection in two feral house mouse lowland populations. Zoologické listy , 24 , 99 – 111.

Zimmermann, K. (1949). Zur Kenntnis der mitteleuro päischen Hausmäuse . Zoologische Jahrbücher. Abteilung für Systematik, Ökologie und Geographie der Tiere, 78 , 217 – 322.

Supplementary Table S1 : Table of microsatellite primer sequences and labels

NAME F/R Sequence 5’ - 3’ Label Length Source 5036 F TGCTGTGGAAGTGAACAGAAA 6FAM 74 - 86 Rubík (unpublished thesis) R AACTAGCCAGGTCACCAGACA 5045 F TGAAATAAACCAGGGCAAAAA PET 109 - 124 Rubík (unpublished thesis) R ACATGATTGCTAACCCCTTCC 6132 F AAAGAAGAGCCAGGAGTGAGC NED 140 - 166 Rubík (unpublished thesis) R TTACCCAGCTGTTCTTCCCTT 7245 F GGGTCCTTAAAATTGGTTGCT PET 143 - 166 Rubík (unpublished thesis) R AGTAAAGGAGGCCGATCATGT 7322 F TGACCACTCTGGCTCATCTTT NED 154 - 184 Rubík (unpublished thesis) R CATGAGCTAATTTGCCTCTGC 7419 F CGTTCCAATATCAACCCCTTT NED 188 - 227 Rubík (unpublished thesis) R CTGTTGCAAAAGCAAAAGACA

Supplementary figure S2 : The maximum - likelihood tree based on sequences of a 1,277 - bp fragment upstream of the HMG box of the Sry gene including a part of the inverted repeated flanking region (see Material and Methods for details).

Paper I I

X chromosome control of meiotic chromosome synapsis in mouse inter - subspecific hybrids

PLOS Genetics , 10(2), e1004088 (2014)

Bhattacharyya T., Reifová R., Gregorová S., Šimeček P., Gergelitis V., Mistřík M., Martincová I. , Piálek J., Forejt J.

X Chromosome Control of Meiotic Chromosome Synapsis in Mouse Inter-Subspecific Hybrids

Tanmoy Bhattacharyya1, Radka Reifova1¤a, Sona Gregorova1, Petr Simecek1¤b, Vaclav Gergelits1, Martin Mistrik2, Iva Martincova3, Jaroslav Pialek3, Jiri Forejt1* 1 Mouse Molecular Genetics Group, Division BIOCEV, Institute of Molecular Genetics, Academy of Sciences of the Czech Republic, Prague, Czech Republic, 2 Institute of Molecular and Translational Medicine, Faculty of Medicine and Dentistry, Palacky´ University Olomouc, Olomouc, Czech Republic, 3 Research Facility Studenec, Institute of Vertebrate Biology, Academy of Sciences of the Czech Republic, Brno, Czech Republic

Abstract Hybrid sterility (HS) belongs to reproductive isolation barriers that safeguard the integrity of species in statu nascendi. Although hybrid sterility occurs almost universally among animal and plant species, most of our current knowledge comes from the classical genetic studies on Drosophila interspecific crosses or introgressions. With the house mouse subspecies Mus m. musculus and Mus m. domesticus as a model, new research tools have become available for studies of the molecular mechanisms and genetic networks underlying HS. Here we used QTL analysis and intersubspecific chromosome substitution strains to identify a 4.7 Mb critical region on Chromosome X (Chr X) harboring the Hstx2 HS locus, which causes asymmetrical spermatogenic arrest in reciprocal intersubspecific F1 hybrids. Subsequently, we mapped autosomal loci on Chrs 3, 9 and 13 that can abolish this asymmetry. Combination of immunofluorescent visualization of the proteins of synaptonemal complexes with whole-chromosome DNA FISH on pachytene spreads revealed that heterosubspecific, unlike consubspecific, homologous chromosomes are predisposed to asynapsis in F1 hybrid male and female meiosis. The asynapsis is under the trans- control of Hstx2 and Hst1/Prdm9 hybrid sterility genes in pachynemas of male but not female hybrids. The finding concurred with the fertility of intersubpecific F1 hybrid females homozygous for the Hstx2Mmm allele and resolved the apparent conflict with the dominance theory of Haldane’s rule. We propose that meiotic asynapsis in intersubspecific hybrids is a consequence of cis-acting mismatch between homologous chromosomes modulated by the trans-acting Hstx2 and Prdm9 hybrid male sterility genes.

Citation: Bhattacharyya T, Reifova R, Gregorova S, Simecek P, Gergelits V, et al. (2014) X Chromosome Control of Meiotic Chromosome Synapsis in Mouse Inter- Subspecific Hybrids. PLoS Genet 10(2): e1004088. doi:10.1371/journal.pgen.1004088 Editor: Bret A. Payseur, University of Wisconsin–Madison, United States of America Received August 9, 2013; Accepted November 19, 2013; Published February 6, 2014 Copyright: ß 2014 Bhattacharyya et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Funding: Support was provided by Premium Academiae of the Academy of Sciences of the Czech Republic, Czech Science Foundation Grant No. 13-08078S and by Grants Nos. LD11079 and CZ.1.05/1.100/02.0109 from the Ministry of Education, Youth and Sports to JF, and Czech Science Foundation Grant No. 206/08/0640 to JP. TB is a PhD student supported in part by the Faculty of Science, Charles University, Prague, Grant Agency of Charles University Grant No. 72109 and European Science Foundation ‘‘Frontiers of Functional Genomics’’ Grant No. SV/4118. IM is a PhD student supported by the Institute of Botany and Zoology, Masaryk University, Brno. MM was supported by European Commission project Biomedreg. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Competing Interests: The authors have declared that no competing interests exist. * E-mail: [email protected] ¤a Current address: Biodiversity Research Group, Department of Zoology, Faculty of Science, Charles University in Prague, Prague, Czech Republic. ¤b Current address: The Jackson Laboratory, Bar Harbor, Maine, United States of America.

Introduction We have chosen M. m. musculus and M. m. domesticus subspecies (hereafter, Mmm and Mmd) as model organisms to study Hybrid sterility (HS) is a postzygotic reproductive isolation mammalian HS (for review see [11–13]). Both subspecies diverged barrier restricting gene flow between the related taxa during from a common ancestor approximately 0.3 to 0.5 million years speciation. It is defined as a condition where two parental forms ago [14] and formed a hybrid zone across Europe after their fertile inter se produce a hybrid that is sterile [1]. One of the most secondary contact [15]. The repeated introgressions of Mmm genes interesting findings coming from previous studies is a dispropor- into Mmd genome and vice versa across their hybrid zone indicate tionately large effect of Chr X on reproductive isolation, particularly incomplete reproductive isolation between both young subspecies on hybrid sterility and inviability. The large X-effect was described [16,17]. Such early-stage model is superior in that it reduces the in diverse organisms, and evolutionary biologists designated it as risk of analyzing HS genes that evolved as a consequence and not one of the speciation rules [2–5]. Another speciation principle, as the cause of speciation after full reproductive isolation of the called Haldane’s rule [6], points to the empirical findings that related taxa [5,18]. Numerous genetic and genomic tools are hybrid inviability and sterility predominantly afflicts the heteroga- available for the mouse model, including the full genomic metic (XY or ZW) sex. The dominance theory originally proposed sequence of inbred strains representing both subspecies and by Muller [7] explained the sex-dependent effect on hybrid fitness additional 17 laboratory inbred strains [19] and a panel of 28 by the manifestation of recessive X-linked alleles in hemizygous XY mouse intersubspecific chromosome substitution (consomic) strains males but not in XX females [8–10]. carrying individual Mmm chromosomes or their parts on Mmd

PLOS Genetics | www.plosgenetics.org 1 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Mmm Author Summary F1 hybrid females homozygous for the Hstx2 allele and resolved the apparent conflict with the dominance theory of Genomes of newly emerging species restrict their gene Haldane’s rule. Based on detailed meiotic analysis of the mouse exchange with related taxa in order to secure integrity. model of intersubspecific F1 hybrids we propose that HS genes Hybrid sterility is one of the reproductive isolation operate on ‘‘sensitized’’ genetic background resulting from the mechanisms restricting gene flow between closely related, difficulties of proper meiotic synapsis of heterosubspecific autoso- sexually reproducing organisms. We showed that hybrid mal homologs and consequent epigenetic dysregulation of X-Y sterility between two closely related mouse subspecies is chromosomes [22]. Accordingly, classical HS genes Prdm9 [24,28] executed by a failure of meiotic synapsis of orthologous and Hstx2 [27] realize their HS-specific phenotypes by interacting, chromosomes in F1 hybrid males. The asynapsis of directly or indirectly, with the process of meiotic pairing and orthologous chromosomes occurred in meiosis of male synapsis of heterospecific homologs. and female hybrids, though only males were sterile due to trans-acting male-specific hybrid sterility genes. We located one of the two major hybrid sterility genes to a 4.7 Mb Results interval on Chromosome X, showed that it controls male sterility by modulating the extent of meiotic asynapsis and Fine mapping of Hstx2 and its role in HS asymmetry of using the inter-subspecific chromosome substitution reciprocal F1 hybrids strains we refuted the simple interpretation of dominance Dobzhansky-Muller incompatibilities (DMIs) between the na- theory of Haldane’s rule. A new working hypothesis posits scent species often result in asymmetry of HS or inviability of male sterility of mouse inter-subsubspecific F1 hybrids as a reciprocal F1 hybrids [27,29–31] although relatively little is known consequence of meiotic chromosome asynapsis caused by about their genetic control or mechanistic basis. Previously we the cis-acting mismatch between orthologous chromo- have shown that asymmetry in male sterility of reciprocal hybrids somes modulated by the trans-acting hybrid male sterility between Mmm mouse subspecies represented by the PWD/Ph genes. (hereafter PWD) inbred strain [32] and Mmd represented by the C57BL/6J inbred strain (hereafter B6) is controlled by the central region of Chr X (64.9 Mb–98.1 Mb, GRCm38). To localize the background [20]. A variety of commercially available antibodies locus responsible for HS asymmetry we crossed consomic F1 detecting meiosis-specific proteins and histone modifications females (B6.PWD-Chr X6B6) with PWD males. All 124 male permit immunodetection of subnuclear structures important for offspring carried B6/PWD heterosubspecific autosomal pairs meiotic chromosome synapsis and segregation [21,22]. while Chr X loci were either PWD or B6, depending on the We identified the first hybrid sterility gene in mice, hybrid recombination breakpoints. Testes weight (TW, range 56–186 mg) sterility 1 – Hst1 – as a polymorphic variant on Chr 17 between and sperm count (SC, 0–13.5 million) were used as surrogate for two laboratory strains, C57BL10/Sn and C3H/Di, both predom- QTL analysis of male fertility phenotypes. Their segregation inantly of Mmd origin (at that time still linkage group IX). When localized a hybrid sterility locus to the 34.6–35.7 cM (1.5-LOD mated with Mmm wild mice trapped in Central Bohemia near support interval) interval with the maximum LOD score 30 and 23 Prague, these crosses produced sterile or fertile male hybrids, at 34.8 cM for TW and SC. As shown in Fig. 1A–D all males that depending on their Hst1 alleles [23]. Recently, Hst1 was identified received the PWD allele at the DXMit87 locus had small testes by the forward genetics approach as PR domain containing 9 bellow 100 mg and little (below 106) sperm in ductus epididymis. This (Prdm9) [24] and later was shown to control meiotic recombination hybrid sterility locus causes complete sterility on F1 hybrid hotspots [25,26]. intersubspecific background, and we designate it hybrid sterility In a study of genetic architecture of F1 hybrid male sterility, the chromosome X 2, Hstx2. Earlier, we reported localization of the results of (Mmm6Mmd)6Mmd backcross predicted a minimum of locus at lower resolution in the (PWD6B6)6B6 backcross (Dzur- four independently segregating HS loci. However, QTL analysis of Gejdosova 2012). the data revealed only two strong HS loci, Hst1/Prdm9 and a locus To further refine the position of Hstx2, a new partial consomic on Chr X [27]. This paradox could be explained either by the strain B6.PWD-Chr X.1s was created with extended proximal action of multiple minor HS loci undetected by relatively low- interval of the Chr XPWD sequence compared to B6.PWD-Chr power QTL analysis or by different behavior of two major HS loci X.1 (for strain description see ref [20]). on the hybrid background. The latter alternative was supported in The borders of the PWD sequence of the introgressed Chr an experiment showing that these two HS loci are not sufficient to XPWD were compared to those of the existing proximal, central recapitulate the F1 HS phenotype on B6 (Mmd) genetic and distal partial consomic strains B6.PWD-Chr X.1, B6.PWD- background [22]. Moreover, for the first time a compelling Chr X.2 and B6.PWD-Chr X.3 [20] using high-resolution Mouse evidence was provided for the mechanism of HS, showing that Universal Genotyping Array (MegaMUGA) (Table S1). To aberrant meiotic pairing of heterosubspecific homologous chro- localize the region carrying Hstx2 on Chr XPWD, females of all mosomes and meiotic arrest are the consequence of intersubspe- four Chr X partial consomic strains were crossed with PWD males cific hybrid genetic background [22]. and the fertility of male offspring was examined (Fig. 2). The Here we report on the role of Chr X in male and female meiosis (B6.PWD-Chr X.16PWD)F1 and (B6.PWD-Chr X.36PWD)F1 in mouse intersubspecific hybrids. We localized the Hstx2 locus hybrid males were semifertile with testes weight comparable to controlling the asymmetry of HS in reciprocal intersubspecific F1 (B66PWD)F1 males, while (B6.PWD-Chr X.1s6PWD)F1 and hybrid males to a 4.7 Mb interval on Chr X and mapped three (B6.PWD-Chr X.26PWD)F1 were fully sterile with small testes autosomal loci that can abolish this asymmetry. We observed the (p,0.0001, t-test) and no sperm in ductus epididymis (Fig. 2). Thus predisposition of heterosubspecific homologs to asynapsis in male (B6.PWD-Chr.X.1s6PWD)F1 hybrids carried the Hstx2PWD allele and female meiosis as the initial step of intrameiotic breakdown of and fully reconstructed the HS phenotype of (PWD6B6) males, the sterile hybrids. The effects of Hstx2 or Hst1/Prdm9 on the showing meiotic arrest at epithelial stage IV and to lesser degree at degree of asynapsis in pachynemas of male but not female late pachytene/diplotene stage (Table S2). The position of Hstx2 intersubspecific hybrids concurred with the fertility of Mmm6Mmd was localized to the 4.7 Mb interval delineated by UNC30904273

PLOS Genetics | www.plosgenetics.org 2 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 1. Single QTL mapping of Hstx2 on Chr X. (A) QTL analysis of testes weight in the (B6.PWD-Chr X6B6)F16PWD cross showed a 1.5-LOD support interval between 34.6 cM to 35.3 cM on Chr X. (B) Distribution of testes weight of males carrying PWD or B6 allele of DXMit87 marker with LOD score 30. (C) QTL analysis of sperm count in ductus epididymis shows the same 1.5 LOD support interval as for testes weight. (D) Distribution of sperm count of males carrying PWD or B6 allele of DXMit87 marker (Chr X: 66.65 Mb, GRCm38) with LOD score above 20. doi:10.1371/journal.pgen.1004088.g001 for the distal end of B6.PWD-Chr X.1 PWD sequence and X single-recombinants with PWD centromeric end for fertility UNC30934795 for the distal end of B6.PWD-Chr X.1s (X: testing. The Hstx1 locus mapped within the interval spanned by 64,880,641–69,581,094, GRCm38). DXMit76 and DXMit143 (Fig. S1). To further localize Hstx1, we phenotyped all four B6.PWD-Chr Introgressed Hstx1PWD causes teratozoospermia in Mmd X partial consomics and found a high percentage of abnormal genome and maps to the same genomic region as Hstx2 sperm cells in B6.PWD-Chr X.1s compared to other three partial The Hstx1 locus in the proximal part of Chr XPWD causes male consomics and B6 males (p,0.05 t-test, Fig. 2). The analysis of sterility when introgressed onto the B6 background [33]. Contrary partial consomic strains independently confirmed the Hstx1 to the F1 hybrid meiotic arrest at late pachytene/diplotene stage localization to the same 4.7 Mb interval of Chr X that carries controlled by Hstx2 [22], Hstx1PWD in the B6 genome causes Hstx2. However, because B6.PWD-Chr X.2 males did not show postmeiotic breakdown and abnormal morphology of a fraction of high frequency of abnormal sperm in spite of their Hstx1PWD allele, non-functional sperm. Here we genotyped the male progeny of we assumed that Hstx1 needs to interact with another genetic females heterozygous for PWD and B6 form of Chr X from the factor from the proximal region of Chr XPWD to manifest the backcross generations 4–9 to B6 background and selected 71 Chr abnormal sperm phenotype (Fig. 2, see also [33]).

PLOS Genetics | www.plosgenetics.org 3 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 2. Fine mapping of Hstx1 and Hstx2 HS loci on Chr X using partial consomic strains. The partial consomic B6.PWD-Chr X.# females were crossed with B6 or PWD males for mapping Hstx1 and Hstx2, respectively. Testes weight and sperm count were used as fertility phenotypes. The borders of introgressed PWD sequence (black) were determined by MegaMUGA genotyping for B6.PWD-Chr X.1 (abbreviated here X.1), B6.PWD-Chr X.1s (X.1s) and B6.PWD-Chr X.2 (X.2). For B6.PWD-Chr X.3 (X.3) mapping see [20]. The map positions correspond to genome assembly GRCm38, megabase scale, for details see Table S1. doi:10.1371/journal.pgen.1004088.g002

Hstx1 and Hstx2 candidate genes the remaining genes, Aff2 carries five, Fmr1nb and Slitrk2 carry two, The 4.7 Mb Chr X candidate region of Hstx1 and Hstx2 loci 4930447F04Rik and Ctag2 carry one, and Fmr1 does not carry any carries 11 known protein-coding genes and 20 miRNA genes (Fig. non-synonymous substitution. Inspection of Sanger Institute S2). Of these, seven protein-coding genes, namely cancer/testis Mouse Genome Project (http://www.sanger.ac.uk/resources/ antigen 2 (Ctag2), RIKEN cDNA 4930447F04 gene mouse/genomes/) confirmed the same SNPs for PWK, a closely (4930447F04Rik), SLIT and NTRK-like family, member 2 related Mmm inbred strain. Search of miRNA sequences revealed (Slitrk2), RIKEN cDNA 4933436I01 gene (4933436I01Rik), fragile one SNP in the seed sequence of Mir743a, changing AAAGACA X mental retardation syndrome 1 homolog (Fmr1), fragile X in B6 to AAAGACG in PWD (Table 1). mental retardation 1 neighbor (Fmr1nb) and AF4/FMR2 family Reproductive isolation genes in Drosophila and in mouse have member 2 (Aff2) show high expression in adult testis. Of them, Aff2 been shown to evolve rapidly and to undergo positive selection is expressed pre-meiotically in spermatogonia, Fmr1 and Fmr1nb [37–39]. Three of the candidates for the Hstx1/2 locus, Ctag2, show expression in early prophase I, and Ctag2, 4930447F04Rik 4933436I01Rik and Fmr1nb, displayed an elevated rate of protein and Slitrk2 are expressed in meiotic and postmeiotic cells. Finally, evolution (Table 1). In particular, 4933436I01Rik is among the 4933436I01Rik is expressed in haploid cells. Sorted populations of most rapidly evolving genes on Chr X [40,41], showing weak but testicular cells from PWD and B6 strains and immature 14.5 dpp significant expression in primary spermatocytes and strong post- testes of their reciprocal hybrids did not show significant meiotic expression [42], https://www.genevestigator.com/gv/). differences in relative mRNA expression levels of six meiotic Fmr1nb, another possible candidate, shows high expression in pre- and/or postmeiotic genes (Fig. S3). All 20 miRNAs in the pachytene spermatocytes [43]. candidate region are expressed in male germ cells but do not undergo meiotic sex chromosome inactivation (MSCI) [34]). Only Intrasubpecific autosomal polymorphisms suppress the Mir465PWD cluster displayed a significant increase of asymmetry of HS expression in the first meiotic prophase of PWD and B6 sorted The ability of Hstx2B6 to rescue the meiotic arrest of Mmm6Mmd testicular cells (Figure 3A, B). The miRNA expression profiling of F1 hybrids is subject to intrasubspecific Mmm polymorphisms. While sterile (PWD6B6)F1 and fertile (B66PWD)F1 14.5dpp testes asymmetric male sterility of (PWD6B6)F1 hybrids depends on the showed 1.5- to 2-fold upregulation of Mir883b-3p, Mir465a/b/c-3p presence of the Hstx2PWD allele, another inbred strain derived from and Mir465a/b -5p in sterile males, while Mir743a, Mir743-5p, Mmm, known as STUS produces fully sterile F1 hybrid males with Mir880 and Mir465c-5p showed 1.2- to 4-fold down-regulation B6 mice regardless of the direction of the cross [44]. To map the (Figure 3C, D). STUS/PWD autosomal allelic variants that ensure full intrameiotic Re-sequencing candidate genes from PWD genomic DNA and arrest in males carrying Mmm Chr XB6, we genotyped 84 test-cross BAC clones [35] and inspection of the PWD exome sequence males from crosses of B6 females with (PWD6STUS)F1 or revealed seven non-synonymous substitutions of the (STUS6PWD)F1 males. QTL analysis of the sperm count 4933436I01Rik PWD allele compared to B6 (see also [36]). Of (binomial, sperm cells present or absent) revealed QTLs on Chr

PLOS Genetics | www.plosgenetics.org 4 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 3. Expression profiling of a cluster of MiRNA genes within the Hstx1/Hstx2 critical region. (A) Log fold-change of expression ratio of PWD versus B6 MiRNA genes in flow-sorted testicular cells. Significant overexpression of Mir465 cluster in PWD germ cells is shown in red. (B) Validation of Mir465 overexpression in PWD primary spermatocytes by qRT PCR. Data normalized to U6 non-coding RNA (C) Log fold-change of expression ratio of MiRNA genes in (PWD6B6)F1 versus (B66PWD)F1 (abbreviated PB6F1 and B6PF1) 14.5 d old testes. Significant upregulation in red (P,0.05). (D) qRT PCR validation of differences in Mir465 expression. Data normalized to Mir152. doi:10.1371/journal.pgen.1004088.g003

3, Chr 9 and Chr 13, while QTL for the testes weight mapped on Hstx2 affects meiotic pairing and spermatogenic Chr 3 and Chr 13 (Fig. 4). The reciprocal cross of (STUS6PWD) differentiation females with B6 males yielded only sterile male offspring without The meiotic arrest of (PWD6B6)F1 hybrid males is associated sperm in ductus epididymis (Table S3), strongly indicating that these with failure of proper synapsis of homologous heterosubspecific B6 autosomal QTLs interact with Mmm Chr X . Several interesting autosomes, delay of DNA double-strand break (DSB) repair on candidate genes with meiotic functions have been found in these unsynapsed autosomes and dysregulation of meiotic sex chromo- QTL regions, including Hormad1, Sycp1, H2afx or Msh3 (Table S4). some inactivation (MSCI) at the first meiotic prophase. However, Admittedly, 1.5-LOD support intervals of the QTLs proved quite full fertility and complete autosomal synapsis is restored when Chr large and none of the selected candidates displayed a dN/dS ratio 17 is PWD/PWD consubspecific on otherwise PWD/B6 F1 indicative of their rapid evolution. background [22]. Here we focused on the fertility parameters and

PLOS Genetics | www.plosgenetics.org 5 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Table 1. Missense SNPs of candidate genes in the Hstx1/Hstx2 critical region on Chr X.

