Cryptococcus Neoformans and Cryptococcus Gattii: Speciation in Progress

and

Cryptococcus gattii:

speciation in progress

Marjan Bovers

bovers_V4.indd 1 25-10-2007 10:14:00 Promotor: Prof. dr. I. M. Hoepelman

Co-promotor: Dr. T. Boekhout

Commissie: Dr. F. E. J. Coenjaerts Prof. dr. P. W. Crous Prof. dr. R. F. Hoekstra Prof. dr. J. A.G. van Strijp Prof. dr. H. A. B. Wösten

Paranimfen: Eiko Kuramae Ruben IJpelaar

Foto voorkant: Artist impression of Cryptococcus neoformans and Cryptococcus gattii by Eiko E. Kuramae Lay-out en drukwerk: Ponsen en Looijen

Het onderzoek dat beschreven wordt in dit proefschrift is uitgevoerd op het Centraalbureau voor Schimmelcultures (Utrecht) en is financieel ondersteund door het Odo van Vloten fonds. De uitgave van dit proefschrift werd mede mogelijk gemaakt door financiële steun van de Eijkman Graduate School en de J.E. Juriaanse stichting.

bovers_V4.indd 2 25-10-2007 10:14:01 Cryptococcus neoformans

and

Cryptococcus gattii:

speciation in progress

Cryptococcus neoformans en Cryptococcus gattii:

voortdurende soortvorming

(met een samenvatting in het Nederlands)

Proefschrift

ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof. dr. J. C. Stoof, ingevolge het besluit van het college voor promoties in het openbaar te verdedigen op donderdag 29 november 2007 des middags te 12.45 uur

door

Marjan Bovers geboren op 7 september 1979, te Eindhoven

bovers_V4.indd 3 25-10-2007 10:14:01 Promotor: Prof. dr. I. M. Hoepelman

Co-promotor: Dr. T. Boekhout

bovers_V4.indd 4 25-10-2007 10:14:01 Contents

Chapter 1 Introduction 7

Chapter 2 Six monophyletic lineages identified within Cryptococcus 29 neoformans and Cryptococcus gattii by multi-locus sequence typing

Chapter 3 The mitochondrial genome of Cryptococcus gattii shows 59 evidence of recombination

Chapter 4 Unique hybrids between fungal pathogens Cryptococcus 83 neoformans and Cryptococcus gattii Chapter 5 Promiscuous mating of Cryptococcus neoformans and 101 Cryptococcus gattii: discovery of a novel AB hybrid

Chapter 6 Identification of genotypically diverse Cryptococcus 117 neoformans and Cryptococcus gattii isolates using Luminex xMAP technology

Chapter 7 General discussion and Summary 139

Samenvatting 157

Dankwoord 167

Curriculum Vitae and List of publications 173

bovers_V4.indd 5 25-10-2007 10:14:01 bovers_V4.indd 6 25-10-2007 10:14:02 Chapter 1

Introduction

bovers_V4.indd 7 25-10-2007 10:14:02 bovers_V4.indd 8 25-10-2007 10:14:02 Chapter 1: Introduction

Taxonomic history 1 The science of Cryptococcus neoformans and Cryptococcus gattii started in 1894, when the Italian researcher Sanfelice first isolated Saccharomyces neoformans from peach juice (Sanfelice, 1894). In the same year Saccharomyces hominis was observed in a human infection (Busse, 1894; Buschke, 1895) and two years later an encapsulated bacilliform yeast, which was named Saccharomyces subcutaneous tumefaciens, was isolated from a young and healthy man (Curtis, 1896). Several of these cultures were re-examined by another researcher, but as the ascospore characteristics of the genus Saccharomyces were not present, these isolates were placed in the genus Cryptococcus (Vuillemin, 1901). Cryptococcus hominis was later described as a synonym to Cryptocococus neoformans (Lodder and Kreger-van Rij, 1952). In 1970, an atypical strain of C. neoformans was isolated from a leukemic patient and this strain was described as C. neoformans var. gattii (Vanbreuseghem and Takashio, 1970). The teleomorph of C. neoformans was discovered when two serotype D isolates were mated and it was named Filobasidiella neoformans (Kwon-Chung, 1975). However, when serotype B and C isolates were mated, a teleomorph that clearly differed from F. neoformans was observed. This resulted in the description of Filobasidiella bacillispora (Kwon-Chung, 1976b). In addition, several physiological assays showed that C. neoformans serotype B and C isolates differed from C. neoformans serotype A and D isolates, which resulted in the description of Cryptococcus bacillisporus for serotype B and C isolates (Kwon- Chung et al., 1978). Although previous mating experiments with C. neoformans var. gattii had been unsuccessful (Kwon-Chung et al., 1978), in 1982, viable basidiospores were produced when C. neoformans var. gattii was mated with C. bacillisporus and C. neoformans (Schmeding et al., 1981; Kwon-Chung et al., 1982a). Furthermore, mating of C. bacillisporus with C. neoformans resulted in the formation of viable basidiospores (Schmeding et al., 1981; Kwon-Chung et al., 1982a). Kwon-Chung et al. (1982a) therefore proposed to treat the two taxa as varieties of C. neoformans, namely C. neoformans var. neoformans and C. neoformans var. gattii. In 1999, based on phenotypic and genotypic data, Franzot et al. (1999) proposed to install a third variety, namely C. neoformans var. grubii, corresponding to serotype A. Despite the results of earlier mating experiments, C. gattii has recently been described as a separate species, because of the increasing amount of data suggesting the distinctiveness of C. neoformans and C. neoformans var. gattii (Kwon-Chung et al., 2002). Currently, two species are recognized within the C. neoformans – C. gattii species complex. These species are the anamorphic yeast C. neoformans (Sanfelice) (Vuillemin, 1901) with its teleomorph Filobasidiella neoformans (Kwon-Chung) (Kwon-Chung, 1975) and the anamorphic yeast C. gattii (Vanbreuseghem and Takashio) (Kwon- Chung et al., 2002) with its teleomorph Filobasidiella bacillispora (Kwon-Chung, 1976b).

bovers_V4.indd 9 25-10-2007 10:14:03 Chapter 1: Introduction

Within C. neoformans two varieties have been described, namely var. grubii and var. neoformans (Franzot et al., 1999). Both C. neoformans and C. gattii belong to the Filobasidiella clade of the Tremellales (Basidiomycota, Hymenomycetes) (Scorzetti et al., 2002). Species that are closely related to C. neoformans and C. gattii are Cryptococcus amylolentus, Tsuchiyaea wingfieldii and Filobasidiella depauperata (Fell et al., 1992; Mitchell et al., 1992, Guého et al., 1993; Kwon-Chung et al., 1995; Fell et al., 2000; Scorzetti et al., 2002).

Genotypes and serotypes

Cryptococcus neoformans and C. gattii can be distinguished by serotype (A, D and AD for the former, B and C for the latter) (Kwon-Chung et al., 1982a; Kwon-Chung et al., 2002), karyotype (Wickes et al., 1994; Boekhout et al., 1997), RAPD pattern (Ruma et al., 1996; Boekhout et al., 1997; Ellis et al., 2000), PCR fingerprint (Meyer et al., 1993), RFLP pattern (Meyer et al., 2003; Latouche et al., 2003), AFLP fingerprint (Boekhout et al., 2001) and DNA sequence (Diaz et al., 2000; Xu et al., 2000b; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Katsu et al., 2004; Butler and Poulter, 2005; Diaz et al., 2005; Bovers et al., 2007a; Bovers et al., 2007b). Several molecular methods showed that two genotypic groups can be recognized within C. neoformans (Meyer et al., 1993; Ruma et al., 1996; Diaz et al., 2000; Ellis et al., 2000; Xu et al., 2000b; Boekhout et al., 2001; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Latouche et al., 2003, Meyer et al., 2003; Katsu et al., 2004; Butler and Poulter, 2005; Diaz et al., 2005; Bovers et al., 2007a) and these groups have been described as separate varieties, namely var. grubii (serotype A) and var. neoformans (serotype D) (Franzot et al., 1999). However, although several molecular methods distinguished four genotypic groups within C. gattii (Ruma et al., 1996; Ellis et al., 2000; Chaturvedi et al., 2002; Biswas et al., 2003; Latouche et al., 2003; Meyer et al., 2003; Butler and Poulter, 2005; Diaz et al., 2005; Fraser et al., 2005; Bovers et al., 2007a), these groups have not been described as distinct taxa. Interestingly, serotypes B and C do not correspond to a specific group, but occur in all genotypic groups C. gattii (Meyer et al., 2003).

Epidemiology and ecology

Cryptococcus neoformans and C. gattii differ in epidemiology and in their ecological niche. Cryptococcus neoformans var. grubii occurs throughout the world and causes 99% of the cryptococcal infections in AIDS patients (Mitchell and Perfect, 1995). Cryptococcus neoformans var. neoformans is also found worldwide, but it occurs most commonly in Europe, where 20% of the reported infections are caused by var. neoformans (Kwon- Chung and Bennett, 1984; Dromer et al., 1996, Tortorano et al., 1997, Tintelnot et al.,

bovers_V4.indd 10 25-10-2007 10:14:03 Chapter 1: Introduction

2004; Viviani et al., 2006). Cryptococcus neoformans var. neoformans is able to infect AIDS patients (Dromer et al., 1996; Tortorano et al., 1997). Among patients diagnosed with 1 cryptococcosis, elderly people as well as people that receive corticosteroid therapy have an increased risk of infection with C. neoformans var. neoformans (Dromer et al., 1996). In contrast to C. neoformans, C. gattii mainly infects otherwise healthy individuals (Rozenbaum and Goncalves, 1994; Speed and Dunt, 1995; Mitchell et al., 1995; Chen et al., 2000) and occurs predominantly in (sub)tropical areas (Kwon- Chung and Bennett, 1984). Cryptococcus gattii has, however, been isolated in Europe (Montagna et al., 1997; Baró et al., 1998; Velegraki et al., 2001; Colom et al., 2005) and in a temperate climate zone in Colombia (Escandón et al., 2006). Furthermore, C. gattii is responsible for the ongoing outbreak of cryptococcosis on Vancouver Island, Canada (Stephen et al., 2002; Hoang et al., 2004; Kidd et al., 2004), and has been detected in other areas of the Pacific Northwest, USA, although recent data suggests that C. gattii has not permanently colonized those areas (MacDougall et al., 2007). Cryptococcus neoformans is often isolated from avian excreta, mainly from pigeon excreta (Emmons, 1955; Casadevall and Perfect, 1998). In addition, it has been isolated from soil (Emmons, 1951) and decaying wood (Lazéra et al., 1996). Cryptococcus gattii has been isolated from several tree species since the first finding of C. gattii on Eucalyptus camaldulensis (Ellis and Pfeiffer, 1990; Callejas et al., 1998; Lazéra et al., 1998; Lazéra et al., 2000; Fortes et al., 2001; Krockenberger et al., 2002; Fraser et al., 2003; Randhawa et al., 2003; Granados and Castañeda, 2005; Escandón et al., 2006; Kidd et al., 2007). Recently, however, it has been suggested that soil may in fact be the principal reservoir for C. gattii (Kidd et al., 2007).

Reproduction and population structure

Cryptococcus neoformans and C. gattii are haploid yeasts that predominantly reproduce asexually, i.e. by budding. However, they also possess a bipolar mating system, with mating types MATa and MATα (Kwon-Chung, 1975; Kwon-Chung, 1976a). Mating may occur if cells of opposite mating types meet (Kwon-Chung, 1975; Kwon-Chung, 1976a; Kwon-Chung, 1976b). MATa cells produce MFa pheromone in response to nitrogen starvation and in response to the MFa pheromone, MATα cells form a conjugation tube (Chang et al., 2000; Wang et al, 2000). In response to MFα pheromone, which is induced by starvation conditions as well as by the presence of MATa cells (Shen et al., 2002), the MATa cells dramatically enlarge to form swollen cells that can fuse with the conjugation tubes of the MATα cells (Davidson et al., 2000). McClelland et al. (2004) hypothesized about the cascade of events following conjugation tube formation by the MATα cell. The MATα nucleus divides and migrates into the conjugation tube. Simultaneously, the MATa nucleus divides and

bovers_V4.indd 11 25-10-2007 10:14:04 Chapter 1: Introduction

the MATa cell initiates hyphal formation. Nuclei from both mating types then migrate into the hyphae. The now dikaryotic hyphae are linked by fused clamp connections. A basidium is formed on the tip of a hyphae and subsequently karyogamy and meisosis occur within the basidium (Kwon-Chung, 1976a). The four resulting nuclei remain in the basidium and repeated post-meiotic mitosis generates four long chains of spores (Kwon-Chung, 1976a; Kwon-Chung, 1980). A single spore chain may contain parental spore types as well as recombinants, indicating that the nuclei in the basidium are randomly distributed and that mitosis of these nuclei occurs randomly prior to spore formation (Kwon-Chung, 1980). The processes that occur during mating are depicted in Figure 1. Initial reports showed that during mating mitochondria are inherited from the MATa parent (Xu et al., 2000a; Yan and Xu, 2003). However, recent reports indicated that in some cases leakage may occur, leading to biparental inheritance or to the presence of only MATα parental mitochondria in the progeny (Yan and Xu, 2003, Toffaletti et al., 2004; Yan et al., 2004; Yan et al., 2007a; Yan et al., 2007b). Mitochondria are predominantly inherited from the MATa parent, probably because the majority of MATα mitochondria stay in the MATα cell and do not completely mix with mitochondria of the MATa cell. Hyphal elongation originates from the MATa cell, thus further reducing the presence of MATα mitochondria in the hyphae (Yan et al., 2007b). Leakage increases under conditions which influence conjugation tube formation and hyphal elongation, such as UV irradiation, high temperature or same-sex mating (Yan et al., 2007a; Yan et al., 2007b). Cryptococcus neoformans and C. gattii cells may also reproduce by haploid fruiting, a process that involves diploidization and meiosis (Lin et al., 2005) and occurs in response to nitrogen starvation and/or desiccation (Wickes et al., 1996). Haploid fruiting might occur through self-diploidization or through cell-cell fusion (Lin et al., 2005). Haploid fruiting resembles mating, but there are some differences. Mating occurs between cells of opposite mating types (Kwon-Chung, 1976a; Kwon-Chung, 1976b), whereas haploid fruiting involves cells of the same mating type (Wickes et al., 1996). During haploid fruiting the nuclei fuse in the hyphae (Lin et al., 2005), whereas during mating the fusion of nuclei occurs in the basidium (Kwon-Chung, 1976a). Furthermore, clamp connections of hyphae produced during mating are fused, whereas clamp connections produced during haploid fruiting are unfused (Wickes et al., 1996). During haploid fruiting, basidia with viable basidiospores are formed, albeit at a lower frequency than in a standard MATa-MATα mating (Wickes et al., 1996). Although haploid fruiting has first been described in MATα isolates of all serotypes (Wickes et al., 1996), it has also been observed in a few MATa isolates (Tscharke et al., 2003). Interestingly, one of the environmental C. gattii isolates from Vancouver Island is a diploid homozygous MATα isolate (Fraser et al., 2005), which may have been generated by aberrant haploid fruiting.

bovers_V4.indd 12 25-10-2007 10:14:05 Chapter 1: Introduction

Several purposes have been suggested for haploid fruiting, or more specifically for the resulting filamentation. Haploid fruiting may increase the chance of finding 1 a mating partner (Wang et al., 2000; Hull and Heitman, 2002). An indication for this is the stimulation of haploid fruiting of MATα cells in response to MFa pheromone (Shen et al., 2002). Haploid fruiting may also increase the foraging capacity under low nutrient conditions, as is indicated by the observation that haploid fruiting of MATα cells is enhanced by overexpression of the MFα1 pheromone gene, which is induced under starvation conditions (Davidson et al., 2000; Shen et al., 2002). Recently, a phenomenon called same-sex mating, i.e. mating between two non- isogenic MATα cells, has been described (Lin et al., 2005; Yan et al., 2007a). The isolation of serotype A MATα-serotype D MATα environmental isolates (Litvintseva et al., 2005a) suggests that same-sex mating may occur in the environment. Although mating of C. neoformans or C. gattii can be induced under laboratory conditions (Kwon-Chung, 1975; Kwon-Chung, 1976b), it has never been found in the environment. In addition, past studies have found evidence for a clonal population structure (Brandt et al., 1993, Brandt et al., 1996; Chen et al., 1995; Franzot et al., 1997). However, when C. neoformans var. grubii and var. neoformans were studied separately, the null hypothesis of recombination, which indicates sexual reproduction, could no longer be rejected (Taylor et al., 1999). In addition, analysis of the CNLAC1 and URA5 genes for AD hybrid isolates showed that recombination occurred within each

Fig. 1. The sequence of events leading to the fusion of two cells of opposite mating type and ultimately to the formation of basidiospores. MATα cells form a conjugation tube in response to MFa phermone. The MFα pheromone, produced by MATα cells, leads to the enlargement of MATa cells. These enlarged MATa cells can fuse with the conjugation tube of the MATα cell. Subsequently, the MATα nucleus divides and migrates into the conjugation tube. The nucleus of the MATa cell divides as well, and this cell initiates hyphal formation. Nuclei of both mating types migrate into the hyphae. The mitochondria are usually uniparentally inherited from the MATa parent. A basidium is formed on the tip of a hyphae and karyogamy and meisosis occur within the basidium. The four resulting nuclei remain in the basidium and four spore chains are formed by mitosis.

bovers_V4.indd 13 25-10-2007 10:14:06 Chapter 1: Introduction

variety (Xu and Mitchell, 2003). Furthermore, evidence for recombination was found in subpopulations of var. grubii (Litvintseva et al., 2003; Litvintseva et al., 2005a), var. neoformans (Litvintseva et al., 2005a) and in subpopulations of C. gattii AFLP6 (Campbell et al., 2005a). In summary, C. neoformans and C. gattii predominantly reproduce clonally, but in some subpopulations sexual reproduction may occur.

Mating-type locus

The mating-type (MAT) locus is the region of a fungal genome that regulates the sexual cycle and which differs between cells of opposite mating type. Cryptococcus neoformans and C. gattii possesses a single MAT locus, which is unusually large, i.e. more than 100 kb (Lengeler et al., 2002; Fraser et al., 2004; Fraser et al., 2005; Ren et al., 2005). It encodes more than twenty genes, including homeodomain genes which establish cell type identity, genes involved in pheromone production and sensing, components of a MAP kinase cascade, essential genes, and genes which do not seem to have a function in mating (Lengeler et al., 2002; Fraser et al., 2004). Evidence suggests that the ancestor of C. neoformans had two unlinked sex- determining regions, that expanded by acquisition of genes of related function. A chromosomal translocation fused the two regions, which resulted in a tripolar intermediate mating system that collapsed into a bipolar system. In this bipolar system recombination suppressing inversions occurred, which resulted in the currently known MAT loci (Fraser et al., 2004). Interestingly, the majority of environmental and clinical isolates belongs to MATα. (Kwon-Chung and Bennett, 1978; Jong et al., 1982; Hironaga et al., 1983; Schmeding et al., 1984; Madrenys et al., 1993; Takeo et al., 1993; Chen et al., 1995; Halliday et al., 1999; Ordóñez and Castañeda, 2001; Ohkusu et al., 2002; Yan et al., 2002; Casali et al., 2003; Fraser et al., 2003; Litvintseva et al., 2003; Huerfano et al., 2003; Trilles et al., 2003; Campbell et al., 2005a; Campbell et al., 2005b; Litvintseva et al., 2005a; Litvintseva et al., 2005b; Escandón et al., 2006; Saracli et al., 2006; Abegg et al., 2006; Okabayashi et al., 2006; Randhawa et al., 2006; Viviani et al., 2006). However, in some cases C. gattii MATa and MATα isolates have been found in an 1:1 ratio and MATa isolates sometimes even outnumbered the MATα isolates (Halliday et al., 1999; Escandón et al., 2006), which indicates that in some niches MATa isolates are just as common as MATα isolates Unequal inheritance of the MAT-locus could provide an explanation for the excess of MATα isolates. However, in laboratory crossings MATa and MATα isolates were either obtained in an 1: 1 ratio (Kwon-Chung et al.¸1976a; Kwon-Chung, 1980; Kwon- Chung et al., 1982a; Kwon-Chung et al., 1982b; Keller et al., 2003; Wickes et al., 1996; Litvintseva et al, 2003; Tscharke et al., 2003; Nielsen et al., 2003) or an excess of MATa progeny was obtained (Kwon-Chung et al., 1982a; Tscharke et al., 2003). When haploid

bovers_V4.indd 14 25-10-2007 10:14:06 Chapter 1: Introduction

fruiting in MATα isolates was first described (Wickes et al., 1996) this phenomenon was thought to explain the high number of MATα isolates in environmental and clinical 1 isolates. However, Tscharke et al. (2003) showed that MATa isolates are also capable of haploid fruiting. In addition, the poor haploid fruiting capability of C. neoformans var. grubii isolates, which are responsible for the majority of cryptoccal infections (Mitchell and Perfect, 1995; Wickes et al., 1996; Tscharke et al., 2003), indicates that haploid fruiting does not provide an explanation for the high number of clinical MATα isolates. It has also been suggested that MATα isolates might be more virulent than MATa isolates. Several approaches have been used to test this hyphothesis. Congenic pairs that differed in mating type were created for C. neoformans var. grubii (serotype A) and C. neoformans var. neoformans (serotype D). Although virulence was associated with MATα in the serotype D congenic pair (Kwon-Chung et al., 1992), no clear association between virulence and mating type was found when progeny of a serotype D mating was compared (Kwon-Chung and Hill, 1981). Furthermore, a serotype A congenic pair did not differ in virulence (Nielsen et al., 2003). However, during a coinfection with MATa and MATα serotype A cells, MATα cells out-competed MATa cells in entry to the central nervous system (Nielsen et al., 2005a). In addition, Barchiesi et al. (2005) found that the presence of a serotype A-MATα allele is associated with virulence. Finally, virulence studies carried out with serotype D congenic pairs of different genetic background showed that the genetic background plays a significant role in determining the effect of mating type on virulence (Nielsen et al., 2005b). These studies indicate that MATα can be associated with virulence, although the genetic background of the isolate determines whether an effect is present.

AD, BD and AB hybrids

Although C. neoformans and C. gattii isolates are usually haploid, occasionally diploid or aneuploid isolates, such as AD, BD or AB hybrids, are found (Hironaga et al., 1983; Kwon-Chung and Bennett, 1984; Takeo et al., 1993; Brandt et al., 1995; Sukroongreung et al., 1996; Tanaka et al., 1996; Tortorano et al., 1997; Meyer et al., 1999; Cogliati et al., 2001; Nishikawa et al., 2003; Trilles et al., 2003; Tintelnot et al., 2004; Litvintseva et al., 2005a; Litvintseva et al., 2005b; Baroni et al., 2006; Bovers et al., 2006; Saracli et al., 2006; Viviani et al., 2006; Bovers et al., 2007c). Hybrids generally possess both mating- type loci which indicates that they most likely result from mating between isolates of opposite mating types (Cogliati et al., 2001; Lengeler et al., 2001). Hybrids can result either from pre-meiotic sporulation or from fusion of haploid meiotic nuclei followed by the packing of a diploid nucleus in a basidiospore (Sia et al., 2000). Kwon-Chung (1976a) observed atypical basidia that produced two normal spores and one spore

bovers_V4.indd 15 25-10-2007 10:14:07 Chapter 1: Introduction

which was twice the normal size and may have contained a diploid nucleus. These observations are consistent with the formation of hybrid, diploid cells by fusion of haploid meiotic cells. Intervarietal AD as well as interspecies BD hybrids have been generated in the laboratory (Tanaka et al., 1999; Sia et al., 2000; Lengeler et al., 2001; Tanaka et al., 2003; Cogliati et al., 2006; Kwon-Chung and Varma, 2006). Interestingly, when serotype A and serotype D isolates were mated, 24 to 70% of the progeny were diploid or aneuploid (Tanaka et al., 2003; Kwon-Chung and Varma, 2006; Cogliati et al., 2006). In addition, mating of a serotype B with a serotype D isolate resulted in 50% diploid or aneuploid progeny (Kwon-Chung and Varma, 2006). These results show that AD and BD hybrids are generated quite easily. Indeed, studies performed on clinical AD hybrid isolates showed that these had been generated at multiple occassions (Xu et al., 2002), in some areas of Europe, 16 to 30% of the clinical isolates are AD hybrids (Kwon- Chung and Bennett, 1984; Cogliati et al., 2001; Viviani et al., 2006). Spain, Greece and Portugal have the highest percentages of clinical AD hybrid isolates, namely 45, 48 and 50%, respectively (Viviani et al., 2006). These observations indicate that in these areas hybrids are responsible for a significant part of the cryptococcal infections.

Infection and virulence

Generally, a C. neoformans or C. gattii infection starts with the inhalation of infectious particles. The infectious particle has not been identified with certainty, although basidiospores seem to be the most likely candidate. Yeast cells are too large to penetrate into the alveoli, which are usually the starting point of the infection (Hatch, 1961) and desiccated yeast cells display poor viability (Ruiz et al., 1982; Wickes, 2002). Inhaled basidiospores can cause infection in mice and are more effective than yeast cells in causing cryptococcosis (Sukroongreung et al., 1998). These results indicate that basidiospores are the most likely source of infection. Interestingly, humans without a history of cryptococcal disease have antibodies against C. neoformans (Chen et al., 1999). Furthermore, the majority of children have been exposed to C. neoformans before they reach the age of five (Goldman et al., 2001). These results show that humans frequently come into contact with C. neoformans. In immunocompetent individuals C. neoformans infection is either cleared or remains dormant (Garcia-Hermoso et al., 1999), but in immunocompromised individuals C. neoformans may disseminate to other organs. Infection of the central nervous system may result in meningoencephalitis, a condition that is fatal if left untreated. In contrast to C. neoformans, C. gattii infects otherwise healthy individuals (Rozenbaum and Goncalves, 1994; Speed and Dunt, 1995; Mitchell et al., 1995; Chen et al., 2000). The reported incubation period for C. gattii of two to seven months (MacDougall and Fyfe, 2006; Lindberg et al., 2007),

bovers_V4.indd 16 25-10-2007 10:14:08 Chapter 1: Introduction

is consistent with infection of a primary pathogen. Although both species infect the central nervous system, C. gattii appears to invade the brain parenchyma more 1 commonly than C. neoformans. Furthermore, in C. gattii infected patients, pulmonary infections are more likely and pulmonary mass-like lesions are more common than in C. neoformans infected patients (Mitchell and Perfect, 1995; Speed and Dunt, 1995). There are several virulence factors that contribute to the virulence of C. neoformans and C. gattii in mammals. Obviously, the ability to grow at 37 °C is essential. Cryptococcus neoformans and C. gattii are the only Tremellales that can grow optimally at temperatures above 30 °C (Kwon-Chung et al., 1982b; Petter et al., 2001) and temperature sensitive mutants of C. neoformans are attenuated in virulence (Perfect, 2006). Another important virulence factor is the production of a large polysaccharide capsule. Acapsular mutants are avirulent in mouse models (Chang and Kwon-Chung, 1994; Chang et al., 1996; Chang and Kwon-Chung, 1998; Chang and Kwon-Chung, 1999). Capsule size increases during infection (Feldmesser et al., 2001) and can be

induced in vitro by high CO2 concentration (Granger et al., 1985), iron deprivation (Vartivarian et al., 1993), and serum (Zaragoza et al., 2003). Although some properties of the capsule enable the host to clear C. neoformans more effectively, others protect C. neoformans against host defenses. Overall, the effect of the capsule is beneficial: encapsulated cryptococcal cells are not phagocytized or killed by neutrophils, monocytes or macrophages to the same degree as acapsular cells (Buchanan and Murphy, 1998). The production of melanin is another important virulence factor. Melanin synthesis is catalyzed by a laccase and may occur when phenolic compounds, e.g. catecholamines, are present (Williamson, 1994; Williamson et al., 1998). Dopamine, a catecholamine which is present in the brain, is a substrate for melanin synthesis (Polacheck et al., 1982, Williamson, 1994). Melanin is synthesized during infection (Nosanchuk et al., 1999; Rosas et al., 2000) and mutants that do not produce melanin are less virulent (Rhodes et al., 1982; Salas et al., 1996). Melanin protects C. neoformans against oxidative damage by scavenging host-produced anti-oxidants (Wang et al., 1995; Buchanan and Murphy, 1998). In addition, laccase decreases the amount of hydroxyl radicals directly, thereby protecting C. neoformans (Liu et al., 1999). Although all these virulence factors contribute to virulence in humans, the human host is probably an accidental encounter and not the primary niche of C. neoformans. Infection of macrophages and amoebae by C. neoformans is similar, and it was therefore postulated that mammalian virulence factors of C. neoformans evolved as a defense mechanism against environmental predators (Steenbergen et al., 2001; Steenbergen et al., 2003).

bovers_V4.indd 17 25-10-2007 10:14:08 Chapter 1: Introduction

Phenetic, biological and phylogenetic species concepts

The definition of a species is subject to ongoing debate, and several different species concepts exist. Each species concept has its own advantages and disadvantages. The most widely used species concepts are introduced below. The phenetic species concept is based on morphology or physiology and can easily be applied. It describes a species as “the smallest group that is consistently and persistently distinct and can be distinguished morphologically (phenotypically)” (Cronquist, 1978). The phenetic species concept, however, does not necessarily follow evolution. The biological species concept defines a species as “a group of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups” (Mayr, 1940; Taylor et al., 2000). However, the biological species concept is only applicable to sexual reproducing organisms. Some fungi lack a sexual state, and other fungi can produce sexual spores without a mating partner. Furthermore, some fungi can reproduce sexually, but fail to do so under laboratory conditions. The phylogenetic species concept can be applied to both sexual and asexual reproducing organisms. In the phylogenetic species concept a species is “the smallest diagnosable cluster of individual organisms within which there is a pattern of ancestry and descent” (Cracraft, 1983). The drawback of the phylogenetic species concept is that individuals are easily grouped, but it is uncertain if a character accounts for intraspecies or interspecies variation. To avoid subjectivity when applying the phylogenetic species concept the genealogical concordance phylogenetic species concept was proposed, which defines a species as “a basal, exclusive group of organisms all of whose genes coalesce more recently with each other than with those of any organism outside the group, and that contains no exclusive group within it” (Baum and Donoghue, 1995; Taylor et al., 2000). Or in simpler words: a species is a group of organisms of which all genes show the same genealogy.