Gene Symbol SNP positiona B6 PWD PWK dN:dSb

Ctag2 65 047 953 T G G 0.57 4930447F04Rik 66 303 564 A C C 0.54 Slitrk2 66 655 874 A G G 0.11 66 656 111 A G G Mir743 66 776 774 T C C - 4933436I01Rik 67 920 137 C T T 0.82 67 920 143 T G G 67 920 312 G T T 67 920 431 T A A 67 920 805 T A A 67 920 818 C T T 67 920 822 T G G Fmr1 - - - - 0.06 Fmr1nb 68 762 025 C G G 0.65 68 769 064 T A A Aff2 69 544 913 A G G 0.20 69 830 745 C T T 69 830 760 C G G 69 830 782 A T T 69 834 780 G A A

aSNPs for protein coding genes were extracted from the PWD exome sequence compared to B6 reference genome (GRCm38) and confirmed by classical re-sequencing. PWK SNPs were obtained from Sanger Institute Mouse Genome Project. bRate of protein evolution is based on one to one comparison with rat orthologs. (GRCm37). doi:10.1371/journal.pgen.1004088.t001

pachytene chromosome synapsis in F1 hybrid males differing at general phenomenon, not confined to the incompatibilities between the Hstx2 locus (Fig. S4A–E). The Hstx2PWD allele in (B6.PWD- B6 and PWD genome. Chr X.1s6PWD) hybrid males ensured full sterility, meiotic arrest at mid-late pachynemas, almost absent diplotene spermatocytes Hstx2 and Hst1/Prdm9 regulate male but not female and a lack of sperm. Immunostaining of SYCP3 and SYCP1 asynapsis of heterosubspecific homologs components of lateral and central elements of synaptonemal Asynapsis preferentially affects autosomal pairs with hetero- complexes or HORMAD2 protein revealed unsynapsed auto- subspecific homologs, and their pairing failure is strongly somes in .90% of pachynemas of both, (PWD6B6) and influenced by the Prdm9 and Hstx2 genes in sterile hybrid males (B6.PWD-Chr X1s6PWD) F1 hybrid males. The super-resolution ([22] and above). We asked whether the genetic control of meiotic structured illumination microscopy documented irregular spots of asynapsis differs between male and female gametogenesis of SYCP1 on some univalents and nonhomologous synapsis and/or intersubspecific hybrids. The pachytene chromosome asynapsis translocations (Fig. 5), resembling ‘‘tangles’’ observed in pachyne- was not observed in PWD and B6 spermatocytes, but occurred in mas with reduced frequency of DSBs [45]. In contrast, (B6.PWD- 14% and 29% of pachytene oocytes of the same genotype. In B6 Chr X.16PWD) males carrying Hstx2 were semifertile, with (PWD6B6)F1 hybrid females, 47.5% of pachynemas showed partial meiotic arrest at late pachytene stage. Only 34% of asynapsis, but contrary to the F1 hybrid males the frequency of pachynemas showed asynapsis of one or two pairs of autosomes asynaptic oocytes was not dependent on the Prdm9 and Hstx2 (Fig. S4A–E). It can be concluded that in F1 hybrid males the genotypes (Fig. 6A, B). The conclusion was reached from the B6 Hstx2 allele partially restores fertility and significantly reduces comparison of male and female meiosis in hybrids between the frequency of pachynemas with asynapsis and the number of particular consomics and PWD. Thus, 46% of (PWD6B6.PWD- unsynapsed autosomes per cell. Chr 17)F1 pachytene oocytes displayed asynapsis that was To test whether the occurrence of meiotic asynapsis is not limited completely absent in spermatocytes of the same genotype. to the (PWD6B6) strain combination, we checked chromosome Moreover 46.5% and 44% of oocytes of (B6.PWD-Chr synapsis in pachytene spermatocytes of (STUS6B6)F1 and X.16PWD)F1 and (B6.PWD-Chr X.1s6PWD)F1 hybrids showed (PWD6SCHEST)F1 hybrids. SCHEST is a wild-derived strain of asynaptic autosomes (Fig. 6B), compared to 34.1% and 96.4% of Mmd (J.P., unpublished). Both F1 hybrids were sterile, showing no pachynemas of the corresponding male genotypes. It can be sperm (STUS6B6) or few sperm (PWD6SCHEST, ,0.9 mil.) in concluded that contrary to male meiosis, Chr 17 and Hstx2 do not ductus epididymis. In both cases .90% of pachytene spermatocytes change the overall frequency of asynaptic pachynemas in female revealed multiple pairs of unsynapsed autosomes (Fig. S5A, B). meiosis of intersubspecific hybrids. However, detailed analysis of Thus, asynapsis in Mmm6Mmd intersubspecific hybrids is a more female hybrids consubspecific for Chr 17PWD showed a lower

PLOS Genetics | www.plosgenetics.org 6 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 4. Single QTL scan for autosomal loci supporting Hstx2 independent intrameiotic arrest of (Mmd6Mmm)F1 intersubspecific hybrids. (A) Testes weight QTLs (red) reached significance on Chrs 3 (marker UNC030163295, Chr3: 104,320,699) and 13 (JAX00357337 Chr 13:47,975,634) and QTLs for sperm count on Chrs 3, 9 (JAX00171568, Chr 9:56,491,601) and 13. Sperm count was evaluated as a binary trait (SC = 0, SC.0). (B) and (C) Additive effect of QTLs on testes weight and sperm count. For map positions and possible candidate genes see Table S4. doi:10.1371/journal.pgen.1004088.g004 number of unsynapsed autosomes per cell (p,0.01) when Chr 17 and Chr X homologs with matching heterosubspecific compared with the other intersubspecific F1 hybrid genotypes pairs in (PWD6B6)F1 pachytene oocytes and oocytes from the (Fig. 6C). Thus, Prdm9/Hst1 and/or some other genes on Chr 17 parental controls. Using the whole-chromosome DNA FISH we exert a limited effect on asynapsis in female hybrids as well. The also visualized Chrs 2, 16, 18, 19 and X. In (PWD6B6)F1 elevated incidence of asynaptic oocytes predetermined to elimi- pachynemas Chr 2 showed the lowest incidence of asynapsis. The nation in intersubspecific ovaries was reflected by a reduced ratio frequency of univalents of small autosomes 16, 17, 18 and 19 of diplotene/pachytene oocytes in ovarian cell spreads (Fig. 6D). varied between 18% and 49% in asynaptic pachytene oocytes. Strikingly, Chr X displayed the highest frequency (64%) of Heterosubspecific but not consubspecific homologs are asynapsis (Table 2). The asynapsis of consubspecific Chr 17PWD/PWD homologs sensitized to asynapsis in female intersubspecific hybrids dropped to zero in (PWD6B6.PWD-Chr 17)F1 oocytes, although as well the total frequency of pachynemas with asynapsis was the same as We have shown that consubspecific (PWD/PWD) homologous in (PWD6B6) hybrids. In (PWD6B6.PWD-Chr X.1s)F1 oocytes, autosomes evade asynapsis in otherwise heterosubspecific (PWD/ 69.9 Mb of the centromeric part of Chr X was consubspecific for B6) genomic background of hybrid males. The finding indicated a the PWD sequence, while the end of the chromosome, 101.4 Mb cis-type of asynapsis control based on some kind of mismatch in length, was PWD/B6 heterosubspecific. Nevertheless, the between orthologous chromosomes of Mmm and Mmd origin [22]. partial PWD homozygosity was sufficient to reduce Chr X Considering the difference between male and female hybrids in asynapsis from 64% down to 5.6% of pachytene oocytes (Table 2). the overall frequency of asynapsis and the male-limited effect of It can be concluded that asynapsis in intersubspecific female and HS genes we asked whether the mismatch of heterosubspecific male hybrids follows the same rule, depending on yet unspecified homologs lowering their synapsis efficiency also operates in female sequence incompatibility between individual homologs of Mmm meiosis. and Mmd origin. For this purpose we analyzed primary oocytes of female hybrids between PWD and chromosome substitution strains carrying Chr Pursuing the dominance theory of Haldane’s rule 17PWD, Chr X.1PWD or Chr X.1sPWD, respectively. We compared To explain Haldane’s rule of hybrid sterility, the dominance the efficacy of meiotic synapsis of consubspecific (PWD/PWD) theory posits the recessive nature of X-linked variants that disrupt

PLOS Genetics | www.plosgenetics.org 7 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 5. Super-resolution microscopy of synaptonemal complexes on spreads of (B6.PWD-Chr X.1s6PWD) pachytene spermatocytes. (A) Detail of a pachytene spermatocyte of a sterile male immunostained by SYCP3 (red) and SYCP1 (green) antibodies. Properly synapsed bivalents (arrows) show two parallel threads of transverse filaments decorated by SYCP1 antibody which form the central region embedded in SYCP3 lateral elements. Unsynapsed chromosomes lack transverse filaments but display some irregular SYCP1 spots (arrowheads). (B) Example of a nonhomologous pairing and/or translocations, and asynapsis in pachynema of (B6.Chr X.1s6PWD)F1 sterile male. Bar 2000 nM. doi:10.1371/journal.pgen.1004088.g005 gametogenesis in hemizygous (XY) but not in homozygous (XX) whole autosomal genome but consubspecific for proximal sex [9]. In its most straightforward interpretation the F1 hybrid 69.9 Mb of Chr XPWD, encompassing the Hstx1/2 hybrid sterility females should be sterile in the same way as their hemizygous male locus. Contradicting the simple interpretation of Muller’s domi- sibs if their genotype were made homozygous for an incompatible nance hypothesis the (B6.PWD-Chr.X.1s6PWD)F1 hybrid fe- Chr X variant. We constructed such genotype by crossing males were fully fertile, as were the parental controls (Table S5). consomic females B6.PWD-Chr.X.1s with PWD males. The However, the results were concordant with the testis-specific resulting female hybrids were PWD/B6 heterosubspecific for the function of Hstx2PWD. Thus, to follow the dominance theory, the

PLOS Genetics | www.plosgenetics.org 8 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 6. Meiotic asynapsis in female hybrids. Abbreviations of consomic strains and their hybrids: DX.1 – B6.PWD-Chr X.1; DX.1PF1 – (B6.PWD- Chr X.16PWD)F1; DX.1sPF1 – (B6.PWD-Chr X.1s6PWD)F1; DX.1B6F1 – (B6.PWD-Chr X.16B6)F1; DX.1sB6F1 – (B6.PWD-Chr X.1s6B6)F1; DX.1sD17F1 – (B6.PWD-Chr X.1s6B6.PWD-Chr 17)F1; D17B6F1 – (B6.PWD-Chr 176B6)F1; B6PF1 – (B66PWD)F1, PB6F1 – (PWD6B6)F1; PD17F1 – (PWD6B6.PWD-Chr 17)F1. (A) Chromosome synapsis in pachytene oocytes of B6 and (B6.PWD-Chr X.1s6PWD)F1 18.5–19.5 dpc female fetuses was analyzed by combination of SYCP1, SYCP3 and CREST (centromeric heterochromatin) immunostaining or by HORMAD2 and SYCP3 to detect unsynapsed chromosomes. Bar, 10 mm. (B) The frequency of oocytes showing one or more asynaptic chromosomes is similar (.40%) irrespective of Hstx2 and Prdm9/Hst1 genotype. (C) Although the (PWD6B6), (B6.PWD-Chr X.1s6PWD), (B6.PWD-Chr X.16PWD) and (B6.PWD-Chr 176PWD)F1 hybrid females do not differ in percentage of pachytene oocytes with asynapsis, the (B6.PWD-Chr 176PWD)F1 females, conspecific for Chr 17PWD, carry significantly less asynapsed chromosomes per cell. (D) The frequency of diplonemas in spread oocyte preparations was significantly lower (p,0.01, x2 test) in intersubspecific hybrids than in parental inbred strains.. doi:10.1371/journal.pgen.1004088.g006 preponderance of male-limited HS in species with heterogametic on Chr X [33]. With the aim to positionally clone the Hstx2 gene sex could be explained by a predominance of recessive, compared we narrowed down the critical region to a 4.7 Mb interval (Chr X: to dominant, mutations of HS genes and their male-limited 64.88 Mb–69.58 Mb) and showed that it also carries the Hstx1 expression. Admittedly, the latter premise is in conflict with HS locus. In contrast to Hstx1 phenotype, the intrameiotic arrest is obeying the Haldane’s rule in birds and Lepidoptera. controlled from a single Hstx2 locus on Chr X. The Hstx2/Hstx1 critical interval is overlapped by and may be identical with the Discussion 8.4 Mb QTL responsible for the sterilizing effect of Mmm Chr XPWK introgressed into the genetic background of Mmd LEWES The role of Hstx2 in F1 hybrid sterility inbred strain [30]. Using the position on Chr X, spermatogenic Disproportionate involvement of Chr X in HS has been well expression, and dN:dS ratio Good and coworkers [41] predicted documented in classical studies of Drosophila hybrids (for review see nine candidate genes for X-linked hybrid sterility, three of which [46,47]) and repeatedly reported in hybrids of the house mouse (Ctag2, 4933436I01Rik and Fmr1nb) also occur in the present list of PWD subsp [27,33,36,48]. The introgression of Chr X of Mmm into Hstx1/2 candidates. Moreover, the Sha2 locus of the Japanese Mmd B6 genetic background resulted in abnormal sperm house mouse Mus m. molossinus [49], potentially identical with morphology and inability to fertilize eggs. This phenotype is Hstx1, maps to the same interval. Sha2 is responsible for controlled mainly by the Hstx1 locus supported by additional loci spermiogenic arrest in B6 males carrying Chr XM.m.molossinus

PLOS Genetics | www.plosgenetics.org 9 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Table 2. Asynapsis of individual chromosomes in pachytene oocytes of intersubspecific F1 hybrids and parental controls.

Frequency of asynaptic chromosomes in pachytene oocytesa

Genotypeb Chr 2 Chr 16 Chr 17 Chr 18 Chr 19 Chr X Any Chr

B6 16.3 (2.8) n = 43 54.9 (9.3) n = 51 17.0 N = 100 PWD 15.9 (4.6) n = 138 55.8 (16.2) n = 138 29.0 N = 100 DX.1sD17F1 15.2 (2.4) n = 46 30.0 (4.8) n = 50 16.0 N = 200 PB6F1 9.8 (4.6) n = 102 23.0 (10.9) n = 61 17.8 (8.4) n = 146 49.4 (23.7) n = 81 30.0 (14.4) n = 60 64.0 (30.7) n = 150 48.0 N = 200 DX.1sPF1 25.6 (11.3) n = 156 5.6 (2.5) n = 178 44.0 N = 200 PD17F1 0 (0) n = 119 55.4 (25.5) n = 112 46.0 N = 150

aEach column represents the sum of two or three independent biological replicas. Asynapsis of each Chr was measured in a separate experiment in a separate set of cells. Incidence of asynapsis of a particular Chr is shown for cells with at least one asynapsis. Value in parenthesis is an estimate of overall frequency of asynapsis of a given Chr considering the overall frequency of cells with any asynapsis (Any Chr column). n - number of cells with asynapsis. N - total number of cells examined. bAbbreviations: DX.1sD17F1 – (B6.PWD-Chr X.1s6B6.PWD-Chr 17)F1, DX.1sPF1 – (B6.PWD-ChrX 1s6PWD)F1, PD17F1 – (PWD6B6.PWD-Chr 17)F1. doi:10.1371/journal.pgen.1004088.t002 introgression [49]. Among the candidate genes in the region, of hybrid sterility, but their direct role in speciation is less clear. In Fmr1nb and 4933436I01Rik are expressed in the appropriate cell an alternative approach, evolutionary biologists collect wild mice type during germ cell differentiation and display two and seven from the house mouse hybrid zone to analyze the introgression of non-synonymous substitutions, respectively. The critical region (sub)species-specific DNA markers. Because this approach can also contains the Mir465 cluster of miRNA genes, which show a reflect all kinds of incompatibilities restricting the gene flow, the significant difference in expression between reciprocal F1 hybrids. results are usually complex, uncovering multiple regions on Moreover, Mir743a carries a single SNP in its seed sequence. autosomes and Chr X. Nonetheless, at least two common themes Admittedly, the Hstx1/Hstx2 candidate region is still too large to have emerged from the field data and laboratory crosses, namely finalize the list of Hstx2/Hstx1 candidate genes. Recently, many the large X-effect and a specific role of 60 Mb–80 Mb interval of ampliconic genes on the mouse and human Chr X were shown to Chr X in reproductive isolation of Mmm/M. m. molossinus and Mmd be unique for a given species and expressed predominantly in [16,17,56,57] testicular germ cells [50]. These features make them potential candidates for reproductive isolation genes. The Hstx1/Hstx2 The role of meiotic chromosome asynapsis in critical region is flanked by amplicons 4930527E24Rik and Xlr intersubspecific reproduction barrier (amplicons 7 and 9 in [51]). However, none of the candidate More than 90% of primary spermatocytes of sterile Mmm6Mmd protein-coding genes or Mir genes is located within a known F1 hybrids fail to synapse properly their chromosomes at the amplicon and all protein-coding candidates have an ortholog in pachytene stage of meiosis. Unsynapsed autosomes carry DMC1/ other mammalian species. RAD51 foci on unrepaired DSBs and are decorated by the The incompatible alleles of major HS loci are not fixed to phosphorylated form of histone H2AFX. The sex body containing homozygosity within Mmm and Mmd subspecies, in agreement with X and Y chromosomes is often malformed or disappears, and the idea of the early stage of their speciation. Hst1/Prdm9 is transcriptional inactivation of sex chromosomes (MSCI) is polymorphic for ‘‘sterility’’ and ‘‘fertility’’ alleles in natural disrupted [22,58]. Such failure of chromosomes to synapse can populations and in inbred strains [23,44,52] and the same is true be under trans-orcis-control. Mutations of various meiotic genes for the X-linked HS QTLs [44,53]. The asymmetric contribution involved directly or indirectly in meiotic chromosome pairing and of Mmm and Mmd genomes to HS of reciprocal hybrids reveals synapsis cause asynapsis of multiple autosomes in trans [59]. A null B6 polymorphic control as well. Chr X causes meiotic arrest allele of the Prdm9 gene on Mmd background causes male and depending on PWD/STUS polymorphic modifiers on Chrs 3, 9 female sterility associated with asynapsis and failure to form the and 13. sex body [60], the phenotype similar to sterile Mmm6Mmd hybrids The proximal part of Chr X carries loci for major incompat- [22,24]. Null mutations of Sycp1, Hormad1 or Mei4, the candidate ibilities also outside the Mus musculus group of mouse subpecies. genes regulating the Hstx2-controlled asymmetry of HS, also cause Introgression of Chr X of Mus spretus into B6 inbred strain reduced asynapsis. Contrary to genes acting in trans, certain structural testes weight and fertility [54], with the largest LOD score mutations of chromosomes such as translocations or inversions can mapping approximately 10 Mb proximal to the Hstx1/Hstx2 cause local, cis-acting asynapsis, followed by meiotic arrest and region. The males were semifertile, with many tubules containing sterility [43,61–63]. To distinguish between the trans- and cis- normally developing spermatozoa but some tubules completely control of asynapsis in sterile Mmm6Mmd males, we modified the devoid of germ cells. The testes of (Mus macedonicus6B6) F1 hybrid F1 hybrids using the intersubspecific chromosome substitution males displayed premeiotic block with Sertoli cells and dividing strains B6.PWD-Chr# [20]. In (B6.PWD-Chr#6PWD)F1 hy- spermatogonia. The QTL analysis of a backcross population brids we compared the ability of consubspecific and heterosub- revealed two major loci, again on Chr 17 and Chr X, but with specific (PWD/PWD vs PWD/B6) chromosomes to synapse on positions distal to Prdm9 and to Hstx1/Hstx2 loci, respectively [55]. otherwise F1 hybrid background. These experiments clearly These crosses confirmed the large X-effect in mice but did not showed that asynapsis is regulated primarily in cis, because reveal common HS genes beyond the group of house mouse heterosubspecific chromosome pairs in male as well as in female subspecies. meiosis were more prone to failure to synapse. The sensitivity of Laboratory crosses of wild-derived inbred strains continue to heterosubspecific chromosome pairs to asynapsis was strongly reveal new details about the genetic control and mechanistic basis modified in trans by the Prdm9 and Hstx2 HS genes because only

PLOS Genetics | www.plosgenetics.org 10 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Prdm9PWD/B6 and Hstx2PWD allelic combinations on F1 hybrid with asynapsis to the level found in female meiosis. Moreover, full background resulted in asynapsis of multiple autosomes in .90% recovery of fertility and meiotic pairing can be achieved in F1 of pachytene spermatocytes and full meiotic arrest. A few proteins hybrid males consubspecific for Chr 17PWD (homozygous required for meiotic chromosome alignment and pairing have Prdm9PWD/PWD). We expect that analysis of recombinant hetero- been described [59]; however, the cis-acting signals which ensure subspecific/consubspecific chromosome pairs could provide the pairing and synapsis of homologous chromosomes are still genetic approach to identifying the cis-acting sites important for unknown. Our assay of meiotic synapsis, comparing the con- meiotic pairing and synapsis. subspecific versus heterosubspecific pairing homologs, offers a genetic approach to solving the problem. Such experiments are in Materials and Methods progress. Animals and ethics statement Haldane’s rule and male-specific effect of Hstx2PWD in The animals were maintained at the Institute of Molecular mouse hybrids Genetics in Prague and Institute of Vertebrate Biology in Studenec Hybrid sterility affects preferentially heterogametic sex, males in (Academy of Sciences), Czech Republic. The project was Drosphila or mammals, and females in birds and Lepidoptera. Several approved by the Institutional Animal Care and Use Committee hypotheses have been proposed to explain Haldane’s rule, of the Institute of Molecular Genetics, AS CR, protocol No. 141/ including the dominance theory, the faster-male theory, the faster 2012. The principles of laboratory animal care (NIH Publication X theory and meiotic drive [47]. According to Muller’s dominance No. 85-23, revised 1985) as well as specific Czech Law No. 246/ theory, Haldane’s rule can be explained by hemizygosity of the X 1992 Sb. compatible with the corresponding EU regulations and (Z) chromosome in the heterogametic sex. Both, recessive and standards, namely Council Directive 86/609/EEC and Appendix dominant X (Z)-linked HS genes could control HS in heteroga- A of the Council of Europe Convention ETS123, were observed. metic sex, but only dominant HS genes could sterilize the C57BL/6J (B6, mostly M. m. domesticus) originated from The homogametic sex. Using attached-X chromosome, Coyne and Jackson Laboratory (Bar Harbor, ME). The PWD/Ph (PWD) and STUS strains were derived from wild M. m. musculus [32,53]. The others tested the prediction by making Drosophila hybrid females PWD homozygous for the recessive-acting X chromosome. In D. chromosome substitution (consomic) strains C57BL/6J-Chr # simulans6D. mauritiana or D. sechellia hybrids the female hybrids [20], abbreviated here B6.PWD-Chr #, were maintained in a carrying two D. simulans Chr X were fertile, contrary to the pathogen-free barrier facility with a 12 h light/12 h dark cycle. prediction (for review see [47] and references therein). The authors The mice had ad libitum access to a standard rodent diet (VELAZ, argued that because HS genes are male specific, suggesting extra ST-1, 3.4% fat) and acidified water. All males were sacrificed at developmental sensitivity of spermatogenesis relative to oogenesis, the age of 60 to 70 days. their recessive forms manifest DMI in male but not in female gametogenesis. Indeed, the mouse Hst1/Prdm9 and Hstx2 are also Genotyping, phenotyping and histology male-specific HS loci, therefore not contradicting the fertility of All 124 male mice from (B6.PWD-Chr X6B6)F16PWD cross female Mmm6Mmd F1 hybrids homozygous for the Hstx2Mmm and 71 male progeny from (B6.PWD-Chr X6B6)F1x B6 cross allele. To accommodate the dominance theory with X-linked, were genotyped using SSLP Chr X markers listed in Table S6. male-specific HS genes, their recessive nature could be tested by a Genomic DNA from mouse tails and spleens was prepared by the dominant transgene from the Mmm subspecies. HotSHOT method [64] followed by phenol-chloroform cleaning [65]. For genotyping B6.PWD-Chr X# partial consomics and 84 A mechanistic model of F1 hybrid sterility males of B66(PWD6STUS) test-cross we used MegaMUGA We propose a mechanistic model of HS based on the high-density genotyping array carrying 77,000 markers on assumption that cis-controlled pachytene asynapsis is the primary Illumina Infinium Platform (http://csbio.unc.edu/CCstatus/ cause of apoptosis of primary spermatocytes and sterility in index.py). intersubspecific hybrids of the house mouse (Fig. 7). We have Eight weeks old male progeny of the crosses were phenotyped found that the number of unsynapsed autosomes per cell varies, for testes weight (TW), sperm count (SC) and percentage of indicating that the same type of cis-acting mechanism operates on abnormal spermatozoa as described [33]. The B66(PWD6STUS) individual autosomes. Although the molecular mechanism of males were phenotyped at 60 days of age as described [44]. For homologous chromosome recognition during meiotic pairing and histological analysis the paraffin-embedded testicular sections were synapsis is unknown in mammals, one possibility is that fast stained with periodic acid Schiff and hematoxylin-eosin and evolving noncoding DNA and/or RNA sequences interfere with observed using a Nikon Eclipse 200 microscope. The Penguin homology search of single-strand 39ends on heterosubspecific 150CL CCD color camera (Pixera) was used to capture homologs during DSB repair, thus interfering with their synapsis photographs, which were processed using Adobe Photoshop during the first meiotic prophase (see also [45]). Alternatively, the (Adobe Systems). process of homolog recognition can be affected earlier, before meiotic recombination begins. QTL analysis The male-specific action of the Hstx2 or Prdm9/Hst1 HS genes QTL mapping of recombinant males from (B6.PWD-Chr could explain why the same perturbation of sequence homology X6B6)F16PWD and B66(PWD6STUS) crosses was performed acts differently in male and female meiosis. While in female using the R 12.1 and its R/qtl package [66] Marker positions were pachynemas the percentage of meiocytes with asynaptic chromo- taken from MGI mouse genetic map [67]. Standard interval somes ranges between 40% and 45% and is ultimately unaffected mapping was implemented using scanone function. TW and logSC by the Hstx2 or Prdm9/Hst1 genes, meiotic asynapsis of F1 males were modeled as continuous variables, fertility/sterility as a binary depends considerably on their genotype. Full sterility and complete variable. Genotype probabilities between markers were calculated meiotic block is associated with the Prdm9PWD/B6 Hstx2PWD at a grid size of 5 cM and with genotyping error rate of 0.01%. genotype only, while the substitution of Hstx2PWD for Hstx2B6 on Genome-wide significance was calculated by 1000 permutations otherwise F1 hybrid background reduces the incidence of cells and compared to a = 5% threshold.

PLOS Genetics | www.plosgenetics.org 11 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

Figure 7. The proposed sequence of events leading to male limited sterility of intersubspecific hybrids of house mouse. Susceptibility of heterosubspecific homologs to asynapsis is common to both sexes. Prdm9/Hst1 and Hstx2 hybrid sterility genes can modulate this sensitivity from 0% to .95% in spermatogenesis but not in oogenesis, depending on allelic combinations of epistatic DMIs. Multiple asynaptic autosomes provoke MSCI, contributing to hybrid male sterility. Approximately one half of unaffected oocytes ensure fertility of hybrid females. It remains to be established what is the cause of asynapsis of heterosubspecific homologs. doi:10.1371/journal.pgen.1004088.g007

Fluorescence-activated cell sorting of spermatogenic Microarray miRNA and protein-coding gene transcription populations analysis and qRT-PCR validation Three spermatogenic populations (leptotene+zygotene+early Total RNA was isolated from sorted cells and 14.5 dpc testis pachytene, mid-late pachytene+diplotene, and spermatids) were using the miRNeasy Mini isolation kit (QIAGEN) as recom- isolated using fluorescence-activated cell sorting (FACS) as mended. RNA concentration was determined by NanoDrop described earlier [43,68] from PWD and B6 testes. The cells (NanoDrop Technologies) and its integrity checked in Agilent were directly sorted into QIAzol lysis reagent of the miRNeasy 2100 bioanalyzer, RNA Lab-On-a-Chip (Agilent Technologies). Mini isolation kit (QIAGEN). Small aliquots of cells were sorted in The total RNA (20–30 ng for gene expression and 120 ng for Krebs-Ringer bicarbonate medium for indirect immunofluores- miRNA expression) was converted to cRNA using the Affymetrix cence analysis. The population composition was estimated by Two-Cycle Target Labeling kit according to the manufacturer’s staining with anti-SYCP3, anti-SYCP1, anti-cH2AFX antibodies instructions or using the Affymetrix 39 IVT Express Kit. (details below) and DAPI (Vectashield). All sorted populations Affymetrix GeneChip Mouse Genome 430.2.0 array, and showed 85–90% purity of the desired cell type. Affymetrix GeneChip miRNA 1.0 Array was hybridized with

PLOS Genetics | www.plosgenetics.org 12 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis cRNA. The data obtained from the experiments were analyzed (Molecular Probes, A -11034), goat anti-Mouse IgG-Alexa Fluor using Bioconductor [69] (http://www.bioconductor.org/) and the 568 (Molecular Probes, A-11031), goat anti-Rabbit IgG-Alexa R project for statistical computing (version 2.12; http://www.r- Fluor 568 (Molecular Probes, A-11036), goat anti-Mouse IgG- project.org/). The probes were annotated to Ensembl gene Alexa Fluor 350 (Molecular Probes, A- 21049), goat anti-Mouse identifiers using the custom chip description file, which was based IgG-Alexa Fluor 647 (Molecular Probes, A-21236), goat anti- on NCBI build 37. The data were normalized using RMA Rabbit IgG-Alexa Fluor 647 (Molecular Probes, A-21245) and (Affymetrix GeneChip Mouse Gene 1.0ST Array) and quantile goat anti-Guinea pig IgG-Cy3 (Chemicon, #AP108C). The normalization (Affymetrix GeneChip miRNA 1.0). We used immunolabeled meiocytes were subjected to DNA FISH using Linear Models for Microarray Data Package, limma version 3.6 Metasystems XMP XCyting Mouse Chromosome N Whole [70] for statistical evaluations of expression differences as Painting Probes for Chrs 2, 16, 17, 18, 19 and X as described described [22]. The microarray dataset is deposited in the NCBI [73]. The images were acquired using a Nikon Eclipse 400 (Tokyo, Gene Expression Omnibus (GEO) with series accession number Japan) microscope with motorized stage control using a Plan Fluor GSE41707 [22] GSE49442 and GSE49443. Expression of objective, 606 (Nikon, MRH00601) and captured using a DS- different X-linked protein-coding genes on spermatogenic popu- QiMc monochrome CCD camera (Nikon) and NIS elements lations were derived from NCBI GEO profiles or NCBI GEO program. The fluorescent intensity of images was adjusted using database GSE7306 [43] and GSE49444. Adobe Photoshop CS software (Adobe Systems). For super- For qRT-PCR of protein-coding genes, reverse transcription of resolution microscopy the meiotic spreads were examined with the isolated RNA samples was carried out using Applied Biosystems Zeiss Axioimager Z.1 platform equipped with the Elyra PS.1 (ABI) high-capacity cDNA reverse transcription kit. The quanti- super-resolution system for SR SIM and the LSM780 module for fication of mRNAs was performed using FastStart DNA Master CLSM, using Alpha Pln Apo 636/1.40 oil Zeiss objective (total SYBR Green I kit (Roche) and amplified in LightCycler 2000 magnification 10086) with appropriate oil (Immersol 518F, by (Roche). Reactions without reverse transcriptase were utilized as Zeiss). SR-SIM setup was 5 rotations and 5 phases for each image negative control. The assays were done in biological and technical layer. Up to 7 (usually 3) 110 nm Z-stacks were acquired per triplicates. The data were analyzed using LightCycler Software image. Staging of meiotic prophase I in males and females were version 3.5.3 (Roche). For validation of miRNA expression we done as described earlier [22]. used ABI TaqMan MicroRNA assays and followed the manufacturer’s instructions. The reactions were cycled in Applied Statistics Biosystems 7300 Real-time PCR system, and associated software Multiple biological replicates of each genotype were analyzed was used for data analysis. The reactions were also carried out for cellular phenotypes and RNA expression. The significance of using biological and technical triplicates and proper negative body weight, testes weight, sperm morphology and breeding controls. The highest and stably expressed miRNAs, U6 non- phenotypes was computed using Welsch’s t-test. Sizes of chromatin coding RNA for sorted cells and Mir152 for 14.5 dpc testis, were areas covered by the hybridization signal in synapsed and used as the reference for data normalization. The primers were unsynapsed autosomes were compared by Analysis of Variance designed using Primer 3 software (http://frodo.wi.mit.edu/). (ANOVA) with Tukey’s correction for multiple testing. Differences Sequences of primers are given in Table S6. between cellular phenotypes were determined with x2 test. All computations were done using R 2.15.0 or Graphpad Prism Sequencing, SNP and PWD exome analysis (http://www.graphpad.com/scientific-software/prism/#1). Exome sequence analysis was carried out for PWD/Ph mice at BGI Europe using Illumina HiSeq 2000 sequencers. The PWD Supporting Information exome sequence was aligned to NCBIm37 genome (BAM format, http://samtools.sourceforge.net/SAM1.pdf) and deposited at the Figure S1 Mapping of Hstx1 locus on Chr X. The fertility of Sequence Read Archive (SRA) accession SRR942524. males with PWD/B6 single recombination declined with the All the non-synonymous mutations between PWD and B6 for recombination breakpoints in the interval DXMit76 (64.75 Mb) 4.7 Mb Hstx2 locus were tabulated. Sequence validations on PWD and DXMit143 (69.28 Mb), indicating the position of the Hstx1 cDNA (for protein-coding genes) and PWD BACs (for miRNAs) gene. [35] were carried out as described [24] using sequencing capillary (EPS) machine ABI310 (Applied Biosystems). The sequences of primers Figure S2 Gene map of the Hstx2/Hstx1 critical region on Chr are listed in Table S3. Some of the SNPs were also confirmed X. Predicted genes and pseudogenes are not included in this map. using the Mouse Phenome database (http://phenome.jax.org/). See text for details. The dN:dS ratio (an indicator of evolutionary selective pressure on (EPS) genetic processes) of different X-linked protein-coding genes between rat and mouse was calculated using Ensemble Biomart. Figure S3 Expression profiling of protein-coding genes within Hstx1/Hstx2 critical region. (A) Log fold-change of expression ratio Immunostaining and DNA FISH of spread meiocytes of PWD versus B6 protein-coding genes in flow sorted testicular cells. Data from Affymetrix GeneChip Mouse Gene 1.0ST Array The meiocyte spreads were prepared by using the hypotonic do not show any significant differences between both strains in protocol as described earlier [21,71]. The nuclei were immuno- expression levels in primary spermatocytes. Abbreviations: Z-EP – stained using following primary antibodies; rat polyclonal anti- Zygotene Early Pachytene, M-LP - Mid-Late Pachytene, ST – SYCP3 (Abcam, #15092), mouse monoclonal anti-SYCP1 Spermatids. (B) qRT PCR of expression levels of six candidate (Abcam, #15087), guinea pig anti-histone linker H1t [72], human genes in testes of 14.5 d reciprocal F1 hybrid males (PWD6B6)F1 autoimmune anti-centromere (AB-Incorporated, #15-235), mouse and (B66PWD(F1). None of the differences is significant. monoclonal anti-cH2AFX (Upstate, #05-636), mouse monoclonal (EPS) antibody anti-SYCP3(D-1) (Santa Cruz #74569), rabbit polyclonal antibody HORMAD2(C-18) (Santa Cruz #82192) and the Figure S4 The effect of Hstx2 on spermatogenic differentiation secondary antibodies: goat anti-Rabbit IgG-AlexaFluor488 and synapsis of meiotic chromosomes. (A) Histological crossections

PLOS Genetics | www.plosgenetics.org 13 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis of spermatogenic tubules of B6 control and (B6.PWD-Chr Table S1 Coordinates of the introgressed PWD sequence in X.16PWD)F1, abbreviated here DX.1PF1, and (B6.PWD-Chr B6.PWD-Chr X subconsomics (GRCmm38). X.1s6PWD)F1, abbreviated DX.1sPF1 hybrids. Note the vacuo- (DOCX) lar degeneration, heteropycnotic cells and absence of sperm cells Table S2 Meiotic stages of adult testes of B6.PWD-Chr.X# and in DX.1sPF1 hybrids. (B) Unsynapsed autosomes and sex PWD hybrids. chromosomes visualized by HORMAD2 and SYCP3 immuno- (DOCX) staining. Early pachynemas with high and low frequency of autosomal univalents are shown. (C) Frequency of primary Table S3 Testes weight and sperm count in male progeny of spermatocytes at various stages of meiotic progress in males of B66(STUS6PWD), B66(PWD6STUS) and reciprocal crosses different genotype. (PWD6B6)F1, abbreviated PB6F1, and (STUS6PWD)6B6, and (PWD6STUS)6B6. B6.PWD-Chr X.1s6PWD)F1 (abbreviated DX.1sPF1) sterile (XLSX) males display the same profile of primary spermatocyte stages. Table S4 Intervals and candidate genes of Chr XPWD- (D, E) Frequency of pachynemas with asynapsis and number of independent HS QTLs. unsynapsed autosomes per cell are similar in PB6F1 and (DOCX) DX.1sPF1 sterile males. In DX.1PF1 males asynapsis occurs with Table S5 Fertility of parental and F1 hybrid females with lower frequency and the pachynemas with asynapsis have lower different allelic combinations at Hstx1/Hstx2 loci. number of univalents. (DOCX) (EPS) Table S6 Primers. Figure S5 Pachytene asynapsis in sterile F1 hybrid males (XLS) prepared by different combinations of Mmm and Mmd inbred strains. (A) Over 90% of pachytene spermatocytes in all three Acknowledgments strain combinations ((PWD6B6)F1 – abbreviated PB6F1, (STUS6B6)F1 – STB6F1 and (PWD6SCHEST)F1 - PSCHF1) We thank A. Toth for providing HORMAD2 antibodies, P. Divina for carry one or more asynapsed chromosome pair. Frequency of help with data submission and P. Petko, Z. Trachtulec, P. Jansa, S. asynapsis of four analyzed autosomes varied between genotypes. Takacova and three anonymous reviewers for valuable comments and critical reading of the manuscript. Average number of univalents per cell was highest in PSCHF1 and lowest in PB6F1. (B) Distribution of pachynemas with a given number of unsynapsed chromosome pairs. Asynapsis varies widely Author Contributions within each genotype. A significant excess of cells with one Conceived and designed the experiments: JF TB. Performed the unsynapsed pair occurs in B6PF1 hybrids. experiments: TB RR SG MM IM JP. Analyzed the data: JF TB RR PS (EPS) VG. Contributed reagents/materials/analysis tools: IM JP MM. Wrote the paper: JF TB.

References 1. Dobzhansky T (1951). Genetics and the origin of Species: Columbia University, 16. Payseur BA, Krenz JG, Nachman MW (2004) Differential patterns of New York. introgression across the X chromosome in a hybrid zone between two species 2. Coyne JA, Orr HA (2004) Speciation: Sinauer Associates, Inc., Sunderland, of house mice. Evolution 58: 2064–2078. Massachusetts U.S.A. 17. Macholan M, Baird SJ, Dufkova P, Munclinger P, Bimova BV, et al. (2011) 3. Moehring AJ, Llopart A, Elwyn S, Coyne JA, Mackay TF (2006) The genetic Assessing multilocus introgression patterns: a case study on the mouse X basis of postzygotic reproductive isolation between Drosophila santomea and D. chromosome in central Europe. Evolution 65: 1428–1446. yakuba due to hybrid male sterility. Genetics 173: 225–233. 18. Lewontin R (1974) The genetic basis of evolutionary change. New York: 4. Slotman M, Della Torre A, Powell JR (2004) The genetics of inviability and Columbia University Press. male sterility in hybrids between Anopheles gambiae and An. arabiensis. 19. Keane TM, Goodstadt L, Danecek P, White MA, Wong K, et al. (2011) Mouse Genetics 167: 275–287. genomic variation and its effect on phenotypes and gene regulation. Nature 477: 5. Maheshwari S, Barbash DA (2011) The Genetics of Hybrid Incompatibilities. 289–294. Annu Rev Genet 45:331–55. 20. Gregorova S, Divina P, Storchova R, Trachtulec Z, Fotopulosova V, et al. 6. Haldane J (1922) Sex ration and unisexual sterility in animal hybrids. J Genet 12: (2008) Mouse consomic strains: exploiting genetic divergence between Mus m. 101–109. musculus and Mus m. domesticus subspecies. Genome Res 18: 509–515. 7. Muller H, Pontecorvo G (1942) Recessive genes causing interspecific sterility and 21. Anderson LK, Reeves A, Webb LM, Ashley T (1999) Distribution of crossing other disharmonies between Drosophila melanogaster and simulans. Genetics over on mouse synaptonemal complexes using immunofluorescent localization of 27: 157. MLH1 protein. Genetics 151: 1569–1579. 8. Coyne JA (1989) Genetics of sexual isolation between two sibling species, 22. Bhattacharyya T, Gregorova S, Mihola O, Anger M, Sebestova J, et al. (2013) Drosophila simulans and Drosophila mauritiana. Proc Natl Acad Sci U S A 86: Mechanistic basis of infertility of mouse intersubspecific hybrids. Proc Natl Acad 5464–5468. Sci U S A 110: E468–477. 9. Turelli M, Orr HA (1995) The dominance theory of Haldane’s rule. Genetics 23. Forejt J, Ivanyi P (1974) Genetic studies on male sterility of hybrids between 140: 389–402. laboratory and wild mice (Mus musculus L.). Genet Res 24: 189–206. 10. Turelli M, Orr HA (2000) Dominance, epistasis and the genetics of postzygotic 24. Mihola O, Trachtulec Z, Vlcek C, Schimenti JC, Forejt J (2009) A mouse isolation. Genetics 154: 1663–1679. speciation gene encodes a meiotic histone H3 methyltransferase. Science 323: 11. Forejt J (1996) Hybrid sterility in the mouse. Trends Genet 12: 412–417. 373–375. 12. Forejt J (1985) Chromosomal and genic sterility of hybrid type in mice and men. 25. Baudat F, Buard J, Grey C, Fledel-Alon A, Ober C, et al. (2010) PRDM9 is a Experimental and Clinical Immunogenetics 2: 106–119. major determinant of meiotic recombination hotspots in humans and mice. 13. Forejt J, Pialek J, Trachtulec Z (2012) Hybrid male sterility genes in the mouse Science 327: 836–840. subspecific crosses. In: Macholan M, Baird SJE, Muclinger P, Pialek J, editors. 26. Parvanov ED, Petkov PM, Paigen K (2010) Prdm9 controls activation of Evolution of the House Mouse. Cambridge: Cambridge University Press. pp mammalian recombination hotspots. Science 327: 835. 482–503. 27. Dzur-Gejdosova M, Simecek P, Gregorova S, Bhattacharyya T, Forejt J (2012) 14. Din W, Anand R, Boursot P, Darviche D, Dod B, et al. (1996) Origin and Dissecting the genetic architecture of F1 hybrid sterility in house mice. Evolution radiation of the house mouse: Clues from nuclear genes. Journal of Evolutionary 66: 3321–3335. Biology 9: 519–539. 28. Flachs P, Mihola O, Simecek P, Gregorova S, Schimenti J, et al. (2012) 15. Baird SJE, Macholan M (2012) What can the Mus musculus musculus/M. m. Interallelic and intergenic incompatibilities of the Prdm9 (Hst1) gene in mouse domesticus hybrid zone tell us about speciation? In: Macholan M, Baird SJ, hybrid sterility. Plos Genet 8: e1003044. Muclinger P, Pialek J, editors. Evolution of the house mouse. Cambridge: 29. Turelli M, Moyle LC (2007) Asymmetric postmating isolation: Darwin’s Cambridge University Press. pp. 334–372. corollary to Haldane’s rule. Genetics 176: 1059–1088.