bovers_V4.indd 18 25-10-2007 10:14:09 Chapter 1: Introduction

Outline of this thesis 1 Cryptococcus neoformans and C. gattii have been described as separate species based on ecological, epidemiological and molecular characteristics. However, several molecular studies have shown that genotypic groups exist within these two species. In this thesis the interactions between the genotypic groups are studied and the taxonomic status of the genotypic groups is investigated. In Chapter 2 six nuclear regions were partially sequenced for one hundred and seventeen haploid C. neoformans and C. gattii isolates to investigate whether the isolates fall into the same genotypic group for all regions studied. Chapter 3 describes the sequence analyses of two mitochondrial regions for fifty-one haploid C. gattii isolates and compares these results to the results obtained by analysis of the nuclear regions. Chapters 2 and 3 provide data for the number of species within the C. neoformans – C. gattii species complex according to the genealogical concordance phylogenetic species concept. In chapter 4 the discovery of the first C. neoformans × C. gattii hybrid is described and chapter 5 describes the identification of another, but different, C. neoformans × C. gattii hybrid and compares the two discovered C. neoformans × C. gattii hybrids. The existence of these hybrids may have implications for the number of species within the C. neoformans-C. gattii species complex according to the biological species concept. In chapter 6 the identification of cryptococcal isolates and clinical specimens using a Luminex suspension array is described. Finally, chapter 7 combines the data obtained in the other chapters to discuss the taxonomic status of the genotypic groups using the phenetic, the biological and the genealogical concordance phylogenetic species concepts.

bovers_V4.indd 19 25-10-2007 10:14:09 Chapter 1: Introduction

References

Abegg MA, Cella FL, Faganello J, Valente P, Schrank A and Vainstein MH (2006) Cryptococcus neoformans and Cryptococcus gattii isolated from the excreta of Psittaciformes in a southern Brazilian zoological garden. Mycopathologia 161: 83-91. Barchiesi F, Cogliati M, Esposto MC, Spreghini E, Schimizzi AM, Wickes BL, Scalise G and Viviani MA (2005) Comparative analysis of pathogenicity of Cryptococcus neoformans serotypes A, D and AD in murine cryptococcosis. J. Infect. 51: 10-16. Baró T, Torres-Rodríguez JM, Hermoso de Mendoza M, Morera Y and Alía C (1998) First identification of autochthonous Cryptococcus neoformans var. gattii isolated from goats with predominantly severe pulmonary disease in Spain. J. Clin. Microbiol. 36: 458-461. Baroni F de A, Paula CR, Silva EG, Viani FC, Rivera IN, Oliveira MT and Gambale W (2006) Cryptococcus neoformans strains isolated from church towers in Rio de Janeiro City, RJ, Brazil. Rev. Inst. Med. trop. S. Paulo 48: 71-75. Baum DA and Donoghue MJ (1995) Choosing among alternative phylogenetic species concepts. Syst. Bot. 20: 560-573. Biswas SK, Wang L, Yokoyama K and Nishimura K (2003) Molecular analysis of Cryptococcus neoformans mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 41: 5572-5576. Boekhout T, van Belkum A, Leenders ACAP, Verbrugh HA, Mukamurangwa P, Swinne D and Scheffers WA (1997) Molecular typing of Cryptococcus neoformans: taxonomic and epidemiological aspects. Int. J. Syst. Bacteriol. 47: 432-442. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WCJ, Abeln ECA, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891- 907. Bovers M, Hagen F, Kuramae EE and Boekhout T (2007a) Six monophyletic lineages identified within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. PhD Thesis: Chapter 2. Bovers M, Hagen F, Kuramae EE and Boekhout T (2007b) The mitochondrial genome of Cryptococcus gattii shows evidence of recombination. PhD Thesis: Chapter 3. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G and Boekhout T (2007c) Promiscuous mating of Cryptococcus neoformans and Cryptococcus gattii: discovery of a novel AB hybrid. PhD Thesis: Chapter 5. Buchanan KL and Murphy JW (1998) What makes Cryptococcus neoformans a pathogen? Emerg. Infect. Dis. 4: 71-83. Buschke A (1895) Über eine durch coccidien hervergerufene krankheit des menschen. Dtsc. Med. Wochenschr. 21: 14. Busse O (1894) Über parasitare Zelleinschlüsse und ihre Züchtung. Zentralbl. Bakteriol. 16: 175-180. Brandt ME, Bragg SL and Pinner RW (1993) Multilocus enzyme typing of Cryptococcus neoformans. J. Clin. Microbiol. 31: 2819-2823. Brandt ME, Hutwagner LC, Klug LA, Baughman WS, Rimland D, Graviss EA, Hamill RJ, Thomas C, Pappas PG, Reingold AL, Pinner RW and the cryptococcal disease active surveillance group (1996) Molecular subtype distribution of Cryptococcus neoformans in four areas of the United States. J. Clin. Microbiol. 34: 912-917. Brandt ME, Hutwagner LC, Kuykendall RJ, Pinner RW and the cryptococcal disease active surveillance group (1995) Comparison of multilocus enzyme electrophoresis and Random Amplified Polymorphic DNA analysis for molecular subtyping of Cryptococcus neoformans. J. Clin. Microbiol. 33: 1890-1895.

bovers_V4.indd 20 25-10-2007 10:14:10 Chapter 1: Introduction

Butler MI and Poulter RTM (2005) The PRP8 inteins in Cryptococcus are a source of phylogenetic and epidemiological information. Fungal Genet. Biol. 42: 452-463. Callejas A, Ordóñez N, Rodriguez MC and Castañeda E (1998) First isolation of Cryptococcus neoformans 1 var. gattii, serotype C, from the environment in Colombia. Med. Mycol. 36: 341-344. Campbell LT, Currie BJ, Krockenberger M, Malik R, Meyer W, Heitman J and Carter D (2005a) Clonality and recombination in genetically differentiated subgroups of Cryptococcus gattii. Eukaryot. Cell 4: 1403-1409. Campbell LT, Fraser JA, Nichols CB, Dietrich FS, Carter D and Heitman J (2005b) Clinical and environmental isolates of C. gattii from Australia that retain sexual fecundity. Eukaryot. Cell 4: 1410-1419. Casadevall A and Perfect JR (1998) Cryptococcus neoformans. ASM press, Washington, USA. Casali AK, Goulart L, Rosa e Silva LK, Ribeiro AM, Amaral AA, Alves SH, Schrank A, Meyer W and Vainstein MH (2003) Molecular typing of clinical and environmental Cryptococcus neoformans isolates in the Brazilian state Rio Grande do Sul. FEMS Yeast Res. 3: 405-415. Chang YC and Kwon-Chung KJ (1994) Complementation of a capsule-deficient mutation of Cryptococcus neoformans restores its virulence. Mol. Cell. Biol. 14: 4912-4919. Chang YC and Kwon-Chung KJ (1998) Isolation of the third capsule-associated gene, CAP60, required for virulence in Cryptococcus neoformans. Infect. Immun. 66: 2230-2236. Chang YC and Kwon-Chung KJ (1999) Isolation, characterization and localization of a capsule- associated gene, CAP10, of Cryptococcus neoformans. J. Bacteriol. 181: 5636-5643. Chang YC, Penoyer LA and Kwon-Chung KJ (1996) The second capsule gene of Cryptococcus neoformans, CAP64, is essential for virulence. Infect. Immun. 64: 1977-1983. Chang YC, Wickes BL, Miller GF, Penoyer LA and Kwon-Chung KJ (2000) Cryptococcus neoformans STE12α regulates virulence but is not essential for mating. J. Exp. Med. 191: 871-881. Chaturvedi V, Fan J, Stein B, Behr MJ, Samsonoff WA, Wickes BL and Chaturvedi S (2002) Molecular genetic analyses of mating pheromones reveal intervariety mating or hybridization in Cryptococcus neoformans. Infect. Immun. 70: 5225-5235. Chen F, Currie BP, Chen LC, Spitzer SG, Spitzer ED and Casadevall A (1995) Genetic Relatedness of Cryptococcus neoformans clinical isolates grouped with the repetitive DNA probe CNRE-1. J. Clin. Microbiol. 33: 2818-2822. Chen LC, Goldman DL, Doering TL, Pirofski LA and Casadevall A (1999) Antibody response to Cryptococcus neoformans proteins in rodents and humans. Infect. Immun. 67: 2218-2224. Chen S, Sorrell T, Nimmo G, Speed B, Currie B, Ellis D, Marriott D, Pfeiffer T, Parr D, Byth K and the Australasian Cryptococcal Study Group (2000) Epidemiology and host- and variety-dependent characteristics of infection due to Cryptococcus neoformans in Australia and New Zealand. Clin. Infect. Dis. 31: 499-508. Cogliati M, Esposto MC, Clarke DL, Wickes BL and Viviani MA (2001) Origin of Cryptococcus neoformans var. neoformans diploid strains. J. Clin. Microbiol. 39: 3889-3894. Cogliati M, Esposto MC, Tortorano AM and Viviani MA (2006) Cryptococcus neoformans population includes hybrid strains homozygous at mating-type locus. FEMS Yeast Res. 6: 608-613. Colom MF, Frasés S, Ferrer C, Jover A, Andreu M, Reus S, Sánchez M and Torres-Rodríguez JM (2005) First case of human Cryptococcosis due to Cryptococcus neoformans var. gattii in Spain. J. Clin. Microbiol. 43: 3548-3550. Cracraft J (1983) Species concepts and speciation analysis. In: Current Ornithology, Vol. 1, p 159-187. Edited by Johnston RF. Plenum Press, New York, USA. Cronquist A (1978) Once again, what is a species? Beltsville Symp. Agricult. Res. 2: 3-20. Curtis F (1896) Contribution à l’étude de la saccharomycose humaine. Ann. Inst. Pasteur 10: 449- 468. Davidson RC, Moore TDE, Odom AR and Heitman J (2000) Characterization of the MFα pheromone of the human fungal pathogen Cryptococcus neoformans. Mol. Microbiol. 38: 1017-1026.

bovers_V4.indd 21 25-10-2007 10:14:10 Chapter 1: Introduction

Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5:1129-1140. Diaz MR, Boekhout T, Theelen B and Fell JW (2000) Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. Dromer F, Mathoulin S, Dupont B, Letenneur L, Ronin O, and the French Cryptococcosis Study group (1996) Individual and environmental factors associated with infection due to Cryptococcus neoformans serotype D. Clin. Infect. Dis. 23: 91-96. Ellis DH and Pfeiffer TJ (1990) Natural habitat of Cryptococcus neoformans var. gattii. J. Clin. Microbiol. 28: 1642-1644. Ellis D, Marriott D, Hajjeh RA, Warnock D, Meyer W and Barton R (2000) Epidemiology: surveillance of fungal infections. Med. Mycol. 38: 173-182. Emmons CW (1951) Isolation of Cryptococcus neoformans from soil. J. Bacteriol. 62: 685-690. Emmons CW (1955) Saprophytic sources of Cryptococcus neoformans associated with the pigeon (Columba livia). Am. J. Hyg. 62: 227-232. Escandón P, Sánchez A, Martínez M, Meyer W and Castañeda E (2006) Molecular epidemiology of clinical and environmental isolates of the Cryptococcus neoformans species complex reveals a high genetic diversity and the presence of the molecular type VGII mating type a in Colombia. FEMS Yeast Res. 6: 625-635. Feldmesser M, Kress Y and Casadevall A (2001) Dynamic changes in the morphology of Cryptococcus neoformans during murine pulmonary infection. Microbiology 147: 2355-2365. Fell JW, Boekhout T, Fonseca A, Scorzetti G and Statzell-Tallman A (2000) Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371. Fell JW, Statzell-Tallman A, Lutz MJ and Kurtzman CP (1992) Partial rRNA sequences in marine yeasts: a model for identification of marine eukaryotes. Mol. Mar. Biol. Biotechnol. 1: 175- 186. Fortes ST, Lazéra MS, Nishikawa MM, Macedo RCL and Wanke B (2001) First isolation of Cryptococcus neoformans var. gattii from a native jungle tree in the Brazilian Amazon rainforest. Mycoses 44: 137-140. Franzot SP, Hamdan JS, Currie BP and Casadevall A (1997) Molecular epidemiology of Cryptococcus neoformans in Brazil and the United States: Evidence for both local genetic differences and a global clonal population structure. J. Clin. Microbiol. 35: 2243-2251. Franzot SP, Salkin IR and Casadevall A (1999) Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840. Fraser JA, Diezmann S, Subaran RL, Allen A, Lengeler KB, Dietrich FS and Heitman J (2004) Convergent evolution of chromosomal sex-determining regions in the animal and fungal kingdoms. PLoS Biol. 2: 2243-2255. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, Diezmann S, Allen A, Stajich JE, Dietrich FS, Perfect JR and Heitman J (2005) Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360-1364. Fraser JA, Subaran RL, Nichols CB and Heitman J (2003) Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: implications for an outbreak on Vancouver Island, Canada. Eukaryot. Cell 2: 1036-1045. Garcia-Hermoso D, Janbon G and Dromer F (1999) Epidemiological evidence for dormant Cryptococcus neoformans infection. J. Clin. Microbiol. 37: 3204-3209. Goldman DL, Khine H, Abadi J, Lindenberg DJ, Pirofski LA, Niang R and Casadevall A (2001) Serological evidence for Cryptococcus neoformans infection in early childhood. Pediatrics 107: E66.

bovers_V4.indd 22 25-10-2007 10:14:11 Chapter 1: Introduction

Granados DP and Castañeda E (2005) Isolation and characterization of Cryptococcus neoformans varieties recovered from natural sources in Bogotá, Colombia and study of ecological conditions in the area. Microb. Ecol. 49: 282-290. 1 Granger DL, Perfect JR and Durack DT (1985) Virulence of Cryptococcus neoformans. Regulation of capsule synthesis by carbon dioxide. J. Clin. Invest. 76: 508-516. Guého E, Improvisi L, Christen R and de Hoog GS (1993) Phylogenetic relationships of Cryptococcus neoformans and some related basidiomycetous yeasts determined from partial large subunit rRNA sequences. Antonie van Leeuwenhoek 63: 175-189. Halliday CL, Bui T, Krockenberger M, Malik R, Ellis DH and Carter DA (1999) Presence of α and a mating types in environmental and clinical collections of Cryptococcus neoformans var. gattii strains from Australia. J. Clin. Microbiol. 37: 2920-2926. Hatch TF (1961) Distribution and deposition of inhaled particles in respiratory tract. Bacteriol. Rev. 25: 237-240. Hironaga M, Ikeda R, Fukazawa Y and Watanabe S (1983) Mating types and serotypes of Cryptococcus neoformans isolated in Japan. Sabouraudia 21: 73-78. Hoang LMN, Maguire JA, Doyle P, Fyfe M and Roscoe DL (2004) Cryptococcus neoformans infections at Vancouver Hospital and Health Sciences Centre (1997-2002): epidemiology, microbiology and histopathology. J. Med. Microbiol. 53: 935-940. Huerfano S, Cepero MC and Castañeda E (2003) Phenotype characterization of environmental Cryptococcus neoformans isolates. Biomedica 23: 328-340. Hull CM and Heitman J (2002) Genetics of Cryptococcus neoformans. Annu. Rev. Genet. 36: 557-615. Jong SC, Bulmer GS and Ruiz A (1982) Serologic grouping and sexual compatibility of airborne Cryptococcus neoformans. Mycopathologia 79: 185-188. Katsu M, Kidd S, Ando A, Moretti-Branchini ML, Mikami Y, Nishimura K and Meyer W (2004) The internal transcribed spacers and 5.8S rRNA gene show extensive diversity among isolates of the Cryptococcus neoformans species complex. FEMS Yeast Res. 4: 377-388. Keller SM, Viviani MA, Esposto MC, Cogliati M and Wickes BL (2003) Molecular and genetic characterization of a serotype A MATa Cryptococcus neoformans isolate. Microbiology 149: 131- 142. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, MacDougall L, Boekhout T, Kwon- Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Colombia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263. Kidd SE, Chow Y, Mak S, Bach PJ, Chen H, Hingston AO, Kronstad JW and Bartlett KH (2007) Characterization of environmental sources of the human and animal pathogen Cryptococcus gattii in British Columbia, Canada, and Pacific Northwest USA. Appl. Environ. Microbiol. 73: 1433-1443. Krockenberger MB, Canfield PJ and Malik R (2002)Cryptococcus neoformans in the koala (Phascolarctos cinereus): colonization by C. neoformans var. gattii and investigation of environmental sources. Med. Mycol. 40: 263-272. Kwon-Chung KJ (1975) A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200. Kwon-Chung KJ (1976a) Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia 68: 821-833. Kwon-Chung KJ (1976b) A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946. Kwon-Chung KJ (1980) Nuclear genotypes of spore chains in Filobasidiella neoformans (Cryptococcus neoformans). Mycologia 72: 418-422. Kwon-Chung KJ and Bennett JE (1978) Distribution of alpha and a mating types of Cryptococcus neoformans among natural and clinical isolates. Am. J. Epidemiol. 108: 337-340.

bovers_V4.indd 23 25-10-2007 10:14:12 Chapter 1: Introduction

Kwon-Chung KJ and Bennett JE (1984) Epidemiological differences between the two varieties of Cryptococcus neoformans. Am. J. Epidemiol. 120: 123-130. Kwon-Chung KJ and Hill WB (1981) Sexuality and pathogenicity of Filobasidiella neoformans (Cryptococcus neoformans). In: Sexuality and pathogenicity of fungi, p 243-250. Edited by Vanbreuseghem R and DeVroey C. Masson, Paris, France. Kwon-Chung KJ and Varma A (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res. 6: 574-587. Kwon-Chung KJ, Bennett JE and Rhodes JC (1982a) Taxonomic studies on Filobasidiella species and their anamorphs. Antonie van Leeuwenhoek 48: 25-38. Kwon-Chung KJ, Bennett JE and Theodore TS (1978) Cryptococcus bacillisporus sp. nov.: Serotype B-C of Cryptococcus neoformans. Int. J. Syst. Bacteriol. 28: 616-620. Kwon-Chung KJ, Boekhout T, Fell JW and Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804-806. Kwon-Chung KJ, Chang YC, Bauer R, Swann EC, Taylor JW and Goel R (1995) The characteristics that differentiate Filobasidiella depauperata from Filobasidiella neoformans. Stud. Mycol. 38: 67-79. Kwon-Chung KJ, Edman JC and Wickes BL (1992) Genetic association of mating types and virulence in Cryptococcus neoformans. Infect. Immun. 60: 602-605. Kwon-Chung KJ, Polacheck I and Popkin RJ (1982b) Melanin-lacking mutants of Cryptococcus neoformans and their virulence for mice. J. Bacteriol. 150: 1414-1421. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Lazéra MS, Cavalcanti MA, Trilles L, Nishikawa MM and Wanke B (1998) Cryptococcus neoformans var. gattii - evidence for a natural habitat related to decaying wood in a pottery tree hollow. Med. Mycol. 36: 119-122. Lazéra MS, Pires FDA, Camillo-Coura L, Nishikawa MM, Bezerra CCF, Trilles L and Wanke B (1996) Natural habitat of Cryptococcus neoformans var. neoformans in decaying wood forming hollows in living trees. J. Med. Vet. Mycol. 34: 127-131. Lazéra MS, Salmito Cavalcanti MA, Londero AT, Trilles L, Nishikawa MM and Wanke B (2000) Possible primary ecological niche of Cryptococcus neoformans. Med. Mycol. 38: 379-383. Lengeler KB, Cox GM and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122. Lengeler KB, Fox DS, Fraser JA, Allen A, Forrester K, Dietrich FS and Heitman J (2002) Mating-type locus of Cryptococcus neoformans: a step in the evolution of sex chromosomes. Eukaryot. Cell 1: 704-718. Lin X, Hull CM and Heitman J (2005) Sexual reproduction between partners of the same mating type in Cryptococcus neoformans. Nature 434: 1017-1021. Lindberg J, Hagen F, Laursen A, Stenderup J and Boekhout T (2007) Cryptococcus gattii risk for tourists visiting Vancouver Island, Canada. Emerg. Infect. Dis. 13: 178-179. Litvintseva AP, Marra RE, Nielsen K, Heitman J, Vilgalys R and Mitchell TG (2003) Evidence of sexual recombination among Cryptococcus neoformans serotype A isolates in sub-Saharan Africa. Eukaryot. Cell 2: 1162-1168. Litvintseva AP, Kestenbaum L, Vilgalys R and Mitchell TG (2005a) Comparative analysis of environmental and clinical populations of Cryptococcus neoformans. J. Clin. Microbiol. 43: 556- 564. Litvintseva AP, Thakur R, Reller LB and Mitchell TG (2005b) Prevalence of clinical isolates of Cryptococcus gattii serotype C among patients with AIDS in sub-saharan Africa. J. Infect. Dis. 192: 888-892. Liu L, Tewari RP and Williamson PR (1999) Laccase protects Cryptococcus neoformans from antifungal activity of alveolar macrophages. Infect. Immun. 67: 6034-6039.

bovers_V4.indd 24 25-10-2007 10:14:13 Chapter 1: Introduction

Lodder J and Kreger-van Rij NJW (1952) Discussion of the genera belonging to the Cryptococcaceae. In: The Yeasts. A taxonomic study, p 371-380. North-Holland Publishing Company, Amsterdam, the Netherlands. 1 MacDougall L and Fyfe M (2006) Emergence of Cryptococcus gattii in novel environment provides clues to its incubation period. J. Clin. Microbiol. 44: 1851-1852. MacDougall L, Kidd SE, Galanis E, Mak S, Leslie MJ, Cieslak PR, Kronstad JW, Morshed MG and Bartlett KH (2007) Spread of Cryptococcus gattii in British Columbia, Canada, and detection in the Pacific Northwest, USA. Emerg. Infect. Dis.13: 42-50. Madrenys N, De Vroey C, Raes-Wuytack C and Torres-Rodríguez JM (1993) Identification of the perfect state of Cryptococcus neoformans from 195 clinical isolates including 84 from AIDS patients. Mycopathologia 123: 65-68. Mayr E (1940) Speciation phenomena in birds. Am. Nat. 74: 249-278. McClelland CM, Chang YC, Varma A and Kwon-Chung KJ (2004) Uniqueness of the mating system in Cryptococcus neoformans. Trends Microbiol. 12: 208-212. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal study group (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195. Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, Viviani MA, Chindamporn A, Sukroongreung S, John MA, Ellis DH and Sorrell TC (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA - a pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 20: 1790-1799. Meyer W, Mitchell TG, Freedman EZ and Vilgalys R (1993) Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans. J. Clin. Microbiol. 31: 2274-2280. Mitchell TG and Perfect JR (1995) Cryptococcosis in the era of AIDS - 100 years after the discovery of Cryptococcus neoformans. Clin. Microbiol. Rev. 8: 515-548. Mitchell DH, Sorrell TC, Allworth AM, Heath CH, McFregor AR, Papanaoum K, Richards MJ and Gottlieb T (1995) Cryptococcal disease of the CNS in immunocompetent hosts: influence of cryptococcal variety on clinical manifestations and outcome. Clin. Infect. Dis. 20: 611-616. Mitchell TG, White TJ and Taylor JW (1992) Comparison of 5.8S ribosomal DNA sequences among the basidiomycetous yeast genera Cystofilobasidium, Filobasidium and Filobasidiella. J. Med. Vet. Mycol. 30: 207-218. Montagna MT, Viviani MA, Pulito A, Aralla C, Tortorano AM, Fiore L and Barbuti S (1997) Cryptococcus neoformans var. gattii in Italy. Note II. Environmental investigation related to an autochtonous clinical case in Apulia. J. Mycol. Méd. 7: 93-96. Nielsen K, Cox GM, Litvintseva AP, Mylonakis E, Malliaris SD, Benjamin DK, Giles SS, Mitchell, TG, Casadevall A, Perfect JR and Heitman J (2005a) Cryptococcus neoformans α strains preferentially disseminate to the central nervous system during coinfection. Infect. Immun. 73: 4922-4933. Nielsen K, Cox GM, Wang P, Toffaletti DL, Perfect JR and Heitman J (2003) Sexual cycle of Cryptococcus neoformans var. grubii and virulence of congenic a and α isolates. Infect. Immun. 71: 4831- 4841. Nielsen K, Marra RE, Hagen F, Boekhout T, Mitchell TG, Cox GM and Heitman J (2005b) Interaction between genetic background and the mating-type locus in Cryptococcus neoformans virulence potential. Genetics 171: 975-983. Nishikawa MM, Lazéra MS, Barbosa GG, Trilles L, Balassiano BR, Macedo RCL, Bezerra CCF, Pérez MA, Cardarelli P and Wanke B (2003) Serotyping of 467 Cryptococcus neoformans isolates from clinical and environmental sources in Brazil: analysis of host and regional patterns. J. Clin. Microbiol. 41: 73-77.

bovers_V4.indd 25 25-10-2007 10:14:14 Chapter 1: Introduction

Nosanchuk JD, Valadon P, Feldmesser M and Casadevall A (1999) Melanization of Cryptococcus neoformans in murine infection. Mol. Cell. Biol. 19: 745-750. Ohkusu M, Tangonan N, Takeo K, Kishida E, Ohkubo M, Aoki S, Nakamura K, Fujii T, Siqueira IC, Maciel EA, Sakabe S, Almeida GM, Heins-Vaccari EM and da S. Lacaz C (2002) Serotype, mating type and ploidy of Cryptococcus neoformans strains isolated from patients in Brazil. Rev. Inst. Med. trop. S. Paulo 44: 299-302. Okabayashi K, Kano R, Watanabe T and Hasegawa A (2006) Serotypes and mating types of clinical isolates from feline cryptococcosis in Japan. J. Vet. Med. Sci. 68: 91-94. Ordóñez N and Castañeda E (2001) Varieties and serotypes of Cryptococcus neoformans clinical isolates in Colombia. Rev. Iberoam. Micol. 18: 128-130. Perfect JR (2006) Cryptococcus neoformans: the yeast that likes it hot. FEMS Yeast Res. 6: 463-468. Petter R, Kang BS, Boekhout T, Davis BJ and Kwon-Chung KJ (2001) A survey of heterobasidiomycetous yeasts for the presence of the genes homologous to virulence factors of Filobasidiella neoformans, CNLAC1 and CAP59. Microbiology 147: 2029-2036. Polacheck I, Hearing VJ and Kwon-Chung KJ (1982) Biochemical studies of phenoloxidase and utilization of catecholamines in Cryptococcus neoformans. J. Bacteriol. 150: 1212-1220. Randhawa HS, Kowshik T and Khan ZU (2003) Decayed wood of Syzygium cumini and Ficus religiosa living trees in Delhi/New Delhi metropolitan area as natural habitat of Cryptococcus neoformans. Med. Mycol. 41: 199-209. Randhawa HS, Kowshik T, Preeti Sinha K, Chowdhary A, Khan ZU, Yan Z, Xu J and Kumar A (2006) Distribution of Cryptococcus gattii and Cryptococcus neoformans in decayed trunk wood of Syzygium cumini trees in north-western India. Med. Mycol. 44: 623-630. Ren P, Roncaglia P, Springer DJ, Fan J and Chaturvedi V (2005) Genomic organization and expression of 23 new genes from MATα locus of Cryptococcus neoformans var. gattii. Biochem. Biophys. Res. Commun. 326: 233-241. Rhodes JC, Polacheck I and Kwon-Chung KJ (1982) Phenoloxidase activity and virulence in isogenic strains of Cryptococcus neoformans. Infect. Immun. 36: 1175-1184. Rosas AL, Nosanchuk JD, Feldmesser M, Cox GM, McDade HC and Casadevall A (2000) Synthesis of polymerized melanin by Cryptococcus neoformans in infected rodents. Infect. Immun. 68: 2845- 2853. Rozenbaum R and Goncalves AJ (1994) Clinical epidemiological study of 171 cases of cryptococcosis. Clin. Infect. Dis. 18: 369-380. Ruiz A, Neilson JB and Bulmer GS (1982) A one year study on the viability of Cryptococcus neoformans in nature. Mycopathologia 77: 117-122. Ruma P, Chen SC, Sorrell TC and Brownlee AG (1996) Characterization of Cryptococcus neoformans by random DNA amplification. Lett. Appl. Microbiol.23: 312-316. Salas SD, Bennett JE, Kwon-Chung KJ, Perfect JR and Williamson PR (1996) Effect of the laccase gene, CNLAC1, on virulence of Cryptococcus neoformans. J. Exp. Med. 184: 377-386. Sanfelice F (1894) Contributo alla morfologia e biologia dei blastomiceti che si sviluppano nei succi di alcuni frutti. Ann. Ig. 4: 463-495. Saracli MA, Yildiran ST, Sener K, Gonlum A, Doganci L, Keller SM and Wickes BL (2006) Genotyping of Turkish environmental Cryptococcus neoformans var. neoformans isolates by pulsed field gel electrophoresis and mating type. Mycoses 49: 124-129. Schmeding KA, Jong SC and Hugh R (1981) Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138. Schmeding KA, Jong SC and Hugh R (1984) Biochemical variation of Cryptococcus neoformans. Mycopathologia 84: 121-131. Scorzetti G, Fell JW, Fonseca A and Statzell-Tallman A (2002) Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495-517.

bovers_V4.indd 26 25-10-2007 10:14:16 Chapter 1: Introduction

Shen WC, Davidson RC, Cox GM, and Heitman J (2002) Pheromones stimulate mating and differentiation via paracrine and autocrine signaling in Cryptococcus neoformans. Eukaryot. Cell 1: 366-377. 1 Sia RA, Lengeler KB and Heitman J (2000) Diploid strains of the pathogenic basidiomycete Cryptococcus neoformans are thermally dimorphic. Fungal Genet. Biol. 29: 153-163. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Steenbergen JN, Nosanchuk JD, Malliaris SD and Casadevall A (2003) Cryptococcus neoformans virulence is enhanced after growth in the genetically malleable host Dictyostelium discoideum. Infect. Immun. 71: 4862-4872. Steenbergen JN, Shuman HA and Casadevall A (2001) Cryptococcus neoformans interactions with amoebae suggest an explanation for its virulence and intracellular pathogenic strategy in macrophages. Proc. Natl. Acad. Sci. USA 98: 15245-15250. Stephen C, Lester S, Black W, Fyfe M and Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can. Vet. J. 43: 792-794. Sugita T, Ikeda R and Shinoda T (2001) Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol. Immunol. 45: 757-768. Sukroongreung S, Kitiniyom K, Nilakul C and Tantimavanich S (1998) Pathogenicity of basidiospores of Filobasidiella neoformans var. neoformans. Med. Mycol. 36: 419-424. Sukroongreung S, Nilakul C, Ruangsomboon O, Chuakul W and Eampokalap B (1996) Serotypes of Cryptococcus neoformans during the AIDS era in Thailand. Mycopathologia 135: 75-78. Tanaka R, Taguchi H, Takeo K, Miyaji M and Nishimura K (1996) Determination of ploidy in Cryptococcus neoformans by flow cytometry. J. Med. Vet. Mycol.34: 299-301. Tanaka R, Nishimura K, Imanishi Y, Takahashi I, Hata Y and Miyaji M (2003) Analysis of serotype AD strains from F1 progenies between urease-positive- and negative-strains. Jpn. J. Med. Mycol. 44: 293-297. Tanaka R, Nishimura K and Miyaji M (1999) Ploidy of serotype AD strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 40: 31-34. Takeo K, Tanaka R, Taguchi H and Nishimura K (1993) Analysis of ploidy and sexual characteristics of natural isolates of Cryptococcus neoformans. Can. J. Microbiol. 39: 958-963. Taylor JW, Geiser DM, Burt A and Koufopanou V (1999) The evolutionary biology and population genetics underlying fungal strain typing. Clin. Microbiol. Rev. 12: 126-146. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS and Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol. 31: 21-32. Tintelnot K, Lemmer K, Losert H, Schär G and Polak A (2004) Follow-up of epidemiological data of cryptococcosis in Austria, Germany and Switzerland with special focus on the characterization of clinical isolates. Mycoses 47: 455-464. Toffaletti DL, Nielsen K, Dietrich F, Heitman J and Perfect JR (2004) Cryptococcus neoformans mitochondrial genomes from serotype A and D strains do not influence virulence. Curr. Genet. 46: 193-204. Tortorano AM, Viviani MA, Rigoni AL, Cogliati M, Roverselli A and Pagano A (1997) Prevalence of serotype D in Cryptococcus neoformans isolates from HIV positive and HIV negative patients in Italy. Mycoses 40: 297-302. Trilles L, Lazéra M, Wanke B, Theelen B and Boekhout T (2003) Genetic characterization of environmental isolates of the Cryptococcus neoformans species complex from Brazil. Med. Mycol. 41: 383-390. Tscharke RL, Lazéra M, Chang YC, Wickes BL and Kwon-Chung KJ (2003) Haploid fruiting in Cryptococcus neoformans is not mating type α-specific. Fungal Genet. Biol. 39: 230-237.