PLOS Genetics | www.plosgenetics.org 14 February 2014 | Volume 10 | Issue 2 | e1004088 Hybrid Sterility X2 Controls Meiotic Synapsis

30. Good JM, Handel MA, Nachman MW (2008) Asymmetry and polymorphism of 52. Trachtulec Z, Vlcek C, Mihola O, Gregorova S, Fotopulosova V, et al. (2008) hybrid male sterility during the early stages of speciation in house mice. Fine haplotype structure of a chromosome 17 region in the laboratory and wild Evolution Int J Org Evolution 62: 50–65. mouse. Genetics 178: 1777–1784. 31. Brideau NJ, Barbash DA (2011) Functional conservation of the Drosophila 53. Pialek J, Vyskocilova M, Bimova B, Havelkova D, Pialkova J, et al. (2008) hybrid incompatibility gene Lhr. BMC Evol Biol 11: 57. Development of unique house mouse resources suitable for evolutionary studies 32. Gregorova S, Forejt J (2000) PWD/Ph and PWK/Ph inbred mouse strains of of speciation. J Hered 99: 34–44. Mus m. musculus subspecies–a valuable resource of phenotypic variations and 54. Elliott R, Miller D, Pearsall R, Hohman C, Zhang Y, et al. (2001) Genetic genomic polymorphisms. Folia Biol (Praha) 46: 31–41. analysis of testis weight and fertility in an interspecies hybrid congenic strain for 33. Storchova R, Gregorova S, Buckiova D, Kyselova V, Divina P, et al. (2004) Chromosome X. Mamm Genome 12: 45–51. Genetic analysis of X-linked hybrid sterility in the house mouse. Mamm 55. Elliott RW, Poslinski D, Tabaczynski D, Hohman C, Pazik J (2004) Loci Genome 15: 515–524. affecting male fertility in hybrids between Mus macedonicus and C57BL/6. 34. Song R, Ro S, Michaels JD, Park C, McCarrey JR, et al. (2009) Many X-linked Mamm Genome 15: 704–710. microRNAs escape meiotic sex chromosome inactivation. Nat Genet 41: 488– 56. Teeter KC, Payseur BA, Harris LW, Bakewell MA, Thibodeau LM, et al. (2008) 493. Genome-wide patterns of gene flow across a house mouse hybrid zone. Genome 35. Jansa P, Divina P, Forejt J (2005) Construction and characterization of a Res 18: 67–76. genomic BAC library for the Mus m. musculus mouse subspecies (PWD/Ph 57. Janousek V, Wang L, Luzynski K, Dufkova P, Vyskocilova MM, et al. (2012) inbred strain). BMC Genomics 6: 161. Genome-wide architecture of reproductive isolation in a naturally occurring 36. Good JM, Vanderpool D, Smith KL, Nachman MW (2011) Extraordinary hybrid zone between Mus musculus musculus and M. m. domesticus. Mol Ecol sequence divergence at Tsga8, an X-linked gene involved in mouse 21: 3032–3047. spermiogenesis. Mol Biol Evol 28: 1675–1686. 58. Campbell P, Good JM, Nachman MW (2013) Meiotic sex chromosome 37. Ting C, Tsaur S, Wu M, Wu C (1998) A rapidly evolving homeobox at the site inactivation is disrupted in sterile hybrid male house mice. Genetics 193: 819– of a hybrid sterility gene [see comments]. Science 282: 1501–1504. 828. 38. Barbash DA, Siino DF, Tarone AM, Roote J (2003) A rapidly evolving MYB- 59. Bolcun-Filas E, Schimenti JC (2012) Genetics of meiosis and recombination in related protein causes species isolation in Drosophila. Proc Natl Acad Sci U S A mice. Int Rev Cell Mol Biol 298: 179–227. 100: 5302–5307. 60. Hayashi K, Yoshida K, Matsui Y (2005) A histone H3 methyltransferase 39. Presgraves DC, Balagopalan L, Abmayr SM, Orr HA (2003) Adaptive evolution controls epigenetic events required for meiotic prophase. Nature 438: 374–378. drives divergence of a hybrid inviability gene between two species of Drosophila. 61. Burgoyne PS, Mahadevaiah SK, Turner JM (2009) The consequences of Nature 423: 715–719. asynapsis for mammalian meiosis. Nat Rev Genet 10: 207–216. 40. Bono H, Yagi K, Kasukawa T, Nikaido I, Tominaga N, et al. (2003) Systematic 62. Burgoyne PS, Mahadevaiah S, Mittwoch U (1985) A reciprocal autosomal expression profiling of the mouse transcriptome using RIKEN cDNA translocation which causes male sterility in the mouse also impairs oogenesis. microarrays. Genome Res 13: 1318–1323. J Reprod Fertil 75: 647–652. 41. Good JM, Dean MD, Nachman MW (2008) A complex genetic basis to X-linked 63. Setterfield LA, Mahadevaiah S, Mittwoch U (1988) Chromosome pairing and hybrid male sterility between two species of house mice. Genetics 179: 2213– germ cell loss in male and female mice carrying a reciprocal translocation. 2228. J Reprod Fertil 82: 369–379. 42.HruzT,LauleO,SzaboG,WessendorpF,BleulerS,etal.(2008) Genevestigator v3: a reference expression database for the meta-analysis of 64. Truett GE, Heeger P, Mynatt RL, Truett AA, Walker JA, et al. (2000) transcriptomes. Adv Bioinformatics 2008: 420747. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide 43. Homolka D, Ivanek R, Capkova J, Jansa P, Forejt J (2007) Chromosomal and tris (HotSHOT). Biotechniques 29: 52–54. rearrangement interferes with meiotic X chromosome inactivation. Genome Res 65. Homolka D, Ivanek R, Forejt J, Jansa P (2011) Differential expression of non- 17: 1431–1437. coding RNAs and continuous evolution of the X chromosome in testicular 44. Vyskocilova M, Prazanova G, Pialek J (2009) Polymorphism in hybrid male transcriptome of two mouse species. PLoS One 6: e17198. sterility in wild-derived Mus musculus musculus strains on proximal chromo- 66. Broman KW, Sen S (2009) A guide to QTL mapping with R/qtl. \New York: some 17. Mamm Genome 20: 83–91. Springer. 45. Kauppi L, Barchi M, Lange J, Baudat F, Jasin M, et al. (2013) Numerical 67. Bult CJ, Eppig JT, Kadin JA, Richardson JE, Blake JA (2008) The Mouse constraints and feedback control of double-strand breaks in mouse meiosis. Genome Database (MGD): mouse biology and model systems. Nucleic Acids Genes Dev 27: 873–886. Res 36: D724–728. 46. Coyne JA, Orr HA (1989) Two rules of speciation. In: Otte D, Endler J, editors. 68. Bastos H, Lassalle B, Chicheportiche A, Riou L, Testart J, et al. (2005) Flow Speciation and Its Consequences. Sunderland, Massachusetts: Sinauer. pp. 180– cytometric characterization of viable meiotic and postmeiotic cells by Hoechst 207. 33342 in mouse spermatogenesis. Cytometry A 65: 40–49. 47. Coyne JA, Orr HA (2004) Speciation. SunderlandMassachusetts: Sinauer 69. Gentleman RC, Carey VJ, Bates DM, Bolstad B, Dettling M, et al. (2004) Associates. 545 p. Bioconductor: open software development for computational biology and 48. Good JM, Giger T, Dean MD, Nachman MW (2010) Widespread over- bioinformatics. Genome Biol 5: R80. expression of the X chromosome in sterile F hybrid mice. PLoS Genet 6: 70. Smyth GK (2004) Linear models and empirical bayes methods for assessing e1001148.. differential expression in microarray experiments. Stat Appl Genet Mol Biol 3: 3. 49. Oka A, Mita A, Sakurai-Yamatani N, Yamamoto H, Takagi N, et al. (2004) 71. Turner JM, Mahadevaiah SK, Fernandez-Capetillo O, Nussenzweig A, Xu X, Hybrid breakdown caused by substitution of the X chromosome between two et al. (2005) Silencing of unsynapsed meiotic chromosomes in the mouse. Nat mouse subspecies. Genetics 166: 913–924. Genet 37: 41–47. 50. Mueller JL, Skaletsky H, Brown LG, Zaghlul S, Rock S, et al. (2013) 72. Inselman A, Eaker S, Handel MA (2003) Temporal expression of cell cycle- Independent specialization of the human and mouse X chromosomes for the related proteins during spermatogenesis: establishing a timeline for onset of the male germ line. Nat Genet 45: 1083–1087. meiotic divisions. Cytogenet Genome Res 103: 277–284. 51. Mueller JL, Mahadevaiah SK, Park PJ, Warburton PE, Page DC, et al. (2008) 73. Kauppi L, Barchi M, Baudat F, Romanienko PJ, Keeney S, et al. (2011) Distinct The mouse X chromosome is enriched for multicopy testis genes showing properties of the XY pseudoautosomal region crucial for male meiosis. Science postmeiotic expression. Nat Genet 40: 794–799. 331: 916–920.

PLOS Genetics | www.plosgenetics.org 15 February 2014 | Volume 10 | Issue 2 | e1004088

100

Paper I I I

Phenotypic effects of the Y chromosome are variable and structured in hybrids among house mouse recombinant lines

Ecology and Evolution ; 9: 6124 – 6137 (2019)

Martincová I. , Ďureje Ľ., Kreisinger J., Macholán M., Piálek J.

101

102

Received: 7 March 2019 | Accepted: 3 April 2019 DOI: 10.1002/ece3.5196

ORIGINAL RESEARCH

Phenotypic effects of the Y chromosome are variable and structured in hybrids among house mouse recombinant lines

Iva Martincová1,2 | Ľudovít Ďureje1 | Jakub Kreisinger3 | Miloš Macholán4 | Jaroslav Piálek1

1Research Facility Studenec, Institute of Vertebrate Biology, Czech Academy of Abstract Sciences, Brno, Czech Republic Hybrid zones between divergent populations sieve genomes into blocks that intro‐ 2 Department of Botany and Zoology, Faculty gress across the zone, and blocks that do not, depending on selection between inter‐ of Science, Masaryk University, Brno, Czech Republic acting genes. Consistent with Haldane's rule, the Y chromosome has been considered 3Department of Zoology, Faculty of counterselected and hence not to introgress across the European house mouse hy‐ Science, Charles University in Prague, Prague, Czech Republic brid zone. However, recent studies detected massive invasion of M. m. musculus Y 4Laboratory of Mammalian Evolutionary chromosomes into M. m. domesticus territory. To understand mechanisms facilitating Genetics, Institute of Animal Physiology and Y spread, we created 31 recombinant lines from eight wild‐derived strains represent‐ Genetics, Czech Academy of Sciences, Brno, Czech Republic ing four localities within the two mouse subspecies. These lines were reciprocally crossed and resulting F1 hybrid males scored for five phenotypic traits associated Correspondence Iva Martincová, Research Facility Studenec, with male fitness. Molecular analyses of 51 Y‐linked SNPs attributed ~50% of genetic Institute of Vertebrate Biology, Czech variation to differences between the subspecies and 8% to differentiation within Academy of Sciences, Květná 8, 603 65 Brno, Czech Republic. both taxa. A striking proportion, 21% (frequencies of sperm head abnormalities) and Email: [email protected] 42% (frequencies of sperm tail dissociations), of phenotypic variation was explained

Funding information by geographic Y chromosome variants. Our crossing design allowed this explanatory Grantová Agentura České Republiky, Grant/ power to be examined across a hierarchical scale from subspecific to local intrastrain Award Number: 15-13265S and 17-25320S effects. We found that divergence and variation were expressed diversely in differ‐ ent phenotypic traits and varied across the whole hierarchical scale. This finding adds another dimension of complexity to studies of Y introgression not only across the house mouse hybrid zone but potentially also in other contact zones.

KEYWORDS Mus musculus domesticus, Mus musculus musculus, phenotype variation, sperm quality, wild‐derived strain, Y‐associated effects

1 | INTRODUCTION Natural selection will sieve the interacting genomes, incompatible combinations will be selected against and confined to the hybrid Secondary contact hybrid zones where genetically diverged taxa zone, neutral genes will diffuse freely to both sites, and selectively meet and mate are widely present across the Tree of Life. Following advantageous variants will recombine away from their native ge‐ initial contact, genes that have diverged in allopatry are brought nomes and spread across the border into non‐native genetic back‐ into novel combinations and tested for their effects on fitness. ground (Barton & Gale, 1990; Payseur, 2010). Faster evolution of X

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2019 The Authors. Ecology and Evolution published by John Wiley & Sons Ltd.

.www.ecolevol.org Ecology and Evolution. 2019;9:6124–6137 | 6124 MARTINCOVÁ et al. | 6125 chromosomes (Coyne & Orr, 1989; Presgraves, 2008), meiotic re‐ German transect (Macholán et al., 2008; Munclinger, Brozikova, combination restricted to an X‐Y pairing region of sex chromosomes Sugerkova, Pialek, & Macholan, 2002). A subsequent study from (Burgoyne, 1982), and their lower effective sizes relative to auto‐ the same region revealed sperm count restoration in hybrids with somes (Hedrick, 1985) imply gene flow of sex‐linked loci across the introgressed musculus Y chromosomes (Albrechtova et al., 2012). zone to be severely restricted. In addition, according to Haldane's Moreover, Y introgression is not restricted to this area. Analysis of rule (Haldane, 1922), sterility or inviability of hybrids should occur, 224 localities in Central Europe revealed that the musculus Y invades primarily, in males and hence Y chromosome introgression should be across the zone in multiple replicates and that this introgression is particularly affected. essentially unidirectional (Ďureje et al., 2012). The presence of mus‐ However, empiric studies on the behavior of Y chromosomes in culus Y chromosomes in the domesticus territory was also reported contact zones have yielded inconsistent results. For example, none from Scandinavia (Jones et al., 2010). However, except the study or extremely limited introgression of Y chromosomes was found of sperm‐related traits by Albrechtová et al. (2012), data inferring in hybrid zones between two subspecies of the European rabbit, the dynamics of the musculus Y chromosome spread in a wider geo‐ Oryctolagus cuniculus (Carneiro et al., 2013; Geraldes, Carniero, graphic context and its possible phenotypic correlates are lacking. et al., 2008), shrew species Sorex araneus and S. antinorii (Yannic, The key question to be answered is then whether there are any Basset, & Hausser, 2008), two evolutionary lineages of the common intersubspecific differences in phenotypes associated with Y chro‐ vole, Microtus arvalis (Beysard & Heckel, 2014), and between two mosome that affect male fitness. However, reducing the search for lineages of the field vole, Microtus agrestis (Beysard, Perrin, Jaarola, differences in phenotypic traits to the intersubspecific level can lead Heckel, & Vogel, 2012). On the other hand, whereas the vast ma‐ to biased inference on Y spread dynamics. For example, if different jority of autosomal and mitochondrial genes were found to change localities within the subspecies display significant variation in the rapidly in a hybrid zone between the baboon species Papio kindae Y‐associated phenotypes, their effects can be canceled out when and Papio griseipes, the Y chromosome of P. kindae showed extensive averaged, and hence, this variability will be obscured. Yet the intra‐ introgression into P. griseipes territory (Chiou, 2017). Introgressive subspecific variation creates local minima and maxima in the fitness hybridization was reported also between two North American landscape and thus can drive the spread of beneficial Y‐linked vari‐ deer species (Odocoileus virginianus and O. hemionus) where vir‐ ants across the subspecies range(s) as well as across the hybrid zone. gianus alleles of the Y‐linked Zfy gene spread into hemionus genome In general, if Y chromosome variation is geographically structured (Wheeldon, Rutledge, Patterson, White, & Wilson, 2013). and associated with variation in phenotypic traits, we might expect Perhaps the most intriguing case of the Y introgression has been three alternative outcomes with respect to the Y introgression abil‐ reported from the European house mouse hybrid zone between two ity in distant replicates of the house mouse hybrid zone. First, there subspecies, Mus musculus musculus and M. m. domesticus. After their will be systematic asymmetric intersubspecific Y‐linked effects caus‐ split 0.5–1 million years ago (Duvaux, Belkhir, Boulesteix, & Boursot, ing directional differences in fitness and this result will suggest uni‐ 2011; Geraldes, Basset, et al., 2008), the two taxa have colonized formity of the Y introgression in the direction of the advantageous Europe following different routes. The musculus mice migrated Y variant. Second, detection of intrasubspecific polymorphism in Y across the plains north of the Black Sea and now inhabit the north‐ effects at various geographic regions will be indicative for different ern and eastern part of Europe. The domesticus mice moved from behavior of the Y within or across various replicates of the zone. the Middle East through Asia Minor and eastern Mediterranean to Third, low phenotypic variance explained by geographically struc‐ the southern and western part of the continent (Cucchi, Auffray, tured Y chromosome variation for a particular phenotypic trait will & Vigne, 2012). Where they meet the two subspecies form a more indicate the absence of association between the Y and a phenotype. than 2,500‐km‐long and only ~20‐km‐wide secondary hybrid zone In this case, the behavior of the Y in the hybrid zone and/or within stretching from Norway to Bulgaria (Ďureje, Macholán, Baird, & the subspecies will be subject to neutral or random processes. Piálek, 2012; Jones, Kooij, Solheim, & Searle, 2010). The zone has To test the three alternatives conditioning the Y spread, we con‐ been studied across several distant geographic transects, and there ducted a study in which sampling was designed to evaluate effects is compelling evidence that it represents a semipermeable barrier of the Y chromosome both at intra‐ and intersubspecific levels. Data allowing neutral diffusion of some genes (e.g., mtDNA) while ham‐ were obtained from reciprocal F1 hybrids derived experimentally in pering introgression of other parts of the genome (e.g., the central the laboratory. Polymorphism was introduced by crossing eight wild‐ X chromosome) (Payseur, Krenz, & Nachman, 2004, Macholán et derived mouse strains and mixing their genomes in a hierarchic way al., 2007, 2011, Dufková, Macholán, & Piálek, 2011, Janoušek et al., that allowed us to infer Y effects from the within‐strain to intersub‐ 2012). specific level. Fitness has many components and each of them can Whereas early studies from distant parts of the hybrid zone such be affected by introduced polymorphism in different ways. As we as Bulgaria (Vanlerberghe, Dod, Boursot, Bellis, & Bonhomme, 1986), documented that sperm‐related traits can affect the dynamics of the southern Bavaria (Tucker, Sage, Warner, Wilson, & Eicher, 1992), and Y spread (Albrechtová et al. 2012), we focused on sperm quantity Denmark (Dod et al., 1993) showed strongly impeded movement of and quality (including number of sperm heads dissociated from tail Y chromosomes across the zone, massive introgression of musculus and number of abnormal sperm heads). Using experimental animals Y into domesticus autosomal background was reported in the Czech/ allowed us to control for age and hence explicitly remove allometric 6126 | MARTINCOVÁ et al. relationships between body traits contributing to male–male compe‐ BUSNA, BULS, STUS, and STUF, were fully inbred (Piálek et al., 2008). tition. Consequently, we added also body and testis size to analysis. To capture local variation, two strains per locality have been derived. Specifically, STRA and STRB originate from Straas [N: 50°11′, E: 11°46′], SCHUNT and SCHEFE from Schweben [N: 50°26′, E: 9°35′], 2 | MATERIAL AND METHODS both from Germany, BULS and BUSNA from Buškovice [N: 50°13′, E: 13°23′ and N: 50°14′, E: 13°22′, respectively], and STUS and STUF 2.1 | Animals and experimental design from Studenec [N: 49°12′, E: 16°04′], both from the Czech Republic. The mouse strains under study have been developed and main‐ The sampling of localities, from which in total more than 25 tained in the breeding facility of the Institute of Vertebrate Biology in strains were developed, was designed a priori to mirror the increase Studenec (licenses for keeping and experimental work 61,974/2017‐ of genetic variation with growing distance from the zone. The selec‐ MZE‐17214 and 62,065/2017‐MZE‐17214, respectively). Four strains tion of eight strains was conditioned by statistical models used to represented domesticus: The STRA and STRB with more than 20 gen‐ test Y effects on phenotypes at various geographically structured erations of brother–sister mating were inbred (Piálek et al., 2008), levels (detailed below). The sampled localities are located symmet‐ whereas SCHUNT and SCHEFE were in the 13th and 14th generation rically about 50 and 250 km from the estimated hybrid zone center of inbreeding, respectively. The four strains representing musculus, (Figure 1a).

FIGURE 1 The design of the experimental crossing. The first column lists subspecies, the second localities and the third, full names of founder wild‐derived strains used for the crossing. Each wild‐derived strain is also labeled with a one‐letter code (fourth column) for simplicity. In all crosses, the first letter stands for a female and the second letter for a male. The RL codes consist of two letters, the first one indicating the origin of mtDNA (column mt) and the second one pointing to the Y chromosome origin in each cross (column Y). The Y column displays also color codes used in bar plots, with blue hues for domesticus and red hues for musculus mice. Autosomal and X‐linked genomes are mixtures of domesticus and musculus genomes. N gives the numbers of tested males per cross. The bottom line indicates levels at which Y chromosomes were tested for phenotypic effects. Inserted panel A depicts a map of trapping localities of the founders of 8 wild‐derived strains studied. The violet line indicates the house mouse hybrid zone course. Panel B shows the neighbor‐Joining tree of Y chromosome haplotypes based on 51 SNPs (see the text). The C57BL/6J strain represents a reference Y haplotype. The bootstrap values based on 100 replicates are shown at each node. The scale is in numbers of SNPs distinguishing pairs of strains MARTINCOVÁ et al. | 6127

The parental strains were crossed in a combinatory design as de‐ treated as a binomial variable with heads classified either as normal picted in Figure 1. The design reflects polymorphism introduced by (Figure 2a,b) or as abnormal (Figure 2c–f). The proportion of ASH mating direction, geographic origin (strain and locality effects), and used for statistical analyses was estimated from 3 squares. subspecific status of each strain. The mating scheme started with crossing strains within each locality (Figure 1, cross 1), then between 2.3 | Molecular analysis localities within the subspecies (Figure 1, cross 2), and finally, between the subspecies (Figure 1, cross 3). As a result, 32 recombinant lines (RL) Genetic divergence of Y chromosomes in the eight strains (Figure 1b) are altogether expected from the experimental mating scheme. was inferred from a set of 51 SNPs spread along the short arm be‐ tween the Zfy1 and Sry genes. This set is a part of the high‐density Mouse Diversity Array (MDA) containing 623,124 SNPs designed 2.2 | Phenotyping to capture genetic variation present in the laboratory mice (Yang et We succeeded in generating experimental males from 31 RLs. In al., 2009). Genotypes for six strains (STRA, STRB, BUSNA, BULS, total, 240 males were examined. Males were sacrificed by cervical STUS, and STUF) and the C57BL/6J strain were obtained from Yang dislocation and dissected at 60 days of age. One external meas‐ et al. (2011). The SCHEST and SCHWEBEN males were genotyped urement, body weight (BW, to 0.01 g), was taken. The spleen was separately using the same MDA probe sets (Yang et al., 2009). The removed, weighed, and preserved in 96% ethanol for molecular anal‐ evolutionary history of the Y chromosome and the robustness of ysis. The testes were weighed individually using analytical balances the resulting tree was inferred using the neighbor‐Joining method (TW, to 0.0001 g), and the values were averaged. Spermatozoa were (Saitou & Nei, 1987) and bootstrap resampling (Felsenstein, 1985) released from the whole left epididymis, and the number of sperm with 100 replicates as implemented in the MEGA program (Kumar, heads was counted in ten squares of a Bürker chamber using an Stecher, & Tamura, 2016). Olympus CX41 microscope under 200× magnification (for details see Vyskočilová, Trachtulec, Forejt, & Piálek, 2005). The mean value 2.4 | Statistical analyses was then used as a representative of the individual's sperm count (SC). The frequency of dissociated sperm heads (DSH) was estimated Statistical analyses were performed in the R statistical environment from five squares. Variation in the sperm head shape (ASH) was (RStudio Team, 2015). We used two different approaches. The first

(a) (b) (c)

(d) (e) (f)

FIGURE 2 The classification of normal and abnormal sperm heads. The first two figures represent normal sperm heads of a domesticus (a) and a musculus (b) male. Figures c–f show examples of abnormal sperm heads 6128 | MARTINCOVÁ et al. one focused on partitioning phenotypic variance associated with supplemented with the Nemenyi post hoc test at the YRL level. Type I the Y effect of subspecies, localities, strains, and RLs. The variance error was set to 0.05; however, as we performed 15 subsidiary com‐ was estimated via hierarchical mixed effect models with Gaussian parisons among means across all hierarchical levels, the significances error structure and fitted with the lmer function from the R pack‐ were Bonferroni corrected (i.e., α = 0.05/15 = 0.003). For the sake of age lme4 (Bates et al., 2014). Localities, Strains, and RLs were in‐ transparency, we report both the uncorrected and corrected signifi‐ cluded as nested random effects. Since the subspecies identity of cances throughout the forthcoming text. the mice under study had only two states (musculus and domesticus), resulting variance estimates of corresponding random effects may 3 | RESULTS be imprecise (Crawley, 2002). Therefore, we considered the subspe‐ cies category as a fixed predictor. We calculated an R2‐like statistics 3.1 | Molecular analysis is consistent with for each model term using the approach described in Nakagawa and geography Schielzeth (2013). In addition, we estimated parameters for fixed ef‐ fects and standard deviations for each random effect level. The para‐ Genotypes at 51 SNPs are shown in Data S1. The phylogenetic tree metric bootstrap was used to derive corresponding 95% confidence suggests that variation at the Y‐linked loci reflects the geographic intervals. The random effects were visualized using sjPlot package position of localities at which the founder mice were collected (cf. (Lüdecke, 2018). The distribution of residuals and the presence of Figure 1a and b). Specifically, out of 51 loci scored, 24 SNPs (47%) outliers were checked using standard diagnostic plots. Where nec‐ were fixed for subspecies‐specific variants. The Straas males shared essary, variables were Box‐Cox transformed (Box & Cox, 1982). two private SNPs, Buškovice and Schweben males possessed one In the second approach, experimental males’ data were par‐ private SNP, whereas males from Studenec had none. No SNPs were titioned in a downward sequence and compared stepwise based detected between pairs of strains from the same localities. on the origin of their Y chromosomes as specified in Figure 1. We started from the top by testing phenotypic effects that can be at‐ 3.2 | Explained phenotypic variation at different tributed to Ys grouped according to their subspecific origin (Yssp hierarchical levels. level). Then, we split the data with respect to their Yssp origin and estimated differentiation between localities within each subspecies Phenotype data are available in Data S2. The R script for all statisti‐ (Yloc level). Subsequently, we subdivided the data according to the cal analyses including visualization of results is available in Data S3. Yloc level and compared strains within each locality (YWDS level). Partitioning of the overall phenotypic variation attributed to the Y Finally, we assessed variation among the recombinant lines sharing chromosome and corresponding R squared‐like values rendered by Y chromosomes of the same strain origin (YRL; see the Y column in the hierarchical model (see Methods) is summarized in Table 1. The Figure 1). In summary, we performed 15 tests: one test at the Yssp largest proportion of variance in all variables is represented by the level, two tests at the Yloc level, four tests at the YWDS level, and eight residual effects and hence remains unexplained. The explained vari‐ tests at the YRL level. Statistical analyses of inter‐ and intrasubspe‐ ances range between 20.6% and 42.3% for abnormal and dissoci‐ cific variation followed standard recommendations (Sokal & Rohlf, ated head sperm, respectively, and are disproportionally partitioned 1995). TW, BW and SC were distributed normally (Shapiro–Wilk test, across the hierarchical levels. The largest fraction of the explained p > 0.05) and had homogeneous variances (Bartlett test, p > 0.05). variability is present at the YRL level, except for the DSH frequency, To compare groups of these variables, we used parametric tests: where higher variance is explained at the Yssp level. In SC and TW, Welch's two samples t test and, at the YRL level, one‐way ANOVA the amount of the explained variance at the Yloc level nearly reaches supplemented with Tukey's post hoc test. Two frequency variables, the YRL level whereas it is zero or negligible at the YWDS and Yssp level, DSH and ASH, were not distributed normally, and hence, they were respectively. For two remaining variables, BW and ASH, the propor‐ analyzed by the non‐parametric Wilcoxon and Kruskal–Wallis tests, tion of explained variance increases with increasing refinement of

TABLE 1 Estimates of phenotypic variance explained at individual hierarchical levels

BW SC TW DSH ASH

Variance R2 Variance R2 Variance R2 Variance R2 Variance R2

Yssp 0.011 0.002 0.259 0.008 1.212 0.005 0.057 0.334 0.022 0.039 Yloc 0.000 0.000 5.531 0.161 39.475 0.163 0.000 0.000 0.000 0.000 YWDS 0.336 0.053 0.000 0.000 0.000 0.000 0.000 0.000 0.029 0.052 YRL 1.098 0.173 6.375 0.186 51.716 0.214 0.015 0.089 0.064 0.114 Residual 4.891 0.772 22.100 0.645 149.752 0.618 0.098 0.577 0.446 0.794

Note. Individual R2 is calculated as proportions of overall variance in the model and their sum is 1. Figures in bold indicate maxima of variance explained across the four different hierarchical levels. MARTINCOVÁ et al. | 6129 the tested model, that is, from the Yssp to YRL level, with exception of traits disappeared but significant differentiation was detected in the the Yloc, where no variance is explained. Details of GLMM estimates sperm count and body and testis weights. BW is the only phenotype (parameter estimates for fixed effects and variances for random ef‐ displaying Y‐associated differentiation between the Ymusculus locali‐ fects), their 95% bootstrap confidence, and R squared‐like statistics ties. YBuskovice males were heavier than YStudenec; however, the differ‐ for each model term are listed in Data S4. ence was not significant after the Bonferroni correction (Figure 3a). The between‐locality differences are most expressed in the sperm count where the YStraas males revealed, on average, lower values 3.3 | Intersubspecific effects of Y (Yssp level) than both the YStudenec and YBuškovice males, whereas the YSchweben All descriptive statistics (means, medians, standard deviations or Q1‐Q3 males produced by more than 5 × 106 spermatozoa than the YStraas interquartile values, and significances without and with the Bonferroni males and this value was above the SC averages observed in the correction) across all hierarchical levels are shown in Table S5. YStudenec and YBuškovice males (Figure 4b). The same pattern was ob‐ Pronounced intersubspecific genetic divergence in Y chromo‐ served in TW (Data S5). It should be noted that SC and TW were somes was only partially associated with differentiation of phe‐ significantly correlated (Spearman's correlation for Ydomesticus and notypic traits. No effect of the Y on body or testis weight and the Ymusculus, r = 0.76, p < 0.001 and r = 0.74, p < 0.001, respectively) this sperm count was detected (BW and SC are shown in Figure 3a–b, high correlation being present at all levels of the analysis hierarchy. data for TW are in Data S5). However, the proportion of dissociated Interestingly, the higher frequency of abnormal sperm heads in do‐ sperm heads (DSH) showed a different picture: The Ydomesticus males mesticus males than in musculus males appeared to be driven by the had a significantly higher frequency of DSH than the Ymusculus males. YStraas males, whereas the ASH median for the YSchweben males did A similar difference was revealed in ASH although its significance not differ from both musculus localities (Figure 4d). (p = 0.014) disappeared after the Bonferroni correction (Figure 3c–d).

3.5 | Interstrain effects (YWDS level) 3.4 | Intrasubspecific effects (Yloc level) Splitting data according their YWDS origin revealed high variation in BW Comparisons between different localities within the subspecies re‐ within the Ymusculus males. This variation was especially pronounced vealed a rather different pattern of phenotypic differentiation: When between the two YBuškovice strains (Figure 5a), with the YBUSNA males compared with the intersubspecific level, variation in sperm quality (N) being by more than two grams heavier than the YBULS males (L),

FIGURE 3 Boxplots for (a) body weight, (b) sperm count, (c) frequency of dissociated sperm heads, and (d) frequency of abnormally shaped sperm heads among male groups with subspecies‐specific types of the Y. In graphs a and b, the crossbars indicate the mean values, the box ranges display standard deviation, and whiskers give ranges between the maximum and minimum values. In graphs c and d, the crossbars refer to the medians, the boxes display the range between the 1st and 3rd quartile, and whiskers span the 1.5 ranges between the lower and upper quartiles. Black dots represent individual values. Lines and asterisks above the boxplots mark uncorrected significant differences between groups of males: “***” 0.001 “**” 0.01 “*” 0.5, BC = NS is displayed when such difference is not significant after the Bonferroni correction 6130 | MARTINCOVÁ et al.

FIGURE 4 Boxplots summarizing variation in (a) body weight, (b) sperm count, (c) frequency of dissociated sperm heads, and (d) frequency of abnormally shaped sperm heads among males from two domesticus (left) and musculus (right) localities. In graphs a and b, the crossbars indicate the mean values, the box ranges display standard deviation, and whiskers depict the range between the maximum and minimum values. In graphs c and d, the crossbars refer to the medians, the boxes display the range between the 1st and 3rd quartile, and the whiskers span the 1.5 interquartile ranges. Black dots represent individual values. Graphs A and B show results of Welsh's t test, and graphs C and D show results of the Wilcoxon test. Lines and asterisks above the boxplots mark uncorrected significant differences between groups of males: “***” 0.001 “**” 0.01 “*” 0.5, BC = NS is displayed when such difference is not significant after the Bonferroni correction

representing roughly 10% of their body weight. A similar trend was the Y variant identical by descent. The most pronounced polymor‐ observed between the YSTUS (S) and YSTUF (F) males, although the phism in BW was detected in the group of YSTRA males where the dif‐ difference (p = 0.02) was not significant when Bonferroni corrected ference between two RLs (LA vs. SA, p = 0.006, not significant after (Figure 5a). The YBUSNA males showed a significantly higher mean the Bonferroni correction) appeared higher than 3 g, representing sperm count than the YBULS males, the difference being as high as more than 20% of their BW (Figure 6a, Data S5). Significant differ‐ 4 × 106 spermatozoa (Figure 5b). The YBUSNA and YBULS males differed ences in BW were found within the YSTUF group where the observed also in SC and TW (p = 0.004 and p = 0.026, respectively); neverthe‐ variation in BW exceeded 15% of their BW (Figure 6a). While in ma‐ less, these differences were not significant after the Bonferroni correc‐ jority of the YWDS groups BW in males from individual RLs spanned tion (Figure 5b, Data S5). No intrastrain variation was detected in DSH over and below the average of the whole dataset, the group of the (Figure 5c). These results seem to confirm systematic differentiation YBUSNA males had BW consistently above the average. between the domesticus and musculus mice observed at the Yssp and Sperm count was the most variable phenotype. Four out of eight Yloc level analysis (cf. Figure 3c and 4c). Interestingly, the higher ASH RLs clusters displayed significant differentiation among groups in variance in the YStraas males found at the Yloc level was found to be each YWDS group (Figure 6b). In the YSTRB and YSTUF males, the intra‐ driven by the significant difference between the two strains, where strain variation remained significant also after the Bonferroni cor‐ the YSTRB males had a twice higher ASH frequency than YSTRA males. rection. Interestingly, distribution of variation in SC was consistent However, this may not be a complete explanation since the variance of across the localities of origin—while one group of YRL was homo‐ ASH was very high in the YSTRB males themselves, much higher than geneous, the second one from the same locality was polymorphic. in all other strains (Figure 5d). Although higher variation in ASH was Maximum difference in SC reached almost 14.6 × 106 between YFB detected in three pairwise WDS comparisons (p = 0.007–0.049), none and YNU males (Data S5). Despite significant correlation between of them remained significant after the Bonferroni correction. TW and SC in the whole dataset (Spearman's correlation, r = 0.744, p < 0.001), variation in TW only partly mirrored that observed in SC, and only one of the YSTUF males remained significant when 3.6 | Intrastrain effect (YRL level) Bonferroni adjusted (Data S5). DSH revealed significant (though not The analysis of intrastrain effects in 31 RLs differs from previous after the Bonferroni correction) differences in two of eight YRL clus‐ analyses in that the tests involve polymorphism in four RLs sharing ters (Figure 6c). MARTINCOVÁ et al. | 6131

FIGURE 5 Boxplots for (a) body weight, (b) sperm count, (c) frequency of dissociated sperm heads, and (d) frequency of abnormally shaped sperm heads among the male groups with different Y chromosomes originating from the eight wild‐derived strains. One‐letter codes of strains are listed in Figure 1. In graphs a and b, the crossbars indicate the mean values, range of boxes display standard deviation, and whiskers give ranges between the maximum and minimum values. In graphs c and d, the crossbars refer to the medians, boxes display the 1st and 3rd quartile, and whiskers show the 1.5 interquartile ranges. Black dots represent individual values. Lines and asterisks above the boxplots mark significant differences between pairs. Graphs A and B show the results of Welsh's t test, and graphs c and d show the results of the Wilcoxon test. Lines and asterisks above boxplots mark uncorrected significant differences between groups of males: “***” 0.001 “**” 0.01 “*” 0.5, BC = NS is displayed when such difference is not significant after the Bonferroni correction

Frequency of ASH displayed the lowest variation within the and varied across the whole hierarchical scale. Before discussing the eight YRL clusters. The only significant differentiation was found in variable traits, however, we wish to make a note pointing to limits on the YSTRB group (p = 0.005, Figure 6d) where three YRL show ASH data inference. more than twice than is the frequency in the whole dataset (0.154). The way we mixed the genomes and generated the F1 hybrids However, also this variation loses significance after the Bonferroni can only model a very short period after establishment of the house correction. mouse contact zone. Consequently, studies of differential pheno‐ typic performance in these hybrids cannot be conclusive in inferring introgressive advantage of the associated Y variants on non‐native 4 | DISCUSSION genetic backgrounds. On the other hand, the results can be consid‐ ered as indicative for the potential of some Y‐linked phenotypes to Studies on spread of genetic variants and inference on selection in perform better than others after the secondary contact. This dif‐ hybrid zones are focused on interactions between two divergent ferential would then be a prerequisite for their subsequent spread. (sub)species. However, as we showed in this paper reducing analy‐ Another cautionary note relates to the strength of Y‐associated ef‐ ses on (sub)species‐specific comparisons and neglecting intra(sub) fects. We are aware that in all the traits under study, most of the vari‐ specific variation can lead to oversimplification of the reality. We ance remained unexplained (Table 1). The residual variance can derive have created a set of recombinant lines that sample natural genetic from the Y‐X, Y‐autosomal, or cytonuclear interactions, from the com‐ polymorphisms within two house mouse subspecies, and by their plexity of the genetic basis of the scored phenotypes, and from the non‐ reciprocal crossings, we produced F1 hybrid males. In this way, we heritable variance component in which the mice grew up. Nevertheless, partitioned variation in a set of phenotypic traits directly related to the explained variation of Y‐associated effects did reveal some patterns fitness into subspecific, local, between‐strain, and within‐strain Y‐ opening a window to understanding the hybrid zone dynamics. associated effects. Of the three expected alternatives mentioned in Introduction (i.e., consistency, asymmetry, and/or polymorphism 4.1 | Asymmetry in the Y chromosome effects in the Y‐associated effects in F1 hybrids), we found no support for the first one. On the contrary, we found compelling evidence for Two of the traits showing differential phenotypic values were re‐ phenotypic polymorphism associated with Y chromosome variants. lated to sperm quality. Both traits, the frequencies of dissociated This variation was expressed diversely in different phenotypic traits and abnormal sperm heads (DSH and ASH, respectively), displayed 6132 | MARTINCOVÁ et al.

FIGURE 6 Boxplots distributions of (a) body weight, (b) sperm count, (c) frequency of dissociated sperm heads, and (d) frequency of abnormally shaped sperm heads among the 31 RLs with different Y chromosomes. Two‐letter codes of RLs are quoted in Figure 1. In graphs a and b, the crossbars indicate the mean values, box ranges display standard deviation, and whiskers give ranges between the maximum and minimum values. In graphs c and d, the crossbars refer to the medians, boxes display the 1st and 3rd quartile, and whiskers span the 1.5 ranges between the lower and upper quartiles. Black dots represent individual values. Lines and asterisks above boxplots mark significant differences within the groups. Graphs A and B show the results of Tukey's post hoc tests, and graphs c and d show the results of the Nemenyi post hoc tests. Lines and asterisks above the boxplots mark the uncorrected significant differences between groups of males: “***” 0.001 “**” 0.01 “*” 0.5, BC = NS is displayed when such difference is not significant after the Bonferroni correction

increased values in Ydomesticus compared to Ymusculus. DSH was the only (2012): In crosses between the WSB (representing domesticus) and trait in which the mixed model explained more variance at the sub‐ PWD (musculus) strain, the frequency of headless/tailless sperm was specific level (Yssp) than at all other levels. The DSH medians were 0.38 in (PWD × WSB)F1, this value being significantly higher than almost homogeneous on the lower scales. The increased variation 0.089 observed in the reciprocal F1 cross (White, Steffy, Wiltshire, in the recombinant lines bearing YSTRB implies an interaction be‐ & Payseur, 2011). Subsequent QTL mapping for headless/tailless tween the Y‐linked gene(s) and other autosomal/X‐linked loci. As far sperm using the F2 recombinant progeny detected loci on chromo‐ as we know, susceptibility toward dissociation of sperm heads from somes 15 and X; none of the QTL was mapped to the Y chromosome tails has been examined only marginally. Nevertheless, our results or mtDNA (White et al., 2012). are in agreement with the strength and directionality of the effect The higher incidence of ASH in sperm of the Ydomesticus males obtained in the study of White, Stubbings, Dumont, and Payseur compared to the Ymusculus males was only significant without the MARTINCOVÁ et al. | 6133

Bonferroni correction. Most explained variance was detected one strain. We conclude that while frequencies of dissociated sperm among the RLs (11% of overall variance); then, it was almost equally heads have potential to affect the dynamics of the Y behavior in partitioned to the subspecific and strain levels (9% of overall vari‐ the house mouse hybrid zone, the frequencies of deformed sperm ance). As almost 80% of variance remains unexplained, the Y‐asso‐ heads will be subject of interactions with other loci and can affect ciated effects cannot be explanatory variables themselves and they the spread of the Y only locally. rather seem to interact with other quantitative trait loci. Hierarchical top‐down splitting of the variation revealed that the intersubspe‐ 4.2 | Polymorphism in Y chromosome effects cific differentiation is driven through markedly increased variance of ASH in the YStraas males (Figure 4d). Increased frequencies of ASH Although no subspecific effects were detected in sperm count (SC) between the YSTRA and YSTRB males document the presence of poly‐ and body weight (BW), these traits displayed substantial variation morphism within a single locality. Interestingly, the STRA and STRB at the intrasubspecific (both between and within localities) and in‐ Y chromosomes share the same SNP alleles so the results can be trastrain levels. Here, we will point to three phenomena connected interpreted as ASH being only partly affected by the scored Y‐linked with this variation. First, as anticipated, the absence of intersubspe‐ loci. Contrary to DSH, the Y‐associated effects on ASH are a com‐ cific differentiation can result from pooling data of opposing effects mon phenomenon in mice. These have been reported in a variety from distinct localities. For example, averages of BW were found to of diverse crosses such as the KE (unknown origin) and CBA (classi‐ be almost identical between the Ydomesticus and Ymusculus individuals. cal laboratory strain of the domesticus origin, carrying the Ymusculus) However, at lower hierarchical levels this trait started to display dif‐ strains (Krzanowska, 1969), B10.BR/SgSn (classical laboratory strain ferent patterns of variation. Whereas BW was significantly differ‐ of the domesticus origin, carrying the Ymusculus) and its congenic mu‐ entiated both between and within musculus localities, it was almost tant strain B10.BR‐Ydel, with a partial deletion in the Y chromosome homogeneous between and within Ydomesticus localities and increased (Styrna, Imai, & Moriwaki, 1991), the outbred albino MF1 strain (Ellis variation only appeared on the lowest, YRL, scale (especially within et al., 2005), and more recently also in the wild‐derived strains PWK, the group of the YSTRA males). PWD (both of the musculus origin), LEWES, and WSB (both of the do‐ Second, for the spread of a Y variant across a population it is mesticus origin) (Campbell, Good, Dean, Tucker, & Nachman, 2012; necessary this variant to be associated with a phenotype that will Campbell & Nachman, 2014; Good, Dean, & Nachman, 2008; White perform better than the less fit variant being ultimately replaced. et al., 2011). Strong evidence of subspecific modulation of ASH Regarding the BW data, such fitness differences were observed at frequency was reported in a cross‐utilizing three strains (Larson et both the WDS and RL levels where the YBUSNA males represented al., 2018) where females of the WSB strain were mated with males the heaviest group of hybrids. As BW is a determinant of male of two musculus strains, PWK and CZECHII, and the two types of competitive advantage, BW may facilitate the spread of the YBUSNA produced F1 hybrids significantly differing in the proportion of chromosomes. The direct effect of the Y chromosome on male ASH. In a test cross between WSB females and (PWK × CZECHII) body weight seems to be corroborated by the high proportion of F1 and (CZECHII × PWK)F1 males, the QTLs contributing to low explained variation (23% of overall variance). Nevertheless, high dif‐ sperm counts and abnormal sperm morphology were detected on ferentiation within the four recombinant lines sharing the same Y various autosomes. Unfortunately, no data on X‐, Y‐, and mtDNA‐ (strongest among the YSTRA and YSTUF males, respectively; Figure 6a) linked QTLs were presented (Larson et al., 2018). Deletions in the indicates that also interactions with other genomic regions probably long arm of the Y chromosome and RNA interference indicate that shape the observed phenotypic variation. Indeed, a picture emerg‐ the Sly gene is a causal link to sperm head deformities (Case et al., ing from other studies suggests that BW is a polygenic trait with 2015; Cocquet et al., 2009, 2012). Along with the detected Y‐linked QTLs scattered across the whole genome (Chan et al., 2012; Corva genetic correlates, several studies associated ASH frequency with & Medrano, 2001) and may also be partly under the control of the mechanisms affecting male fitness. For example, in vivo examina‐ Y chromosome. Using a panel of 17 Y chromosome consomic strains tions of the ability of abnormal sperm to reach fertilization suggest sharing the same genetic background, a continuous distribution the uterus junction as a barrier preventing deformed sperm reaching in body weight in adult mice was identified (Suto, 2013). As body the eggs (Krzanowska, 1974; Nestor & Handel, 1984). weight was independent of the autosomal and X chromosome ge‐ In summary, the frequency of dissociated sperm heads was the netic background, the results were interpreted that Y the chromo‐ only trait differ significantly the Ydomesticus relative to the Ymusculus some contains genes contributing to body size in mice. males. The direction of asymmetry is in agreement with the ob‐ Third, the spread of advantageous variants for any trait can be served introgression of the Ymusculus chromosomes onto domesticus context‐dependent. For example, pronounced variation in SC was background as demonstrated in many replicates of Central European observed within the Ydomesticus males. Males possessing the YBUSNA hybrid zone (Ďureje et al., 2012), in western Norway (Jones et al., chromosome may outcompete males with the YSTRA or YSTRB chro‐ 2010) or in the majority of classical laboratory strains that carry the mosomes due to higher sperm count whereas this invasion could molossinus/musculus Y type (Bishop, Boursot, Baron, Bonhomme, & be prevented in regions occupied by males carrying the YSCHUNT Hatat, 1985; Yang et al., 2011). Differentiation of abnormal sperm or YSCHEFE chromosomes (Figure 5b). This suggests that while a Y heads at subspecific level was weakly supported and attributed to variant can invade a territory of a less fit Y variant, its spread will 6134 | MARTINCOVÁ et al. be hampered at regions occupied by a fitter variant (or, in the case & Piálek, 2009; Vyskočilová et al., 2005; White et al., 2011). In the of encounter of two equally fit Ys, we may expect their symmetric present study, we did not detect any fully sterile individuals (no diffusion). However, this simplistic scenario will be modulated by Y‐X sperms in epididymis) in the group of 240 RL males (the lowest sperm and Y‐autosomal interactions as well as by recombination rates be‐ count, 0.35 × 106, was scored in a YLA male, Figure 6b). We also did tween the interacting loci. There is an empiric observation of such not detect any considerably higher proportion of oligospermatic (ab‐ context‐depending Y spread. normally low sperm count) males: There were only nine (0.04%) indi‐ It has been shown that in the Czech‐Bavarian portion of the viduals with SC < 5 × 106 in the whole sample. Of these males, three zone, the Ymusculus, which introgresses into the domesticus genome, were YFB males, nevertheless individuals carrying the YSTRB chro‐ rescues sperm numbers in comparison with domesticus males with mosomes significantly segregated for SC (Figure 5b): For example, their native Y chromosomes (Albrechtova et al., 2012). The inva‐ the mean difference between the YFB and YLB males was 10.6 × 106 sive front of Ymusculus is sharply delimited by an abrupt cline from (see Data S5). We can thus conclude that hybrid male sterility was Ydomesticus (Macholán et al., 2008). This suggests the advantageous not substantially represented in these F1 hybrids. Nevertheless, variant reached its spread limits finding a Ydomesticus variant resistant lack of difference in sperm count at subspecific level documented to replacement. The spread is also modulated by genetic conflict de‐ here suggests that the spread of the Ymusculus in the Czech replicate tected in the same hybrid zone. The Y invasion is associated with (Albrechtova et al., 2012) may not be universally present along the restoration of sex ratio of female‐biased distortion in noninvaded whole length of the hybrid zone. domesticus and domesticus populations close to the hybrid zone, Genetic polymorphism in Y chromosomes can be a clue for under‐ pointing to an ongoing genetic conflict between Y and X chromo‐ standing the heterogeneity of opinions regarding introgressive be‐ somes (Macholán et al., 2008, 2011). Both sex chromosomes in mice havior of the Y chromosome in the hybrid zone noted in Introduction. carry ampliconic gene families, including Slx/Slx1 and Sly, whose copy However, empirical and theoretical studies of the Y chromosome numbers vary between and even within the subspecies (Cocquet et dynamics have usually been focused on binomial markers fixed for al., 2009; Ellis, Bacon, & Affara, 2011; Scavetta & Tautz, 2010). Those alternative variants in respective subspecies (here marked as the genes have an antagonistic effect during sperm differentiation, and Ydomesticus and Ymusculus variants). For example, most studies assessing they are involved in a postmeiotic intragenomic conflict that causes the behavior of the Y in the mouse contact zone used loci within the segregation distortion, abnormal spermatogenesis, and hybrid ste‐ non‐recombining region such as the Zfy2 gene (Macholán et al., 2008; rility. This situation is expected when balance between Slx/Slxl1 and Munclinger et al., 2002) and/or DNA restriction patterns (Tucker et Sly copy numbers, and therefore expression, is disrupted (Cocquet et al., 1992; Vanlerberghe et al., 1986). Similarly, simulation studies al., 2009, 2010, Cocquet et al. 2012). modeling genetic incompatibilities between sex chromosomes and As noted above, in F1 hybrids it is hard to distinguish Y‐associ‐ autosomes have been based on diagnostic alleles (e.g., Sciuchetti et ated phenotypic effects from effects of mtDNA. Nevertheless, we al., 2018). Most of genetic polymorphism detected here can be also can provide arguments why the Y is more likely to contribute to the classified as subspecies‐specific variants. Nevertheless, we found phenotypic variation observed in this study than the mitochondrial a signal for intrasubspecific variation in almost 8% of SNPs. Within genome. At the intersubspecific level (Yssp), significances of mtDNA each subspecies, this polymorphism was extended to the local level effects on DSH would be the same as for the Y; however, the direc‐ and each locality had its own specific haplotype. tion of the effect would be opposite; that is, the frequencies of DSH Ultimate knowledge on Y genetic variation can be obtained from would be higher in the mtDNAmusculus males (having Ydomesticus) than in long‐range sequencing. The Y chromosome is notoriously known the mtDNAdomesticus/Ymusculus males. This would predict an advantage for problems with sequencing due to low complexity regions and for the mtDNAdomesticus variant yet it is unclear how this advantage high copy number variation especially in the long Yq arm (Soh et al., would pass from fathers to sons as mtDNA is transmitted maternally. 2014). Sequenced Y chromosomes also reveal the presence of high Mitochondrial DNA is known to introgress across the house mouse variation in SNPs, copy number variation, and small indels compara‐ hybrid zone in either direction (Božíková et al., 2005). This would ble with other genomic segments between and within mouse sub‐ imply the existence of differentiation in mtDNA‐associated pheno‐ species (Harr et al., 2016; Keane et al., 2011; Morgan & de Villena, typic variation; however, no Bonferroni corrected significant mtDNA 2017; Scavetta & Tautz, 2010). This variability is a prerequisite for effects at the intrasubspecific level, and only one interstrain effect the evolution of different functional behavior among different house in the mtDNAStraas males, were detected. Finally, to the best of our mouse Y haplotypes; however, associating Y genetic variation with knowledge, most of the mtDNA effects reported in the literature are phenotypic variation is under explored in mice. Such studies ap‐ associated with sperm motility and not with the traits analyzed in peared challenging in Norway rats where the role of genetic variants this study (for a review, see St. John, Jokhi, & Barratt, 2005). and gene duplications was explored in multiple Y consomic strains. Asymmetry and polymorphism in Y chromosome phenotypic ef‐ Sequencing of the male‐specific region of chromosome Y (MSY) re‐ fects was also revealed in studies of mouse hybrid sterility based on vealed that (a) genetic variation altering a broad range of inbred rat crosses of a vast array of musculus and domesticus strains (Britton‐ phenotypes and (b) per chromosome size, MSY contributed to higher Davidian, Fel‐Clair, Lopez, Alibert, & Boursot, 2005; Forejt & Iványi, strain‐specific male phenotypic variation relative to all other chro‐ 1974; Good et al., 2008; Larson et al., 2018; Vyskočilová, Pražanová, mosomes (Prokop et al., 2016). MARTINCOVÁ et al. | 6135