bovers_V4.indd 27 25-10-2007 10:14:17 Chapter 1: Introduction

Vanbreuseghem R and Takashio M (1970) An atypical strain of Cryptococcus neoformans (Sanfelice) Vuillemin. Part II. Cryptococcus neoformans var. gattii. Ann. Soc. Belg. Med. Trop. 50: 695-702. Vartivarian SE, Anaissie EJ, Cowart RE, Sprigg HA, Tingler MJ and Jacobson ES (1993) Regulation of cryptococcal capsular polysaccharide by iron. J. Infect. Dis. 161: 186-190. Velegraki A, Kiosses VG, Pitsouni H, Toukas D, Daniilidis VD and Legakis NJ (2001) First report of Cryptococcus neoformans var. gattii serotype B from Greece. Med. Mycol. 39: 419-422. Viviani MA, Cogliati M, Esposto MC, Lemmer K, Tintelnot K, Colom Valiente MF, Swinne D, Velegraki A, Velho R and the European Confederation of Medical Mycology (ECMM) Cryptococcosis working group (2006) Molecular analysis of 311 Cryptococcus neoformans isolates from a 30- month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res. 6: 614-619. Vuillemin P (1901) Les blastomycètes pathogènes. Rev. Gen. Sci. Pures Appl. 12: 732-751. Wang Y, Aisen P and Casadevall A (1995) Cryptococcus neoformans melanin and virulence: mechanism of action. Infect. Immun. 63: 3131-3136. Wang P, Perfect JR and Heitman J (2000) The G-protein β subunit GPB1 is required for mating and haploid fruiting in Cryptococcus neoformans. Mol. Cell. Biol. 20: 352-362. Wickes BL (2002) The role of mating type and morphology in Cryptococcus neoformans pathogenesis. Int. J. Med. Microbiol. 292: 1-17. Wickes BL, Mayorga ME, Edman U and Edman JC (1996) Dimorphism and haploid fruiting in Cryptococcus neoformans: association with the α-mating type. Proc. Natl. Acad. Sci. USA 93: 7327- 7331. Wickes BL, Moore TDE and Kwon-Chung KJ (1994) Comparison of the electrophoretic karyotypes and chromosomal location of ten genes in the two varieties of Cryptococcus neoformans. Microbiology 140: 543-550. Williamson PR (1994) Biochemical and molecular characterization of the diphenol oxidase of Cryptococcus neoformans: identification as a laccase. J. Bacteriol.176: 656-664. Williamson PR, Wakamatsu K and Ito S (1998) Melanin biosynthesis in Cryptococcus neoformans. J. Bacteriol. 180: 1570-1572. Xu J and Mitchell TG (2003) Comparative gene genealogical analyses of strains of serotype AD identify recombination in populations of serotypes A and D in the human pathogenic yeast Cryptococcus neoformans. Microbiology 149: 2147-2154. Xu J, Ali RY, Gregory DA, Amick D, Lambert SE, Yoell HJ, Vilgalys RJ and Mitchell TG (2000a) Uniparental mitochondrial transmission in sexual crosses in Cryptococcus neoformans. Curr. Microbiol. 40: 269-273. Xu J, Luo G, Vilgalys RJ, Brandt ME and Mitchell TG (2002) Multiple origins of hybrid strains of Cryptococcus neoformans with serotype AD. Microbiology 148: 203-212. Xu J, Vilgalys R and Mitchell TG (2000b) Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 9: 1471-1481. Yan Z and Xu J (2003) Mitochondria are inherited from the MATa parent in crosses of the basidiomycete fungus Cryptococcus neoformans. Genetics 163: 1315-1325. Yan Z, Hull CM, Heitman J, Sun S and Xu J (2004) SXI1α controls uniparental mitochondrial inheritance in Cryptococcus neoformans. Curr. Biol. 14: 743-744. Yan Z, Hull CM, Sun S, Heitman J and Xu J (2007a) The mating type-specific homeodomain genes SXI1α and SXI2a coordinately control uniparental mitochondrial inheritance in Cryptococcus neoformans. Curr. Genet. 51: 187-195. Yan Z, Li X and Xu J (2002) Geographic distribution of mating type alleles of Cryptococcus neoformans in four areas of the United States. J. Clin. Microbiol. 40: 965-972. Yan Z, Sun S, Shahid M and Xu J (2007b) Environment factors can influence mitochondrial inheritance in the fungus Cryptococcus neoformans. Fungal Genet. Biol. 44: 315-322. Zaragoza O, Fries BC and Casadevall A (2003) Induction of capsule growth in Cryptococcus neoformans

by mammalian serum and CO2. Infect. Immun. 71: 6155-6164.

bovers_V4.indd 28 25-10-2007 10:14:19 Chapter 2

Six monophyletic lineages identified

within Cryptococcus neoformans

and Cryptococcus gattii by

multi-locus sequence typing

M Bovers1, F Hagen1, EE Kuramae1,2 and T Boekhout1,3

1CBS - Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Netherlands Institute of Ecology (NIOO-KNAW), Centre for Terrestrial Ecology, Heteren, The Netherlands; 3Department of Internal Medicine and Infectious Diseases, University Medical Centre Utrecht, Utrecht, The Netherlands.

bovers_V4.indd 29 25-10-2007 10:14:21 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Summary

Cryptococcus neoformans and Cryptococcus gattii are closely related pathogenic basidiomycetous yeasts in which six haploid genotypes have been distinguished. The two haploid genotypes of C. neoformans have been described as var. grubii and var. neoformans. The four C. gattii genotypes have, however, not been described as separate taxa. One hundred and seventeen isolates representing all six haploid genotypes were selected for multi-locus sequence typing using six loci to investigate if the isolates consistently formed monophyletic lineages. Two monophyletic lineages, corresponding to varieties grubii and neoformans, were consistently present within C. neoformans, supporting the current classification. In addition, four monophyletic lineages corresponding to the previously described genotypes were consistently found within C. gattii, indicating that these lineages should be considered different taxa as well.

bovers_V4.indd 30 25-10-2007 10:14:21 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Introduction

Cryptococcus neoformans and Cryptococcus gattii are pathogenic basidiomycetous yeasts that belong to the Filobasidiella clade of the Tremellales (Scorzetti et al., 2002). Populations of C. neoformans and C. gattii are predominantly clonal (Brandt et al., 1993, Brandt et al., 1996; Chen et al., 1995; Franzot et al., 1997), but evidence 2 of recombination has been found within subpopulations (Litvintseva et al., 2003; Campbell et al., 2005; Litvintseva et al., 2005). Currently, two varieties are recognized within C. neoformans, namely var. grubii and var. neoformans (Franzot et al. 1999). Cryptococcus gattii had been described as a third variety of C. neoformans (Kwon-Chung et al., 1982), but differences in ecology, biochemical and molecular characteristics, as well as the absence of genetic recombination in progeny of crosses between C. neoformans var. neoformans and C. neoformans var. gattii have resulted in the description of C. gattii as a separate species (Kwon-Chung et al., 2002). One of the most striking differences between C. neoformans and C. gattii concerns the host range. Although both species may cause meningoencephalitis, C. neoformans mainly causes disease in immunocompromised patients, whereas C. gattii may infect otherwise healthy people (Rozenbaum and Goncalves, 1994; Mitchell et al., 1995; Speed and Dunt, 1995; Chen et al., 2000). A widely used method to differentiate groups within the C. neoformans – C. gattii species complex is serotyping (Evans, 1950; Wilson et al., 1968). Serotype A corresponds to C. neoformans var. grubii, whereas serotype D corresponds to C. neoformans var. neoformans (Franzot et al., 1999). Cryptococcus gattii contains isolates of serotypes B and C (Kwon-Chung et al., 2002). Inaddition several molecular genotyping methods also been used to distinguish groups within the C. neoformans – C. gattii species complex. Six haploid genotypic groups have consistently been found with several molecular fingerprinting methods, such as PCR fingerprinting, RFLP, RAPD and AFLP analysis (Ruma et al., 1996; Ellis et al., 2000; Boekhout et al., 2001; Latouche et al., 2003; Meyer et al., 2003; Kidd et al., 2004), as well as sequence analysis of coding and non-coding regions (Chaturvedi et al., 2002; Biswas et al., 2003; Butler and Poulter, 2005; Diaz et al., 2005). Two of these haploid genotypic groups correspond to the two varieties of C. neoformans. The four genotypic groups that can be distinguished within C. gattii have, however, not been described as separate taxa. The different haploid genotypic groups and the relationship between variety, serotype and the different genotyping methods are shown in Table 1. Unfortunately, most sequence analyses of the C. neoformans – C. gattii species complex used only one region and it is difficult to compare genealogies of different genomic regions, which could provide insight into the mode of reproduction, because the sets of isolates differ between studies. One hundred and seventeen isolates

bovers_V4.indd 31 25-10-2007 10:14:22 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

representing all known haploid molecular genotypes and including both clinical and environmental isolates were used for multi-locus sequence typing (MLST). Hybrid isolates exist (Tanaka et al., 1999; Cogliati et al., 2000; Boekhout et al., 2001; Lengeler et al., 2001; Bovers et al., 2006; Bovers et al., 2007), but these were not included in our study as the results obtained by analyzing hybrid isolates are expected to be similar to those obtained by analysis of haploid isolates. Six loci including two ribosomal DNA regions, namely Internal Transcribed Spacers 1 and 2 including 5.8S rDNA (ITS) and Intergenic Spacer 1 (IGS1), as well as the laccase gene (CNLAC1), the largest and second largest subunit of RNA polymerase II (RPB1 and RPB2) and Translation Elongation Factor 1α (TEF1α) were selected for our MLST study. MLST analysis of all haploid molecular genotypes present within the C. neoformans – C. gattii species complex resulted in the identification of six monophyletic lineages.

Table 1. Overview of varieties, serotypes and haploid genotypes within the Cryptococcus neoformans and Cryptococcus gattii species complex.

AFLP Molecular IGS ITS Species Serotype 1 genotype 2, 3, 4 genotype 1, 5 genotype 6 genotype 7 C. neoformans C. neoformans var. grubii A 1 VNI 1a/1b 1 A 1A VNB 1a 1 A 1B VNII 1c 1 C. neoformans var. neoformans D 2 VNIV 2a/2b/2c 2 C. gattii C. gattii B/(C)* 4A VGI 4c 7 B/(C)* 4B VGI 4a/4b 3/7 C. gattii B/C 5A/5C VGIII 5 5 B 5B VGIII 5 5 C. gattii B/(C)* 6 VGII 3 4 C. gattii B/C 7 VGIV 6 6

1 Meyer et al. (2003); 2 Barreto de Oliveira et al. (2004); 3 Boekhout et al. (2001); 4 Kidd et al. (2004), 5 Litvintseva et al. (2006); 6 Diaz et al. (2005); 7 Katsu et al. (2004); * Isolates of the serotypes indicated between brackets were not included in our study.

Materials and Methods

Isolates

One hundred and seventeen haploid isolates of clinical (60%), veterinary (7%), environmental (24%), laboratory (8%) and unknown (1%) origin were used for sequence analyses. Isolates of each of the six haploid genotypic groups currently recognized within the C. neoformans – C. gattii species complex were included. The origin, serotype and genotype of the strains are presented in Table 2.

bovers_V4.indd 32 25-10-2007 10:14:23 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Cryptococcus amylolentus (CBS6039), Filobasidiella depauperata (CBS7841) and Tsuchiyaea wingfieldii (CBS7118), species which are closely related to C. neoformans and C. gattii (Fell et al., 1992; Mitchell et al., 1992, Guého et al., 1993; Kwon-Chung et al., 1995; Fell et al., 2000; Scorzetti et al., 2002), were included as outgroup species. Cryptococcus podzolicus (CBS6819 and CBS7717) was added to the set of outgroup species, because this is the only other heterobasidiomycetous yeast that expresses 2 laccase activity (Petter et al., 2001). The origin of the outgroup strains is described in Table 3.

Selected loci and their chromosomal location

Six regions were included in our MLST analysis. Chromosomal locations were determined based on the C. neoformans serotype D complete genome of isolate JEC21 (Loftus et al., 2005). Two ribosomal DNA regions, located on chromosome 2, were included, namely Internal Transcribed Spacers 1 and 2 including 5.8S rDNA (ITS) and Intergenic Spacer 1 (IGS1). Furthermore, the laccase gene (CNLAC1) located on chromosome 7; the largest subunit of RNA polymerase II (RPB1), located on chromosome 5; the second largest subunit of RNA polymerase II (RPB2), located on chromosome 4; and Translation Elongation Factor 1α (TEF1α), located on chromosome 13, were included in our study.

Cultivation, DNA extraction, PCR and sequencing

Cultivation and DNA extraction of C. neoformans and C. gattii isolates was carried out using an optimized protocol of Bolano et al. (2001), which has previously been described (Bovers et al., 2006). Cryptococcus amylolentus, C. podzolicus, F. depauperata and T. wingfieldii isolates were grown on solid YPGA medium (1% yeast extract, 1% pepton, 2% d-glucose, 2% technical agar no. 3; Oxoid) for seven days at room temperature. Cells were harvested and DNA was extracted by adding 750 μl phenol: chloroform:isoamylalcohol (25:24:1, pH 8.0), 750 μl lysis buffer (0.5% w/v SDS, 0.5% w/v Sarkosyl in TE, pH 7.5) and sterile sand to the cells. The cells were bead-beated for 3 min at 2,500 beats min-1 and subsequently centrifuged for 15 min at 17,000 × g and 4 ºC. The DNA fraction was ethanol-precipitated and dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8). All PCR reactions were carried out in a total volume of 50 μl containing 0.2 mM dNTPs, 0.6 μM of both primers, 1.0 U Taq polymerase (Gentaur) and 1-2 μl genomic DNA. Primer sequences, buffer composition and amplification conditions are listed in Table 4. Amplicons were purified with the GFXTM PCR DNA and Gel Band Purification Kit (Amersham Biosciences) and used for sequencing.

bovers_V4.indd 33 25-10-2007 10:14:24 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii α TEF1 EF211692 EF211693 EF211694 EF211695 EF211696 EF211697 EF211698 EF211699 EF211700 EF211701 EF211702 EF211703 EF211704 EF211705 EF211706 EF211707 EF211708 EF211709 EF211710 EF211711 CNLAC1 EF211577 EF211578 EF211579 EF211580 EF211581 EF211582 EF211583 EF211584 EF211585 EF211586 EF211587 EF211588 EF211589 EF211590 EF211591 EF211592 EF211593 EF211594 EF211595 EF211596 RPB2 EF211457 EF211458 EF211459 EF211460 EF211461 EF211462 EF211463 EF211464 EF211465 EF211466 EF211467 EF211468 EF211469 EF211470 EF211471 EF211472 EF211473 EF211474 EF211475 EF211476 RPB1 EF211337 EF211338 EF211339 EF211340 EF211341 EF211342 EF211343 EF211344 EF211345 EF211346 EF211347 EF211348 EF211349 EF211350 EF211351 EF211352 EF211353 EF211354 EF211355 EF211356 * * IGS EF211249 EF211250 EF211251 EF211252 EF211253 EF211254 EF211255 EF211256 EF211257 EF211258 EF211259 EF211260 EF211261 EF211262 EF211263 EF211264 EF211265 EF211266 AJ300842 AJ300864 isolates. GenBank accession numbers of all ITS EF211129 EF211130 EF211131 EF211132 EF211133 EF211134 EF211135 EF211136 EF211137 EF211138 EF211139 EF211140 EF211141 EF211142 EF211143 EF211144 EF211145 EF211146 EF211147 EF211148 CBS Cryptococcus gattii L. Spanjaard L. Spanjaard L. Spanjaard L. Spanjaard L. Katsu et al. (2004) al. et Katsu Katsu et al. (2004) al. et Katsu Reference / Source / Reference Franzot et al. (1999) al. et Franzot Lengeler et al. (2002) al. et Lengeler Lengeler et al. (2001) al. et Lengeler Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Litvintseva et al. (2003) al. et Litvintseva (2003) al. et Litvintseva (2003) al. et Litvintseva (2003) al. et Litvintseva (2003) al. et Litvintseva and Candida Candida , New York, York, New , Cryptococcus Cryptococcus (H99) grubii grubii var. var. , Argentina , Soil Italy USA var. var. Origin strain H99 strain Cryptococcus neoformans Non AIDS patient AIDS Non AIDS patient, Botswana patient, AIDS Botswana patient, AIDS Botswana patient, AIDS Botswana patient, AIDS Botswana patient, AIDS psicrophylicus Human, Pennsylvania, USA Pennsylvania, Human, neoformans HIV positive male, the Netherlands the male, positive HIV Netherlands the male, positive HIV Netherlands the male, positive HIV Decaying wood of Cassia tree, Brazil tree, Cassia of wood Decaying HIV negative female, the Netherlands the female, negative HIV Soil sample in garden of a patient with with patient a of garden in sample Soil Pigeon dropping, Belo Horizonte, Brazil Horizonte, Belo dropping, Pigeon Subculture of type strain of of strain type of Subculture Cryptococcal meningitis patient, Tanzania patient, meningitis Cryptococcal Patient with Hodgkin’s disease, type strain of of strain type disease, Hodgkin’s with Patient Cryptococcus neoformans Cryptococcus neighboring birds colonies, rural aviary, Apulia, Apulia, aviary, rural colonies, birds neighboring 5- fluoroorotic acid (5-FOA)-resistant mutant of mutant (5-FOA)-resistant acid fluoroorotic 5- Blastomycosis from man, type strain of of strain type man, from Blastomycosis 4,5 nd nd nd nd nd nd nd nd nd nd nd nd nd VNI VNI VNI VNI VNB VNB VNB VNB Molecular Molecular genotype genotype 1,2,3 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1B 1A 1A 1A 1A 1A AFLP AFLP genotype genotype A A A A A A A A A A A A A A A A A A A A Serotype (T) grubii var. var. AFLP genotype, molecular type, serotype and origin of (=CBS10515 =H99) (=CBS10515

(T) neoformans

Table 2. Table sequenced regions are indicated. Isolate (=CBS10512) 125.91 821330 930104-I 930104-II 940441 ATCC90112 Bt1 Bt27 Bt63 Bt130 Bt206 CBS996 C. CBS1931 CBS7812 CBS8336 CBS8710 CBS9172 H99 (=CBS8710 =CBS10515) (=CBS8710 H99 5FOAr H99 C3’1 Hamden

bovers_V4.indd 34 25-10-2007 10:14:27 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii EF211712 EF211713 EF211714 EF211715 EF211716 EF211717 EF211718 EF211719 EF211720 EF211721 EF211722 EF211723 EF211724 EF211725 EF211726 EF211727 EF211728 EF211729 EF211730 EF211731 EF211597 EF211598 EF211599 EF211600 EF211601 EF211602 EF211603 EF211604 EF211605 EF211606 EF211607 EF211608 EF211609 EF211610 EF211611 EF211612 EF211613 EF211614 EF211615 EF211616 EF211477 EF211478 EF211479 EF211480 EF211481 EF211482 EF211483 EF211484 EF211485 EF211486 EF211487 EF211488 EF211489 EF211490 EF211491 EF211492 EF211493 EF211494 EF211495 EF211496 2 EF211357 EF211358 EF211359 EF211360 EF211361 EF211362 EF211363 EF211364 EF211365 EF211366 EF211367 EF211368 EF211369 EF211370 EF211371 EF211372 EF211373 EF211374 EF211375 EF211376 * * * EF211267 EF211268 EF211269 EF211270 EF211271 EF211272 EF211273 EF211274 EF211275 EF211276 EF211277 EF211278 EF211279 EF211280 EF211281 EF211282 EF211283 AJ300883 AJ300862 AJ300861 EF211149 EF211150 EF211151 EF211152 EF211153 EF211154 EF211155 EF211156 EF211157 EF211158 EF211159 EF211160 EF211161 EF211162 EF211163 EF211164 EF211165 EF211166 EF211167 EF211168 (2004) (2004) (2004) (2004) (2004) (2004) (2004) (2004) (2004) (2004) (2004) (2004) W. Meyer W. Diaz et al. (2000) al. et Diaz Diaz et al. (2000) al. et Diaz (2000) al. et Diaz D’ Souza et al. (2004) al. et Souza D’ D’ Souza et al. (2004) al. et Souza D’ Boekhout et al. (2001) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto al. et Oliveira de Baretto al. et Oliveira de Baretto AIDS patient, Rwanda patient, AIDS Non AIDS patient, USA patient, AIDS Non AIDS patient, Zimbabwe patient, AIDS Hollow trees, Piauí, Brazil Piauí, trees, Hollow Brazil Piauí, trees, Hollow Brazil Piauí, trees, Hollow AIDS patient, Natal, Brazil Natal, patient, AIDS Non AIDS, São Paulo, Brazil Paulo, São AIDS, Non Non AIDS, São Paulo, Brazil Paulo, São AIDS, Non Non AIDS, São Paulo, Brazil Paulo, São AIDS, Non AIDS patient, the Netherlands the patient, AIDS erythematosus, steroids, Australia steroids, erythematosus, Pigeon dropping, São Paulo, Brazil Paulo, São dropping, Pigeon Pigeon dropping, São Paulo, Brazil Paulo, São dropping, Pigeon Pigeon dropping, São Paulo, Brazil Paulo, São dropping, Pigeon Clinical, Johannesburg, South Africa South Johannesburg, Clinical, HIV negative patient, systemic lupus lupus systemic patient, negative HIV Pigeon dropping, Rio de Janeiro, Brazil Janeiro, de Rio dropping, Pigeon Pigeon dropping, Rio de Janeiro, Brazil Janeiro, de Rio dropping, Pigeon AIDS patient, Portugal (visited Venezuela) (visited Portugal patient, AIDS HIV negative patient, asthma, steroids, Australia steroids, asthma, patient, negative HIV nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd VNI 1 1 1 1 1 1 1 1 1 1 1 1B 1B 1B 1B 1B 1B 1A 1A 1A A A A A A A A A A A A A A A A A A A A A ICB23 (=MT23) ICB23 ICB87 (=MT87) ICB87 ICB89 (=YT6) ICB89 ICB154 (=MT154) ICB154 ICB165 (=MTB16) ICB165 ICB166 (=MTB18) ICB166 ICB175 (=MTW3) ICB175 ICB176 (=MTW5) ICB176 ICB178 (=MTW9) ICB178 ICB186 (=MTPI4) ICB186 (=MTPI7) ICB187 (=MTPI9) ICB188 M27049 296 NIH P152 PAH-21b PAH-22 AvB0 1335 RDA RV64610 RV65662

bovers_V4.indd 35 25-10-2007 10:14:30 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii EF211732 EF211733 EF211734 EF211735 EF211736 EF211737 EF211738 EF211739 EF211740 EF211741 EF211742 EF211743 EF211744 EF211745 EF211746 EF211747 EF211748 EF211749 EF211750 EF211751 EF211752 EF211753 EF211617 EF211618 EF211619 EF211620 EF211621 EF211622 EF211623 EF211624 EF211625 EF211626 EF211627 EF211628 EF211629 EF211630 EF211631 EF211632 EF211633 EF211634 EF211635 EF211636 EF211637 EF211638 EF211497 EF211498 EF211499 EF211500 EF211501 EF211502 EF211503 EF211504 EF211505 EF211506 EF211507 EF211508 EF211509 EF211510 EF211511 EF211512 EF211513 EF211514 EF211515 EF211516 EF211517 EF211518 EF211377 EF211378 EF211379 EF211380 EF211381 EF211382 EF211383 EF211384 EF211385 EF211386 EF211387 EF211388 EF211389 EF211390 EF211391 EF211392 EF211393 EF211394 EF211395 EF211396 EF211397 EF211398 * * * * * * * * EF211284 EF211285 EF211286 EF211287 EF211288 EF211289 EF211290 EF211291 EF211292 EF211293 EF211294 EF211295 EF211296 EF211297 AJ300890 AJ300917 AJ300912 AJ300906 AJ300901 AJ300886 AJ300897 AJ300900 EF211169 EF211170 EF211171 EF211172 EF211173 EF211174 EF211175 EF211176 EF211177 EF211178 EF211179 EF211180 EF211181 EF211182 EF211183 EF211184 EF211185 EF211186 EF211187 EF211188 EF211189 EF211190 (2004) (2004) (2004) (2004) (1992a) (1992a) W. Meyer W. W. Meyer W. W. Meyer W. Kwon-Chung et al. al. et Kwon-Chung Kwon-Chung et al. al. et Kwon-Chung Meyer et al. (1999) al. et Meyer (1999) al. et Meyer Boekhout et al. (2001) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Baretto de Oliveira et al. al. et Oliveira de Baretto Torula Torula , USA , Canada nasalis mating type mating mating type mating Dropping of pigeon of Dropping (=NIH12 × NIH433) × (=NIH12 AIDS patient, France patient, AIDS Cat paranasal, Australia paranasal, Cat Cerebrospinal fluid, USA fluid, Cerebrospinal Man, lesion on bone, USA bone, on lesion Man, Non AIDS, São Paulo, Brazil Paulo, São AIDS, Non Non AIDS, São Paulo, Brazil Paulo, São AIDS, Non Non AIDS, São Paulo, Brazil Paulo, São AIDS, Non Cuckoo dropping, Thailand dropping, Cuckoo Non-AIDS patient, Illinois, USA Illinois, patient, Non-AIDS Pigeon dropping, Madras, India Madras, dropping, Pigeon Milk from mastitic cow, Switzerland cow, mastitic from Milk Dead white mouse, the Netherlands the mouse, white Dead molecular type VNI, Sydney, Australia Sydney, VNI, type molecular molecular type VNII, Sydney, Australia Sydney, VNII, type molecular HIV positive human, reference strain of of strain reference human, positive HIV Genetic offspring of CBS6885 × CBS7000 CBS7000 × CBS6885 of offspring Genetic Nasal tumour of horse, type strain of of strain type horse, of tumour Nasal Congenic pair with JEC21 that differs only in in only differs that JEC21 with pair Congenic Congenic pair with JEC20 that differs only in in only differs that JEC20 with pair Congenic HIV positive human, Kwa Mashu, South Africa South Mashu, Kwa human, positive HIV Immunocompetent human, reference strain of of strain reference human, Immunocompetent Nonmeningitic cellulitis and osteomyelitis, USA osteomyelitis, and cellulitis Nonmeningitic nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd VNI VNI VNII VNII 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 1B 1B 1B A A A A A A D D D D D D D D D D D D D D D D neoformans var. (R) (R) (T) neoformans

TN/ENV/2 (=WM721) TN/ENV/2 11536 UON WM 02.33 (=CDCR267) 02.33 WM WM148 WM148 WM626 WM714 C. (=CBS6900) B-3501 BD5 CBS882 CBS882 CBS918 CBS5467 CBS5728 CBS6885 (=NIH 12) (=NIH CBS6885 430) (=NIH CBS6886 CBS6995 CBS7816 ICB105 (=MT105) ICB105 ICB106 (=MT106) ICB106 ICB109 (=MT109) ICB109 ICB163 (=MT163) ICB163 JEC20 (=CBS10511 =NIH-B4476) (=CBS10511 JEC20 JEC21 (=CBS10513 =NIH-B4500) (=CBS10513 JEC21

bovers_V4.indd 36 25-10-2007 10:14:33 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii EF211754 EF211755 EF211756 EF211757 EF211758 EF211759 EF211760 EF211761 EF211762 EF102047 EF211763 EF211764 EF102048 EF211765 EF211766 EF211767 EF211768 EF211769 EF211770 EF211771 EF211639 EF211640 EF211641 EF211642 EF211643 EF211644 EF211645 EF211646 EF211647 EF102071 EF211648 EF211649 EF102072 EF211650 EF211651 EF211652 EF211653 EF211654 EF211655 EF211656 EF211519 EF211520 EF211521 EF211522 EF211523 EF211524 EF211525 EF211526 EF211527 EF102051 EF211528 EF211529 EF102052 EF211530 EF211531 EF211532 EF211533 EF211534 EF211535 EF211536 2 EF211399 EF211400 EF211401 EF211402 EF211403 EF211404 EF211405 EF211406 EF211407 EF102061 EF211408 EF211409 EF102062 EF211410 EF211411 EF211412 EF211413 EF211414 EF211415 EF211416 * * * * * * * * */ EF211298 EF211299 EF211300 EF211301 EF211302 EF211303 EF102032 EF102033 EF211304 EF211305 EF211306 EF211307 AJ300934 AJ300932 AJ300928 AJ300937 AJ300930 AJ300925 AJ300926 AJ300927 AJ300923 EF211191 EF211192 EF211193 EF211194 EF211195 EF211196 EF211197 EF211198 EF211199 EF102028 EF211200 EF211201 EF102029 EF211202 EF211203 EF211204 EF211205 EF211206 EF211207 EF211208 M.S. Lazera M.S. Halliday (2000) Halliday Diaz et al. (2000) al. et Diaz Diaz et al. (2000) al. et Diaz Katsu et al. (2004) al. et Katsu Katsu et al. (2004) al. et Katsu Meyer et al. (1999) al. et Meyer Lengeler et al. (2001) al. et Lengeler Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout (1997) al. et Boekhout (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout (1997) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Gatti and Eeckels (1970) Eeckels and Gatti

, USA , var. var. Cryptococcus Cryptococcus sheppei hollow, Balranald, Balranald, hollow, , China , Cryptococcus gattii Cryptococcus Cryptococcus gattii Cryptococcus , China , neoformans var. var.

C. Cryptococcus neoformans Cryptococcus Cryptococcus hondurianus Cryptococcus Australia Australia a ade2 lys2; derived from from derived lys2; ade2 a Honduras Man, USA Man, , Congo (Zaire) Congo , (RV 20186) (RV (RV 20186) (RV JEC20/JEC21 tree #19 hollow 4, Renmark, Renmark, 4, hollow #19 tree shanghaiensis MAT Human, Thailand Human, Human, Germany Human, Man, Congo (Zaire) Congo Man, Gut of a goat, Spain goat, a of Gut gattii shanghaiensis Lung of a goat, Spain goat, a of Lung var. var. Man, tumour, Lille, France Lille, tumour, Man, Human, Papua New Guinea New Papua Human, Pigeon droppings, São Paulo, Brazil Paulo, São droppings, Pigeon Second isolate of of isolate Second Eucalyptus camaldulensis Eucalyptus Torulopsis neoformans Torulopsis HIV positive human, reference strain of of strain reference human, positive HIV Meningoencephalitic lesion, type strain of of strain type lesion, Meningoencephalitic Serotype D, D, Serotype molecular type VNIV, Melbourne, Australia Melbourne, VNIV, type molecular E. camaldulensis E. Subculture of type strain of of strain type of Subculture Subculture of type strain of of strain type of Subculture Cerebrospinal fluid, type strain of of strain type fluid, Cerebrospinal Meningitis, type strain strain type Meningitis, Infected skin, syntype syntype skin, Infected Air in in Air nd nd nd nd nd nd nd nd nd nd nd nd nd nd nd VGI VGI VGI VNIV VNIV 2 2 2 2 4 4 4 4 4B 4B 4B 4B 4B 4B 4B 4A 4A 4A 4A 4A B B B B B B B B B B B B B B B B D D D D (T) (T) (R) (T) (T) AFLP4=VGI gattii

JEC171 MT-B12 RKI-M318/90 WM629 C. 48A 503 2738 (=WM1251) 2738 503 56A CBS883 CBS919 CBS1622 =RV20186 (=CBS8273 CBS6289 B-3939) =NIH CBS6290 CBS6992 (=NIH 17) (=NIH CBS6992 CBS6998 (=NIH 365) (=NIH CBS6998 CBS7229 CBS7748 (=IFM50902) (=IFM50902) CBS7748 =RV20186 (=CBS6289 CBS8273 B-3939) =NIH E566 =CBS8273 (=CBS6289 RV20186 B-3939) =NIH RV54130

bovers_V4.indd 37 25-10-2007 10:14:36 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii EF211772 EF211773 EF211774 EF211775 EF211776 EF211777 EF211778 EF211779 EF211780 EF211781 EF211782 EF211783 EF211784 EF211785 EF211786 EF211787 EF211788 EF211789 EF211790 EF211791 EF211657 EF211658 EF211659 EF211660 EF211661 EF211662 EF211663 EF211664 EF211665 EF211666 EF211667 EF211668 EF211669 EF211670 EF211671 EF211672 EF211673 EF211674 EF211675 EF211676 EF211537 EF211538 EF211539 EF211540 EF211541 EF211542 EF211543 EF211544 EF211545 EF211546 EF211547 EF211548 EF211549 EF211550 EF211551 EF211552 EF211553 EF211554 EF211555 EF211556 EF211417 EF211418 EF211419 EF211420 EF211421 EF211422 EF211423 EF211424 EF211425 EF211426 EF211427 EF211428 EF211429 EF211430 EF211431 EF211432 EF211433 EF211434 EF211435 EF211436 * * * EF211308 EF211309 EF211310 EF211311 EF211312 EF211313 EF211314 EF211315 EF211316 EF211317 EF211318 EF211319 EF211320 EF211321 EF211322 EF211323 EF211324 AJ300929 AJ300940 AJ300939 EF211209 EF211210 EF211211 EF211212 EF211213 EF211214 EF211215 EF211216 EF211217 EF211218 EF211219 EF211220 EF211221 EF211222 EF211223 EF211224 EF211225 EF211226 EF211227 EF211228 Kidd et al. (2005) al. et Kidd Kidd et al. (2004) al. et Kidd Kidd et al. (2004) al. et Kidd Kidd et al. (2004) al. et Kidd Kidd et al. (2004) al. et Kidd Kidd et al. (2004) al. et Kidd Katsu et al. (2004) al. et Katsu Katsu et al. (2004) al. et Katsu Meyer et al. (2003) al. et Meyer Meyer et al. (2003) al. et Meyer Boekhout et al. (2001) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (2001) al. et Boekhout (2001) al. et Boekhout (2001) al. et Boekhout , bacillisporus

, USA , wood from hollow, hollow, from wood , San Diego, USA Diego, San , Cryptococcus , Mt. Annan, New South South New Annan, Mt. , Man Guinea Canada Unknown Unknown Diego, USA Diego, USA Diego, Patient, USA Patient, Island, Canada Island, California, USA California, Wales, Australia Wales, Gulf Island, Canada Island, Gulf Human, California, USA California, Human, Eucalyptus citriodora Eucalyptus Vancouver Island, Canada Island, Vancouver sp. debris from car park of zoo, San San zoo, of park car from debris sp. Human, Auckland, New Zealand New Auckland, Human, Detritus of almond tree, Colombia tree, almond of Detritus Eucalyptus citriodora Eucalyptus molecular type VGI, Sydney, Australia Sydney, VGI, type molecular Immunocompetent male, Nanoose Bay, Bay, Nanoose male, Immunocompetent Immunocompetent, Human, Papua New New Papua Human, Immunocompetent, Immunocompetent male, lung, Kelowna, Kelowna, lung, male, Immunocompetent Eucalyptus camaldulensis Eucalyptus reference strain of molecular type VGIII, San San VGIII, type molecular of strain reference Immunocompetent female, Victoria, Canada Victoria, female, Immunocompetent Eucalyptus tereticornis Eucalyptus Immunocompetent male, Duncan, Vancouver Vancouver Duncan, male, Immunocompetent Eucalyptus Immunocompetent human, reference strain of of strain reference human, Immunocompetent Human, type strain of of strain type Human, Dead wild Dall’s porpoise lymph node, Shores of of Shores node, lymph porpoise Dall’s wild Dead nd nd nd nd nd nd nd nd VGI VGI VGI VGII VGII VGII VGII VGII VGIII VGIII VGIII VGIII 4 4 4 5 6 6 6 6 6 4B 5B 5B 5B 5A 5C 5C 5C 5C 5C 5C B B B B B B B B B B B B B B C C C C C C (=NIH 191) (=NIH (T) (R) (R) AFLP5=VGIII AFLP6=VGII gattii gattii

WM176 WM179 (=CBS10510) WM276 WM830 C. 380C 384C CBS5758 CBS6955 CBS6955 18) (=NIH CBS6993 CBS6996 CBS8755 (=HOO58-I-682) CBS8755 CN043 WM161 WM726 WM728 C. F2866 A1M A1M F2932 A1M A1M R265 (=CBS10514) R265 A1M A1M R269 A1M A1M R271 A1M

bovers_V4.indd 38 25-10-2007 10:14:38 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii EF211792 EF211793 EF211794 EF211795 EF211796 EF211797 EF211798 EF211799 EF211800 EF211801 EF211802 EF211803 EF211804 EF211805 EF211806 EF211677 EF211678 EF211679 EF211680 EF211681 EF211682 EF211683 EF211684 EF211685 EF211686 EF211687 EF211688 EF211689 EF211690 EF211691 Diaz et al. (2000); al. et Diaz * EF211557 EF211558 EF211559 EF211560 EF211561 EF211562 EF211563 EF211564 EF211565 EF211566 EF211567 EF211568 EF211569 EF211570 EF211571 2 EF211437 EF211438 EF211439 EF211440 EF211441 EF211442 EF211443 EF211444 EF211445 EF211446 EF211447 EF211448 EF211449 EF211450 EF211451 * * * EF211325 EF211326 EF211327 EF211328 EF211329 EF211330 EF211331 EF211332 EF211333 EF211334 EF211335 EF211336 AJ300919 AJ300920 AJ300922 Litvintseva et al. (2006); al. et Litvintseva 5 EF211229 EF211230 EF211231 EF211232 EF211233 EF211234 EF211235 EF211236 EF211237 EF211238 EF211239 EF211240 EF211241 EF211242 EF211243 (2004) Kidd et al. (2004) al. et Kidd (2004) al. et Kidd Kidd et al. (2004) al. et Kidd Katsu et al. (2004) al. et Katsu Katsu et al. (2004) al. et Katsu Katsu et al. (2004) al. et Katsu Meyer et al. (2003) al. et Meyer Meyer et al. (2003) al. et Meyer Diaz and Fell (2005) Fell and Diaz Latouche et al. (2002) al. et Latouche Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (1997) al. et Boekhout Boekhout et al. (2001) al. et Boekhout Baretto de Oliveira et al. al. et Oliveira de Baretto Meyer et al. (2003); al. et Meyer 4 bark debris, San San debris, bark , Arnhemland, Northern Northern Arnhemland, , Francisco, USA Francisco, Sick goat, Aruba goat, Sick Territory, Australia Territory, Human, Punjab, India Punjab, Human, Nest of wasp, Uruguay wasp, of Nest Hollow trees, Piauí, Brazil Piauí, trees, Hollow HIV positive patient, India patient, positive HIV Vancouver Island, Canada Island, Vancouver Human, Rio de Janeiro, Brazil Janeiro, de Rio Human, F. Hagen (unpublished data); (unpublished Hagen F. VGIV, Johannesburg, South Africa South Johannesburg, VGIV, 3 Clinical, Johannesburg, South Africa South Johannesburg, Clinical, Immunocompetent female, Nanaimo, Nanaimo, female, Immunocompetent Eucalyptus camaldulensis Eucalyptus Immunocompetent human, Seattle, USA Seattle, human, Immunocompetent Immunocompetent male, Victoria, Canada Victoria, male, Immunocompetent Cheetah, reference strain of molecular type type molecular of strain reference Cheetah, Immunocompetent human, lung, reference reference lung, human, Immunocompetent Immunocompetent female, Victoria, Canada Victoria, female, Immunocompetent strain of molecular type VGII, Sydney, Australia Sydney, VGII, type molecular of strain Eucalyptus camaldulensis Eucalyptus nd nd nd nd VGII VGII VGII VGII VGII VGII VGII VGII VGIV VGIV VGIV 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 B B B B B B B B B B B B C C C Barreto de Oliveira et al. (2004); al. et Oliveira de Barreto 2 reference strain (Meyer et al., 2003); nd = not determined. (R) (R) (R) AFLP7=VGIV gattii type strain;

Boekhout et al. (2001); al. et Boekhout A1M R368 A1M A1M R406 A1M R409 A1M CBS1930 CBS6956 CBS6956 =ATCC32609) 444 (=NIH CBS7750 CBS8684 HEC11102 ICB184 (=MTPI2) ICB184 RAM2 WM178 (=IFM50894) C. B-5742 B5748 M27055 WM779 (=IFM50896) 1 (T)

bovers_V4.indd 39 25-10-2007 10:14:41 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii RPB2 EF211572 EF211573 EF211574 EF211575 EF211576 RPB1 EF211452 EF211453 EF211454 EF211455 EF211456 ITS Amplification conditions EF211244 EF211245 EF211246 EF211247 EF211248 sequences are indicated. a final extension step of 72ºC for 5 min. a final extension step of 72ºC for 7 min. a final extension step of 72ºC for 5 min. a final extension step of 72ºC for 7 min. a final extension step of 72ºC for 7 min. a final extension step of 72ºC for 7 min. CBS CBS CBS CBS CBS RPB2 1 min, 57ºC for min and 72ºC 3 with 1 min, 50ºC for min and 72ºC with 1 min, 57ºC for min and 72ºC 2 with 1 min, 62ºC for min and 72ºC 2 with 94ºC for 5 min, followed by 35 cycli of 94ºC for 5 min, followed by 40 cycli of 94ºC for 3 min, followed by 35 cycli of 96ºC for 5 min, followed by 35 cycli of 94ºC for 3 min, followed by 35 cycli of 94ºC for 5 min, followed by 35 cycli of 45 sec, 52ºC for 1 min and 72ºC 2 min, with 30 sec, 59ºC for sec and 72ºC 2 min, with Reference and RPB1 Cryptococcus Sterigmatomyces Canada (= , ) , 5 nM EDTA, pH 8.8 , 5 nM EDTA, pH 8.3 , 5 nM EDTA, pH 8.8 , 5 nM EDTA, , 0.01% gelatin, 0.1% , 0.01% gelatin, 0.1% , 0.01% gelatin, 0.1% 2 2 2 2 2 2 (1 × PCR buffer) ), Russia Buffer composition Triton X-100, pH 8.3 Triton X-100, pH 8.3 Triton X-100, pH 8.3 Triton , type strain of mM MgCl mM MgCl mM MgCl 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, mM MgCl mM MgCl mM MgCl 10.4 mM Tris-HCl, 75 mM KCl, 1.5 10.4 mM Tris-HCl, 75 mM KCl, 3.5 10.4 mM Tris-HCl, 75 mM KCl, 3.5 10.4 mM Tris-HCl, Tsuchiyaea wingfieldii Tsuchiyaea Candida podzolica South Africa (= , Filobasidiella arachnophila ) (1990) (2006) (= Dombeya rotundifolia Reference This study White et al. Xu et al. (2000) Liu et al. (2006) Litvintseva et al. Diaz et al. (2000) , type strain of ), South Africa Origin Peat, Russia africana Candida amylolenta wingfieldii Cryptococcus podzolicus (= analyses. GenBank accession numbers of ITS, (buprestid beetle) in subsp. Filobasidiella depauperata RPB2 amylolentus and Olea europea RPB1 Enneadesmus forficulus Primer sequences (5’-3’) Podzolic soil, type strain of LAC-F: GGCGATACTATTATCGTA IG2R: ATGCATAGAAAGCTGTTGG ITS4: TCCTCCGCTTATTGATATGC LAC-R: TTCTGGAGTGGCTAGAGC ITS1: TCCGTAGGTGAACCTGCGG IG1F: CAGACGACTTGAATGGGAACG TEF1-F: AATCGTCAAGGAGACCAACG Dead spider, type strain of Dead spider, TEF1-R: CGTCACCAGACTTGACGAAC RPB1-Af: GARTGYCCDGGDCAYTTYGG RPB1-Cf: CCNGCDATNTCRTTRTCCATRTA RPB2-Fcrypto: TGGGGYATGGTTTGTCCKGC RPB2-Rcrypto: CCCATGGCTTGTTTRCCCATYGC Frass of larvae of Frass of scolytid beetles in ) ) (T) (T) RPB1 α (T) (T) TEF1 ( Isolate α CBS6039 CBS6819 CBS7118 CBS7717 CBS7841 ) Overview of selected loci and their chromosomal location. In addition, primer sequences, buffer composition and the conditions used for amplification for used conditions the and composition buffer sequences, primer addition, In location. chromosomal their and loci selected of Overview Origin of outgroup isolates used in ITS, CNLAC1 ) type strain. RPB2 Table 4. Table are shown. Region and Chromosomal location including 2 and 1 Spacers Transcribed Internal 5.8S rDNA (ITS) chromosome 2 Intergenic Spacer (IGS) chromosome 2 Laccase ( chromosome 7 Largest subunit of RNA polymerase II ( chromosome 5 ( chromosome 4 Elongation Factor 1 Translation chromosome 13 Second largest subunit of RNA polymerase II Table 3. Table Species Cryptococcus amylolentus Cryptococcus podzolicus Tsuchiyaea wingfieldii Tsuchiyaea Cryptococcus podzolicus Filobasidiella depauperata (T)

bovers_V4.indd 40 25-10-2007 10:14:42 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Sequencing reactions were carried out with the BigDye v3.1 Chemistry kit (Applied Biosystems) using primers that had been used in the initial PCR reactions. Sequencing reactions were purified with Sephadex G-50 Superfine columns (Amersham Biosciences) and a MultiScreen HV plate (Millipore). An ABI 3700XL DNA analyzer (Applied Biosystems) was used to determine the sequences. GenBank accession numbers are listed in Tables 2 and 3. 2

Alignment and phylogenetic analyses

SeqMan 5.03 (DNASTAR) was used to assemble consensus sequences which were checked manually. Sequences were aligned with ClustalX version 1.81 (Thompson et al., 1997) and visually corrected using GeneDoc (www.nrbsc.org/downloads/). Cryptococcus amylolentus, C. podzolicus, F. depauperata and T. wingfieldii were used as an outgroup in ITS, RPB1 and RPB2 analyses. Cryptococcus neoformans analyses of IGS1, CNLAC1 and TEF1α were carried out using five C. gattii isolates (CBS6998, E566, CBS6955, CBS7750, WM779) as an outgroup. Cryptococcus gattii analyses of IGS1, CNLAC1 and TEF1α were performed using five C. neoformans isolates (H99, 125.91, WM714, JEC20, CBS6886) as an outgroup. Neighbor-Joining (NJ) and Maximum Parsimony (MP) phylogenetic analyses were performed using PAUP* (Phylogenetic Analysis Using Parsimony) version 4.0b10 software (Swofford, 2000). NJ analyses were carried out using the uncorrected (“p”), Jukes-Cantor, Kimura 2-parameter and HKY85 substitution models. Any ties that were encountered were broken randomly. Bootstrap analysis (Hillis and Bull, 1993) with a thousand replicates was used to determine the significance of branches. MP analyses were carried out (heuristic search, stepwise addition, random taxon addition, thousand maximum trees) with tree bisection and reconstruction (TBR) as the branch-swapping algorithm. All characters were unordered and of equal weight, and gaps were treated both as missing and as a new character state. Gaps in C. gattii TEF1α and C. neoformans IGS1 analyses were treated only as a new character state because of lack of computational power. Bootstrap analysis (Hillis and Bull, 1993) was performed with a thousand replicates.

Combinability assessment and concatenation of sequences

One strain was selected from each genotypic group and the distance matrix of each of the six sequenced regions was calculated using ClustalX version 1.81 (Thompson et al., 1997). The Pearson’s correlation between all of the distance matrices was calculated. Regions with correlation values higher than 0.90 (IGS1, RPB1, RPB2, CNLAC1 and

bovers_V4.indd 41 25-10-2007 10:14:43 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

TEF1α) were concatenated and regions with correlation values higher than 0.60 (ITS, IGS1, RPB1, RPB2, CNLAC1 and TEF1α) were concatenated as well. A set of concatenated sequences included all haplotypes of either C. neoformans or C. gattii. In addition, outgroup sequences were included. Four C. gattii isolates (WM276, CBS6955, A1MR265, WM779) representing all haploid genotypic C. gattii groups were included as an outgroup for the C. neoformans data set, whereas two C. neoformans isolates (H99, JEC21) representing the two C. neoformans varieties were included as an outgroup for the C. gattii data set. NJ analysis using the Kimura 2-parameter substitution model in PAUP version 4.0b10 (Swofford, 2000) was carried out to compare the results of the sets of concatenated sequences with and without the ITS region. The analyses yielded phylogenetic trees with similar topologies and bootstrap values. We therefore decided to include ITS in all further analyses. NJ and MP analyses were carried out as described above.

Results

Cryptococcus neoformans and Cryptococcus gattii overall genotypic structure

The topology of the C. neoformans – C. gattii species complex was inferred for ribosomal DNA region ITS and the RPB1 and RPB2 genes. Phylogenetic analysis of ITS gave very low bootstrap support for a C. neoformans cluster, ranging from 55 to 58% in ITS-NJ analyses, and ITS-MP analyses did not support a C. neoformans cluster (bootstrap value <50%). Furthermore, a C. gattii cluster was not supported. Analysis of RPB2 gave a slightly higher bootstrap support. A separate C. neoformans cluster received bootstrap support ranging from 67 to 76% in RPB2-NJ analyses, but RPB2-MP analyses did not support a separate C. neoformans cluster (bootstrap value ± 50%). RPB2 analysis supported a separate C. gattii cluster with bootstrap values of 100% and 78% in RPB2-NJ and RPB2-MP analyses, respectively. RPB1 analysis supported the division of C. neoformans and C. gattii into two sister groups. Bootstrap values for the C. neoformans cluster ranged from 90 to 94% in RPB1-NJ and from 69 to 71% in RPB1-MP analyses. In addition, a separate C. gattii cluster received strong bootstrap support with values of 100% and 98% in RPB1-NJ and RPB1-MP analyses, respectively. In summary, NJ and MP analyses of RPB1 and RPB2 supported a separate C. gattii cluster. A separate C. neoformans cluster was supported by NJ analyses of RPB1 and RPB2, and moderately supported by MP analyses of RPB1. An overview of bootstrap values is given in Table 5. Our results indicated that C. neoformans and C. gattii are sister groups. The topology of the

bovers_V4.indd 42 25-10-2007 10:14:45 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

C. neoformans – C. gattii species complex obtained by RPB2 and RPB1 MP analyses is depicted in Figures 1 and 2, respectively. The DNA similarity between C. neoformans and C. gattii isolates was determined for the combined data set of ITS, IGS1, CNLAC1, RPB1, RPB2 and TEF1α. Cryptococcus neoformans and C. gattii sequences were 84 to 86% similar. 2 Cryptococcus neoformans genotypic structure

The structure within the C. neoformans clade was studied for ribosomal DNA regions ITS and IGS1, and for the RPB1, RPB2, CNLAC1 and TEF1α genes. The number of C. neoformans haplotypes was 4 for ITS, 11 for CNLAC1, 12 for RPB1, 13 for RPB2, 16 for IGS1 and 18 for TEF1α. All isolates clustered consistently, i.e. they fell into either var. grubii or var. neoformans for all six regions studied. Although a separate var. grubii cluster received strong bootstrap support ranging from 81 to 83% in ITS-NJ analyses, bootstrap support was low for ITS-MP analyses, i.e. ranging from 50 to 63%. However, all other analyzed regions strongly supported a separate var. grubii cluster with bootstrap values ≥ 90% in both NJ and MP analyses, as is illustrated in Figures 1 and 2. In addition, a separate var. neoformans cluster was strongly supported by all regions analyzed, e.g. Figures 1 and 2, with bootstrap values ≥ 90% in NJ analyses and ≥ 82% in MP analyses. Bootstrap support values for all analyzed regions are given in Table 5. To infer the relationship of the isolates within the two varieties, phylogenetic analyses were carried out using the concatenated data set of all six loci. This set included all nine haplotypes of var. neoformans (n=20) and all twenty-two haplotypes of var. grubii (n=46). The concatenated sequences of the two varieties were 91 to 92% similar. The topology obtained by MP analysis of the concatenated sequences is shown in Figure 3 and an overview of the obtained bootstrap support values is given in Table 6. The var. neoformans clade contained all AFLP2 isolates, including the type strain of Torula nasalis (CBS882) and the VNIV reference strain (WM629). Within the var. grubii clade three major clusters received strong bootstrap support, i.e. ≥ 93% in both NJ and MP analyses. One of these clusters contained all AFLP1 isolates, including the type strain of C. neoformans var. grubii (H99=CBS8710=CBS10515), the type strain of Candida psicrophylicus (CBS996), and the reference strain of VNI (WM148). The reference strain of VNII (WM626) clustered together with the AFLP1B isolates. Interestingly, all AFLP1A isolates fell into the cluster that also contained the VNB isolates (Litvintseva et al., 2006). The AFLP1/VNI cluster formed a sister group to the AFLP1B/VNB cluster, and this combined cluster received bootstrap support values ranging from 67 to 70% in NJ, and ranging from 78 to 80% in MP analyses.

bovers_V4.indd 43 25-10-2007 10:14:45 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Table 5. Bootstrap support values obtained by Neighbor-Joining and Maximum Parsimony analyses of the six selected loci are shown for Cryptococcus neoformans and Cryptococcus gattii, C. neoformans, C. neoformans var. grubii, C. neoformans var. neoformans, C. gattii and for each of the genotypic groups within C. gattii. Bootstrap support for the relationship between C. gattii genotypic groups is indicated as well. In addition, the number of haplotypes for each of the six regions are indicated.

Number Number Neighbor-Joining Maximum Parsimony Species/Genotypic group of of uncorrected Jukes- gap: gap: Kimura 2 HKY85 isolates haplotypes (“p”) Cantor new state missing ITS * C. neoformans and C. gattii 117 13 100 100 100 100 98 95 C. neoformans (AFLP1, AFLP2) 66 4 58 57 57 55 - 50 var. grubii (AFLP1) 46 2 82 82 83 81 50 63 var. neoformans (AFLP2) 20 2 91 91 92 91 85 87 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 51 9 - - 50 - - - AFLP4 20 3 62 58 58 58 54 63 AFLP5 11 2 63 63 65 63 63 65 AFLP6 16 2 66 63 62 65 66 63 AFLP7 4 2 basal basal basal basal basal basal (AFLP4, AFLP5, AFLP7) ------(AFLP4, AFLP5, AFLP6) ------(AFLP4, AFLP6, AFLP7) ------(AFLP4, AFLP5) ------(AFLP6, AFLP7) ------RPB1 * C. neoformans and C. gattii 23 100 100 100 100 100 100 C. neoformans (AFLP1, AFLP2) 12 94 91 91 90 69 71 var. grubii (AFLP1) 8 100 100 100 100 99 100 var. neoformans (AFLP2) 4 100 100 100 100 100 100 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 11 100 100 100 100 98 98 AFLP4 4 81 79 79 77 59 61 AFLP5 2 100 100 99 99 99 98 AFLP6 3 100 100 100 100 99 99 AFLP7 2 99 98 98 98 80 80 (AFLP4, AFLP5, AFLP7) 76 74 74 72 66 63 (AFLP4, AFLP5, AFLP6) ------(AFLP4, AFLP6, AFLP7) ------(AFLP4, AFLP5) ------(AFLP6, AFLP7) ------((AFLP4, AFLP5) AFLP6) ------RPB2 * C. neoformans and C. gattii 24 100 100 100 100 100 100 C. neoformans (AFLP1, AFLP2) 13 76 70 72 67 51 - var. grubii (AFLP1) 8 100 100 100 100 98 97 var. neoformans (AFLP2) 5 100 100 100 99 82 83 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 11 100 100 100 100 78 78 AFLP4 5 98 97 97 97 97 97 AFLP5 2 100 100 100 100 99 99 AFLP6 3 98 97 97 97 93 94 AFLP7 1 100 99 99 99 88 88 (AFLP4, AFLP5, AFLP7) ------(AFLP4, AFLP5, AFLP6) ------(AFLP4, AFLP6, AFLP7) ------(AFLP4, AFLP5) ------(AFLP6, AFLP7) ------((AFLP4, AFLP5) AFLP6) ------

bovers_V4.indd 44 25-10-2007 10:14:48 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Number Number Neighbor-Joining Maximum Parsimony Species/Genotypic group of of uncorrected Jukes- gap: gap: Kimura 2 HKY85 isolates haplotypes (“p”) Cantor new state missing IGS1 † C. neoformans and C. gattii 36 × × × × × × C. neoformans (AFLP1, AFLP2) 16 100 100 100 100 100 × var. grubii (AFLP1) 11 100 91 100 92 100 × var. neoformans (AFLP2) 5 80 100 100 100 100 × 2 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 20 100 100 100 100 100 100 AFLP4 7 100 99 100 99 100 99 AFLP5 5 100 100 100 100 100 100 AFLP6 6 100 100 100 100 100 100 AFLP7 2 100 100 100 99 100 100 (AFLP4, AFLP5, AFLP7) - - - - - 51 (AFLP4, AFLP5, AFLP6) 60 - - 79 - - (AFLP4, AFLP6, AFLP7) ------(AFLP4, AFLP5) - 57 70 - 68 - (AFLP6, AFLP7) ------((AFLP4, AFLP5) AFLP6) - 80 52 - - - CNLAC1 † C. neoformans and C. gattii 27 × × × × × × C. neoformans (AFLP1, AFLP2) 11 100 100 100 100 100 100 var. grubii (AFLP1) 7 100 100 100 100 100 100 var. neoformans (AFLP2) 4 100 100 100 100 100 100 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 16 100 100 100 100 100 100 AFLP4 5 100 100 100 100 100 100 AFLP5 4 100 99 99 100 99 96 AFLP6 4 100 100 100 99 99 99 AFLP7 3 100 100 100 100 100 100 (AFLP4, AFLP5, AFLP7) ------(AFLP4, AFLP5, AFLP6) ------(AFLP4, AFLP6, AFLP7) ------(AFLP4, AFLP5) 66 59 61 62 86 55 (AFLP6, AFLP7) 54 55 58 56 - - ((AFLP4, AFLP5) AFLP6) ------TEF1α † C. neoformans and C. gattii 34 × × × × × × C. neoformans (AFLP1, AFLP2) 18 100 100 100 100 100 100 var. grubii (AFLP1) 13 100 100 100 100 100 100 var. neoformans (AFLP2) 5 100 100 100 100 100 99 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 16 100 100 100 100 100 × AFLP4 7 100 100 100 100 100 × AFLP5 3 100 100 100 100 100 × AFLP6 3 100 100 100 100 97 × AFLP7 3 100 100 100 100 99 × (AFLP4, AFLP5, AFLP7) 85 88 85 85 79 - (AFLP4, AFLP5, AFLP6) ------(AFLP4, AFLP6, AFLP7) ------(AFLP4, AFLP5) - - - - 67 - (AFLP6, AFLP7) ------((AFLP4, AFLP5) AFLP6) ------

outgroup = C. amylolentus, T. wingfieldii, F. depauperata and C. podzolicus; † outgroup = C. neoformans analyses: fiveC. gattii isolates / C. gattii analyses: five C. neoformans isolates; - = bootstrap support < 50%; × = not determined.

bovers_V4.indd 45 25-10-2007 10:14:51 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Filobasidiella depauperata (CBS7841) 100 Tsuchiyaea wingfieldii (CBS7118) 84 Cryptococcus amylolentus (CBS6039) 100 Cryptococcus podzolicus (CBS7717) Cryptococcus podzolicus (CBS6819) CBS8684 A1MF2866 A1MR271 CBS1930 A1MF2932 A1MR265 A1MR269 93 A1MR368 AFLP6 CBS6956 A1MR409 VGII ICB184 CBS7750 RAM2 A1MR406 HEC11102 WM178 R CBS6998 CBS1622 CBS6992 56A 97 CBS6289 48A CBS6290 WM276 CBS8273 RV20186 T AFLP4 Cryptococcus gattii WM830 VGI RV54130 CBS7229 T 5032738 WM176 CBS919 T CBS883 T CBS7748 WM179 R E566 CBS6996 CBS5758 78 384C CN043 380C AFLP5 CBS6993 99 CBS6955 T VGIII CBS8755 WM728 WM161 R WM726 B5742 WM779 R AFLP7 B5748 VGIV 88 M27055 Bt1 ICB186 ICB187 ICB176 Bt130 H99 5FOAr WM02.33 ICB89 ICB87 ICB23 WM148 R TN/ENV/2 CBS1931 100 ATCC90112 821330 CBS8336 CBS7812 CBS8710 P152 98 RDA1335AvB0 H99 T CBS9172 C. neoformans M27049 NIH296 var. grubii CBS996 T ICB188 930104II 930104I AFLP1/1A/1B HamdenC31 RV65662 VNI/VB/VNII RV64610 ICB154 Bt206 Bt27 Cryptococcus neoformans ICB165 ICB178 Bt63 125.91 WM714 51 UON11536 PAH22 ICB166 WM626 R ICB175 940441 PAH21b MTB12 WM629 R CBS882 T ICB163 ICB105 CBS6886 CBS6885 JEC171 C. neoformans JEC21 CBS7816 var.neoformans JEC20 ICB106 CBS5728 82 CBS5467 AFLP2 BD5 CBS918 VNIV RKIM318/90 ICB109 10 B3501 CBS6995