DATA AVAILABILITY STATEMENT 4.3 | Perspective All data and the R script used in this manuscript are available as elec‐ In this study, we admixed 4 domesticus and 4 musculus genomes tronic supplementary material. separately within each subspecies. This design allowed, on aver‐ age, two recombination events per chromosome within each sub‐ species. After generating intersubspecific F1 hybrids, we found ORCID that incorporating eight strains with four SNP‐defined Y hap‐ Iva Martincová https://orcid.org/0000-0001-5066-0849 lotypes into the experimental crossing had a dramatic influence Jakub Kreisinger https://orcid.org/0000-0001-9375-9814 on phenotypic variation between and within mouse subspecies. Despite this effect, the introduced genetic variation and number of recombination events are only a tiny fraction of that which is REFERENCES expected to exist in hybrid zones. This finding adds another dimen‐ Albrechtova, J., Albrecht, T., Baird, S. J. E., Macholan, M., Rudolfsen, sion of complexity to studies of Y introgression not only across the G., Munclinger, P., … Pialek, J. (2012). Sperm‐related phenotypes house mouse hybrid zone but potentially also in other secondary implicated in both maintenance and breakdown of a natural spe‐ contact zones. cies barrier in the house mouse. Proceedings of the Royal Society B: Analyses of various replicates of this zone have frequently built Biological Sciences, 279(1748), 4803–4810. https://doi.org/10.1098/ rspb.2012.1802 on a reduced one‐dimensional model based on distances from the Baird, S. J. E., & Macholán, M. (2012). What can the Mus musculus mus‐ zone center and introgression being measured as a cline shift of a culus/M. m. domesticus hybrid zone tell us about speciation? In M. locus in either direction (review in Baird & Macholán, 2012). Such Macholán, S. J. E. Baird, P. Munclinger, & J. Piálek (Eds.), Evolution reduction of two‐dimensional sampling (defined by geographic of the House Mouse (pp. 334–372). Oxford: Oxford University Press. coordinates) prevents plausible description of the extent of Y in‐ Barton, N. H., & Gale, K. (1990). Genetic analysis of Hybrid zones. In Hybrid Zone Pat tern and Process (pp. 1–33). ht tps://doi.org/10. 2307/2265918. trogression whose cline orientation can be different from the con‐ Bates, D., Machler, M., Bolker, B. M., & Walker, S. C. (2014). Fitting linear mixed‐ sensus center of hybrid zone (Macholán et al., 2008). To specify effect models using lme4. Journal of Statistical Software, 30, 51, arXiv pre‐ further the dynamics of the Y chromosome behavior in the zone, print arXiv:1406.5823. https://doi.org/10.1016/j.rssm.2011.12.001 sampling design was enlarged to an area from the Bavarian Alps Beysard, M., & Heckel, G. (2014). Structure and dynamics of hybrid zones at different stages of speciation in the common vole (Microtus ar‐ to the Baltic Sea coast (Ďureje et al., 2012). Currently, we are ana‐ valis). Molecular Ecology, 23(3), 673–687. https://doi.org/10.1111/ lyzing molecular genetic data to localize Y introgression along this mec.12613 contact. Results of this study suggest that Y introgression will be Beysard, M., Perrin, N., Jaarola, M., Heckel, G., & Vogel, P. (2012). predominantly unidirectional and polymorphic between geographic Asymmetric and differential gene introgression at a contact zone between two highly divergent lineages of field voles (Microtus replicates. Again, contrary to one‐dimensional analytical models, agrestis). Journal of Evolutionary Biology, 25(2), 400–408. https://doi. the spread of an advantageous variant will be facilitated in two‐di‐ org/10.1111/j.1420-9101.2011.02432.x mensional space offering more sites to cross the barrier (Piálek & Bishop, C. E., Boursot, P., Baron, B., Bonhomme, F., & Hatat, D. (1985). Barton, 1997). Given the length of the house mouse hybrid zone in Most classical Mus musculus domesticus laboratory mouse strains carry a Mus musculus musculus Y chromosome. Nature, 315, 70. Central Europe, there is an ample space for advantageous variants https://doi.org/10.1038/315070a0 to cross. The molecular data will clarify whether Y introgression is Box, G. E., & Cox, D. R. (1982). An analysis of transformations. Journal of from a single resource or if multiple Y variants can invade the do‐ the American Statistical Association, 77(377), 209–210. https://doi.or mesticus background. g/10.1080/01621459.1982.10477788 Božíková, E., Munclinger, P., Teeter, K. C., Tucker, P. K., Macholán, M., & Piálek, J. (2005). Mitochondrial DNA in the hybrid zone between ACKNOWLEDGMENTS Mus musculus musculus and Mus musculus domesticus: A comparison of two transects. Biological Journal of the Linnean Society, 84(3), 363– We thank Stuart J. E. Baird for valuable comments of an earlier 378. https://doi.org/10.1111/j.1095-8312.2005.00440.x version of the draft and Lidka Rousková, Helena Hejlová, and Jana Britton‐Davidian, J., Fel‐Clair, F., Lopez, J., Alibert, P., & Boursot, P. (2005). Postzygotic isolation between the two European subspecies Piálková for the welfare provided to the experimental mice. This of the house mouse: Estimates from fertility patterns in wild and lab‐ study was supported by the Czech Science Foundation (Projects oratory‐bred hybrids. Biological Journal of the Linnean Society, 84(3), 15‐13265S and 17‐25320S). 379–393. https://doi.org/10.1111/j.1095-8312.2005.00441.x Burgoyne, P. S. (1982). Genetic homology and crossing over in the X and Y chromosomes of mammals. Human Genetics, 61(2), 85–90. https:// AUTHORS CONTRIBUTION doi.org/10.1007/BF00274192 Campbell, P., Good, J. M., Dean, M. D., Tucker, P. K., & Nachman, M. W. IM conducted experimental crossing, animal maintenance, data col‐ (2012). The contribution of the Y chromosome to hybrid male sterility lection, analysis, and visualization. LD participated in data collection. in house mice. Genetics, 191(4), 1271–1281. https://doi.org/10.1534/ genetics.112.141804 JK participated in data analysis. MM contributed to the result inter‐ Campbell, P., & Nachman, M. W. (2014). X‐Y interactions underlie sperm pretation. JP designed the study. IM and JP wrote the manuscript head abnormality in hybrid male house mice. Genetics, 196(4), 1231– with contribution of all other authors. 1240. https://doi.org/10.1534/genetics.114.161703 6136 | MARTINCOVÁ et al.

Carneiro, M., Baird, S. J. E., Afonso, S., Ramirez, E., Tarroso, P., Teotónio, H., … Forejt, J., & Iványi, P. (1974). Genetic studies on male sterility of hybrids be‐ Ferrand, N. (2013). Steep clines within a highly permeable genome across tween laboratory and wild mice (Mus musculus L.). Genetical Research, a hybrid zone between two subspecies of the European rabbit. Molecular 24(2), 189–206. https://doi.org/10.1017/S0016672300015214 Ecology, 22(9), 2511–2525. https://doi.org/10.1111/mec.12272 Geraldes, A., Basset, P., Gibson, B., Smith, K. L., Harr, B., Yu, H.‐T., Case, L. K., Wall, E. H., Osmanski, E. E., Dragon, J. A., Saligrama, N., … Nachman, M. W. (2008). Inferring the history of speciation in Zachary, J. F., … Teuscher, C. (2015). Copy number variation in Y house mice from autosomal, X‐linked, Y‐linked and mitochon‐ chromosome multicopy genes is linked to a paternal parent‐of‐ori‐ drial genes. Molecular Ecology, 17(24), 5349–5363. https://doi. gin effect on CNS autoimmune disease in female offspring. Genome org/10.1111/j.1365-294X.2008.04005.x Biology, 16(1), 16–28. https://doi.org/10.1186/s13059-015-0591-7 Geraldes, A., Carniero, M., Delibes‐Mateos, M., Villafuerte, R., Nachman, Chan, Y. F., Jones, F. C., McConnell, E., Bryk, J., Bünger, L., & Tautz, D. M. W., & Ferrand, N. (2008). Reduced introgression of the Y chro‐ (2012). Parallel selection mapping using artificially selected mice mosome between subspecies of the European rabbit (Oryctolagus reveals body weight control loci. Current Biology, 22(9), 794–800. cuniculus) in the Iberian Peninsula. Molecular Ecology, 17, 4489–4499. https://doi.org/10.1016/j.cub.2012.03.011 https://doi.org/10.1111/j.1365-294X.2008.03943.x Chiou, K. L. (2017). Population Genomics of a Baboon Hybrid Zone in Good, J. M., Dean, M. D., & Nachman, M. W. (2008). A complex ge‐ Zambia. Graduate School of Arts and Sciences. Retrieved from netic basis to X‐linked hybrid male sterility between two species of https://openscholarship.wustl.edu/art_sci_etds/1094. house mice. Genetics, 179(4), 2213–2228. https://doi.org/10.1534/ Cocquet, J., Ellis, P. J. I., Mahadevaiah, S. K., Affara, N. A., Vaiman, D., & genetics.107.085340 Burgoyne, P. S. (2012). A genetic basis for a postmeiotic X versus Y Haldane, J. B. S. (1922). Sex ratio and unisexual sterility in hybrid an‐ chromosome intragenomic conflict in the mouse. PLoS Genetics, 8(9), imals. Journal of Genetics, 12(2), 101–109. https://doi.org/10.1007/ e1002900. https://doi.org/10.1371/journal.pgen.1002900 BF02983075 Cocquet, J., Ellis, P. J. I., Yamauchi, Y., Mahadevaiah, S. K., Affara, N. A., Harr, B., Karakoc, E., Neme, R., Teschke, M., Pfeifle, C., Pezer, Ž., … Tautz, Ward, M. A., & Burgoyne, P. S. (2009). The multicopy gene sly re‐ D. (2016). Genomic resources for wild populations of the house presses the sex chromosomes in the male mouse germline after mei‐ mouse, Mus musculus and its close relative Mus spretus. Scientific osis. PLoS Biology, 7(11), e1000244. https://doi.org/10.1371/journal. Data, 3, 160075. https://doi.org/10.1038/sdata.2016.75 pbio.1000244 Hedrick, P. W. (1985). Genetics of Population. Boston: Jones and Bartlett Cocquet, J., Ellis, P. J. I., Yamauchi, Y., Riel, J. M., Karacs, T. P. S., Rattigan, Publishers. A., … Burgoyne, P. S. (2010). Deficiency in the multicopy Sycp3‐Like Janoušek, V., Wang, L., Luzynski, K., Dufková, P., Vyskočilová, M. X‐linked Genes Slx and Slxl1 causes major defects in spermatid dif‐ M., Nachman, M. W., … Tucker, P. K. (2012). Genome‐wide ar‐ ferentiation. Molecular Biology of the Cell, 21, 3497–3505. https://doi. chitecture of reproductive isolation in a naturally occurring org/10.1091/mbc.E10 hybrid zone between Mus musculus musculus and M. m. do‐ Corva, P. M., & Medrano, J. F. (2001). Quantitative trait loci (QTLs) mapping mesticus. Molecular Ecology, 21(12), 3032–3047. https://doi. for growth traits in the mouse: A review. Genetics Selection Evolution, org/10.1111/j.1365-294X.2012.05583.x 33(2), 105–132. https://doi.org/10.1186/1297-9686-33-2-105 John, J. C. S., Jokhi, R. P., & Barratt, C. L. R. (2005). The impact of mitochon‐ Coyne, J. A., & Orr, H. A. (1989). Patterns of speciation in Drosophila. drial genetics on male infertility. International Journal of Andrology, Evolution, 43(2), 362–381. https://doi.org/10.2307/2410984 28(2), 65–73. https://doi.org/10.1111/j.1365-2605.2005.00515.x Crawley, M. G. (2002). Statistical computing: An introduction to data anal‐ Jones, E. P., Van Der Kooij, J., Solheim, R., & Searle, J. B. (2010). Norwegian ysis using S‐Plus. Chichester: Wiley. house mice (Mus musculus musculus/domesticus): Distributions, routes Cucchi, T., Auffray, J.‐C., & Vigne, J.‐D. (2012). On the origin of the of colonization and patterns of hybridization. Molecular Ecology, 19(23), house mouse synantrophy and dispersal in Near East and Europe: 5252–5264. https://doi.org/10.1111/j.1365-294X.2010.04874.x Zooarcheological review and perspectives. In M. Macholán, S. J. E. Felsenstein, J. (1985). Confidence limits on phylogenies: An approach Baird, P. Munclinger, & J. Piálek (Eds.), Evolution of the House Mouse using the bootstrap; confidence limits on phylogenies: An ap‐ (pp. 65–93). Oxford: Oxford University Press. proach using the bootstrap. Evolution, 39(4), 783–791. https://doi. Dod, B., Jermiin, L. S., Boursot, P., Chapman, V. H., Nielsen, J. T., & org/10.1111/j.1558-5646.1985.tb00420.x Bonhomme, F. (1993). Counterselection on sex chromosomes in the Keane, T. M., Goodstadt, L., Danecek, P., White, M. A., Wong, K., Yalcin, Mus musculus European hybrid zone. Journal of Evolutionary Biology, 6(4), B., … Adams, D. J. (2011). Mouse genomic variation and its effect on 529–546. https://doi.org/10.1046/j.1420-9101.1993.6040529.x phenotypes and gene regulation. Nature, 477, 289–294. https://doi. Dufková, P., Macholán, M., & Piálek, J. (2011). Inference of selection and org/10.1038/nature10413 stochastic effects in the house mouse hybrid zone. Evolution, 65(4), Krzanowska, H. (1969). Factor responsible for spermatozoan abnormality 993–1010. https://doi.org/10.1111/j.1558-5646.2011.01222.x located on the Y chromosome in mice. Genetical Research.13, 17–24. Ďureje, L., Macholán, M., Baird, S. J. E., & Piálek, J. (2012). The mouse hybrid Krzanowska, H. (1974). The passage of abnormal spermatozoa through zone in Central Europe: From morphology to molecules. Folia Zoologica, the uterotubal junction of the mouse. Journal of Reproduction and 61(3–4), 308–318. https://doi.org/10.25225/fozo.v61.i3.a13.2012 Fertility, 34, 81–90. https://doi.org/10.1530/jrf.0.0380081 Duvaux, L., Belkhir, K., Boulesteix, M., & Boursot, P. (2011). Isolation Kumar, S., Stecher, G., & Tamura, K. (2016). MEGA7: Molecular evolu‐ and gene flow: Inferring the speciation history of European house tionary genetics analysis version 7.0 for bigger datasets. Molecular mice. Molecular Ecology, 20(24), 5248–5264. https://doi.org/ Biology and Evolution, 33(7), 1870–1874. https://doi.org/10.1093/ 10.1111/j.1365-294X.2011.05343.x molbev/msw054 Ellis, P. J. I., Bacon, J., & Affara, N. A. (2011). Association of Sly with sex‐ Larson, E. L., Vanderpool, D., Sarver, B. A. J., Callahan, C., Keeble, S., linked gene amplification during mouse evolution: A side effect of Provencio, L. P., … Good, J. M. (2018). The evolution of polymorphic genomic conflict in spermatids? Human Molecular Genetics, 20(15), hybrid incompatibilities in house mice. Genetics, 209(3), 845–859. 3010–3021. https://doi.org/10.1534/genetics.118.300840 Ellis, P. J. I., Clemente, E. J., Ball, P., Touré, A., Ferguson, L., Turner, J. M. A., Lüdecke, D. (2018). sjPlot: Data visualization for statistics in social sci‐ … Burgoyne, P. S. (2005). Deletions on mouse Yq lead to upregulation ence. https://doi.org/10.5281/zenodo.1308157 of multiple X‐ and Y‐linked transcripts in spermatids. Human Molecular Macholán, M., Baird, S. J. E., Dufková, P., Munclinger, P., Bímová, B. V., & Genetics, 14(18), 2705–2715. https://doi.org/10.1093/hmg/ddi304 Piálek, J. (2011). Assessing multilocus introgression patterns: A case MARTINCOVÁ et al. | 6137