Fig. 1. Phylogenetic tree of Cryptococcus neoformans and Cryptococcus gattii obtained by analysis of partial RPB2 sequences. Presented is one of 684 most parsimonious trees (length 527; consistency index 0.767; retention index 0.948) computed with gaps treated as missing data. Data consisted of 653 characters of which 252 characters were parsimony informative. Bootstrap values (1000 replicates) are indicated for the main branches. T type strain, R molecular type reference strain (Meyer et al., 2003).

bovers_V4.indd 46 25-10-2007 10:14:52 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

100 Cryptococcus amylolentus (CBS6039) Tsuchiyaea wingfieldii (CBS7118) 62 Filobasidiella depauperata (CBS7841) 100 Cryptococcus podzolicus (CBS6819) Cryptococcus podzolicus (CBS7717) CBS6992 CBS1622 CBS6998 5032738 61 CBS6290 CBS8273 CBS883 T CBS6289 56A RV20186 T AFLP4 48A WM176 VGI WM830 WM276 E566 CBS7229 T 2 WM179 R CBS7748 CBS919 T RV54130 CN043 CBS6996 CBS8755 63 CBS6993 384C 380C AFLP5 Cryptococcus gattii 98 CBS6955 T CBS5758 VGIII WM161 R WM726 WM728 WM779 R 98 M27055 AFLP7 80 B5748 VGIV B5742 CBS1930 WM178 R ICB184 CBS8684 RAM2 99 A1MR269 A1MR368 CBS6956 AFLP6 A1MR409 A1MR271 VGII A1MR265 A1MF2932 CBS7750 HEC11102 A1MR406 A1MF2866 Bt206 Bt63 Bt27 Bt1 HamdenC31 100 RV64610 RV65662 ICB154 100 ICB165 ICB178 Bt130 CBS7812 NIH296 RDA1335AvB0 CBS9172 ICB188 ICB87 ICB23 ATCC90112 ICB176 930104II 125.91 C. neoformans 930104I ICB187 var. grubii CBS8336 CBS8710 CBS996 T WM02.33 AFLP1/1A/1B M27049 CBS1931 VNI/VB/VNII 71 TN/ENV/2 WM148 R ICB186 ICB89 Cryptococcus neoformans 821330 H99 5FOAr H99 T P152 ICB175 940441 UON11536 PAH21b ICB166 PAH22 WM626 R WM714 CBS5467 ICB105 CBS6886 RKIM318/90 CBS918 BD5 MTB12 100 JEC21 C. neoformans WM629 R CBS6995 CBS6885 var. neoformans JEC171 ICB109 CBS5728 AFLP2 CBS7816 CBS882 T VNIV ICB163 B3501 10 ICB106 JEC20

Fig. 2. Phylogenetic tree of Cryptococcus neoformans and Cryptococcus gattii obtained by analysis of partial RPB1 sequences. Presented is one of 21 most parsimonious trees (length 625; consistency index 0.803; retention index 0.966) computed with gaps treated as missing data. Data consisted of 769 characters of which 310 characters were parsimony informative. Bootstrap values (1000 replicates) are indicated for the main branches. T type strain, R molecular type reference strain (Meyer et al., 2003).

bovers_V4.indd 47 25-10-2007 10:14:53 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Cryptococcus gattii genotypic structure

The structure within the C. gattii clade was inferred for ribosomal DNA regions ITS and IGS1, and for coding regions RPB1, RPB2, CNLAC1 and TEF1α. The obtained number of C. gattii haplotypes was 9 for ITS, 11 for RPB1, 11 for RPB2, 16 for CNLAC1, 16 for TEF1α and 20 for IGS1. Four strongly supported monophyletic lineages corresponding to the four previously described genotypic groups of C. gattii (Meyer et al., 2003) were present in all six studied regions. All isolates clustered consistently, i.e. they fell into the same monophyletic lineage for all regions studied. ITS-NJ and ITS-MP analyses showed a basal position for C. gattii AFLP7 and the C. gattii AFLP4, AFLP5 and AFLP6 clusters received low bootstrap support ranging from 54 to 65%. NJ and MP analyses of all other regions, however, resulted in strong bootstrap support ranging from 80 to 100% for all four C. gattii groups, as is illustrated by Figure 1. The only exception was RPB1 phylogenetic analysis (Figure 2), in which C. gattii AFLP4 received moderate bootstrap support ranging from 77 to 81% in RPB1-NJ and ranging from 59 to 61% in RPB1-MP analyses. An overview of bootstrap values for each of the C. gattii genotypic groups is given in Table 5. To infer the relationship of the genotypic groups within the C. gattii clade, phylogenetic analyses were carried out using concatenated sequences of the six regions. All C. gattii haplotypes were included, i.e. 13 AFLP4 haplotypes (n=20), 7 AFLP5 haplotypes (n=11), 7 AFLP6 haplotypes (n=16) and 4 AFLP7 haplotypes (n=4). The concatenated sequences of the C. gattii genotypic groups were 95 to 96% similar. The AFLP4 and AFLP5 cluster received high bootstrap support ranging from 76 to 79% in NJ and from 94 to 97% in MP analyses. AFLP7 clustered basal to the AFLP4

Table 6. Bootstrap support values obtained by Neighbor-Joining and Maximum Parsimony analyses of the concatenated data set of six regions are indicated for Cryptococcus neoformans, C. neoformans var. grubii, C. neoformans var. neoformans, the three clusters within C. neoformans var. grubii as well as for the relationship between these clusters.

Concatenated data set (RPB1, RPB2, CNLAC1, TEF1α, IGS1 and ITS) Neighbor-Joining Maximum Parsimony Species/Genotypic group Number Number of uncorrected Jukes- gap: gap: of isolates haplotypes Kimura 2 HKY85 (“p”) Cantor new state missing C. neoformans (AFLP1, AFLP2) 66 31 100 100 100 100 100 100 var. grubii (AFLP1) 46 22 100 100 100 100 100 100 AFLP1B/VNII 10 4 100 100 100 100 98 100 AFLP1/VNI 28 13 95 96 96 95 83 93 AFLP1A/VNB 8 5 100 100 99 100 98 98 (AFLP1/VNI, AFLP1A/VNB) 67 69 70 69 80 78 var. neoformans (AFLP2) 20 9 100 100 100 100 100 100

outgroup: C. gattii isolates WM276, CBS6955, A1MR265 and WM779.

bovers_V4.indd 48 25-10-2007 10:14:54 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

A1MR265 WM779 C. gattii WM276 CBS6955

B3501/CBS6995/ICB109 CBS882T /ICB163/MTB12/WM629 R CBS7816/JEC20/JEC21/JEC171 100 CBS5728/CBS6885/ICB106 AFLP2 C. neoformans RKIM318/90 VNIV var. neoformans 2 CBS918/BD5 CBS5467 CBS6886 ICB105 ICB165/ICB178 100 100 WM714 ICB175 AFLP1B R PAH22/WM626 VNII 940441/ICB166/UON11536 PAH21b 125.91 TN/ENV/2 100 ICB87 RDA1335AvB0 93 ATCC90112/ICB23/P152 ICB188 AFLP1 C. neoformans ICB89/ICB176 VNI var. grubii 821330/CBS1931 930104I/930104II/CBS8710/CBS9172/H99T/H99 5FOAr CBS996 T/WM148R 78 Bt130 CBS7812/CBS8336/ICB186/ICB187/NIH196/WM02.33 M27049 Bt63 VNB Bt206 98 HamdenC3’1/ICB154/RV64610/RV65662 AFLP1A Bt1 VNB 10 Bt27

Fig. 3. Phylogenetic tree of both varieties of Cryptococcus neoformans obtained by analysis of the concatenated data set (RPB1, RPB2, CNLAC1, TEF1α, IGS1 and ITS). Presented is one of 341 most parsimonious trees (length 896; consistency index 0.867; retention index 0.963) computed with gaps treated as missing data. Data consisted of 3922 characters of which 550 characters were parsimony informative. Bootstrap values (1000 replicates) are indicated for the main branches. T type strain, R molecular type reference strain (Meyer et al., 2003).

and AFLP5 sistergroups, supported by bootstrap values ranging from 87 to 91% in NJ analyses and from 67 to 81% in MP analyses. AFLP6 was found to have a basal position to the other C. gattii genotypic groups. The topology of the C. gattii clade, derived by MP analysis of the concatenated sequences, is depicted in Figure 4 and an overview of the bootstrap support is given in Table 7. The previously described AFLP4A and AFLP5B minor genotypes (Boekhout et al., 2001) could be recognized in our analyses. The type strains of Torulopsis neoformans var. sheppei (CBS919) and C. neoformans var. shanghaiensis (CBS7229),

bovers_V4.indd 49 25-10-2007 10:14:55 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

as well as the syntype of Cryptococcus hondurianus (CBS883), and the reference strain of VGI (WM179) clustered together with the AFLP4 isolates. The type strain of C. gattii (RV20186=CBS6289=CBS8273) fell into the AFLP4A subcluster of AFLP4. The type strain of Cryptococcus bacillisporus (CBS6955) clustered together with the AFLP5 isolates. The reference strain of VGIII (WM161) fell into the AFLP5B subcluster of AFLP5. The reference strain of VGII (WM178) and the reference strain of VGIV (WM779) clustered together with the AFLP6 and AFLP7 isolates, respectively.

H99 Cryptococcus neoformans JEC21 CBS6998 100 CBS1622/CBS6992 CBS6290 48A/56A AFLP4A CBS8273/RV20186 T 64 CBS6289 WM830 WM276 AFLP4 WM176 VGI CBS883 T 94 5032738 CBS7748 E566 CBS7229 T/RV54130 CBS919 T WM179 R 384C 81 98 CBS6996 CBS8755 Cryptococcus gattii 380C/CBS5758/CBS6993 AFLP5 100 CBS6955 T VGIII CN043 WM161 R AFLP5B 100 WM726/WM728 100 100 M27055 WM779 R AFLP7 B5748 VGIV B5742 CBS1930 WM178 R 100 ICB184 CBS8684 AFLP6 RAM2 VGII HEC11102 CBS6956/CBS7750/A1MF2866/A1MF2932/A1MR265/ 10 A1MR269/A1MR271/A1MR368/A1MR406/A1MR409

Fig. 4. Phylogenetic tree of Cryptococcus gattii genotypes obtained by analysis of the concatenated data set (RPB1, RPB2, CNLAC1, TEF1α, IGS1 and ITS). Presented is one of sixty most parsimonious trees (length 847; consistency index 0.902; retention index 0.961) computed with gaps treated as missing data. Data consisted of 3932 characters of which 459 characters were parsimony informative. Bootstrap values (1000 replicates) are indicated for the main branches. T type strain, R molecular type reference strain (Meyer et al., 2003).

bovers_V4.indd 50 25-10-2007 10:14:56 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Table 7. Bootstrap support values obtained by Neighbor-Joining and Maximum Parsimony analyses of the concatenated data set of six regions are given for Cryptococcus gattii, its genotypic groups and for the relationship between the genotypic groups of C. gattii.

Concatenated data set (RPB1, RPB2, CNLAC1, TEF1α, IGS1 and ITS) Neighbor-Joining Maximum Parsimony Species/Genotypic group Number Number of uncorrected Jukes- Kimura 2- gap: gap: of isolates haplotypes (“p”) Cantor parameter HKY85 new state missing 2 C. gattii (AFLP4, AFLP5, AFLP6, AFLP7) 51 31 100 100 100 100 100 100 AFLP4/VGI 20 13 100 100 100 100 100 100 AFLP5/VGIII 11 7 100 100 100 100 100 100 AFLP6/VGII 16 7 100 100 100 100 100 100 AFLP7/VGIV 4 4 100 100 100 100 100 100 (AFLP4/VGI, AFLP5/VGIII) 76 77 79 78 97 94 ((AFLP4/VGI, AFLP5/VGIII), AFLP7/VGIV) 91 90 87 89 67 81

outgroup: C. neoformans isolates H99 and JEC21.

Discussion

Our analyses showed that six monophyletic lineages, that correspond to the previously recognized molecular genotypes (Boekhout et al., 2001; Meyer et al., 2003; Diaz et al., 2005), occur consistently within the C. neoformans – C. gattii species complex. Sequence similarity of the concatenated data set was 91 to 92% between the two C. neoformans varieties and 95 to 96% between the C. gattii genotypes. The sequence similarity between C. neoformans and C. gattii was 84 to 86%. IGS and PRP8 intein sequence similarity between the C. neoformans varieties were 78.4-79.6% and 94-95%, respectively (Butler and Poulter, 2005; Diaz et al., 2005). DNA relatedness between the C. neoformans varieties was 87.7-93.5% (Aulakh et al., 1981). In addition, IGS and PRP8 intein sequence similarity between C. gattii genotypes was 90.9-96.0% and 97%, respectively (Butler and Poulter, 2005; Diaz et al., 2005). Sequence comparison of six coding regions resulted in a similarity of 93-95% between C. gattii genotypes AFLP4 and AFLP6 (Chaturvedi et al., 2005) and the DNA relatedness between C. gattii genotypes AFLP5 and AFLP6 was 88.5% (Aulakh et al., 1981; Boekhout et al., 2001). Furthermore, IGS and PRP8 intein sequence similarity between C. neoformans and C. gattii was 66.0- 69.4% and 85-87%, respectively (Butler and Poulter, 2005; Diaz et al., 2005). A DNA relatedness of 55.2-63% was observed between C. neoformans and C. gattii (Aulakh et al., 1981). The variability in observed sequence similarities is probably caused by the amount of coding regions in the area analyzed. The sequence similarity observed in our study lies between the similarities observed in other studies. Our analyses indicated that C. gattii and C. neoformans are sister groups and the division of C. neoformans into two varieties was supported by all of our studied regions. In addition, three clusters could be recognized within the var. grubii clade.

bovers_V4.indd 51 25-10-2007 10:14:57 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

These clusters correspond to the previously described AFLP genotypes 1, 1A and 1B (Boekhout et al., 2001; Barreto de Oliveira et al., 2004). The reference strain of VNI clustered together with AFLP1, and the reference strain of VNII fell into the AFLP1B cluster, which indicates that genotype VNII is identical to AFLP1B. Genotype VNII was previously thought to correspond to the AFLP1A genotype, but at that time the AFLP1B genotype had not been recognized (Boekhout et al., 2001; Meyer et al., 2003; Barreto de Oliveira et al., 2004). Interestingly, the AFLP1A isolates formed one cluster together with the VNB isolates. The AFLP fingerprints of the VNB isolates (data not shown) are similar to the previously described AFLP1A fingerprints (Boekhout et al., 2001). In addition, comparison of AFLP1A sequences with additional IGS1 and CNLAC1 VNB sequences (Litvintseva et al., 2006) confirmed that the AFLP1A isolates clustered within the VNB cluster. VNB has been described as a unique genotype, and isolates belonging to VNB had only been found in Botswana (Litvintseva et al., 2006). Interestingly, the AFLP1A isolates included in our study were isolated from Brazilian pigeon droppings and from patients in Rwanda, Portugal/Venezuela and Brazil, which indicates that the VNB/AFLP1A genotype is also present in regions outside Botswana. In summary, our results indicate that AFLP1 is identical to VNI, AFLP1B is identical to VNII, and AFLP1A is identical to VNB. In addition, our data supports the topology found by Litvintseva et al. (2006), namely AFLP1B/VNII being basal to the AFLP1/VNI and AFLP1A/VNB sister group. Furthermore, our analyses showed that four strongly supported monophyletic lineages occur within C. gattii. In addition, all C. gattii isolates clustered in the same monophyletic lineage for all regions studied. Cryptococcus gattii has consistently been divided into four genotypes, using molecular fingerprinting methods (Ruma et al., 1996; Ellis et al., 2000; Latouche et al., 2003; Meyer et al., 2003) and sequence analysis (Chaturvedi et al., 2002; Biswas et al., 2003; Diaz et al., 2005; Butler and Poulter, 2005; Fraser et al., 2005; this study). Therefore, we propose to recognize these genotypes as different taxa. The description of these genotypes as taxa will help to understand the characteristics of each of these groups. Some characteristics are already known, e.g. AFLP4 is the C. gattii parental genotype present in all currently known C. neoformans – C. gattii hybrids (Bovers et al., 2006; Bovers et al., 2007) and AFLP6 is the C. gattii genotype responsible for the ongoing outbreak of cryptococcosis on Vancouver Island (Kidd et al., 2004). Additional characteristics will be identified more easily when the C. gattii genotypes are recognized as separate taxa. In addition, analyses were carried out to infer the relationship among the C. gattii genotypic groups using the concatenated data set. These analyses indicated that AFLP7 clusters basal to the AFLP4 and AFLP5 sister groups and that AFLP6 is basal to all other C. gattii genotypic groups. The same topology has been found in analyses of the IGS1+5S+IGS2 (Diaz et al., 2005) and TEF1α region (Fraser et al., 2005). In

bovers_V4.indd 52 25-10-2007 10:14:58 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

addition, PRP8 intein analysis supported a topology were AFLP7 clustered basal to the AFLP4 and AFLP5 sister groups (Butler and Poulter, 2005). Furthermore, AFLP4 and AFLP5 formed sister groups in GPD1 analysis (Fraser et al., 2005). However, C. gattii topologies that are in conflict with the above mentioned topology have been described as well. CNLAC1 analysis indicated that AFLP6 and AFLP7 formed sister groups (Fraser et al., 2005; this study), but bootstrap support was low in CNLAC1- 2 NJ analyses, namely between 54 and 58%, and this cluster was not supported by CNLAC1-MP analyses (bootstrap support <50%) (this study). In addition, IGS1 analysis showed that AFLP6 clustered basal to the AFLP4 and AFLP5 sister groups (this study). However, analysis of the complete IGS1+5S+IGS2 region (Diaz et al., 2005) resulted in a topology identical to the topology obtained with our concatenated data set. Therefore, we conclude that the C. gattii topology obtained by analyses of the concatenated data set is most likely the true topology. This topology indicates that AFLP4 and AFLP5 are the two C. gattii groups that are most closely related, whereas AFLP6 is the most basal C. gattii group. Population studies of C. neoformans and C. gattii indicated that recombination may occur within subpopulations of the same genotype (Litvintseva et al., 2003; Campbell et al., 2005; Litvintseva et al., 2005). In addition, a high amount of variability has been found within C. neoformans and C. gattii karyotypes (Kwon- Chung et al., 1992b; Perfect et al., 1993; Dromer et al., 1994; Boekhout et al., 1997). The high amount of karyotype variability also indicates that recombination may occur within C. neoformans and C. gattii as karyotype polymorphisms are usually generated by meiotic events (Zolan, 1995). Our data showed that six monophyletic lineages were consistently present within the C. neoformans – C. gattii species complex. In addition, all isolates clustered in the same monophyletic lineage for all regions studied, thus indicating that recombination between monophyletic lineages has not occurred. Based on these results the monophyletic lineages should be described as separate taxa. Many different species concepts could be used to determine the status of these monophyletic lineages, but the two most widely used are the genealogical concordance phylogenetic species concept (GCPSC) and the biological species concept (BSC). The GCPSC defines a species as “a basal, exclusive group of organisms all of whose genes coalesce more recently with each other than with those of any organism outside the group, and that contains no exclusive group within it” (Baum and Donoghue, 1995; Taylor et al., 2000). Organisms that fall into one monophyletic lineage for all genes studied are considered different species under the GCPSC. The BSC defines a species as “a group of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups” (Mayr, 1940; Taylor et al., 2000). Under the BSC organisms that may sexually reproduce and produce fertile progeny are considered a species. Our

bovers_V4.indd 53 25-10-2007 10:14:59 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

data showed that all isolates clustered into the same monophyletic lineage for all studied regions, which indicates that there was no recombination between different monophyletic lineages. According to the GCPSC the monophyletic lineages should thus be described as different species. However, when the BSC is applied the description of each of the six monophyletic lineages as separate species is debatable. The existence of hybrids between the two varieties of C. neoformans (Tanaka et al., 1999; Lengeler et al., 2001), and more importantly, the recent discovery of hybrids between C. neoformans and C. gattii (Bovers et al., 2006; Bovers et al., 2007) shows that mating may occur between the two varieties of C. neoformans and between C. neoformans and C. gattii. In addition, the description of the teleomorph of C. gattii, i.e. Filobasidiella bacillispora, was based on the observation of basidiospores when C. gattii AFLP5 isolate CBS6955 was mated with C. gattii AFLP6 isolate CBS6956 (Kwon-Chung et al., 1976; Boekhout et al., 2001). Furthermore, Kwon-Chung and Varma (2006) investigated the F1 progeny of a C. neoformans var. neoformans (JEC20) × C. neoformans var. grubii (H99), and a C. neoformans var. neoformans (B3502) × C. gattii AFLP4 (CBS6289) mating. The intervarietal mating resulted in the recovery of 15% recombinant haploid progeny, but no recombinant haploid progeny was observed in the C. neoformans var. neoformans × C. gattii AFLP4 mating (Kwon-Chung and Varma, 2006). Although the above described studies indicate that mating may occur between different genotypic groups, no data is present on the fertility of the obtained progeny. Until the fertility of intergenotypic progeny has been investigated the number of species within the C. neoformans – C. gattii species complex can not be determined under the BSC. In conclusion, our data showed that six monophyletic lineages were consistently present within the C. neoformans – C. gattii species complex indicating that these monophyletic lineages should be described as separate taxa. However, studies on the fertility of intergenotypic progeny should be carried out to determine the taxonomic status of the monophyletic lineages.

Acknowledgements

Isolates were kindly donated by the following people: F Dromer, CA D’Souza, AI Hoepelman, JW Kronstad, KJ Kwon-Chung, MS Lazera, K Lengeler, A Litvintseva, W Meyer, L Spanjaard, D Swinne, JM Torres-Rodríguez and A van Belkum. We would like to thank E Groenewald for many valuable discussions and S Bakker, C Bayrakdar, V Robert and B Theelen for technical assistance. Work of M Bovers was supported by the “Odo van Vloten fonds” and the Netherlands-Florida Scholarship Foundation. F Hagen and EE Kuramae were funded by the Renewal Fund of the Royal Netherlands Academy of Arts and Sciences (RNAAS-KNAW).

bovers_V4.indd 54 25-10-2007 10:15:00 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

References

Aulakh JS, Straus SE and Kwon-Chung KJ (1981) Genetic relatedness of Filobasidiella neoformans (Cryptococcus neoformans) and Filobasidiella bacillispora (Cryptococcus bacillisporus) as determined by deoxyribonucleic acid base composition and sequence homology studies. Int. J. Syst. Bacteriol. 31: 97-103. Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman 2 J, Rivera ING and Paula CR (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J. Clin. Microbiol. 42: 1356-1359. Baum DA and Donoghue MJ (1995) Choosing among alternative phylogenetic species concepts. Syst. Bot. 20: 560-573. Biswas SK, Wang L, Yokoyama K and Nishimura K (2003) Molecular analysis of Cryptococcus neoformans mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 41: 5572-5576. Boekhout T, van Belkum A, Leenders ACAP, Verbrugh HA, Mukamurangwa P, Swinne D and Scheffers WA (1997) Molecular typing of Cryptococcus neoformans: taxonomic and epidemiological aspects. Int. J. Syst. Bacteriol. 47: 432-442. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WCJ, Abeln ECA, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891-907. Bolano A, Stinchi S, Preziosi R, Bistoni F, Allegrucci M, Baldelli F, Martini A and Cardinali G (2001) Rapid methods to extract DNA and RNA from Cryptococcus neoformans. FEMS Yeast Res. 1: 221- 224. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G and Boekhout T (2007) Promiscuous mating of Cryptococcus neoformans and Cryptococcus gattii: discovery of a novel AB hybrid. PhD Thesis: Chapter 5. Brandt ME, Bragg SL and Pinner RW (1993) Multilocus enzyme typing of Cryptococcus neoformans. J. Clin. Microbiol. 31: 2819-2823. Brandt ME, Hutwagner LC, Klug LA, Baughman WS, Rimland D, Graviss EA, Hamill RJ, Thomas C, Pappas PG, Reingold AL, Pinner RW and the cryptococcal disease active surveillance group (1996) Molecular subtype distribution of Cryptococcus neoformans in four areas of the United States. J. Clin. Microbiol. 34: 912-917. Butler MI and Poulter RTM (2005) The PRP8 inteins in Cryptococcus are a source of phylogenetic and epidemiological information. Fungal Genet. Biol. 42: 452-463. Campbell LT, Currie BJ, Krockenberger M, Malik R, Meyer W, Heitman J and Carter D (2005) Clonality and recombination in genetically differentiated subgroups of Cryptococcus gattii. Eukaryot. Cell 4: 1403-1409. Chaturvedi S, Ren P, Narasipura SD and Chaturvedi V (2005) Selection of optimal host strain for molecular pathogenesis studies on Cryptococcus gattii. Mycopathologia 160: 207-215. Chaturvedi V, Fan J, Stein B, Behr MJ, Samsonoff WA, Wickes BL and Chaturvedi S (2002) Molecular genetic analyses of mating pheromones reveal intervariety mating or hybridization in Cryptococcus neoformans. Infect. Immun. 70: 5225-5235. Chen F, Currie BP, Chen LC, Spitzer SG, Spitzer ED and Casadevall A (1995) Genetic Relatedness of Cryptococcus neoformans clinical isolates grouped with the repetitive DNA probe CNRE-1. J. Clin. Microbiol. 33: 2818-2822. Chen S, Sorrell T, Nimmo G, Speed B, Currie B, Ellis D, Marriott D, Pfeiffer T, Parr D, Byth K and the Australasian Cryptococcal Study Group (2000) Epidemiology and host-and variety-dependent characteristics of infection due to Cryptococcus neoformans in Australia and New Zealand. Clin. Infect. Dis. 31: 499-508.

bovers_V4.indd 55 25-10-2007 10:15:01 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Cogliati M, Allaria M, Liberi G, Tortorano AM and Viviani MA (2000) Sequence analysis and ploidy determination of Cryptococcus neoformans var. neoformans. J. Mycol. Med. 10: 171-176. Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5: 1129-1140. Diaz MR, Boekhout T, Theelen B and Fell JW (2000) Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. Diaz MR and Fell JW (2005) Use of a suspension array for rapid identification of the varieties and genotypes of the Cryptococcus neoformans species complex. J. Clin. Microbiol. 43: 3662-3672. Dromer F, Varma A, Ronin O, Mathoulin S and Dupont B (1994) Molecular typing of Cryptococcus neoformans serotype D clinical isolates. J. Clin. Microbiol. 32: 2364-2371. D’Souza CA, Hagen F, Boekhout T, Cox GM and Heitman J (2004) Investigation of the basis of virulence in serotype A strains of Cryptococcus neoformans from apparently immunocompetent individuals. Curr. Genet. 46: 92-102. Ellis D, Marriott D, Hajjeh RA, Warnock D, Meyer W and Barton R (2000) Epidemiology: surveillance of fungal infections. Med. Mycol. 38: 173-182. Evans EE (1950) The antigenic composition of Cryptococcus neoformans. I. A serologic classification by means of the capsular and agglutination reactions. J. Immunol. 64: 423-430. Fell JW, Boekhout T, Fonseca A, Scorzetti G and Statzell-Tallman A (2000) Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371. Fell JW, Statzell-Tallman A and Lutz MJ (1992) Partial rRNA sequences in marine yeasts: a model for identification of marine eukaryotes. Mol. Mar. Biol. Biotechnol.1: 175-186. Franzot SP, Hamdan JS, Currie BP and Casadevall A (1997) Molecular epidemiology of Cryptococcus neoformans in Brazil and the United States: Evidence for both local genetic differences and a global clonal population structure. J. Clin. Microbiol. 35: 2243-2251. Franzot SP, Salkin IR and Casadevall A (1999) Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, Diezmann S, Allen A, Stajich JE, Dietrich FS, Perfect JR and Heitman J (2005) Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360-1364. Gatti F and Eeckels R (1970) An atypical strain of Cryptococcus neoformans (Sanfelice) Vuillemin 1894. Part. 1. Description of the disease and of the strain. Ann. Soc. Belg. Med. Trop. 50: 6. Guého E, Improvisi L, Christen R and de Hoog GS (1993) Phylogenetic relationships of Cryptococcus neoformans and some related basidiomycetous yeasts determined from partial large subunit rRNA sequences. Antonie van Leeuwenhoek 63: 175-189. Halliday CL (2000) A molecular study of mating type and recombination in Cryptococcus neoformans var. gattii. PhD thesis. University of Sydney, Sydney, Australia. Hillis DM and Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol. 42: 182-192. Katsu M, Kidd S, Ando A, Moretti-Branch ML, Mikami Y, Nishimura K and Meyer W (2004) The internal transcribed spacers and 5.8S rRNA gene show extensive diversity among isolates of the Cryptococcus neoformans species complex. FEMS Yeast Res. 4: 377-388. Kidd SE, Guo H, Bartlett KH, Xu J and Kronstad JW (2005) Comparative gene genealogies indicate that two clonal lineages of Cryptococcus gattii in British Columbia resemble strains from other geographical areas. Eukaryot. Cell 4: 1629-1638.

bovers_V4.indd 56 25-10-2007 10:15:02 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, MacDougall L, Boekhout T, Kwon- Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263. Kwon-Chung KJ (1976) A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946. Kwon-Chung KJ, Bennett JE and Rhodes JC (1982) Taxonomic studies on Filobasidiella species and their anamorphs. Antonie van Leeuwenhoek 48: 25-38. 2 Kwon-Chung KJ, Boekhout T, Fell JW and Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804-806. Kwon-Chung KJ, Chang YC, Bauer R, Swann EC, Taylor JW and Goel R (1995) The characteristics that differentiate Filobasidiella depauperata from Filobasidiella neoformans. Stud. Mycol. 38: 67-79. Kwon-Chung KJ, Edman JC and Wickes BL (1992a) Genetic association of mating types and virulence in Cryptococcus neoformans. Infect. Immun. 60: 602-605. Kwon-Chung KJ and Varma A (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res. 6: 574-587. Kwon-Chung KJ, Wickes BL, Stockman L, Roberts GD, Ellis D and Howard DH (1992b) Virulence, serotype, and molecular characteristics of environmental strains of Cryptococcus neoformans var. gattii. Infect. Immun. 60: 1869-1874. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Latouche GN, Sorrell TC and Meyer W (2002) Isolation and characterisation of the phospholipase B gene of Cryptococcus neoformans var. gattii. FEMS Yeast Res. 2: 551-561. Lengeler KB, Cox GM and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122. Lengeler KB, Wang P, Cox GM, Perfect JR and Heitman J (2002) Identification of theMAT a mating- type locus of Cryptococcus neoformans reveals a serotype A MATa strain thought to have been extinct. Proc. Natl. Acad. Sci. USA 97: 14455-14460. Litvintseva AP, Kestenbaum L, Vilgalys R and Mitchell TG (2005) Comparative analysis of environmental and clinical populations of Cryptococcus neoformans. J. Clin. Microbiol. 43: 556- 564. Litvintseva AP, Marra RE, Nielsen K, Heitman J, Vilgalys R and Mitchell TG (2003) Evidence of sexual recombination among Cryptococcus neoformans serotype A isolates in sub-Saharan Africa. Eukaryot. Cell 2: 1162-1168. Litvintseva AP, Thakur R, Vilgalys R and Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172: 2223-2238. Liu YJ, Hodson MC and Hall BD (2006) Loss of the flagellum happened only once in the Fungal Lineage: Phylogenetic structure of Kingdom Fungi inferred for RNA polymerase II subunit genes. BMC Evol. Biol. 6: 74. Loftus BJ, Fung E, Roncaglia P, Rowley D, Amedeo P, Bruno D, Vamathevan J, Miranda M, Anderson IJ, Fraser JA, Allen JE, Bosdet IE, Brent MR, Chiu R, Doering TL, Donlin MJ, D’Souza CA, Fox DS, Grinberg V, Fu J, Fukushima M, Haas BJ, Huang JC, Janbon G, Jones SJ, Koo HL, Krzywinski MI, Kwon-Chung JK, Lengeler KB, Maiti R, Marra MA, Marra RE, Mathewson CA, Mitchell TG, Pertea M, Riggs FR, Salzberg SL, Schein JE, Shvartsbeyn A, Shin H, Shumway M, Specht CA, Suh BB, Tenney A, Utterback TR, Wickes BL, Wortman JR, Wye NH, Kronstad JW, Lodge JK, Heitman J, Davis RW, Fraser CM and Hyman RW (2005) The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans. Science 307: 1321-1324.

bovers_V4.indd 57 25-10-2007 10:15:03 Chapter 2: Multi-locus sequence typing of C. neoformans and C. gattii

Mayr E (1940) Speciation phenomena in birds. Am. Nat. 74: 249-278. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal study group (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195. Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, Viviani MA, Chindamporn A, Sukroongreung S, John MA, Ellis DH and Sorrell TC (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA - a pilot study to standardize techniques on which to base a detailed epidemiogical survey. Electrophoresis 20: 1790-1799. Mitchell DH, Sorrell TC, Allworth AM, Heath CH, McGregor AR, Papanaoum K, Richards MJ and Gottlieb T (1995) Cryptococcal disease of the CNS in immunocompetent hosts: influence of cryptococcal variety on clinical manifestations and outcome. Clin. Infect. Dis. 20: 611-616. Mitchell TG, White TJ and Taylor JW (1992) Comparison of 5.8S ribosomal DNA sequences among the basidiomycetous yeast genera Cystofilobasidium, Filobasidium and Filobasidiella. J. Med. Vet. Mycol. 30: 207-218. Perfect JR, Ketabchi N, Cox GM, Ingram CW and Beiser CL (1993) Karyotyping of Cryptococcus neoformans as an epidemiological tool. J. Clin. Microbiol. 31: 3305-3309. Petter R, Kang BS, Boekhout T, Davis BJ and Kwon-Chung KJ (2001) A survey of heterobasidiomycetous yeasts for the presence of the genes homologous to virulence factors of Filobasidiella neoformans, CNLAC1 and CAP59. Microbiology 147: 2029-2036. Rozenbaum R and Goncalves AR (1994) Clinical epidemiological study of 171 cases of cryptococcosis. Clin. Infect. Dis. 18: 369-380. Ruma P, Chen SC, Sorrell TC and Brownlee AG (1996) Characterization of Cryptococcus neoformans by random DNA amplification. Lett. Appl. Microbiol.23: 312-316. Scorzetti G, Fell JW, Fonseca A and Statzell-Tallman A (2002) Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495-517. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Swofford DL (2000) PAUP* 4.0: Phylogenetic Analysis Using Parsimony. Sinauer Associates, Sunderland, USA. Tanaka R, Nishimura K and Miyaji M (1999) Ploidy of serotype AD strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 40: 31-34. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS and Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol. 31: 21-32. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F and Higgins DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24: 4876-4882. White TJ, Bruns T, Lee S and Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications, p 315- 322. Edited by Innis MA, Gelfand DH, Sninsky JJ and White TJ. Academic Press, San Diego, USA. Wilson DE, Bennett JE and Bailey JW (1968) Serological grouping of Cryptococcus neoformans. Proc. Soc. Exp. Biol. Med. 127: 820-823. Xu J, Vilgalys R and Mitchell TG (2000) Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 9: 1471- 1481. Zolan ME (1995) Chromosome-length polymorphism in fungi. Microbiol. Rev. 59: 686-698.

bovers_V4.indd 58 25-10-2007 10:15:04 Chapter 3

The mitochondrial genome of

Cryptococcus gattii shows evidence

of recombination

M Bovers1, F Hagen1, EE Kuramae1,2 and T Boekhout1,3

bovers_V4.indd 59 25-10-2007 10:15:05 Chapter 3: Recombination within mitochondria of C. gattii

Summary

The primary pathogen Cryptococcus gattii is a basidiomycetous yeast that is closely related to the opportunistic pathogen Cryptococcus neoformans. Several molecular methods have distinguished four genotypic groups within C. gattii. However, the majority of these studies used regions of the nuclear genome. In our study, the large ribosomal subunit RNA (MtLrRNA) and the ATP synthase subunit 6 (ATP6) regions of the mitochondrial genome were sequenced to further investigate the genotypic structure of C. gattii. Three genotypic groups, namely AFLP5, AFLP6, and AFLP7, formed monophyletic lineages. However, the AFLP4 genotypic group contained five different mitochondrial genotypes that did not form a monophyletic lineage. Interestingly, the majority of studied AFLP4 isolates contained mitochondrial genomes (partially) identical to those found in isolates belonging to the AFLP6 genotypic group. This indicates that plasmogamy has occurred between AFLP4 and AFLP6 cells, possibly by mating. In addition, the discovery of mitochondrial genomes that possessed sequences partially identical to those found in AFLP4 isolates and partially identical to those found in AFLP6 isolates indicates that recombination between mitochondria of different genotypic groups occurred in nature. Recombination of mitochondria may have an impact on fitness as mitochondria play an important role in energy production and stress responses.

bovers_V4.indd 60 25-10-2007 10:15:06 Chapter 3: Recombination within mitochondria of C. gattii

Introduction

Cryptococcus gattii is a pathogenic basidiomycetous yeast that is closely related to Cryptococcus neoformans and has previously been described as a variety of C. neoformans (Kwon-Chung et al., 1982). Recently, however, C. gattii has been described as a distinct species because of differences in ecology, epidemiology, biochemical and molecular characteristics (Kwon-Chung et al., 2002; Kwon-Chung and Varma, 2006). Both C. gattii and C. neoformans may cause meningoencephalitis, but the primary pathogen C. gattii can cause disease in otherwise healthy individuals, whereas the opportunist C. neoformans primarily infects immunocompromised patients (Rozenbaum and 3 Goncalves, 1994; Speed and Dunt, 1995; Mitchell et al., 1995; Chen et al., 2000). Cryptococcus gattii has been found on several tree species since its first isolation from Eucalyptus camaldulensis (Ellis and Pfeiffer, 1990; Callejas et al., 1998; Lazéra et al., 1998; Lazéra et al., 2000; Fortes et al., 2001; Krockenberger et al., 2002; Fraser et al., 2003; Randhawa et al., 2003; Granados and Castañeda, 2005; Escandón et al., 2006; Kidd et al., 2007), suggesting that trees might be the primary ecological niche of C. gattii. Recently, Kidd et al. (2007) have, however, suggested that soil may in fact be the principal reservoir for C. gattii. Cryptococcus gattii occurs predominantly in (sub)tropical areas (Kwon-Chung and Bennett, 1984), but has also been isolated in Europe (Montagna et al., 1997; Baró et al., 1998; Velegraki et al., 2001; Colom et al., 2005) and in a temperate climate zone in Colombia (Escandón et al., 2006). Furthermore, C. gattii is responsible for the ongoing outbreak of cryptococcosis on Vancouver Island, Canada (Stephen et al., 2002; Hoang et al., 2004; Kidd et al., 2004). These reports indicate that C. gattii may also occur in more temperate climate zones. Several molecular methods have identified four major genotypic groups within C. gattii (Ruma et al., 1996; Ellis et al., 2000; Chaturvedi et al., 2002; Biswas et al., 2003; Latouche et al., 2003; Meyer et al., 2003; Butler and Poulter, 2005; Diaz et al., 2005; Fraser et al., 2005; Kidd et al., 2005; Bovers et al., 2007a). An overview of these genotypic groups is given in Table 1. The majority of these studies used nuclear regions to study the genotypic structure of C. gattii. However, the relationship between organisms is most reliably established when different sets of data are used. Mitochondrial regions are useful genetic markers because mitochondria evolve independently from the nuclear genome and thus provide an additional, independent data set. In C. neoformans mitochondria are usually uniparentally inherited, although mitochondrial leakage may occur occasionally (Xu et al., 2000; Yan and Xu, 2003, Toffaletti et al., 2004; Yan et al., 2004; Yan et al., 2007a; Yan et al., 2007b). In our study, the partial nucleotide composition of two mitochondrial regions, namely large ribosomal subunit RNA (MtLrRNA) and ATP synthase subunit 6 (ATP6), was investigated for fifty-one isolates representing all C. gattii genotypic groups. The obtained sequences

bovers_V4.indd 61 25-10-2007 10:15:07 Chapter 3: Recombination within mitochondria of C. gattii

were used for phylogenetic analyses and the resulting genealogies were compared to the genealogy obtained by analyses of six nuclear regions (Bovers et al., 2007a). Surprisingly, analysis of mitochondrial regions showed that the majority of studied AFLP4 isolates possessed a mitochondrial genome that contained some sequences identical to those found in AFLP6 isolates. These results indicate that plasmogamy has occurred between AFLP4 and AFLP6 cells. In addition, our data shows that recombination between mitochondria belonging to different genotypic groups occurs in nature.

Table 1. Overview of Cryptococcus gattii genotypes as identified by several molecular methods.

Species Serotype 1 AFLP genotype 2, 3, 4 Molecular genotype 1, 5 IGS genotype 6 ITS genotype 7 Intein genotype 8 C. gattii B/(C)* 4A/4B VGI 4a/4b/4c 3/7 ig-I C. gattii B/C 5A/5B/5C VGIII 5 5 ig-III C. gattii B/(C)* 6 VGII 3 4 ig-II C. gattii B/C 7 VGIV 6 6 ig-IV

1 Meyer et al. (2003); 2 Barreto de Oliveira et al. (2004); 3 Boekhout et al. (2001); 4 Kidd et al. (2004), 5 Litvintseva et al. (2006); 6 Diaz et al. (2005); 7 Katsu et al. (2004); 8 Butler and Poulter (2005); * Isolates of the serotypes indicated between brackets were not included in our study.

Materials and methods

Isolates

Fifty-one haploid C. gattii isolates of clinical (59%), veterinary (8%), environmental (24%), laboratory (6%) and unknown (3%) origin were analyzed for their nucleotide composition. Isolates of all C. gattii genotypic groups were included. Cryptococcus neoformans isolates (125.91, H99, WM714, CBS6886 and JEC20) were used as outgroup in phylogenetic analyses, as C. neoformans is the species that is most closely related to C. gattii (Kwon-Chung et al., 1982; Kwon-Chung et al., 2002). The origin, serotype and genotype of all isolates is presented in Table 2.

Cultivation, DNA extraction, PCR reaction and sequencing

mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, pH 8.3), 0.2 mM dNTPs, 0.6 μM of primer, 1.0 U Taq DNA polymerase (Gentaur) and 1-2 μl genomic DNA.

bovers_V4.indd 62 25-10-2007 10:15:09 Chapter 3: Recombination within mitochondria of C. gattii * * ATP6 EF544778 EF544779 EF544780 EF544781 EF544782 EF544783 EF544784 EF544785 EF544786 EF544787 EF544788 EF544789 EF544790 EF544791 EF544792 EF544793 EF102038 EF102039 * * haplotypes are haplotypes MtLrRNA EF544832 EF544833 EF544834 EF544835 EF544836 EF544837 EF544838 EF544839 EF544840 EF544841 EF544842 EF544843 EF544844 EF544845 EF544846 EF544847 EF102067 EF102068 ATP6 ATP6 (1970) Halliday (2000) Gatti and Eeckels Diaz et al. (2000) Diaz et al. (2000) Katsu et al. (2004) Reference / Source Meyer et al. (2003) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (2001) Boekhout et al. (2001) 3

var. isolates. MtLrRNA and MtLrRNA isolates. Torulopsis Torulopsis shanghaiensis , USA Cryptococcus gattii, , USA var. var. hollow, Balranald, hollow, Cryptococcus gattii Cryptococcus gattii China of of sheppei

Cryptococcus hondurianus var. var. Cryptococcus neoformans China Origin Honduras Man, USA (RV 20186) (RV 20186) Congo (Zaire) C. neoformans Human, Thailand Man, Congo (Zaire) Gut of a goat, Spain shanghaiensis, tree #19 hollow 4, Renmark Australia Lung of a goat, Spain South Australia, Australia Eucalyptus citriodora Man, Tumour, Lille, France Man, Tumour, Cryptococcusneoformans Human, Papua New Guinea neoformans Eucalyptus camaldulensis molecular type VGI, Sydney, Australia molecular type VGI, Sydney, and Subculture of type strain Subculture of type strain Immunocompetent human, reference strain of Infected skin, syntype Air in Second isolate of Meningitis, type strain Meningoencephalitic lesion, type strain of Cerebrospinal fluid, type strain of E. camaldulensis

4 1 4 2 2 3 4 4 3 4 1 2 4 2 4 1 1 2 ATP6 haplotype Cryptococcusgattii 2 2 2 4 4 2 2 2 2 2 2 4 2 1 2 2 2 1 MtLrRNA haplotype 5 nd nd nd nd nd nd nd nd nd nd nd nd nd nd VGI VGI VGI VGI type Molecular 2,4 4 4 4 4 4 4B 4B 4B 4B 4B 4B 4B 4B 4A 4A 4A 4A 4A AFLP genotype 1 4 4 4 4 4 4 4 4 4 4 4 4 4A 4A 4A 4A 4A 4A Nuclear genotype B B B B B B B B B B B B B B B B B B Serotype isolates and GenBank accession numbers are given for all sequenced regions. (T) C. gattii AFLP genotype, molecular type, serotype and origin of origin and serotype type, molecular genotype, AFLP (T) AFLP4=VGI (R) (T) (T) Table 2. Table indicated for Isolate 48A 503 2738 (=WM1251) 56A CBS883 CBS919 CBS1622 CBS6289 (=CBS8273 =RV20186 =NIHB-3939) CBS6290 CBS6992 (=NIH 17) CBS6998 (=NIH 365) CBS7229 CBS7748 (=IFM50902) CBS8273 (=CBS6289 =RV20186 =NIH B-3939) E566 RV20186 (=CBS6289 =CBS8273 =NIH B-3939) RV54130 WM176 WM179 C. gattii

bovers_V4.indd 63 25-10-2007 10:15:12 Chapter 3: Recombination within mitochondria of C. gattii EF544794 EF544795 EF544796 EF544797 EF544798 EF544799 EF544800 EF544801 EF544802 EF544803 EF544804 EF544805 EF544806 EF544807 EF544808 EF544809 EF544810 EF544811 EF544812 EF544813 EF544814 EF544815 EF544816 EF544848 EF544849 EF544850 EF544851 EF544852 EF544853 EF544854 EF544855 EF544856 EF544857 EF544858 EF544859 EF544860 EF544861 EF544862 EF544863 EF544864 EF544865 EF544866 EF544867 EF544868 EF544869 EF544870 Kidd et al. (2005) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Katsu et al. (2004) Katsu et al. (2004) Meyer et al. (2003) Boekhout et al. (2001) Boekhout et al. (2001) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (1997) Boekhout et al. (2001) Boekhout et al. (2001) Boekhout et al. (2001) Boekhout et al. (1997) Boekhout et al. (1997) , , San Diego, USA Cryptococcus bacillisporus USA wood from hollow, reference wood from hollow, Man Canada Australia Unknown Unknown , Mt. Annan, New South Wales, , Mt. Annan, New South Wales, Patient, USA Island, Canada Island, Canada Island, Canada California, USA Sick goat, Aruba Human, California, USA Human, Auckland, New Zealand sp. debris from car park of zoo, San Diego, Detritus of almond tree, Colombia Eucalyptus citriodora Immunocompetent human, Seattle, USA Immunocompetent male, Victoria, Canada Immunocompetent male, Victoria, Immunocompetent female, Victoria, Canada Immunocompetent female, Victoria, Canada Immunocompetent female, Victoria, strain of molecular type VGIII, San Diego, USA Human, type strain of Immunocompetent, Human, Papua New Guinea Immunocompetent female, Nanaimo, Vancouver Immunocompetent female, Nanaimo, Vancouver Immunocompetent male, lung, Kelowna, Canada Immunocompetent male, Nanoose Bay, Vancouver Vancouver Immunocompetent male, Nanoose Bay, Eucalyptus tereticornis Immunocompetent male, Duncan, Vancouver Island, Immunocompetent male, Duncan, Vancouver Dead wild Dall’s porpoise lymph node, Shores of Gulf Dead wild Dall’s Eucalyptus Eucalyptus camaldulensis 1 1 5 8 5 7 5 8 5 6 5 5 5 2 2 2 2 2 2 2 2 2 2 2 2 5 5 5 5 5 5 5 5 5 5 5 1 1 1 1 1 1 1 1 1 1 nd nd nd nd nd nd nd nd VGI VGI VGII VGII VGII VGII VGII VGII VGII VGII VGII VGIII VGIII VGIII VGIII 4 4 5 6 6 6 6 6 6 6 6 6 6 5B 5B 5B 5A 5C 5C 5C 5C 5C 5C 4 4 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 5B 5B 5B B B B B B B B B B B B B B B B B B C C C C C C (=NIH 191) (T) (R) AFLP5=VGIII AFLP6=VGII WM276 (=CBS10510) WM830 380C 384C CBS5758 CBS6955 CBS6993 (=NIH 18) CBS6996 CBS8755 (=HOO58-I-682) CN043 WM161 WM726 WM728 A1M F2866 A1M F2932 A1M R265 (=CBS10514) A1M R269 A1M R271 A1M R368 A1M R406 A1M R409 CBS1930 CBS6956 (=NIH 444 =ATCC32609) C. gattii C. gattii

bovers_V4.indd 64 25-10-2007 10:15:16 Chapter 3: Recombination within mitochondria of C. gattii EF544817 EF544818 EF544819 EF544820 EF544821 EF544822 EF544823 EF544824 EF544825 EF544826 EF544773 EF544774 EF544775 EF544776 EF544777 Litvintseva et al. EF544871 EF544872 EF544873 EF544874 EF544875 EF544876 EF544877 EF544878 EF544879 EF544880 EF544827 EF544828 EF544829 EF544830 EF544831 6 (1992) al. (2004) Katsu et al. (2004) Katsu et al. (2004) Katsu et al. (2004) Kwon-Chung et al. Meyer et al. (2003) Meyer et al. (2003) Diaz and Fell (2005) Franzot et al. (1999) Baretto de Oliveira et Lengeler et al. (2002) Latouche et al. (2002) Boekhout et al. (1997) Boekhout et al. (2001) Boekhout et al. (2001) Boekhout et al. (1997) 3 Meyer et al. (2003); 5 , New York, USA , New York, grubii , Arnhemland, Northern bark debris, San Francisco, var. var. USA type Territory, Australia Territory, Dropping of pigeon Human, Punjab, India Nest of wasp, Uruguay Cat paranasal, Australia Hollow trees, Piauí, Brazil HIV positive patient, India Johannesburg, South Africa Human, Rio de Janeiro, Brazil F. Hagen (unpublished F. data); Clinical, Johannesburg, South Africa 4 molecular type VGII, Sydney, Australia molecular type VGII, Sydney, Cryptococcal meningitis patient, Tanzania Patient with Hodgkin’s disease, type strain of Patient with Hodgkin’s Eucalyptus camaldulensis Cheetah, reference strain of molecular type VGIV, Cheetah, reference strain of molecular type VGIV, Cryptococcus neoformans Eucalyptus camaldulensis Congenic pair with JEC21 that differs only in mating Immunocompetent human, lung, reference strain of (2004);

2 2 2 2 2 2 9 9 9 9 1 1 1 1 1 1 3 3 2 2 nd nd nd nd nd nd nd VNI VGII VGII VGII VGII VGIV VGIV VGIV Barreto de Oliveira et al. 3 reference strain; nd = not determined. (R) 6 6 6 6 6 6 7 7 7 7 1 1 2 2 1B (2001);

6 6 6 6 6 6 7 7 7 7 1 1 2 2 1B type strain; (T) B B B B B B B A A A C C C D D Boekhout et al. 2 (R) (R) grubii neoformans var. var. var. (T) Bovers et al. (2007b); * AFLP7=VGIV Bovers et al. (2007a); CBS7750 CBS8684 HEC11102 ICB184 (=MTPI2) RAM2 WM178 (=IFM50894) B-5742 B5748 M27055 WM779 (=IFM50896) 125.91 (=CBS10512) H99 (=CBS8710 =CBS10515) WM714 CBS6886 (=NIH 430) JEC20 (=CBS10511 =NIH- B4476) 1 (2006); C. gattii C. neoformans C. neoformans

bovers_V4.indd 65 25-10-2007 10:15:17 Chapter 3: Recombination within mitochondria of C. gattii

Amplification of large ribosomal subunit RNA (MtLrRNA) was carried out using primers MtLrRNA-F (5’ GACCCTATGCAGCTTCTACTG 3’) and MtLrRNA-R (5’ TTATCCCTAGCGTAACTTTTATC 3’) (White et al., 1990). Amplification conditions were 94 ºC for 3 min, followed by 35 cycli of 94 ºC for 1 min, 50 ºC for 1 min and 72 ºC for 1 min, with a final extension step of 72 ºC for 7 min. ATP synthase subunit 6 (ATP6) was amplified using primers ATP6-F (5’ ATTACATCTCCACTAGAACAATTC 3’) and ATP6-R (5’ AGTTCAATGGCATCCTTGATATAG 3’). Amplification conditions were 94 ºC for 5 min, followed by 35 cycli of 94 ºC for 1 min, 54 ºC for 1 min and 72 ºC for 2 min, with a final extension step of 72 ºC for 7 min. Amplicons were purified with the GFXTM PCR DNA and Gel Band Purification Kit (Amersham Biosciences) and used for sequencing. Sequencing reactions were performed with the BigDye v3.1 Chemistry kit (Applied Biosystems) using primers that had been used in the initial PCR reactions. Sequencing reactions were purified with Sephadex G-50 Superfine columns (Amersham Biosciences) and a MultiScreen HV plate (Millipore). An ABI 3700XL DNA analyzer (Applied Biosystems) was used to determine the sequences. GenBank accession numbers are listed in Table 2.

Alignment and phylogenetic analyses

SeqMan 5.03 (DNASTAR) was used to assemble consensus sequences and these were checked manually. Sequences were aligned using ClustalX version 1.81 (Thompson et al., 1997) and visually corrected using GeneDoc version 2.5.000 (www. nrbsc.org/downloads/). Neighbor-Joining (NJ) and Maximum Parsimony (MP) phylogenetic analyses were performed using PAUP* (Phylogenetic Analysis Using Parsimony) version 4.0b10 (Swofford, 2000). NJ analyses were carried out with the uncorrected (“p”), Jukes-Cantor, Kimura 2-parameter and HKY85 substitution models. Any ties that were encountered were broken randomly. Bootstrap analysis (Hillis and Bull, 1993) with a thousand replicates was used to determine the significance of branches. MP analyses were carried out (heuristic search, stepwise addition, random taxon addition, thousand maximum trees) with tree bisection and reconstruction (TBR) as the branch-swapping algorithm. All characters were unordered and of equal weight, gaps were treated both as missing and as a new character state. Bootstrap analysis (Hillis and Bull, 1993) was performed with a thousand replicates.

bovers_V4.indd 66 25-10-2007 10:15:18 Chapter 3: Recombination within mitochondria of C. gattii

Results

MtLrRNA

Analysis of partial MtLrRNA sequences resulted in the identification of five C. gattii haplotypes. The alignment of the five haplotypes is shown in Figure 1. Four polymorphic nucleotides, which are indicated between brackets, were present among 299 analyzed nucleotides. Haplotype 1 (CTAG) was present in all AFLP6 isolates and in AFLP4 isolates WM179 and E566; haplotype 2 (CTAC) was present in most of the AFLP4 isolates and in AFLP7 isolates M27055 and WM779; haplotype 3 (CTTC) was 3 present in AFLP7 isolates B5742 and B5748; haplotype 4 (CGAC) was present in AFLP4 isolates CBS883, CBS919 and CBS7748; and haplotype 5 (GTAA) was present in all AFLP5 isolates. An overview of the MtLrRNA haplotype of all isolates is given in Table 2. NJ and MP analyses indicated that haplotype 1 was basal to the other

Fig. 1. Alignment of Cryptococcus gattii partial MtLrRNA sequences.

haplotypes. NJ analyses showed that the cluster consisting of haplotypes 2, 3 and 4 formed a sister group to haplotype 5 with bootstrap values ranging from 61 to 66%. However, this topology was not supported by MP analyses. In addition, the cluster consisting of haplotypes 2, 3 and 4 was supported by bootstrap values ranging from 61 to 66% in NJ analyses, but it was not supported by MP analyses. Haplotype 3 formed a separate cluster, which was supported by NJ and MP analyses with bootstrap values of 60 to 65%. In addition, a separate haplotype 4 cluster was supported by NJ and MP analyses with bootstrap values ranging from 61 to 64%. Furthermore, the cluster formed by haplotype 5 was strongly supported by NJ and MP analyses with bootstrap values ranging from 80 to 86%. The topology obtained by MP MtLrRNA analysis is depicted in Figure 2b.

bovers_V4.indd 67 25-10-2007 10:15:18 Chapter 3: Recombination within mitochondria of C. gattii

ATP6

Analysis of partial ATP6 sequences showed that among 611 analyzed nucleotides 34 nucleotides were polymorphic within C. gattii. Nine haplotypes could be identified. Haplotype 1 was present in AFLP4 isolates 503 2738, CBS7229, RV54130, WM176, WM276 and WM830. All AFLP6 isolates and AFLP4 isolates WM179, E566, CBS883, CBS919 and CBS7748 possessed haplotype 2. Haplotype 3 was identified in AFLP4 isolates CBS1622 and CBS6992. Haplotype 4 was found in AFLP4 isolates 48A, 56A, CBS6289, CBS6290, CBS6998, CBS8273 and RV20186. AFLP5 isolates 380C, CBS5758, CBS6993, CBS8755, WM161, WM726 and WM728 possessed haplotype 5, whereas haplotype 6 was present in AFLP5 isolate CN043. Haplotype 7 was found in AFLP5 isolate CBS6955 and haplotype 8 was present in AFLP5 isolates 384C and CBS6996. All AFLP7 isolates possessed haplotype 9. The ATP6 haplotype of each isolate is indicated in Table 2 and the alignment of the partial ATP6 sequences is given in Figure 3. NJ and MP analyses showed a division of C. gattii into two clades. One clade consisted of haplotypes 1, 2 and 3, and was strongly supported by bootstrap values ranging from 84 to 91% for NJ and MP analyses. The other clade contained haplotypes 4, 5, 6, 7, 8, and 9, and was strongly supported by bootstrap values ranging from 93 to 99% for NJ and MP analyses. Haplotype 1 formed a separate cluster supported by bootstrap values ranging from 94 to 99% for NJ and from 75 to 76% for MP analyses. The cluster consisting of haplotypes 2 and 3 was strongly supported by bootstrap values ranging from 95 to 100% for NJ and MP analyses. Haplotype 3 formed a separate cluster which was supported by bootstrap values ranging from 61 to 65% for NJ and MP analyses. A separate haplotype 2 cluster was weakly supported by NJ analyses with bootstrap values ranging from 54 to 64%, but it was not supported by MP analyses. Haplotype 4 formed a separate cluster strongly supported by bootstrap values ranging from 97 to 99% for NJ and from 74 to 75% for MP analyses. Haplotypes 5, 6, 7 and 8 formed one cluster strongly supported by bootstrap values ranging from 92 to 94% for NJ and MP analyses. Haplotype 5 formed a separate cluster in NJ analyses, supported by bootstrap values ranging from 87 to 97%, but such a cluster was not supported by MP analyses. Haplotypes 6, 7 and 8 formed one cluster strongly supported by bootstrap values ranging from 93 to 95% for NJ and from 82 to 83% for MP analyses. A separate haplotype 8 cluster was strongly supported by bootstrap values ranging from 98 to 99% for NJ and MP analyses. Haplotypes 6 and 7 formed one cluster supported by bootstrap values of 94% for NJ analyses, but this cluster was not supported in MP analyses. Haplotype 9 formed a separate cluster strongly supported by bootstrap values ranging from 97 to 100%. The topology obtained by MP ATP6 analysis is shown in Figure 2a.

bovers_V4.indd 68 25-10-2007 10:15:19 Chapter 3: Recombination within mitochondria of C. gattii isolates sequences. ATP6 ATP6 Phylogenetic tree of tree Phylogenetic Fig. 2. Fig. Cryptococcus gattii obtained by analysis of a) partial Presented is one of four most parsimonious trees (length 83; index consistency 0.819; index retention missing 0.974) as treated gaps computed with data. Data 64 consisted which of characters 611 of parsimony were characters informative; b) sequences. partial is MtLrRNA one Presented (length trees parsimonious of three 15; most consistency 1.000; index retention 1.000) index computed gaps with treated as data. missing Data 13 consisted which of characters 299 of parsimony were characters informative. Bootstrap values replicates) (1000 are indicated for the main h: haplotype branches. number; M: mitochondrial genotype.

b 3 0 10 0 6 0 9 9 8 6 9 1 6 84 93 95 75 E566 MtLrRNA RAM2 ICB184 WM17 WM178 CBS1 CBS6 CBS7 CBS86 ) A1MR265 A1MR26 A1MR36 A1MR40 A1MR40 A1MR27 HEC11102 A1MF286 A1MF2932 6 8 6 2 9 0 0 3 6 A A 22 62 98 89 99 22 29 27 56 48 63 (M5-h1 (M5-h1) WM779 WM830 WM27 WM17 M27055 503273 1 RV5413 CBS6 CBS7 CBS16 CBS6 CBS8 81 CBS69 CBS62 RV2018 0. 6 8 0 8 83 19 88 74 C2 JE B574 B5742 (M3-h2) (M3-h2) (M2-h2) (M2-h2) (M2-h2) (M2-h2) (M2-h2) (M2-h2) CBS8 CBS9 (M1-h2) (M1-h2) (M1-h2) (M1-h2) (M1-h2) (M1-h2) (M1-h2) CBS6 CBS7 9 3 8 5 3 5 6 75 95 99 75 99 H9 380C 384C 125.91 CN04 (M4-h4) (M4-h4) (M4-h4) WM161 WM728 WM726 CBS5 CBS6 CBS6 CBS8 CBS6 4 I I WM71 6 s 99 h4;MtLrRNA h2 h2;MtLrRNA h1 h9;MtLrRNA h2,3 h5-8;MtLrRNA h5 h5-8;MtLrRNA h1-3;MtLrRNA h1,2,4 h1-3;MtLrRNA 5 AFLP4 / VG / AFLP4 AFLP4 / VGI VGI / AFLP4 384C CBS6 AFLP6 / VGII / AFLP6 ATP6 AFLP7 / VGIV / AFLP7 AFLP5 / VGII / AFLP5 95 ATP6 ATP6 3 ATP6 ATP6 ATP6 98 CBS6 3 8 5 6 CN04 99 75 75 82 CBS6 WM161 WM728 380C CBS5 CBS8 WM72 ) (M1-h4) (M1-h4) (M1-h4) (M1-h4) (M1-h4) (M1-h4) (M1-h4) ) 8 0 3 9 6 Cryptococcus neoforman (M3-h3) (M3-h3) 99 29 27 28 9 1 (M4-h2 (M4-h2) (M4-h2) 94 6 2 2 A A (M5-h2 (M5-h2) 6 9 5 9 1 0 8 0 6 4 62 99 9 CBS6 56 CBS8 48 CBS6 RV2018 CBS6 93 75 74 95 68 83 19 B5748 M27055 WM77 B5742 (M2-h1) (M2-h1) (M2-h1) (M2-h1) (M2-h1) (M2-h1) 9 0 74 8 CBS1 CBS6 22 97 A1MR40 A1MR40 CBS7 CBS7 A1MR26 A1M368 CBS1 HEC11102 A1MF286 WM17 E566 RAM2 ICB184 CBS6 CBS8 A1MF2932 A1MR26 CBS8 WM178 A1MR27 CBS9 65 503273 CBS7 RV5413 WM830 WM714 WM176 WM276 95 125.91 H99 6 93 75 88 0 84 C2 CBS6 JE ATP6 0 10 a

bovers_V4.indd 69 25-10-2007 10:15:23 Chapter 3: Recombination within mitochondria of C. gattii

Fig. 3. Alignment of Cryptococcus gattii partial ATP6 sequences.