study on the mouse X chromosome in central Europe. Evolution, 65(5), Sokal, R. R., & Rohlf, J. F. (1995). Biometry: The Principles and Practice 1428–1446. https://doi.org/10.1111/j.1558-5646.2011.01228.x of Statistics. W. H. Freeman (Ed.) (3rd edition). New York, NY: WH Macholán, M., Baird, S. J. E., Munclinger, P., Dufková, P., Bímová, B., & Freeman and Company. Piálek, J. (2008). Genetic conflict outweighs heterogametic incom‐ Styrna, J., Imai, H. T., & Moriwaki, K. (1991). An increased level of sperm patibility in the mouse hybrid zone? BMC Evolutionary Biology, 8, 271. abnormalities in mice with a partial deletion of the Y‐chromo‐ Macholán, M., Vyskočilová, M., Bonhomme, F., Kryštufek, B., Orth, some. Genetical Research, 57(2), 195–199. https://doi.org/10.1017/ A., & Vohralík, V. (2007). Genetic variation and phylogeography S0016672300029268 of free‐living mouse species (genus Mus) in the Balkans and the Suto, J. I. (2013). Y chromosome of the inbred mouse KK/Ta strain is as‐ Middle East. Molecular Ecology, 16(22), 4774–4788. https://doi. sociated with reduced body size in Y‐consomic strains. BMC Research org/10.1111/j.1365-294X.2007.03526.x Notes, 6(1), 64. https://doi.org/10.1186/1756-0500-6-64 Morgan, A. P., & de Villena, F.‐P.‐M. (2017). Sequence and structural di‐ Tucker, P. K., Sage, R. D., Warner, J., Wilson, A., & Eicher, E. (1992). versity of mouse Y chromosomes. Molecular Biology and Evolution, Abrupt cline for sex chromosomes in a hybrid zone between 34(12), 3186–3204. https://doi.org/10.1093/molbev/msx250 two species of mice. Evolution, 46(4), 1146–1163. https://doi. Munclinger, P., Brozikova, E., Sugerkova, M., Pialek, J., & Macholan, M. org/10.1111/j.1558-5646.1992.tb00625.x (2002). Genetic variation in house mice (Mus, Muridae, Rodentia) Vanlerberghe, F., Dod, B., Boursot, P., Bellis, M., & Bonhomme, F. from the Czech and Slovak Republics. Folia Zoologica (Czech Republic), (1986). Absence of Y‐chromosome introgression across the hybrid 51(2), 81–92. zone between Mus musculus domesticus and Mus musculus muscu‐ Nakagawa, S., & Schielzeth, H. (2013). A general and simple method lus. Genetical Research, 48(3), 191–197. https://doi.org/10.1017/ for obtaining R2 from generalized linear mixed‐effects mod‐ S0016672300025003 els. Methods in Ecology and Evolution, 4(2), 133–142. https://doi. Vyskočilová, M., Pražanová, G., & Piálek, J. (2009). Polymorphism in hy‐ org/10.1111/j.2041-210x.2012.00261.x brid male sterility in wild‐derived Mus musculus musculus strains on Nestor, A., & Handel, M. A. (1984). The transport of morphologically proximal chromosome 17. Mammalian Genome, 20(2), 83–91. https:// abnormal sperm in the female reproductive tract of mice. Gamete doi.org/10.1007/s00335-008-9164-3 Research, 10(2), 119–125. https://doi.org/10.1002/mrd.1120100204 V y s k o č i l o v á , M . , Tr a c h t u l e c , Z . , F o r e j t , J . , & P i á l e k , J . ( 2 0 0 5 ) . D o e s g e o g r a p h y m a t‐ P ayseur, B . A . (2010). Using dif ferent ial int rogre ssion in hy b r id zone s to id en‐ ter in hybrid sterility in house mice? Biological Journal of the Linnean Society, tify genomic regions involved in speciation. Molecular Ecology Resources, 84(3), 663–674. https://doi.org/10.1111/j.1095-8312.2005.00463.x 10(5), 806–820. https://doi.org/10.1111/j.1755-0998.2010.02883.x Wheeldon, T. J., Rutledge, L. Y., Patterson, B. R., White, B. N., & Wilson, Payseur, B. A., Krenz, J. G., & Nachman, M. W. (2004). Differential patterns P. J. (2013). Y‐chromosome evidence supports asymmetric dog in‐ of introgression across the X chromosome in a hybrid zone between trogression into eastern coyotes. Ecology and Evolution, 3(9), 3005– two species of house mice. Evolution; International Journal of Organic 3020. https://doi.org/10.1002/ece3.693 Evolution, 58(9), 2064–2078. https://doi.org/10.1554/03-738 White, M. A., Steffy, B., Wiltshire, T., & Payseur, B. A. (2011). Genetic Piálek, J., & Barton, N. H. (1997). The spread of an advantageous allele dissection of a key reproductive barrier between nascent species across a barrier: The effect of random drift and selection against het‐ of house mice. Genetics, 189(1), 289–304. https://doi.org/10.1534/ erozygous. Genetics, 145, 493–504. genetics.111.129171 Pialek, J., Vyskocilova, M., Bimova, B., Havelkova, D., Pialkova, J., White, M. A., Stubbings, M., Dumont, B. L., & Payseur, B. A. (2012). Dufkova, P., … Forejt, J. (2008). Development of unique house mouse Genetics and evolution of hybrid male sterility in house mice. Genetics, resources suitable for evolutionary studies of speciation. Journal of 191(3), 917–934. https://doi.org/10.1534/genetics.112.140251 Heredity, 99(1), 34–44. https://doi.org/10.1093/jhered/esm083 Yang, H., Ding, Y., Hutchins, L. N., Szatkiewicz, J., Bell, T. A., Paigen, B. Presgraves, D. C. (2008). Sex chromosomes and speciation in Drosophila. J., … Churchill, G. A. (2009). A customized and versatile high‐den‐ Trends in Genetics, 24(7), 336–343. https://doi.org/10.1016/j. sity genotyping array for the mouse. Nature Methods, 6(9), 663–666. tig.2008.04.007.Sex https://doi.org/10.1038/nmeth.1359 Prokop, J. W., Tsaih, S.‐W., Faber, A. B., Boehme, S., Underwood, A. C., Yang, H., Wang, J. R., Didion, J. P., Buus, R. J., Bell, T. A., Welsh, C. E., … Troyer, S., … Jacob, H. J. (2016). The phenotypic impact of the male‐ de Villena, F.‐M. (2011). Subspecific origin and haplotype diversity in specific region of chromosome‐Y in inbred mating: The role of ge‐ the laboratory mouse. Nature Genetics, 43(7), 648–655. https://doi. netic variants and gene duplications in multiple inbred rat strains. org/10.1038/ng.847 Biology of Sex Differences, 7(1), 1–16. https://doi.org/10.1186/ Yannic, G., Basset, P., & Hausser, J. (2008). A hybrid zone with coincident s13293-016-0064-z clines for autosomal and sex‐specific markers in the Sorex araneus RStudio Team. (2015). RStudio: Integrated Development for R. Boston: group. Journal of Evolutionary Biology, 21, 658–667. https://doi. RStudio Inc. Retrieved from http://www.rstudio.com/. org/10.1111/j.1420-9101.2008.01526.x Saitou, N., & Nei, M. (1987). The neighbor‐Joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4(4), 406–425. SUPPORTING INFORMATION Scavetta, R. J., & Tautz, D. (2010). Copy number changes of CNV regions in intersubspecific crosses of the house mouse. Molecular Biology Additional supporting information may be found online in the and Evolution, 27(8), 1845–1856. https://doi.org/10.1093/molbev/ Supporting Information section at the end of the article. msq064 Sciuchetti, L., Dufresnes, C., Cavoto, E., Brelsford, A., & Perrin, N. (2018). Dobzhansky‐Muller incompatibilities, dominance drive, and sex‐chro‐ How to cite this article: Martincová I, Ďureje Ľ, Kreisinger J, mosome introgression at secondary contact zones: A simulation study. Evolution, 72(7), 1350–1361. https://doi.org/10.1111/evo.13510 Macholán M, Piálek J. Phenotypic effects of the Y Soh, Y. Q. S., Alföldi, J., Pyntikova, T., Brown, L. G., Graves, T., Minx, P. chromosome are variable and structured in hybrids among J., … Page, D. C. (2014). Sequencing the mouse y chromosome re‐ house mouse recombinant lines. Ecol Evol. 2019;9:6124– veals convergent gene acquisition and amplification on both sex 6137. https://doi.org/10.1002/ece3.5196 chromosomes. Cell, 159(4), 800–813. https://doi.org/10.1016/j. cell.2014.09.052 Paper I V

Sperm quality parameters are increased and asymmetric in house mouse hybrids

submitted paper ( Mammalian Genome )

Martincová I. , Ďurej e Ľ. , Baird S. J. E., Piálek J .

117

118

Sperm quality parameters are increased and asymmetric in house mouse hybrids

Iva Martincová 1,2,* , Ľudovít Ďureje 1 , Stuart J. E. Baird 1 , Jaroslav Piálek 1

1 Research Facility Studenec, Institute of Vertebrate Biology, Czech Academy of Sciences,

Brno, Czech Republic

2 Department of Botany and Zoology, Faculty of Science, Masaryk University, Brno, Czech

Republic

*Corresponding author:

Iva Martincová

Research Facility Studenec,

Institute o f Vertebrate Biology,

Czech Academy of Sciences,

Květná 8, 603 65 Brno,

Czech Republic

[email protected]

ORCID iD:

Iva Martincová: 0000 - 0001 - 5066 - 0849

Stuart J. E. Baird: 0000 - 0002 - 7144 - 9919

Jaroslav Piálek: 0000 - 0002 - 0829 - 7481

119

Abstract

Spermatogenesis is a tuned cascade of processes producing sperm; impairment of any phase of this process can affect fitness of males. The level of impairment can be pronounced in hybrids between genetically divergent populatio ns. To explore the effect of hybridization on sperm quality we produced F1 hybrids from 29 wild derived strains of two house mouse subspecies, M. m. musculus and M. m. domesticus , which diverged 0.5 MY ago. The measured sperm quality traits did not signifi cantly differ between intrasubspecific crosses. Effects of intersubspecific hybridization were dependent on sperm trait and cross direction. The proportion of sperm head abnormalities was increased in F1 intersubspecific hybrids. The frequency of dissociat ed sperm heads was increased in the M. m. musculus x M. m. domesticus

( ♀ × ♂ ) F1 but decreased in M. m. domesticus x M. m. musculus ( ♀ × ♂ ) F1 hybrids, with the difference in medians being more than 180% . We deduce that the dissociated sperm heads trait is associated with the X chromosome and modulated by interaction with the Y chromosome; nevertheless, the high proportion of unexplained variance (55.46 %) suggests the presence of polymorphic autosomal in teractions. The reported differences in sperm quality between cross types may be highly relevant to male fitness in zones of secondary contact between the two subspecies. The cross direction asymmetry in frequency of dissociated sperm heads should favour t he M. m. musculus Y chromosome. This is consistent with the spread of the M. m. musculus Y chromosome in nature across the hybrid zone between these two subspecies.

Keywords : Mus musculus musculus , Mus musculus domesticus , phenotype variation, sperm head s , wild - derived strains

120

Introduction

Lower fertility in m ale s due to abnormal spermatozoa has been reported in many animals including humans, but its pathogenic causes, including genetic factors , remain largely unknown (Chen et al. 2016) . D ata from knockout mice suggest that numerous genes can impair spermiogenesis (reviewed in Chen et al. 2016). In nature, the incidence of genetic ally induced abnormalities can be affected due to hybridization between diverged populations i n zones of seconda ry contact (Alund et al. 2013) . Decreased sperm quality will tend to reduce, and improv ed sperm quality increase, the spread of causal genes . The amplitude of abnormal sperm morphology changes will be modulated by geographic standing variation, affecting gene flow at local scales. Nevertheless, in some traits hybridization may reveal species - specific effects, affecting gene flow at wider scale s along contact zones.

The house mouse hybrid zone (HMHZ) between Mus musculus musculus and M. m. domesticus whose genomes diverged 0.5 MY ago is among the best studied animal hybrid zones ( Baird &

Macholán 2012). The zone stretch es across Europe from Nor way to Bulgaria ; more than 2500 km long , itis only 10 - 20 km wide. T he enigmatic behaviour of the sex chromosomes has been especially challeng ing to our understanding of the extent and causality of introgressive hybridization (Albrechtová et al. 2012) . While introgression of the X chromosome is limited in comparison with the autosomal loci Y introgression seems widespread along an 850 km of the contact in Central Europe , and highly asymmetric : Y musculus invades the domesticus background , the converse bei ng extremely rare (Macholán et al. 2007, 2008 , Ďureje et al.

2012 ).

T o explore the conditions of th is Y chromosome spread in a wider context we earlier derived

31 recombinant lines from eight wild - derived strains representing four localities within the two mouse subspecies (Martincová et al. 2019 ) . These strains were first crossed within either

121 subspecies and subsequently reciprocally crossed to raise intersubsp ecific hybrids. The resulting F1 hybrid males were scored for five phenotypic traits associated with male fitness .

Hierarchical analysis of reproductive traits in F1 hybrids with recombi ned intrasubspecific genomes revealed that body and testis weights and sperm count differed on local scales (i.e. between localities and strains within subspecies) but not at the intersubspecific level

(Martincová et al. 2019 ). On the other hand, two sperm quality traits (frequenc y of abnormal sperm head s ( ASH ) and frequenc y of dissociat ed sperm heads from tail ( DSH ) ) displayed Y - associated differentiation at the intersubspecific level . In both cases the F1 hybrids with

Y musculus performed better than the F1 hybrids possessing Y domesticus . However, hierarchical model analysis suggested that the signal detected at the intersubspecific level in ASH might be spurious, rather caused by interactions between one specific Y domesticus haplotype and the

X or autosomes in recombinant lines .

In this paper we explore the replicability and generality of the sperm quality observations for

8 Y haplotypes reported by (Martincová et al. 2019 ). I ncreasing sample size such that representative genetic variation is captured within each of the subspecies and inter - and intrasubs pecific F1 hybrid comparisons we address two questions: (1) Are the proportions of deformed sperm in intersubspecific hybrids different in comparison with intrasubspecific F1 hybrids? (2) Is the sperm quality in intersubspecific F1 hybrids dependent on cro ss direction and, if so, are frequencies of DSH and ASH decreased in the domesticus × musculus ( ♀ x ♂ ) male progeny when compared with the musculus × domesticus ( ♀ x ♂ ) male progeny ? Such a comparative study of the same set of sperm - related traits across d ifferent experimental replicates tests the repeatability of subspecies - specific phenotypic variation observations .

122

Method s

Anim als

The 2 9 wild - derived strains used to produce F1 hybrids are maintained in the breeding facility of the Institute of Vertebrate Biology in Studenec ( Piálek et al. 200 8 ; licence s for keeping animals and experime ntal work 61974/2017 - MZE - 17214 and 62065/2017 - MZE - 17214, respectively). F our teen of them were derived at University of Montpellier by Annie Orth and

Fran ç ois Bonhomme and donated to Studenec in 2017 and 2018. PWD was derived in the

Institute of Molecular Genetics ( Gregorová & Forejt 2000 ). Sixteen strains represent sampling of the wild standing variation of domesticus genomes and 13 strains musculus genomes . Th eir distribution captures a wealth of genetic variation present within a geographic area covering almost 8.5 M km 2 . Detailed information on the origin of wild - derived strains and numbers of mated sires and dams used are listed in Table 1 and can also be retrieved at https://housemice.cz/ . Numbers of sires used to generate intra - and/or intersubspecific hybrids ranged between 1 - 18 (mean ± SD: 6.14 ± 4.69) and the numbers of dams ranged between 1 - 15 (7.00 ± 4.49). In total, we scored 178 unique F1 males representing 34 domesticus × domesticus , 61 domesticus × musculus ,42 musculus × domesticus and 42 musculus × musculus crosses. Note, in all notifications of crosses, the female precedes the male ( ♀ × ♂) . Each male was derived from a unique pair of parents and the ir data are considered independent.

123

Table 1 List of wild - derived strains and numbers of parents used in this study

Genome State WDS Latitude Longitude Sir e s Dams domesticus Israel BIK 32.766 34.960 7 5 domesticus Algeria BZO 35.698 - 0.634 2 4 domesticus Cyprus DCA 34.583 32.970 1 0 domesticus Cyprus DCP 34.772 32.430 8 6 domesticus Denmark DDO 55.409 9.383 2 4 domesticus Georgia DGA 41.601 42.069 4 5 domesticus Israel DIK 32.980 35.808 1 0 domesticus Italy DJO 45.527 8.542 2 1 domesticus Tahiti DOT - 17.538 - 149.559 1 0 domesticus Germany SCHUNT 50.427 9.598 10 15 domesticus UK SIN 59.297 - 2.554 3 4 domesticus UK SIT 59.297 - 2.554 8 12 domesticus Germany STAIL 50.427 9.598 2 5 domesticus Germany STRA 50.181 11.763 10 14 domesticus Germany STRB 50.181 11.763 8 10 domesticus France WLA 43.605 1.444 6 4 musculus Czechia BULS 50.222 13.376 12 15 musculus Czechia BUSNA 50.228 13.370 9 9 musculus Armenia MAM 38.902 46.247 1 1 musculus Georgia MGA 41.717 45.978 2 3 musculus Hungary MHB 47.495 19.040 1 1 musculus Poland MPB 52.701 23.875 7 8 musculus Czechia PWD 50.013 14.481 18 14 musculus Slovakia SENK 48.299 17.349 5 2 musculus Estonia SKA 58.955 24.834 7 12 musculus Estonia SKE 58.941 24.908 6 6 musculus Czechia STUF 49.200 16.064 15 7 musculus Czechia STUS 49.200 16.064 14 5

Phenotyping

All m ales were sacrificed by cervical dislocation and dissected at 60 days of age. Spermatozoa were released from the whole left epididymis and transferred into a watch glass with 2ml of

1 % sodium citrate (for details see Vyskočilová et al. 2005 ). Sperm quality parameters were evaluated in a Bürker haemocytometer using an Olymp us CX41 microscope under 200x magnification (for details see Vyskočilová et al. ( 2005) ) . T he frequency of dissociated sperm

124 heads (DSH) was estimated from five haemocytometer squares (mean number of sperm heads examined ± SD: 212.12 ± 88.00). Variation in the sperm head shape (ASH) was treated as a binomial variable with heads classified either as normal (Fig. 1 . A, D ) or abnormal (Fig. 1 . B , C ,

E, F). The proportion of ASH used for statistical analys e s was estimated from 3 haemocytometer squares ( mean number of sperm heads examined ± SD: 129.34 ± 52.01). All recorded phenotypic data are available in Supplementary Table S1.

Fig . 1 C lassification of normal and abnormal sperm heads . Top panels show sperm heads of a ( SCHUNT × MPB ) F1 hybrid, lower panels heads of a ( BIK × BULS )F1 hybrid. Figures A and D show normal heads, figures B, C and E, F show examples of abnormal sperm heads .

Statistical analys e s

Statistical analys e s were performed in the R statistical environment ( RStudio Team 2015 , R

Core Team 201 8 ) . The statistical models treat the sperm quality parameters (DSH and ASH) as dependent variable s and cross type ( domesticus × domesticus , domesticus × musculus , musculus × domesticus , musculus × musculus ) as explanatory variables. Neith er of DSH and ASH were distributed normally in F1 hybrids (Shapiro - Wilk normality test, P = 4.38 × 10 - 10 and P < 2.20 × 10 -

16 , respectively) . To improve the fit of DSH and ASH to normality we examined two transformations suggested in the literature for sperm head abnormalities : t he arcsine square -

125 root transformation (Kawai et al. 2006, White et al. 2011 ) and the Box - Cox power transformation utili zed by Martincová et al. (2019).

Where data transformation achieved normality and variance homogeneity , parametric tests were used to analyse differentiation in sperm quality between the crosses . We applied linear model ling ( function lm, from the R package stats ( R Core Team 201 8 ) ) and a linear mixed - effect s model fitted with the lmer function ( R package lme4 , Bates et al. ( 2015 ) ) . In mixed - effect s model s we asked whether unequal numbers of sires and dams used per individual strain ( see Table 1 for exact numbers ) disproportionally affected variance in the model and hence statistical inference . Both linear and mixed - effects model s were tested for normality of residuals. Selection of the best model fit was based on the Akaike’s information criterion

( Δ AIC) (Akaike 19 74). For post hoc comparison of pairwise difference s in between inter - and intrasubspecific crosses for the selected model s we utilized the glht package (Bretz et al.

2010). V ariables that did n ot conform to normal distribution were analysed using the n on - parametric Kruskal - Walis test and post hoc Kruskal Neményi test for pair - wise comparisons of mean rank sums as implemented in the R package PMCMR (Pohlert 2014).

The proportion of explained variance associated with fixed effects ( cross type ) and with unequal contribution of sir es and dams from the same strain was calculated using the approach described in Nakagawa & Schielzeth ( 2013) . In addition, we estimated parameters for fixed effects and standard deviations for each random effect level. The par ametric bootstrap was used to derive corresponding 95% confidence intervals .

126

Results

The arcsine square - root transformation failed to achieve normality for both variables

(Shapiro - Wilk normality test, P = 7.45 × 10 - 5 for DSH and P < 2.2 0 × 10 - 16 for ASH). Box - Cox power transformation achieved approximations to normality. For DSH, the optimal λ was estimated as 0.09. The transformed variable DSH.BC = (DSH 0.09 - 1)/0.09 was in conformity with normality

(Shapiro - Wilk normality test, P = 0.8 2 ) and disp layed homogenous variances across the four crosses (Bartlett test, P = 0.4 2 ). The optimal λ for ASH was estimated at - 0.5 0 ; however, the transformed variable ASH.BC = (ASH - 0.5 - 1)/ - 0.5 displayed non - normal distribution (Shapiro -

Wilk normality test, P = 0.00 ).

Frequencies of DSH within the four cross types are depicted in Fig 2 and detailed in

Supplementary Table S 2.1 . P arametric model fitting revealed that the model with random effects of strain identity of sir e s and dams performed bette r than the linear model ( Δ AIC =

6.29 , P = 0.0 1 ; see Supplementary Table 2 .2 ) . Results of post hoc comparison of pairwise differences in frequencies of DSH in the mixed - effects model are summarized in

Supplementary Table S 2 .3 and visualised with letters in F ig 2 . Two patterns emerge from the results. Th e mean frequencies of DSH did not significantly differ between intrasubspecific crosses being respectively ~10% and ~12% in the domesticus and musculus F1 hybrids.

However, t he int er subspecific crosses displayed significant differen ces depending on cross type. T he numbers of DSH were ~8% in domesticus × musculus and 15% in musculus × domesticus males and the medians of DSH differ by more than 180% between them becoming highly significant (Tukey post hoc comparison, P <0.001 ) .

127

Fig. 2 Frequency of dissociated sperm heads in intra - and intersubspecific crosses . Different l etters indicate significan t differen ces between crosses (see Supplementary Table 2.3) . Medians, quartiles, 1.5 interquartile range and individual data are presented .

The explained fraction of variance attributed to cross type (fixed effects) in DSH was 23.41%, t he fraction of variance attributed to strain origin of males was 12. 3 5 % and 8.77% to females and the proportion of unexplained variance was 55 . 46 %.

Frequencies of sperm head abnormalities in F1 hybrids are shown in Fig. 3 and detailed in

Supplementary Table S 2 .1 . The n onparametric test detected cross type dependent differentiation (Kruskal - Wallis test, P = 4.95×10 - 5 ) . The p ost hoc pairwise comparisons among cross types are in Supplementary Table S 2 .4 and shown with letters in Fig 3 . The incidence of abnormal heads was almost the same in the intrasubspecific musculus and domesticus

128 hybrids , reaching 6.98% and 7.10%, respectively . H ybridization increased ASH frequencies in both intersubspecific hybrids, though only the difference detected in the domesticus × musculus males was significant (ASH = 10.00%) and the musculus × domesticus males were intermediate (ASH = 8 . 13 %) . Males with severely deformed sperm head prevalence were rare: o nly 4 males (2.24%) displayed abnormal heads in frequencies higher than 50%, all of them originating from the musculus × domesticus cross.

Fig. 3 Frequency of abnormal sperm heads in intr a - and intersubspecific crosses . Different letters indicate significant differences between cross es (see Supplementary Table 2.4) . Medians, quartiles,

1.5 interquartile range and individual data are presented. One Mus*Dom male with ASH = 78.26% is out of the Y - axis limit.

129

Discussion Spermatogenesis is a tuned cascade of process es producing sperm and impairment of any phase of this process can affect fitness of males. The m ost severe impairments are caused by h ybridization and in inter(sub)specific hybrids ultimately lead to sterility (Forejt et al. 2012) .

Using a wide spectrum of wild - derived strains, we investigated the effects of hybridization on sperm quality parameters that can potentially decrease fertilization success. We found that frequencies of abnormal and dissociated sperm heads do not differ between parental intrasubspecific hybrids (i.e. within the musculus and domesticus crosses). However, the proportions of DSH and ASH differ significantly between and are depend ent on cross direction in in tersubspecific hybrids.