Combined analysis of mitochondrial data

All AFLP6 isolates contained MtLrRNA haplotype 1 and ATP6 haplotype 2, whereas AFLP7 isolates possessed MtLrRNA haplotype 2 or 3 and ATP6 haplotype 9. MtLrRNA haplotype 3 differed only one nucleotide from MtLrRNA haplotype 2 from which it probably originated. The AFLP5 isolates contained MtLrRNA haplotype 5 and ATP6 haplotypes 5, 6, 7 or 8. As expected, the ATP6 haplotypes that were present in AFLP5 isolates formed one cluster. AFLP4 isolates possessed MtLrRNA haplotype 1, 2 or 3 and ATP6 haplotype 1, 2, 3 or 4. Surprisingly, these haplotypes did not cluster together. The AFLP4 isolates could be divided into five mitochondrial genotypes (M1 to M5). Genotype AFLP4-M1 (MtLrRNA haplotype 2 and ATP6 haplotype 4), which corresponds to the previously described genotypic subgroup AFLP4A (Boekhout et al., 2001), consisted of isolates 48A, 56A, CBS6289, CBS6290, CBS6998, CBS8273 and RV20186. This genotype formed a clade with AFLP5 and AFLP7 isolates in both ATP6

bovers_V4.indd 70 25-10-2007 10:15:24 Chapter 3: Recombination within mitochondria of C. gattii

ATP6 nuclear B5748 97 M27055 M27055 100 B5742 AFLP7 / VGIV WM779R WM779R B5748 60 B5742 CBS6290 CBS6998 56A CBS8273 CBS1622/CBS6992 100 75 48A CBS6290 CBS6289 48A/56A 81 CBS8273/RV20186T CBS6998 64 95 RV20186T AFLP4 / VGI CBS6289 WM830 CBS6993 WM276 WM161R WM176 WM728 CBS883T 91 CBS5758 5032738 CBS8755 CBS7748 94 WM726 E566 380C T 3 T CBS7229 /RV54130 CBS6955 T CN043 CBS919 100 R CBS6996 WM179 100 384C AFLP5 / VGIII 384C CBS6996 CBS1930 CBS8755 CBS6956 380C/CBS5758/CBS6993 CBS8684 T 100 WM178R CBS6955 A1MR409 CN043 HEC11102 WM161R A1MF2866 WM726/WM728 100 A1MF2932 CBS1930 A1MR269 WM178R A1MR271 ICB184 CBS7750 AFLP6 / VGII 100 A1MR368 CBS8684 A1MR406 RAM2 A1MR265 HEC11102 ICB184 CBS6956/CBS7750/A1MF2866/A1MF2932/A1MR265/ a 1 RAM2 A1MR269/A1MR271/A1MR368/A1MR406/A1MR409 10 b

Fig. 4. Phylogenetic tree of Cryptococcus gattii isolates obtained by analysis of a) partial ATP6 sequences. Cryptococcus gattii AFLP4 isolates that possessed mitochondrial sequences identical to sequences found in AFLP6 isolates were excluded. Presented is the most parsimonious tree (length 79; consistency index 0.861; retention index 0.978) computed with gaps treated as missing data. Data consisted of 611 characters of which 64 characters were parsimony informative; b) of six concatenated nuclear regions (RPB1, RPB2, CNLAC1, TEF1α, IGS1 and ITS). Presented is one of sixty most parsimonious trees (length 847; consistency index 0.902; retention index 0.961) computed with gaps treated as missing data. Data consisted of 3932 characters of which 459 characters were parsimony informative. Bootstrap values (1000 replicates) are indicated for the main branches. T: type strain. R: molecular type reference strain (Meyer et al., 2003).

and MtLrRNA analyses (Figure 2) similar to the topology obtained by analyses of six concatenated nuclear regions (Bovers et al., 2007a; Figure 4). Genotype AFLP4-M1 thus appears to be the core AFLP4 genotype. Genotype AFLP4-M2 (MtLrRNA haplotype 2 and ATP6 haplotype 1) consisted of isolates 503 2738, CBS7229, RV54130, WM176, WM276 and WM830 and possessed the core AFLP4 MtLrRNA sequence. Interestingly, the ATP6 sequence of this genotype was a chimeric sequence. This sequence was partially identical to the sequence found in AFLP6 isolates and partially identical to the sequence of core AFLP4 isolates (Figure 5). Genotype AFLP4-M3 (MtLrRNA haplotype 2 and ATP6 haplotype 3) consisted of isolates CBS1622 and CBS6992 and

bovers_V4.indd 71 25-10-2007 10:15:27 Chapter 3: Recombination within mitochondria of C. gattii

possessed the core AFLP4 MtLrRNA sequence and an ATP6 sequence which differed one nucleotide from the ATP6 sequence found in AFLP6 isolates. Genotype AFLP4-M4 (MtLrRNA haplotype 4 and ATP6 haplotype 2) consisted of isolates CBS883, CBS919 and CBS7748 and possessed an MtLrRNA sequence which differed one nucleotide from the core AFLP4 MtLrRNA sequence and an ATP6 sequence identical to that of AFLP6 isolates. Genotype AFLP4-M5 (MtLrRNA haplotype 1 and ATP6 haplotype 2) consisted of isolates E566 and WM179 and possessed MtLrRNA and ATP6 sequences identical to those found in AFLP6 isolates. To summarize, the mitochondrial genome of most AFLP4 isolates contained sequences that were (partially) identical to those found in AFLP6 isolates. The mitochondrial genotype of all AFLP4 isolates and the topology of the AFLP4 clade as it was derived by analysis of six concatenated nuclear regions (Bovers et al., 2007a) are shown in Figure 6. Analyses of partial ATP6 sequences were also carried out without the presence of AFLP4 isolates that contained sequences (partially) identical to those found in AFLP6 isolates. These AFLP4 isolates were excluded because their presence might obscure the genotypic structure of C. gattii. The obtained topology, depicted in Figure 4, showed that the core AFLP4 isolates formed a sister group to the AFLP7 isolates. This cluster was poorly supported with bootstrap values ranging from 53 to 57% for NJ and from 50 to 60% for MP analyses. The core AFLP4/AFLP7 cluster formed a sister group to the AFLP5 isolates, and this AFLP4/AFLP7/AFLP5 clade was strongly supported with bootstrap values ranging from 98 to 99% for NJ and from 94 to 95% for MP analyses. The AFLP6 isolates clustered basal to the other C. gattii genotypic groups in ATP6 analyses. The basal position of AFLP6 isolates was also observed in MtLrRNA analyses.

Discussion

Phylogenetic analyses of partial MtLrRNA sequences showed that AFLP6 isolates clustered basal to all other C. gattii genotypic groups. The same topology was found when partial ATP6 sequences of core AFLP4, AFLP5, AFLP6 and AFLP7 isolates were analyzed. These results correspond to the topology that had been found by analyses of six concatenated nuclear regions (Bovers et al., 2007a; Figure 4). Cryptococcus gattii AFLP5 appears to be the most derived genotypic group in both MtLrRNA and ATP6 analyses. Surprisingly, two AFLP4 isolates (AFLP4-M5) were found that possessed MtLrRNA and ATP6 sequences identical to those found in AFLP6 isolates. In addition, three AFLP4 isolates (AFLP4-M4) possessed a MtLrRNA sequence that differed one nucleotide from the core AFLP4 sequence, but the ATP6 sequence was identical to

bovers_V4.indd 72 25-10-2007 10:15:28 Chapter 3: Recombination within mitochondria of C. gattii

Fig. 5. Alignment of Cryptococcus gattii partial ATP6 sequences for haplotypes 1, 2 and 4. Haplotype 2 is the haplotype present in all AFLP6 isolates, whereas haplotype 4 is found in core AFLP4 isolates. Interestingly, haplotype 1, which is found in AFLP4 isolates of cluster AFLP4-M2, appears to be a chimera between haplotypes 2 and 4.

the sequence found in all AFLP6 isolates. Furthermore, two AFLP4 isolates (AFLP4- M3) possessed the core AFLP4 MtLrRNA sequence, whereas the ATP6 sequence differed one nucleotide from the sequence found in AFLP6 isolates. In addition, six AFLP4 isolates (AFLP4-M2) possessed core AFLP4 MtLrRNA sequence, but the ATP6 sequence appeared to be a chimera between core AFLP4 and AFLP6 sequences. Our results show that besides core AFLP4 isolates, which are AFLP4 in both the nuclear and the mitochondrial genome, AFLP4 isolates exist that possess mitochondrial genomes that consist completely of AFLP6 sequences or that contain a combination of AFLP4 and AFLP6 sequences. It could be argued that the presence of AFLP6 mitochondrial sequences in AFLP4 isolates is a retained ancestral character state. However, in this case AFLP6 mitochondrial sequences would be expected in other genotypic groups of C. gattii, especially in AFLP7 as this genotypic group is most closely related to AFLP6 (Bovers et al., 2007a). In addition, as the genotypic groups of C. gattii diverged some time ago mutations would have occurred in the ancestral sequence, which would have resulted in some polymorphisms. However, AFLP4 isolates exist that possess ATP6 sequences that are completely identical to those found in AFLP6 isolates. These results suggest that the presence of AFLP6 mitochondrial sequences in AFLP4 isolates is not a retained ancestral character state. AFLP4 and AFLP6 isolates have been isolated from the same geographic regions (Sorrell et al., 1996; Kidd et al., 2003; Campbell et al., 2005; Kidd et al., 2005; Kidd et al., 2007), which indicates that these genotypic groups occur in the same areas and may come in contact. Interestingly, AFLP4 isolates that possessed mitochondrial genomes with (partial) AFLP6 sequences were all isolated from countries near the Pacific Ocean,

bovers_V4.indd 73 25-10-2007 10:15:29 Chapter 3: Recombination within mitochondria of C. gattii

CBS6998 ATP6 haplotype 3 CBS1622/CBS6992 100 M3 MtLrRNA haplotype 2 CBS6290 63 60 48A/56A 64 ATP6 haplotype 4 CBS8273/RV20186T M1 MtLrRNA haplotype 2 74 CBS6289 Nucleus 93 Mitochondrion WM830 ATP6 MtLrRNA WM276 60 black = AFLP4 ATP6 haplotype 1 WM176 white = AFLP6 M2 MtLrRNA haplotype 2 grey = AFLP4 like 99 5032738 light grey = AFLP6 like black and white = chimera AFLP4/AFLP6 CBS7229T/RV54130 60 E566 ATP6 haplotype 2 M5 MtLrRNA haplotype 1 WM179R

CBS919T ATP6 haplotype 2 64 CBS7748 M4 MtLrRNA haplotype 4 CBS883T

Fig. 6. Phylogenetic tree of Cryptococcus gattii isolates obtained by analysis of six concatenated nuclear regions (RPB1, RPB2, CNLAC1, TEF1α, IGS1 and ITS). Presented is one of sixty most parsimonious trees (length 847; consistency index 0.902; retention index 0.961) computed with gaps treated as missing data. Only the topology obtained for the AFLP4 clade is shown. Data consisted of 3932 characters of which 459 characters were parsimony informative. Bootstrap values (1000 replicates) are indicated. The mitochondrial genotype as well as the ATP6 and MtLrRNA haplotypes are shown. T: type strain. R: molecular type reference strain (Meyer et al., 2003). Haploid isolates are underlined.

whereas core AFLP4 isolates were isolated from Africa and Europe. This could indicate that the abnormal AFLP4 isolates originate in the region of the Pacific Ocean. The presence of isolates with a nuclear AFLP4 genome and (partial) AFLP6 mitochondrial regions indicates that either somatic fusion or mating has occurred between AFLP4 and AFLP6 cells. To our best knowledge, somatic fusion without mating has never been reported in C. neoformans or in C. gattii. Mating usually occurs between isolates of opposite mating type (MATa and MATα) (Kwon-Chung, 1975; Kwon-Chung, 1976a; Kwon-Chung, 1976b), but has also been reported between isolates of identical mating type (Lin et al., 2005). During mating the nucleus of the MATα cell migrates into the conjugation tube and the recipient MATa cell generates a hypha (McClelland et al., 2004). Previous reports indicated that mitochondria in C. neoformans were uniparentally inherited from the MATa parent (Xu et al., 2000; Yan and Xu, 2003), probably because the MATa cell produces the hypha. However, recent studies have shown that in some cases leakage may occur (Yan and Xu, 2003, Toffaletti et al., 2004; Yan et al., 2004; Yan et

bovers_V4.indd 74 25-10-2007 10:15:31 Chapter 3: Recombination within mitochondria of C. gattii

al., 2007a; Yan et al., 2007b) leading to the presence of MATα parental mitochondria in the progeny. Recent studies on other fungal species have shown that strictly uniparental or biparental mitochondrial inheritance is rare (Yan and Xu, 2005), and it has therefore been suggested to treat mitochondrial inheritance as a quantitative rather than a qualitative trait (Birky, 1995). Mitochondrial leakage following AFLP4 × AFLP6 mating would have resulted in a cell with both types of mitochondria. Subsequent mitotic divisions could have resulted in isolates that possessed a complete AFLP6 mitochondrial genome. In addition, recombination between the two types of mitochondria that were present would have resulted in mitochondrial genomes with both AFLP4 and AFLP6 sequences. Recombination between mitochondria has been observed in other fungi under laboratory 3 conditions, e.g. Agaricus bisporus (De la Bastide and Horgen, 2003), Agrocybe aegerita (Barroso and Labarère, 1997), Aspergillus nidulans (Rowlands and Turner, 1975), Coprinus cinereus (Baptista-Ferreira et al., 1983; Economou et al., 1987), Kluyveromyces lactis (Brunner et al., 1977), Neurospora crassa (Mannella and Lambowitz, 1978), Neurospora intermedia (Yang and Griffiths, 1992), Pleurotus ostreatus (Matsumoto and Fukumasa-Nakai, 1996), Podospora anserina (Belcour and Begel, 1977), Saccharomyces cerevisiae (Wilkie and Thomas, 1973; Wolf et al., 1973; Callen, 1974) and Schizosaccharomyces pombe (Seitz-Mayr et al., 1978), as well as in the environment, e.g. Agrocybe aegerita (Barroso et al., 1995), Armillaria gallica (Saville et al., 1998), Candida albicans (Anderson et al., 2001) and Neurospora crassa (Taylor et al., 1986). In addition, mitochondrial recombination has been observed in laboratory crossings of C. neoformans isolates (Toffaletti et al., 2004; Yan et al., 2007b). Although our results indicate that mating and recombination between two mitochondrial genomes has occurred, mating would also have resulted in the presence of two nuclear genomes. Hybrid isolates between the two C. neoformans varieties and between C. neoformans and C. gattii have been described (Tanaka et al., 1999; Cogliati et al., 2000; Boekhout et al., 2001; Lengeler et al., 2001; Bovers et al., 2006; Bovers et al., 2007b). These isolates are diploid or aneuploid (Tanaka et al., 1999, Cogliati et al., 2000, Lengeler et al., 2001, Bovers et al., 2006; Bovers et al., 2007b) and possess alleles from both parents. However, all AFLP4 isolates that had been studied by flow cytometry were haploid (M. Bovers, unpubl. data) and nuclear AFLP6 sequences have not been found in these AFLP4 isolates (Bovers et al., 2007a), which indicates that these isolates are not hybrids. Possibly, mating between different C. gattii genotypic groups does not result in hybrid formation. However, experiments to test this hypothesis have not been carried out yet. The predominant uniparental inheritance of mitochondria as well as the small size of the mitochondrial genome increase the chance of incorporation of foreign alleles by drift and selection (Martinsen et al., 2001; Funk and Omland, 2003; Ballard and Whitlock, 2004). The predominant uniparental inheritance and the haploid nature of mitochondria both decrease the effective population size and thereby increase the chance of fixation by drift (Funk and Omland, 2003; Ballard and Whitlock, 2004).

bovers_V4.indd 75 25-10-2007 10:15:32 Chapter 3: Recombination within mitochondria of C. gattii

In addition, the small genome size decreases the probability of counter selection because negative gene actions are less likely to occur (Martinsen et al., 2001; Ballard and Whitlock, 2004). These processes could explain why mitochondrial regions but not nuclear regions were incorporated. Another possibility is that AFLP6 sequences are present in parts of the nuclear genome that have not yet been studied. Mitochondria play a central role in energy production and in responses to stresses (Osiewacz and Kimpel, 1999; Akhter et al., 2003). These processes play a key role in the fitness of an organism, and the mitochondrial genotype may therefore influence fitness as well. A different mitochondrial genotype may have a positive effect on fitness, as was observed in Saccharomyces cerevisiae when mitochondria of wine yeasts were transferred to laboratory yeast, resulting in an increased viability and increased ethanol and temperature tolerance (Jiménez and Benítez, 1988). However, the mitochondrial genotype does not always affect fitness. No difference in virulence or high temperature growth rate could be found for mitochondria derived from both C. neoformans varieties (Toffaletti et al., 2004). In addition, the mitochondrial genotype may also have an negative effect on fitness. Several mitochondrial proteins are produced in the nucleus (Osiewacz and Kimpel, 1999; Burton et al., 2006) and these nuclear encoded proteins interact with mitochondrial encoded proteins, e.g. in the electron transport system. The presence of a mitochondrial genotype different from the nuclear genotype may therefore negatively affect fitness as both genomes have co-evolved (Burton et al., 2006). Cryptococcus gattii isolates with different mitochondrial genotypes should be studied to investigate whether the mitochondrial genotype affects fitness in C. gattii. Our results indicate that fusion may occur between AFLP4 and AFLP6 isolates, possibly by mating, leading to the generation of cells with an AFLP4 nuclear genotype and an (partial) AFLP6 mitochondrial genotype. Our study is the first to report on mitochondrial inheritance in C. gattii and provides evidence for mitochondrial recombination occurring in nature. Furthermore, the high percentage of studied AFLP4 isolates that possessed a recombined mitochondrial genome (65%) indicates that recombination occurs frequently in nature. The mitochondrial genotype may affect fitness, but whether this is true for C. gattii remains to be studied.

Acknowledgements

Isolates were kindly donated by the following researchers: JW Kronstad, KJ Kwon-Chung, MS Lazera, W Meyer, D Swinne and JM Torres-Rodríguez. We would like to thank C Bayrakdar and HL Hoogveld for technical assistance. Work of M Bovers was supported by the “Odo van Vloten fonds”. F Hagen and EE Kuramae were funded by the Renewal Fund of the Royal Netherlands Academy of Arts and Sciences (RNAAS-KNAW).

bovers_V4.indd 76 25-10-2007 10:15:33 Chapter 3: Recombination within mitochondria of C. gattii

References

Ahkter S, McDade HC, Gorlach JM, Heinrich G, Cox GM and Perfect JR (2003) Role of alternative oxidase gene in pathogenesis of Cryptococcus neoformans. Infect. Immun. 71: 5794-5802. Anderson JB, Wickens C, Khan M, Cowen LE, Federspiel N, Jones T and Kohn LM (2001) Infrequent genetic exchange and recombination in the mitochondrial genome of Candida albicans. J. Bacteriol. 183: 865-872. Ballard JWO and Whitlock MC (2004) The incomplete natural history of mitochondria. Mol. Ecol. 13: 729-744. Baptista-Ferreira JLC, Economou A and Casselton LA (1983) Mitochondrial genetics of Coprinus: Recombination of mitochondrial genomes. Curr. Genet. 7: 405-407. Baró T, Torres-Rodríguez JM, Hermoso de Mendoza M, Morera Y and Alía C (1998) First 3 identification of autochthonousCryptococcus neoformans var. gattii isolated from goats with predominantly severe pulmonary disease in Spain. J. Clin. Microbiol. 36: 458-461. Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman J, Rivera ING and Paula CR (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J. Clin. Microbiol. 42: 1356-1359. Barroso G and Labarère J (1997) Genetic evidence for nonrandom sorting of mitochondria in the basidiomycete Agrocybe aegerita. Appl. Environ. Microbiol. 63: 4686-4691. Barroso G, Blesa S, and Labarere J (1995) Wide distribution of mitochondrial genome rearrangements in wild strains of the cultivated basidiomycete Agrocybe aegerita. Appl. Environ. Microbiol. 61: 1187-1193. Belcour L and Begel O (1977) Mitochondrial genes in Podospora anserina: recombination and linkage. Molec. Gen. Genet. 153: 11-21. Birky CW (1995) Uniparental inheritance of mitochondrial and chloroplast genes: mechanisms and evolution. Proc. Natl. Acad. Sci. USA 92: 11331-11338. Biswas SK, Wang L, Yokoyama K and Nishimura K (2003) Molecular analysis of Cryptococcus neoformans mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 41: 5572- 5576. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WCJ, Abeln ECA, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891- 907. Boekhout T, van Belkum A, Leenders ACAP, Verbrugh HA, Mukamurangwa P, Swinne D and Scheffers WA (1997) Molecular typing of Cryptococcus neoformans: taxonomic and epidemiological aspects. Int. J. Syst. Bacteriol. 47: 432-442. Bolano A, Stinchi S, Preziosi R, Bistoni F, Allegrucci M, Baldelli F, Martini A and Cardinali G (2001) Rapid methods to extract DNA and RNA from Cryptococcus neoformans. FEMS Yeast Res. 1: 221-224. Bovers M, Hagen F, Kuramae EE and Boekhout T (2007a) Six monophyletic lineages identified within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. PhD Thesis: Chapter 2. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G and Boekhout T (2007b) Promiscuous mating of Cryptococcus neoformans and Cryptococcus gattii: discovery of a novel AB hybrid. PhD Thesis: Chapter 5. Brunner A, Tuena de Cobos A and Griffiths DE (1977) The isolation and genetic characterization of extrachromosomal chloramphenicol and oligomycin-resistant mutants from the petite- negative yeast Kluyveromyces lactis. Molec. Gen. Genet. 152: 183-191.

bovers_V4.indd 77 25-10-2007 10:15:34 Chapter 3: Recombination within mitochondria of C. gattii

Burton RS, Ellison CK and Harrison JS (2006) The sorry state of F2 hybrids: consequences of rapid mitochondrial DNA evolution in allopatric populations. Am. Nat. 168: S14-S24. Butler MI and Poulter RTM (2005) The PRP8 inteins in Cryptococcus are a source of phylogenetic and epidemiological information. Fungal Genet. Biol. 42: 452-463. Callejas A, Ordóñez N, Rodriguez MC and Castañeda E (1998) First isolation of Cryptococcus neoformans var. gattii, serotype C, from the environment in Colombia. Med. Mycol. 36: 341-344. Callen DF (1974) Recombination and segregation of mitochondrial genes in Saccharomyces cerevisiae. Molec. Gen. Genet. 134: 49-63. Campbell LT, Currie BJ, Krockenberger M, Malik R, Meyer W, Heitman J and Carter D (2005) Clonality and recombination in genetically differentiated subgroups of Cryptococcus gattii. Eukaryot. Cell 4: 1403-1409. Chaturvedi V, Fan J, Stein B, Behr MJ, Samsonoff WA, Wickes BL and Chaturvedi S (2002) Molecular genetic analyses of mating pheromones reveal intervariety mating or hybridization in Cryptococcus neoformans. Infect. Immun. 70: 5225-5235. Chen S, Sorrell T, Nimmo G, Speed B, Currie B, Ellis D, Marriott D, Pfeiffer T, Parr D, Byth K and the Australasian Cryptococcal Study Group (2000) Epidemiology and host- and variety- dependent characteristics of infection due to Cryptococcus neoformans in Australia and New Zealand. Clin. Infect. Dis. 31: 499-508. Cogliati M, Allaria M, Liberi G, Tortorano AM and Viviani MA (2000) Sequence analysis and ploidy determination of Cryptococcus neoformans var. neoformans. J. Mycol. Med. 10: 171- 176. Colom MF, Frasés S, Ferrer C, Jover A, Andreu M, Reus S, Sánchez M and Torres-Rodríguez JM (2005) First case of human Cryptococcosis due to Cryptococcus neoformans var. gattii in Spain. J. Clin. Microbiol. 43: 3548-3550. De la Bastide PY and Horgen PA (2003) Mitochondrial inheritance and the detection of non- parental mitochondrial DNA haplotypes in crosses of Agaricus bisporus homokaryons. Fungal Genet. Biol. 38: 333-342. Diaz MR and Fell JW (2005) Use of a suspension array for rapid identification of the varieties and genotypes of the Cryptococcus neoformans species complex. J. Clin. Microbiol. 43: 3662-3672. Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5:1129-1140. Diaz MR, Boekhout T, Theelen B and Fell JW (2000) Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. Economou A, Lees V, Pukkila PJ, Zolan ME and Casselton LA (1987) Biased inheritance of optional insertions following mitochondrial genome recombination in the basidiomycete fungus Coprinus cinereus. Curr. Genet. 11: 513-519. Ellis D, Marriott D, Hajjeh RA, Warnock D, Meyer W and Barton R (2000) Epidemiology: surveillance of fungal infections. Med. Mycol. 38: 173-182. Ellis DH and Pfeiffer TJ (1990) Natural habitat of Cryptococcus neoformans var. gattii. J. Clin. Microbiol. 28: 1642-1644. Escandón P, Sánchez A, Martínez M, Meyer W and Castañeda E (2006) Molecular epidemiology of clinical and environmental isolates of the Cryptococcus neoformans species complex reveals a high genetic diversity and the presence of the molecular type VGII mating type a in Colombia. FEMS Yeast Res. 6: 625-635. Fortes ST, Lazéra MS, Nishikawa MM, Macedo RCL and Wanke B (2001) First isolation of Cryptococcus neoformans var. gattii from a native jungle tree in the Brazilian Amazon rainforest. Mycoses 44: 137-140.

bovers_V4.indd 78 25-10-2007 10:15:35 Chapter 3: Recombination within mitochondria of C. gattii

Franzot SP, Salkin IR and Casadevall A (1999) Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, Diezmann S, Allen A, Stajich JE, Dietrich FS, Perfect JR and Heitman J (2005) Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360-1364. Fraser JA, Subaran RL, Nichols CB and Heitman J (2003) Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: implications for an outbreak on Vancouver Island, Canada. Eukaryot. Cell 2: 1036-1045. Funk DJ and Omland KE (2003) Species-level paraphyly and polyphyly: frequency, causes and consequences, with insights from animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 34: 397-423. Gatti F and Eeckels R (1970) An atypical strain of Cryptococcus neoformans (Sanfelice) Vuillemin 1894. Part. 1. Description of the disease and of the strain. Ann. Soc. Belg. Med. Trop. 50: 6. 3 Granados DP and Castañeda E (2005) Isolation and characterization of Cryptococcus neoformans varieties recovered from natural sources in Bogotá, Colombia and study of ecological conditions in the area. Microb. Ecol. 49: 282-290. Halliday CL (2000) A molecular study of mating type and recombination in Cryptococcus neoformans var. gattii. PhD thesis. University of Sydney, Sydney, Australia. Hillis DM and Bull JJ (1993) An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Syst. Biol.42: 182-192. Hoang LMN, Maguire JA, Doyle P, Fyfe M and Roscoe DL (2004) Cryptococcus neoformans infections at Vancouver Hospital and Health Sciences Centre (1997-2002): epidemiology, microbiology and histopathology. J. Med. Microbiol. 53: 935-940. Jiménez J and Benítez T (1988) Yeast cell viability under conditions of high temperature and ethanol concentrations depends on the mitochondrial genome. Curr. Genet. 13: 461-469. Katsu M, Kidd S, Ando A, Moretti-Branchini ML, Mikami Y, Nishimura K and Meyer W (2004) The internal transcribed spacers and 5.8S rRNA gene show extensive diversity among isolates of the Cryptococcus neoformans species complex. FEMS Yeast Res. 4: 377-388. Kidd SE, Chow Y, Mak S, Bach PJ, Chen H, Hingston AO, Kronstad JW and Bartlett KH (2007) Characterization of environmental sources of the human and animal pathogen Cryptococcus gattii in British Columbia, Canada, and Pacific Northwest USA. Appl. Environ. Microbiol. 73: 1433-1443. Kidd SE, Guo H, Bartlett KH, Xu J and Kronstad JW (2005) Comparative gene genealogies indicate that two clonal lineages of Cryptococcus gattii in British Columbia resemble strains from other geographical areas. Eukaryot. Cell 4: 1629-1638. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, MacDougall L, Boekhout T, Kwon-Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Colombia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263. Kidd SE, Sorrell TC and Meyer W (2003) Isolation of two molecular types of Cryptococcus neoformans var. gattii from insect frass. Med. Mycol. 41: 171-176. Krockenberger MB, Canfield PJ and Malik R (2002) Cryptococcus neoformans in the koala (Phascolarctos cinereus): colonization by C. neoformans var. gattii and investigation of environmental sources. Med. Mycol. 40: 263-272. Kwon-Chung KJ (1975) A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200. Kwon-Chung KJ (1976a) Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia 68: 821-833. Kwon-Chung KJ (1976b) A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946.

bovers_V4.indd 79 25-10-2007 10:15:36 Chapter 3: Recombination within mitochondria of C. gattii