W e replicated the Martincová et al. (2019) results for subspecies - specific effects of hybridization on frequency of DSH , where 8 wild - derived strains showed significantly increased frequency of D SH in musculus × domesticus F1 hybrids in comparison with domesticus × musculus F1s . Our e xtension of DSH data to 29 strains strongly supports that this asymmetric effect is replicable among subspecific crosses. The domesticus × musculus F1s that display lower DSH frequency than the musculus × musculus males share the ir Y muscul us chromosome origin but differ in the subspecific origin of the X chromosome . Similarly, the musculus × domesticus F1s who have higher proportion of DSH than the domesticus × domesticus males share the ir Y domes tic us chromosome origin but possess different subspecific types of the X chromosome. This suggest s that most of the DSH differen ces are associated with the X chromosome and modulated by interaction with the Y chromosome , which changes the direction of the response in the intersubspecific hybrids : the Y domestic us increases and the

Y muscul us decrease s DSH frequency . Although the effects of autosomal loci cannot be teste d in this experiment, the high variation observed in DSH data (the proportion of unexplained

130 variance being over 55.46% ) suggests the presence of polymorphic autosomal and sex - linked gene interactions.

Now considering ASH: frequencies were elevated in both reciprocal types of F1 hybrids in comparison with the parental F1 hybrids. W e cannot replicate the 8 wild - derived strains results of Martincová et al. (2019) , which suggested an increased frequency of ASH in the musculus × domesticus F1 hybrids. Th os e authors traced the causality of this variation to

Y domesticus from one locality interacting with autosomal or X - linked loci. None of these Y domesticus chromosomes were however found in males displaying high rates of abnormal s perm (ASH >

30%, N = 8) in th e current study. Moreover, among the four cross types the only significantly increased proportion of ASH was observed in the domesticus × musculus F1 hybrids, i.e. , in the opposite direction of the selective advantage that woul d be required to explain the Y muscul us spread in the HMHZ. Hence, it seems that the incidence of ASH can be increased in intersubspecific mouse hybrids , but these effects appear polymorphic , with their occurrence conditioned by specific genotype(s).

F or ASH g enetic correlates between the sex chromosomes and sperm head abnormalities are well established (e.g. Ellis et al. 2005, Good et al. 2008, White et al. 2011, Cocquet et al. 2012,

Campbell & Nachman 2014 ). However, these effect are not sex chromosome e xclusive. In a laboratory congenic strain, B10.M, a high incidence of sperm - head morphological abnormalities was mapped to chromosomes 1 and 4 and no signal was detected on the X chromosome (Gotoh et al. 2012).

As far as we know, only one stud y has analysed genetic correlates for DSH between intersubspecific F1 hybrids (White et al., 2011 ) . They found increased DSH incidence in musculus × domesticus F1s (represented respectively by wild - derived strains PWD and WSB) and th is increase was more than 4 times higher in comparison with the reciprocal domesticus 131

× musculus F1 hybrids. Quantitative trait loci associated with DSH were detected on proximal parts of chromosomes 15 (within a 16 - 48 Mb interval) and X (10 - 96 Mb interval) (White et al.,

2011). The sex chromosome effect s on DSH demonstrated in th e current study apprear to be the strongests sperm trait effects found in exp e rimental crosses using wild - derived mice

(White et al., 2011, Martincová et al. 2019). Are these associa tions reflected by the physical position s of the genes participating i n cohesion between the sperm head and tail?

The sperm head and tail are bridged by the myosin - based connecting piece . A comprehensive search detected various factors that interact with myosin subunits ( Chen et al. 2016 ) . The

O az 3 gene that encodes ornithine decarboxylase antizyme 3 [located on chromosome 3 ] , the

O df 1 gene encoding the outer dense fibre of sperm tails 1 [chromosome 15 : 38.2 Mb ] and the

Spata6 encoding spermatogenesis associated 6 [chromosome 4 ] participate in myosin - based microfilament formation (genomic positions were retrieved at http://www.informatics.jax.org/ ) . Only SPATA6 forms a complex with myosin light and heavy c hain subunits (e.g., MYL6 on chromosome 3) during connecting piece formation ( Yuan et al.

2015) . T he Oaz3 gene - encode d protein p12 targets phosphatase targeting subunit 3 Ppp1r16a

( synonym MYPT3 on chromosome 15 [ 36.25 cM ] ) which is a regulator of activity of the protein phosphatase s Ppp1cb (synonym PP1β on chromosome 5) and Ppp1cc (synonym PP1γ2 on chromosome 5) (Ruan et al. 2011) . Linking of ODF1 to microtubules might occur via

ODF1/SPAG5 [ chromosome 11 ] / SPAG4 [ chromosome 2 ] interaction. SPAG4 knock - out mice demonstrate that the SPAG4 itself is not essential for the formation of the sperm head - to - tail coupling apparatus, nevertheless, SPAG4 is required for tightening the sperm head - to - tail anchorage (Yang et al. 2018). Surprisingly, none of the genes noted above are located on the sex chromosome s , and only two autosomal genes ( Odf1 and Ppp1r16a ) lie within the interval s

132 identified for QTL s of DSH (White et al., 2011) . This suggests that other sex chromosome - linked loci that can affect the tightness of sperm head - to - tail bonds remain to be determined.

The mechanism causing asymmetry in DSH frequencies between two types of intersubspecific hybrids might be considered in e volutionary context as a result of an arms race . T he developmental environment of sperm in a male’s epididymis contains proteins encoded by genes on both the male’s X and Y chromosomes (though there are many more genes on the X chromosome ). Any gene in the non - recombining X could increase its copy number in progeny of the male by selecting against Y - bearing sperm. One way to do so would be to encode a DSH promoter in the epididymis. A DSH - promoting X chromosome that also gives sperm carrying it (the same X) resistance to the promoter will win an X|Y arms race for passage through the epididymis. Y - bearing sperm will suffer disproportionate DSH until they gain ‘resistance’ to this X chromosome strategy – for example by increasing their own resistance to the DS H promoter . Such arms races are not uncommon in the house mouse ( Cocquet et al. 2009, 2012,

Ellis et al. 2011, Larson et al. 2017 ) and are, very likely, long - term features of the evolutionary process. Suppose, when the populations giving rise to musculus a nd domesticus were split (0.5

MYA), an on - going X|Y arms race in the epididymis was also split, following independent trajectories for half a million years before secondary contact (in both nature and lab oratory crosses). It is highly unlikely that the arm s races will come together in identical states. Coupled h igher DHS promoter levels and resistance levels in Mus would be consistent with our observed results: Y muscul us sperm in a domesticus X epididymis combine high resistance with low promoter levels : low DSH. Y domestic us sperm in a musculus X epididymis combine low resistance with high promoter levels : high DSH. This hypothesis has a testable prediction: DSH sperm should tend to be Y - bearing, not X, and a fluorescence in - situ hybridization protocol p robing X and Y chromosomes can address this question. Finally, we note the hypothesis is

133 consistent with both the Y muscul us invasion across the HMHZ and its associated disto rtion of the trapping sex ratio : ubiquitous low levels of X - induced DSH within each taxon would be consistent with female - biased sex ratios in ‘pure’ populations ( Macholán et al. 2008 ). If the

‘ Y muscul us sperm in a domesticus X epididymis combine high resistance with low promoter levels ’ case eliminated DSH the prediction would be sex ratio parity – as observed in Y muscul us introgressed populations ( Macholán et al. 2008 ).

A higher incidence of tailless sperm can also result as a consequence of sperm manipulation a f ter its release from epididymis. For exa mple, in patients in which s emen analysis was normal , a minimal micromanipulation for ICSI resulted in decapitation of the spermatozoon during immobilization (Kamal et al. 1999) . However, it would be difficult to explain the differences in

DSH among the cr oss types we have observed , as all sperm atozoa were manipulated using the same protocol.

Finally, b y comparing two data transformations used in the literature we found that only the

Box - Cox transform ation was useful to approximate normality at least in some proportional data. We suggest this transformation as a preferable method for analysis of sperm quality parameters.

In conclusion , we found strong evidence that intersubspecific hybridization significantly affects sperm quality and these effects are de pendent on sperm trait and cross type direction.

The p roportion of sperm head abnormalities wa s in general increased by hybridization, the frequency of dissociated sperm heads is increased in the musculus × domesticus F1 but decreased in the domesticus × m usculus F1 hybrids. The reported differences in sperm quality between cross types may be highly relevant to male fitness in zones of secondary contact between the two house mouse subspecies. The u terus junction h as been described as a barrier preventing de formed sperm reaching the eggs (Krzanowska, 1974 , Nesto r & Handel, 1984) ; 134 consequently, hybrids with increased ASH may be target s of selection. On the other hand, head - tail dissociations have a very direct effect on fitness as tailless head cannot swim through the uterine environment to reach the female gam etes . The cross direction asymmetry in frequency of dissociated sperm heads should favour the M. m. musculus Y chromosome in F1 male progeny. This is consistent with the spread of the M. m. musculus Y chromosome in nature across the hybrid zone between the se two subspecies (Macholán et al. 2008,

Albrechtová et al. 2012, Ďureje et al. 2012 ) . The frequencies of both ASH and DSH observed in this study may appear low (medians ranging between 7.0 - 15.1%). However, their fitness consequences will be tested in natu re in the presence of male - male sperm competition (Dean et al. 2006 ), and so have the potential to be very significant .

Data availability

All data are available as electronic supplementary material .

Competing interests

The authors declare that they have no competing interests .

Accession ID

House mouse ( Mus musculus ), the NCBI taxon ID 10090 .

Acknowledgements

We thank Jakub Kr eisinger for statistical advice, and Lidka Rousková, Helena Hejlová, Iva

Posp íšilová, and Jana Piálková for the welfare provided to th e experimental mice.

This study was supported by the Czech Science Foundation (Projects 17 - 25320S and 19 -

12774S) and the ROZE program of the Czech Academy of Sciences. The funding agencies

135 played no role in the design of the study, the collection, analysi s, and interpretation of data and in writing the manuscript.

References

Albrechtová J, Albrecht T, Baird SJE, Macholán M, Rudolfsen G, Munclinger P, Tucker PK, Piálek J (2012) Sperm -

related phenotypes implicated in both maintenance and breakdown of a natural species barrier in the

house mouse. Proc R Soc B - Biol Sci 279:4803 – 4810 https://doi.org/10.1098/rspb.2012.1802

Akaike H (1 974 ) New look at statistical - model identification. I EEE Transact Automatic Control AC19:716 – 723

https://doi.org/10.1109/TAC.1974.1100705

Alund M., Immler S, Rice AM, Qvarnström A (2013) Low fertility of wild hybrid male flycatchers despite recent

diverg ence. Biol Lett 9: 20130169 https://doi.org/10.1098/rsbl.2013.0169

Baird SJE, Macholán M (2012) What can the Mus musculus musculus/M. m. domesticus hybrid zone tell us

about speciation? In: Macholán M, Baird SJE, Munclinger P, Piálek J (eds.), Evolution of the House Mouse.

Cambridg e University Press, Cambridge: 334 – 372

Bates D , Machler M , Bolker BM, Walker SC ( 2015 ) Fitting linear mixed - effects models using lme4. J Stat

Softw are 67:1 – 48 https://doi.org/10.18637/jss.v067.i01

Bretz F, Hothorn T, Westfall P (201 1 ) Multiple Comparisons Using R. CRC Press, Boca Raton

Campbell P, Nachman MW (2014) X - Y interactions underlie sperm head abnormal ity in hybrid male house mice.

Genetics 196: 1231 – 1240 https://doi.org/10.1534/genetics.114.161703

Chen SR, Batool A,. Wang YQ,. Hao XX, Chang CS, Cheng CY, Liu Y. X (2016) The control of male fertility by

spermatid - specific factors: searching for contraceptive targets from spermatozoon's head to tail. Cell Death

& Dis 7:e2472 https://doi.org/10.1038/cddis.2016.344

Cocquet J, Ellis PJI, Yam auchi T, Mahadevaiah SK, Affara NA, Ward MA, Burgoyne PS (2009) The multicopy gene

Sly represses the sex chromosomes in the male mouse germline after meiosis. PLoS Biol 7:e1000244

https://doi.org/10.1371/journal.pbio.1000244

Cocquet J, Ellis PJI, Mahadevaiah SK, Affara NA, Vaiman D, Burgoyne PS ( 2012 ) A genetic basis for a postmeiotic

X versus Y chromosome intragenomic conflict in the mouse. PLoS Genetics 8 : e1002900

https://doi.org/10.1371/journal.pgen.1002900 136

Coyne JA Orr HA (2004). Speciation. Sinauer Associates, Sunderland

Dean MD, Ardlie KG , Nachman MW (2006) The frequency of multiple paternity suggests that sperm

competition is common in house mice ( Mus domesticus ). Mol Ecol 15 :4141 – 4151

https://doi.org/10.1111/j.1365 - 294X.2006.03068.x

Ďureje L, Macholán M, Baird SJE, Piálek J (2012) The mouse hybrid zone in Central Europe: From morphology to

molecules. Folia Zool 61:308 – 318

Ellis PJI, Clemente EJ, Ball P, Toure A, Ferguson L, Turner JMA, Loveland KL. Affara NA, Burgoyne PS (2005)

Deletions on mouse Yq lead to upregulation of multiple X - and Y - linked transcripts in spermatids. Human

Mol Genet 14 : 2705 – 2715 https://doi.org/10.1093/hmg/ddi304

Ellis PJI, Bacon J, Affara NA (2011) Association of Sly with sex - linked gene amplification during mouse evolution:

a side effect of genomic conflict in spermatids? Human Mol Genet 20:3010 – 3021

https://doi.org/10.1093/hmg/ddr204

Forejt J, Piálek J, Trachtulec Z (2012) Hybrid male sterility genes in the mouse subspecific crosses. In: Evolution

of the House Mouse , edited by. Macholán M, Baird SJE, Munclinger P, Piálek J, Cambridge: Cambridge Univ

Press, p 482 – 503

Good JM, Dean MD, Nachman MW (2008) A complex genetic basis to X - linked hybrid male sterility between

two species of house mice. Genetics 179: 2213 – 2228 https://doi.org/10.1534/genetics.107.085340

Gotoh H, Hirawatari K, Hanzawa N, Miura I, Wakana S (2012) QTL on mouse chromosomes 1 and 4 causing

sperm - head morphological abnormality and male subfertility. Mamm Genome 23:399 – 403

https://doi.org/10.1007/s00335 - 012 - 9395 - 1

Gregorová S, Forejt J (2000) PWD/Ph and PWK/Ph inbred mouse strains of Mus m. musculus subspecies - a

valuable resource of phenotypic variations and genomic polymorphisms. Folia Biol, Praha 46:31 – 41

Kamal A, Manso ur R, Fahmy I, Serour G, Rhodes C, Aboulghar M (1999) Easily decapitated spermatozoa defect:

a possible cause of unexplained infertility. Human Reprod 14:2791 – 2795

https://doi.org/10.1093/humrep/14. 11.2791

Kawai Y, Hata T, Suzuki O, Matsuda J (2006) The relationship between sperm morphology and in vitro

fertilization ability in mice. J Reprod Dev 52:561 – 568 https://doi.org/10.1262/jrd.18023

Krzanowska H (1974) The passage of abnormal spermatozoa through the uterotubal junction of the mouse. J

Reprod Fert 34: 81 – 90

137

Larson EL, Keeble S, Vanderpool D, Dean MD, Good JM ( 2017 ) The composite regulatory basis of the large X -

effect in mouse speciation . Mol Biol Evol 34:282 – 295 https://doi.org/10.1093/molbev/msw243

Macholán M, Munclinger P, Šugerková M, Dufková P, Bímová B, Božíková E, Zima J, Piálek J (2007) Genetic

analysis of autosomal and X - link ed markers across a mouse hybrid zone. Evolution 61:746 – 771

https://doi.org/10.1111/j.1558 - 5646.2007.00065.x

Macholán M, Baird SJE, Munclinger P, Dufková P, Bímová B, Piálek J (2008) Genetic conflict outweighs

heterogametic incompatibility in the mouse hybrid zone? BMC Evol Biol 8:271

https://doi.org/10.1186/1471 - 2148 - 8 - 271

Martincová I., Ďureje Ľ., Kreisinger J., Macholán M., Piálek J. 2 019. Phenotypic effects of the Y chromosome are

variable and structured in hybrids among house mouse recombinant lines. Ecol Evol: 9:6124 – 6137 .

https://doi.org/10.1002/ece3.5196

Nakagawa S , Schielzeth H ( 2013 ) A general and simple method for obtaining R 2 from generalized linear mixed -

effects models. Methods Ecol Evol 4: 133 – 142 https://doi.org/10.1111/j.2041 - 210x.2012.00261.x

Nestor A, Handel , MA (1984) The transport of morphologically abnormal sperm in the female reproductive

tract of mice. Gamete Res 10: 119 – 125 https://doi.org/10.1002/mrd.1120100204

Piálek J , Vyskočilová M, Bímová B, Havelková D, Piálková J, Dufková P, Bencová V, Ďureje Ľ, Albrecht T, Hauffe

HC, Macholán M, Munclinger P, Storchová R, Zajícová A, Holáň V, Gregorová S, Forejt J (2008) Development

of unique house mouse resources suitable for evolutionary studies of speciation. J Heredity 99:34 – 44

https://doi.org/10.1093/jhered/esm083

Pohlert T ( 2014 ) The pairwise multiple comparison of mean ranks package (PMCMR). R package.

https://CRAN.R - project.org/package=PMCMR

R Core Team (2018). R: A language and environment for statistical computing. R Foundation for Statistical

Computing, Vienna, Austria. URL: https://www .R - project.org/

RStudio Team (2015) RStudio: Integrated Development for R. RStudio, Inc., Boston. Retrieved from

http://www.rstudio.com/

Ruan Y, Cheng M, Ou Y, Oko R, van der Hoorn FA (2011) Ornithine decarboxylase antizyme Oaz3 modulates

protein phosphatase activity . J Biol Chem 286 :29417 – 29427

Vyskočilová M, Trachtulec Z, Forejt J, Piálek J (2005) Does geography matter in hybrid sterility in house mice?

Biol J Linn Soc 84 :663 – 674 https://doi.org/10.1111/j.1095 - 8312.2005.00463.x

138

White M , Steffy B , Wiltshire T , Payseur, BA ( 2011 ) Genetic dissection of a key reproductive barrier between

nascent species of house mice. Genetics 189 : 289 – 304 https://doi.org/10.1534/genetics.111.129171

Yuan S, Stratton CJ, Bao J, Zheng H, Bhetwal BP, Yanagimachi R, Yan W (2015) Spata6 is required for normal

assembly of the sperm connecting piece and tight head - tail conjunction. Proc Natl Acad Sci USA 112:E430 –

E439 https://doi.org/10.1073/pnas.1424648112

Yang K, Adham IM, Meinhardt A, Hoyer - Fender S (2018) Ultra - structure of the sperm head - to - tail linkage

complex in the absence of the spermatid - specific LINC component SPAG4. Histochemistry Cell Biol 150:49 –

59 https://doi.org/ 10.1007/s00418 - 018 - 1668 - 7

Supplementary Material

Supplementary Material S1 . Phenotypic data for sperm traits in individual crosses are not

included in printed version of the thesis. The data will be available as electronic

supplementary material or on request (e - mail [email protected])

139

Supplementary Table S 2 .1 - 2.4 . Descriptive statistics and tests including post hoc comparison

for dissociated and abnormal sperm heads.

Supplementary Table S2 .1 Medians and the 25 and 75% quartiles for abnormal head s perm

(ASH) and dissociated sperm heads (DSH) in intra - and intersubspecific crosses

Cross_type Medians.ASH Medians.DSH

Dom*Dom 7.10 ( 5.35 ~ 8.44 ) 9.93 ( 8.11 ~ 13.03 )

Dom*Mus 10.00 ( 7.14 ~ 14.39 ) 8.33 ( 6.62 ~ 10.71 )

Mus*Dom 8.13 ( 6.53 ~ 10.48 ) 15.13 ( 10.66 ~ 18.04 )

Mus*Mus 6.98 ( 5.84 ~ 9.00 ) 12.06 ( 9.68 ~ 14.05 )

140

Supplementary Table S 2 .2

Dissociated sperm heads tests

(a) anova for linear model based on Box - Cox transformed data formula: DSH.BC ~ OffCross

Df Sum Sq Mean Sq F value Pr(>F)

OffCross 3 5.483 1.828 18.413 2.019e - 10

Residuals 174 17.271 0.099

(b) anova for mixed effects model based on Box - Cox transformed data

Formula: DSH.BC ~ OffCross + (1 | StrSir) + (1 | StrDam)

Sum Sq Mean Sq NumDF DenDF F value Pr(>F)

OffCross 2.189 0.730 3 44.927 9.682 4.799e - 05

Models: lmDSH: DSH.BC ~ OffCross mixDSH.MF: DSH.BC ~ OffCross + (1 | StrSir) + (1 | StrDam)

Df AIC BIC logLik deviance Chisq Chi Df Pr(>Chisq) lmDSH 5 99.914 115.82 - 44.957 89.914 mixDSH.MF 7 93.623 115.90 - 39.812 79.623 10.291 2 0.005826

ΔAIC = 6.29

141

Supplementary Table S 2 .3 Results of post hoc pairwise comparisons of dissociated sperm heads (DSH) between cross types using Tukey contrasts. Analysis is based on the linear mixed model with random effects using transformed data

Contrast Estimate±SE Prob

Dom*Mus - Dom*Dom - 0.105 ± 0.081 0.550

Mus*Dom - Dom*Dom 0.354 ± 0.082 <0.001

Mus*Mus - Dom*Dom 0.144 ± 0.099 0.452

Mus*Dom - Dom*Mus 0.459 ± 0.091 <0.001

Mus*Mus - Dom*Mus 0.249 ± 0.074 0.004

Mus*Mus - Mus*Dom 0.210 ± 0.083 0.052

Supplementary Table S 2 .4 Results of a nonparametric Tukey - Kramer (Nemenyi) test for post hoc pairwise comparisons of abnormal sperm heads (ASH) between cross types

Contrast Estimate Prob

Dom*Mus - Dom*Dom 5.903 0.000

Mus*Dom - Dom*Dom 3.347 0.084

Mus*Mus - Dom*Dom 0.988 0.898

Mus*Dom - Dom*Mus 2.450 0.307

Mus*Mus - Dom*Mus 5.121 0.002

Mus*Mus - Mus*Dom 2.473 0.298

142

143

144

List of conferences Domestic :

Simulace hybridní zóny myši domácí pomocí mnohogenomových rekombinan tních kmenů. Zoologické dny , Ostrava , 2014 (poster)

Mouse multigenomic recombinant strains. Mus studenticus. Mohelno, 2014 (oral presentation)

Rozmanizost hybridní zóny myši domácí: porovnání různých transektů. Zoologické dny, Brno, 2017

(oral presentation)

International :

Multigenomic recombinant strains as a tool for simulation of first contact in house mouse hybrid zone. 3rd International mouse meeting , Plön, Germany, 2014 (poster)

Simulation of house mouse hybrid zone using multigenomic recombinant lines. EMPSEB21. 2015,

Stirling, Scotland (oral presentation)

House mouse hybrid zone variability: from a phenotypical point of view. 4th International Mou se

Meeting , Zurych, Switzerland , 2017 (oral presentation)

House mouse hybrid zone variability: from a phenotypical point of view. Hybrid Zone Workshop,

Mohelno, Czech Republic, 2017 (oral presentation)

145

146