Kwon-Chung KJ and Bennett JE (1984) Epidemiological differences between the two varieties of Cryptococcus neoformans. Am. J. Epidemiol. 120: 123-130. Kwon-Chung KJ and Varma A (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res. 6: 574-587. Kwon-Chung KJ, Bennett JE and Rhodes JC (1982) Taxonomic studies on Filobasidiella species and their anamorphs. Antonie van Leeuwenhoek 48: 25-38. Kwon-Chung KJ, Boekhout T, Fell JW and Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804-806. Kwon-Chung KJ, Edman JC and Wickes BL (1992) Genetic association of mating types and virulence in Cryptococcus neoformans. Infect. Immun. 60: 602-605. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Latouche GN, Sorrell TC and Meyer W (2002) Isolation and characterisation of the phospholipase B gene of Cryptococcus neoformans var. gattii. FEMS Yeast Res. 2: 551-561. Lazéra MS, Cavalcanti MA, Trilles L, Nishikawa MM and Wanke B (1998) Cryptococcus neoformans var. gattii - evidence for a natural habitat related to decaying wood in a pottery tree hollow. Med. Mycol. 36: 119-122. Lazéra MS, Salmito Cavalcanti MA, Londero AT, Trilles L, Nishikawa MM and Wanke B (2000) Possible primary ecological niche of Cryptococcus neoformans. Med. Mycol. 38: 379-383. Lengeler KB, Cox GM and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122 Lengeler KB, Wang P, Cox GM, Perfect JR and Heitman J (2002) Identification of the MATa mating-type locus of Cryptococcus neoformans reveals a serotype A MATa strain thought to have been extinct. Proc. Natl. Acad. Sci. USA 97: 14455-14460. Lin X, Hull CM and Heitman J (2005) Sexual reproduction between partners of the same mating type in Cryptococcus neoformans. Nature 434: 1017-1021. Litvintseva AP, Thakur R, Vilgalys R and Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172: 2223-2238. Mannella CA and Lambowitz A (1978) Interaction of wild-type and poky mitochondrial DNA in heterokaryons of Neurospora. Biochem. Biophys. Res. Commun. 80: 673-679. Martinsen GD, Whitham TG, Turek RJ and Keim P (2001) Hybrid populations selectively filter gene introgression between species. Evolution 55: 1325-1335. Matsumoto T and Fukumasa-Nakai Y (1996) Mitochondrial DNA inheritance in sexual crosses of Pleurotus ostreatus. Curr. Genet. 30: 549-552. McClelland CM, Chang YC, Varma A and Kwon-Chung KJ (2004) Uniqueness of the mating system in Cryptococcus neoformans. Trends Microbiol. 12: 208-212. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal study group (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195. Mitchell DH, Sorrell TC, Allworth AM, Heath CH, McFregor AR, Papanaoum K, Richards MJ and Gottlieb T (1995) Cryptococcal disease of the CNS in immunocompetent hosts: influence of cryptococcal variety on clinical manifestations and outcome. Clin. Infect. Dis. 20: 611- 616. Montagna MT, Viviani MA, Pulito A, Aralla C, Tortorano AM, Fiore L and Barbuti S (1997) Cryptococcus neoformans var. gattii in Italy. Note II. Environmental investigation related to an autochtonous clinical case in Apulia. J. Mycol. Méd. 7: 93-96.

bovers_V4.indd 80 25-10-2007 10:15:36 Chapter 3: Recombination within mitochondria of C. gattii

Osiewacz HD and Kimpel E (1999) Mitochondrial-nuclear interactions and lifespan control in fungi. Exp. Gerontol. 34: 901-909. Randhawa HS, Kowshik T and Khan ZU (2003) Decayed wood of Syzygium cumini and Ficus religiosa living trees in Delhi/New Delhi metropolitan area as natural habitat of Cryptococcus neoformans. Med. Mycol. 41: 199-209. Rowlands RT and Turner G (1975) Three-marker extranuclear mitochondrial crosses in Aspergillus nidulans. Molec. Gen. Genet. 141: 69-79. Rozenbaum R and Goncalves AJ (1994) Clinical epidemiological study of 171 cases of cryptococcosis. Clin. Infect. Dis. 18: 369-380. Ruma P, Chen SC, Sorrell TC and Brownlee AG (1996) Characterization of Cryptococcus neoformans by random DNA amplification. Lett. Appl. Microbiol.23: 312-316. Saville BJ, Kohli Y and Anderson JB (1998) mtDNA recombination in a natural population. Proc. Natl. Acad. Sci. USA 95: 1331-1335. 3 Seitz-Mayr G, Wolf K and Kaudewitz F (1978) Extrachromosomal inheritance in Schizosaccharomyces pombe. Molec. Gen. Genet. 164: 309-320. Sorrell TC, Brownlee AG, Ruma P, Malik R, Pfeiffer TJ and Ellis DH (1996) Natural environmental sources of Cryptococcus neoformans var. gattii. J. Clin. Microbiol. 34: 1261-1263. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Stephen C, Lester S, Black W, Fyfe M and Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can. Vet. J. 43: 792-794. Swofford DL (2000) PAUP* 4.0: Phylogenetic Analysis Using Parsimony. Sinauer Associates, Sunderland, USA. Tanaka R, Nishimura K and Miyaji M (1999) Ploidy of serotype AD strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 40: 31-34. Taylor JW, Smolich BD and May G (1986) Evolution and mitochondrial DNA in Neurospora crassa. Evolution 40: 716-739. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F and Higgins, DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24: 4876-4882. Toffaletti DL, Nielsen K, Dietrich F, Heitman J and Perfect JR (2004) Cryptococcus neoformans mitochondrial genomes from serotype A and D strains do not influence virulence. Curr. Genet. 46: 193-204. Velegraki A, Kiosses VG, Pitsouni H, Toukas D, Daniilidis VD and Legakis NJ (2001) First report of Cryptococcus neoformans var. gattii serotype B from Greece. Med. Mycol. 39: 419-422. White TJ, Bruns T, Lee S and Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications, p 315-322. Edited by Innis MA, Gelfand DH, Sninsky JJ and White TJ. Academic Press, San Diego, USA. Wilkie D and Thomas DY (1973) Mitochondrial genetic analysis by zygote cell lineages in Saccharomyces cerevisiae. Genetics 73: 367-377. Wolf K, Dujon B and Slonimski PP (1973) Mitochondrial genetics. V. Multifactorial mitochondrial crosses involving a mutation conferring paromomycin-resistance in Saccharomyces cerevisiae. Molec. Gen. Genet. 125: 53-90. Xu J, Ali RY, Gregory DA, Amick D, Lambert SE, Yoell HJ, Vilgalys RJ and Mitchell TG (2000) Uniparental mitochondrial transmission in sexual crosses in Cryptococcus neoformans. Curr. Microbiol. 40: 269-273. Yan Z and Xu J (2003) Mitochondria are inherited from the MATa parent in crosses of the basidiomycete fungus Cryptococcus neoformans. Genetics 163: 1315-1325.

bovers_V4.indd 81 25-10-2007 10:15:37 Chapter 3: Recombination within mitochondria of C. gattii

Yan Z and Xu J (2005) Fungal mitochondrial inheritance and evolution. In: Evolutionary genetics of fungi, p 221-252. Edited by Xu J. Horizon Bioscience, Norfolk, United Kingdom. Yan Z, Hull CM, Heitman J, Sun S and Xu J (2004) SXI1α controls uniparental mitochondrial inheritance in Cryptococcus neoformans. Curr. Biol. 14: 743-744. Yan Z, Hull CM, Sun S, Heitman J and Xu J (2007a) The mating type-specific homeodomain genes SXI1α and SXI2a coordinately control uniparental mitochondrial inheritance in Cryptococcus neoformans. Curr. Genet. 51: 187-195. Yan Z, Sun S, Shahid M and Xu J (2007b) Environment factors can influence mitochondrial inheritance in the fungus Cryptococcus neoformans. Fungal Genet. Biol. 44: 315-322. Yang X and Griffiths AJF (1992) Male transmission of linear plasmids and mitochondrial DNA in the fungus Neurospora. Genetics 134: 1055-1062.

bovers_V4.indd 82 25-10-2007 10:15:38 Chapter 4

Unique hybrids between fungal

pathogens Cryptococcus

neoformans and Cryptococcus gattii

M Bovers1, F Hagen1, EE Kuramae1, MR Diaz2, L Spanjaard3, F Dromer4, HL Hoogveld5, T Boekhout1

1CBS - Fungal Biodiversity Centre, Utrecht, The Netherlands; 2RSMAS-Rosenstiel School of Marine and Atmospheric Science, Division of Marine Biology and Fisheries, Key Biscayne, USA; 3The Netherlands Reference Laboratory for Bacterial Meningitis (AMC/RIVM), Department of Medical Microbiology, Academic Medical Center, Amsterdam, The Netherlands; 4Unité de Mycologie Moléculaire, CNRS FRE2849, Centre National de Référence Mycologie et Antifongiques, Institut Pasteur, Paris, France; 5Netherlands Institute of Ecology (NIOO- KNAW), Centre for Limnology, Nieuwersluis, The Netherlands.

FEMS Yeast Res. (2006) 6: 599-607

bovers_V4.indd 83 25-10-2007 10:15:38 Chapter 4: C. neoformans – C. gattii BD hybrid

Summary

Cryptococcus neoformans and C. gattii are yeasts that bath cause meningoencephalitis, but they differ in host range and geographical distribution. Cryptococcus neoformans occurs worldwide and mostly infects immunocompromised patients, whereas C. gattii occurs mainly in (sub)tropical regions and infects healthy individuals. Anomalous C. neoformans strains were isolated from patients. These strains were found to be monokaryotic, and diploid or aneuploid. Amplified Fragment Length Polymorphism (AFLP) and sequence analyses indicated that genotypes AFLP2 (C. neoformans) and AFLP4 (C. gattii) were represented in these strains. The strains were serologically BD. Mating- and serotype-specific PCR reactions showed that the strains are serotype D-MATa/serotype B-MATα. This study is the first to describe naturally occurring hybrids between C. neoformans and C. gattii.

bovers_V4.indd 84 25-10-2007 10:15:39 Chapter 4: C. neoformans – C. gattii BD hybrid

Introduction

Cryptococcus neoformans and C. gattii are encapsulated basidiomycetous yeasts that can cause life-threatening meningoencephalitis. Cryptococcus neoformans occurs worldwide, whereas C. gattii occurs predominantly in tropical and subtropical regions (Kwon- Chung and Bennett, 1984). However, a recent outbreak of C. gattii on Vancouver Island, Canada (Kidd et al., 2004), as well as the isolation of C. gattii isolates in Italy (Montagna et al., 1997), Spain (Baró et al., 1998; Colom et al., 2005) and Greece (Velegraki et al., 2001) indicate that C. gattii may also exist in more temperate climates. The two cryptococcal species differ in their ability to cause disease: C. neoformans is seen as a secondary pathogen because it mainly infects immunocompromised people, whereas the primary pathogen C. gattii infects mainly otherwise healthy individuals (Speed and Dunt, 1995; Casadevall and Perfect, 1998; Sorrell, 2001). Cryptococcus gattii was recently 4 raised from varietal to species level (Kwon-Chung et al., 2002) on the basis of differences from C. neoformans as seen in DNA fingerprints (Ruma et al., 1996; Sorrell et al., 1996; Meyer et al., 1999; Boekhout et al., 2001; Meyer et al., 2002; Latouche et al., 2003) and sequence data (Xu et al., 2000; Diaz et al., 2000; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Butler and Poulter, 2005). In addition, molecular genetic analysis of a laboratory cross between C. neoformans var. neoformans and C. neoformans var. gattii showed no evidence of recombination between the two species (Varma et al., 2002). Cryptococcus neoformans and C. gattii can be distinguished by serotype (A, D and AD for the former, B and C for the latter), RAPD pattern (Ruma et al., 1996; Sorrell et al., 1996), PCR fingerprint (Meyer et al., 1999), RFLP pattern (Meyer et al., 2002; Latouche et al., 2003), AFLP fingerprint (Boekhout et al., 2001) and sequencing (Xu et al., 2000; Diaz et al., 2000; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Butler and Poulter, 2005). Within C. neoformans two varieties are distinguished, namely var. grubii and var. neoformans. Cryptococcus gattii can be subdivided into four genotypic groups. Table 1 summarizes the relationships between the varieties, serotypes and different genotypic groups. The existence of serotype AD hybrids, which are hybrids between the two varieties of C. neoformans, shows that somatic fusion and karyogamy may occur within C. neoformans between strains of different mating types (MATα and MATa), but the ecological niche where mating occurs has not yet been discovered. A hybrid between C. neoformans and C. gattii has never been found, although there have been predictions that such entities might exist (Chaturvedi et al., 2002; D’Souza et al., 2004). During an investigation of clinical C. neoformans isolates from the Netherlands we observed three isolates from two Dutch patients that did not fit the previously defined AFLP genotypes. In this paper we present our analysis of these isolates. Various molecular and conventional techniques indicate that these isolates are hybrids between C. neoformans (serotype D, AFLP2) and C. gattii (serotype B, AFLP4).

bovers_V4.indd 85 25-10-2007 10:15:39 Chapter 4: C. neoformans – C. gattii BD hybrid

Table 1. The subdivision of Cryptococcus neoformans and Cryptococcus gattii into varieties, serotypes and genotypes.

Species Serotype AFLP genotype 1 IGS genotype 2 Molecular genotype 3 C. neoformans C. neoformans var. grubii A 1/1A/1B 1A/1B/1C VNI/VNII C. neoformans var. neoformans D 2 2A/2B/2C VNIV C. neoformans hybrid AD 3 VNIII C. gattii C. gattii B 4 4A/4B/4C VGI C. gattii B/C 5 5 VGIII C. gattii B 6 3 VGII C. gattii B/C 7 6 VGIV

1 Boekhout et al. (2001); 2 Diaz et al. (2005); 3 Meyer et al. (2003).

Materials and Methods

Clinical and reference strains

Three cryptococcal strains were isolated from the cerobrospinal fluid (CSF) of two Dutch patients. Isolate AMC770616 was isolated in 1977 from a 23 year old male, who was treated for an apparent brain tumour and died during treatment. It is unknown whether this patient was immunocompromised, but he is unlikely to have had an HIV infection because he was treated before the onset of the AIDS epidemic. Isolates AMC2010404 and AMC2011225 were isolated from a 35 year old male patient in February and May 2001, respectively. In the past, this patient kept pigeons and it is known that he had visited the Caribbean and Sri Lanka. The patient was negative for HIV but had sarcoidosis with resulting low CD4 counts (0.16 × 109 l-1). This patient was treated successfully for recurrent cryptococcal meningitis. All strains used in this study are listed in Table 2.

Ploidy analysis

Flow cytometry was used to measure the DNA content of the three isolates. Fresh cells were obtained by cultivating yeast cells in 2 ml YPG (1% yeast extract, 1% pepton, 2% d-glucose) medium supplemented with 0.5 M sodium chloride for 24 hours at 30 rpm and 25 ºC. The cells were subcultured under the same conditions as described before, by inoculating 200 μl of this culture into 2 ml YPG medium supplemented with 0.5 M sodium chloride. After 48 hours the cells were harvested and quantitatively stained with propidium iodide (Darzynkiewicz et al., 1994). The DNA content of individual cells was determined using a MoFloTM High- Performance Cell Sorter (Dako Cytomation). The cell sorter was adjusted with 1.00 μm Fluoresbrite® YG Carboxylate Microspheres and 2.00 μm Fluoresbrite®

bovers_V4.indd 86 25-10-2007 10:15:40 Chapter 4: C. neoformans – C. gattii BD hybrid

Table 2. Strains used in this study.

Strain Mating-/ Serotype AFLP genotype Origin Usage1 AMC770616 aD-αB 8 Human, CSF, the Netherlands all AMC2010404 aD-αB 8 Human, CSF, the Netherlands all AMC2011225 aD-αB 8 Human, CSF, the Netherlands all B3501 αD 2 Laboratory strain, genetic offspring of NIH12 × NIH433 F CBS1622 αB 4 Tumour A, M, S CBS5467 αD 2 Milk from mastitic cow, Switzerland M CBS5757 αB 4 Unknown A CBS6992 αB 4 Man, USA C, S CBS7816 aD 2 Cuckoo dropping, Thailand M E566 aB 4 Eucalyptus camaldulensis, Australia M JEC20 aD 2 Laboratory strain A, S JEC21 αD 2 Laboratory strain A, C, S WM276 αB 4 Debris of Eucalyptus tereticornis, Australia F

1A = AFLP analysis; C = CGB medium; F = flow cytometry; M = mating-serotype PCR; S = sequence analysis. 4

Polychromatic RED Microspheres (both: Polysciences). Forward and side scatter were set at ~5º and 90º respectively, the wavelength of the exciting laser beam was 488 nm and fluorescence was measured at 630 nm. A minimum of 10,000 cells were counted and their fluorescence intensities measured. The data were represented as graphs where the x-axis represents the fluorescent intensity (logarithmic) and the y-axis the amount of measured cells.

Nuclear staining

Strains were grown for five days at 24 ºC on YPGA medium (1% yeast extract, 1% pepton, 2% d-glucose, 2% technical agar #3 (Oxoid)). A 0.5 μg ml-1 DAPI solution

(Sigma-Aldrich) in McIlvaine buffer (citric acid 17.6 mM, Na2HPO4 0.16 M, pH 7.0) was used to suspend the cells. The cells were incubated for two hours in the DAPI solution before examining the stained nuclei microscopically (excitation: 358 nm, emission: 461 nm).

Coloration of CGB medium

Strains were grown at 24 ºC on CGB medium (Kwon-Chung et al., 1982a). The color of the CGB medium was assessed on day six and fifteen.

Serology

The Crypto Check serotyping kit from Iatron Laboratories was used according to the manufacturer’s instructions to test the serotype of the strains.

bovers_V4.indd 87 25-10-2007 10:15:41 Chapter 4: C. neoformans – C. gattii BD hybrid

DNA isolation and AFLP genotyping

Five single colonies from each of the three putative hybrid strains were cultivated for two days at 25 ºC under agitation (30 rpm) in liquid YPG medium (1% yeast extract, 1% pepton, 2% d-glucose) supplemented with 0.5 M sodium chloride to reduce capsule size. DNA was isolated according to Bolano et al. (2001) with minor modifications. Yeast cells were incubated for 3-4 hours in ureum buffer (urea 8 M, NaCl 0.5 M, Tris 20 mM, EDTA 20 mM, SDS 2%). Phenol:chloroform:isoamylalcohol (25:24:1, pH 8.0) and lysis buffer (0.5% w/v SDS, 0.5% Sarkosyl in TE, pH 7.5) were added 1:1 to the pelleted yeast cells and the cells were bead beated for 3 min at 2500 rpm with sterile sand. After centrifugation the DNA fraction was ethanol precipitated and dissolved in TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8). AFLP analysis was performed on five single colonies of the putative hybrid strains as described by Boekhout et al. (2001).

Sequencing

Sequence reactions were performed using primers amplifying portions of Laccase (CNLAC1), Internal Transcribed Spacer (ITS) (Xu et al., 2000), Intergenic Spacer (IGS) (Diaz et al., 2000) and the second largest subunit of RNA polymerase II (RPB2) using the bRPB2-6f and bRPB2-7.1r primers described by Matheny (2005). Most of these regions have been used previously to distinguish the different genotypes of C. neoformans and C. gattii. Amplicons were purified with the GFXTM PCR DNA and Gel Band Purification Kit (Amersham Biosciences). Amplicons from haploid strains were sequenced directly with BigDye v3.1 Chemistry (Applied Biosystems) and were analyzed on an ABI 3700XL DNA analyzer (Applied Biosystems). Amplicons from putative hybrid strains were cloned with the TA Cloning® Kit (Invitrogen) into Escherichia coli DH5α according to the manufacturer’s instructions. At least thirteen clones were picked randomly, amplified and sequenced.

IGS genotype analysis based on Luminex technology

The putative hybrid strains were analyzed in duplicate using a bead liquid suspension array. Protocol details are described in Diaz and Fell (2005). Specific oligonucleotide probes for each of the six haploid genotypes were used, as well as probes targeting either C. neoformans or C. gattii (Diaz and Fell, 2005). The probes, which were designed in the Intergenic Spacer region (IGS), were covalently bound to fluorescently color coded

bovers_V4.indd 88 25-10-2007 10:15:42 Chapter 4: C. neoformans – C. gattii BD hybrid

microspheres following the carbodiimide method (Fulton et al., 1997). Biotinylated target amplicons were allowed to anneal with their complementary probe sequences and were quantified by the addition of the appropiate conjugate, streptavidin R-phycoerythrin. The microspheres were analyzed with the Luminex 100 analyzer (Luminex), which employs a dual laser system, simultaneously allowing microsphere identity to be determined and the level of conjugate fluorescence to be quantified. Median fluorescent intensity (MFI) values were calculated. A positive signal was defined as two times the background MFI signal, once the background MFI had been subtracted. This assay was performed in a multiplex format as described by Diaz and Fell (2005).

Mating- serotype analysis

Several PCR’s with mating- and serotype-specific primers were performed on the 4 putative hybrid strains and selected reference strains (Table 2).

C. gattii specific PCR PCR amplifications were performed in 20 µl volumes containing 1 × PCR buffer (10

mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, pH 8.3), 0.1 mM dNTPs, 0.5 U of Taq polymerase (Gentaur), 3 µl of template DNA and 30 pmol of both primers 660U and 660L. These primers are based on an anonymous DNA fragment (216 bp) that was amplified by Randomly Amplified Polymorphic DNA (RAPD) analysis performedon a C. gattii strain (Halliday et al., 1999). Amplification conditions were 94 ºC for 5 min, followed by 30 cycles of 94 ºC for 30 sec, 55 ºC for 1 min and 72 ºC for 2 min, and a final extension step of 72 ºC for 7 min.

Serotype D specific PCRs PCR amplifications were performed in 20 µl volumes containing 1 × PCR buffer (10

mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, pH 8.3), 0.1 mM dNTPs, 0.5 U of Taq polymerase (Gentaur), 2 µl of template DNA and 20 pmol of both primers. The serotype D specific primer pair JOHE2596/JOHE3240 amplifies a 790 bp region of the GPA1 gene that is specific for serotype D isolates (Lengeler et al., 2001; Barreto de Oliveira et al., 2004). Amplification conditions were as follows: 96 ºC for 5 min, followed by 25 cycles of 96 ºC for 30 sec, 55 ºC for 30 sec and 72 ºC for 45 sec, and a final extension step of 72 ºC for 5 min. Primer pair JOHE7267/JOHE7268 is specific for serotype D-MATα isolates and amplifies a 1200 bp fragment of the STE20α gene, whereas primer pair JOHE7273/JOHE7275 is specific for serotype D-MATa isolates and amplifies an 870 bp fragment of the STE20a gene (Barreto de Oliveira et al., 2004). Amplification conditions were 96 ºC for 5 min, followed by 30 cycles of 96 ºC for 15 sec, 66 ºC for 15 sec and 72 ºC for 1 min , and a final extension step of 72 ºC for 5 min.

bovers_V4.indd 89 25-10-2007 10:15:43 Chapter 4: C. neoformans – C. gattii BD hybrid

Mating type specific PCR Two mating type specific primer sets based on the STE12 gene were developed using sequences of strains H99 (αA-AFLP1; AF542529), 125.91 (aA-AFLP1; AF542528), JEC20 (aD-AFLP2; AF242352), JEC21 (αD-AFLP2; AF012924), E566 (aB-AFLP4; AY710429), WM276 (αB-AFLP4; AY710430) and CBS6956 (αB-AFLP6; AY421965), and tested using thirteen strains of different genetic background. Primer sequences are listed in Table 3. STE12αF809/STE12αR1607 amplifies a 760 bp region specific for both C. neoformans and C. gattii MATα strains, whereas STE12aF537/STE12aR1299 amplifies a 800 bp region specific for both C. neoformans and C. gattii MATa strains. PCR amplifications were performed in 25 µl volumes containing 1 × PCR buffer (10

mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, pH 8.3), 0.2 mM dNTPs, 0.5 U of Taq polymerase (Gentaur), 1 µl of template DNA and 15 pmol of both primers. Amplification conditions were 94 ºC for 5 min, followed by 35 cycles of 94 ºC for 1 min, 58 ºC for 1 min and 72 ºC for 2 min, and a final extension step of 72 ºC for 7 min.

Table 3. Primer sequences for the mating type specific PCR of both Cryptococcus neoformans and Cryptococcus gattii. The primer sequences were based on the STE12 gene.

Specificity Primer sequence (5’-3’) STE12α-F809: TTGACCTTTTRTTCCGCAATG MATα (C. neoformans and C. gattii) STE12α-R1607: TTTCTTCTCCCCTGTTTATAGGC STE12a-F537: GTTCTTTGGAATGGCTTATTTCATAT MATa (C. neoformans and C. gattii) STE12a-R1299: GMCTTGCGTGGATCATATCTA

Results

Ploidy analysis and karyology

Figure 1 shows the strains B3501 and AMC770616 as an example. The graph shows the fluorescent intensity of the cells, where the first peak corresponds to cells in the G1 phase and the second peak corresponds to cells in the G2 phase. The G1 and the G2 peaks of the haploid reference strain B3501 (AFCP 2) were placed at positions 40.7 and 70.7, respectively. The reference strain WM276 (AFCP 4) had a G1 peak at position 34.9 and a G2 peak at position 59.5. The G2 peak of the haploid reference strains coincided with the G1 peak of AMC770616, AMC2010404 and AMC2011225 (Figure 1), which were placed at 66.5, 52.1 and 52.3, respectively. The G2 peaks were located at position 125.4, 107.0 and 97.8 for respectively strains AMC770616, AMC2010404 and AMC2011225.

bovers_V4.indd 90 25-10-2007 10:15:44 Chapter 4: C. neoformans – C. gattii BD hybrid

Fig. 1. Analysis of ploidy. The first peak corresponds to the G1 phase and the second peak corresponds 4 to the G2 phase. Haploid strain B3501 is represented by the dashed line and the putative hybrid strain AMC770616 is represented by the full line.

The number of nuclei per cell was determined for all putative hybrid strains by DAPI staining. Cells were globose, subglobose to ellipsoidal, and all cells were monokaryotic (Figure 2).

Fig. 2. Cell morphology and nuclear staining by DAPI. Cell morphology of AMC770616 (A) and AMC2010404 (B) shows that they are globose, subglobose to ellipsoidal. DAPI staining of the nucleus in cells of strain AMC770616 (C) and AMC2010404 (D) reveals that cells of both strains are monokaryotic. Bar represents 10µm.

bovers_V4.indd 91 25-10-2007 10:15:46 Chapter 4: C. neoformans – C. gattii BD hybrid

Coloration of CGB medium

After six days of culturing, CGB medium inoculated with the positive control C. gattii (CBS1622) was completely blue, while CGB medium inoculated with the negative control C. neoformans (JEC21) remained yellow. The color of the CGB medium of strain AMC770616 on day six was blue-green, but the medium turned completely blue on day fifteen. The CGB medium for strains AMC2010404 and AMC2011225 was mostly yellow on day six, but a slight blue color could be detected. On day fifteen, the medium of AMC2010404 and AMC2011225 was blue-green, while the CGB medium of JEC21 remained yellow (data not shown).

Serology

Strains AMC770616, AMC2010404 and AMC2011225 were serotyped with the Crypto Check serotyping kit. All strains agglutinated with both serum factor five (serotype B) and serum factor eight (serotype D) of the kit. This indicates that these strains are serologically BD.

AFLP genotyping

The AFLP patterns (Figure 3) of the three putative hybrid strains did not match any of the previously defined AFLP genotypes. The AFLP patterns contained fragments corresponding to fragments unique to AFLP2 (serotype D) as well as to fragments typical of AFLP4 (serotype B). This indicated that genetically the strains combined elements of both AFLP2 and AFLP4.

Fig. 3. AFLP fingerprint of the putative BD hybrid strains in duplicate (AMC770616, AMC2010404 and AMC2011225) as well as two strains for each of the putative parental AFLP genotypes (AFLP4: CBS1622 and CBS5757; AFLP2: JEC20 and JEC21). Rectangles indicate AFLP fragments occurring in all the putative BD hybrid strains and in one of the putative parental AFLP genotypes. X indicates AFLP fragments present in some of the putative BD strains and in one of the putative parental AFLP genotypes.

bovers_V4.indd 92 25-10-2007 10:15:48 Chapter 4: C. neoformans – C. gattii BD hybrid

Sequencing

Parts of the Internal Transcribed Spacer (ITS), Intergenic Spacer (IGS), Laccase (CNLAC1) and the second largest subunit of RNA polymerase II (RPB2) regions were cloned and sequenced. For all three putative BD hybrid strains thirty clones were sequenced for ITS, IGS and RPB2. At least thirteen clones were sequenced for CNLAC1. The results of the sequence analysis were the same for all three strains. All thirty ITS clones displayed the sequence corresponding to AFLP4. No AFLP2 sequences were detected. In the case of IGS, most of the clones had AFLP4 sequences; however, some AFLP2 sequences were found. Cloning of RPB2 and CNLAC1 yielded sequences of both AFLP2 and AFLP4. All sequences were submitted at GenBank (accession numbers DQ286656-DQ286676). 4

1000 )

500 Median Fluorescence Intensity (MFI

0 CNNb CNN1b CNN2d CNGCNG4c CNG5b CNG3 CNG6 Probes

770616 2010404 2011225

Fig. 4. IGS genotype analysis, based on Luminex technology, of strains AMC770616, AMC2010404 and AMC2011225. Each strain was analyzed in an assay with eight probes that was performed in duplicate. The background signal was subtracted. CNNb, CNN1b, CNN2d are probes specific for Cryptococcus neoformans in general, serotype A and serotype D, respectively. CNG, CNG4c, CNG5b, CNG3, CNG6 correspond to respectively the Cryptococcus gattii specific, AFLP4, AFLP5, AFLP6 and AFLP7 specific probes. TheC. neoformans specific probe (CNNb) as well as the serotype D (CNN2d), the C. gattii specific probe (CNG) and the AFLP4 specific probe (CNG4c) reacted with the hybrid strains.

bovers_V4.indd 93 25-10-2007 10:15:52 Chapter 4: C. neoformans – C. gattii BD hybrid

IGS genotype analysis based on Luminex technology

Four specific probes gave a positive signal for all three of the putative hybrid strains. These probes were the C. neoformans probe, the C. gattii probe, and the probes specific for AFLP2 and AFLP4 (Figure 4).

Mating- serotype PCR analysis

The putative BD hybrid strains amplified with primers specific for C. gattii (primers 660U/660L) and C. neoformans serotype D (primers JOHE2596/JOHE3240). As expected, the C. gattii-specific primers gave amplicons with C. gattii strains CBS1622 and E566. Strains CBS5467 and CBS7816, which are both serotype D, yielded PCR products with the serotype D primers (Figure 5). Amplicons were also obtained for primer set STE12a (primers STE12aF537/ STE12aR1299), specific for MATa, and for primer set STE12α (primers: STE12αF809/ STE12αR1607), which is specific for MATα. In addition, positive amplification was obtained with the serotype D-MATa (primers JOHE7273/JOHE7275) primer set. No amplicon was obtained for the serotype D-MATα primer set (primers JOHE7267/ JOHE7268). The reference strains gave amplicons with the expected primer pairs. When the STE12a primer pair was used, an amplicon was obtained for the MATa strains CBS7816 and E566, whereas the MATα strains CBS1622 and CBS5467 were

Fig. 5. Results of mating- and serotype-specific PCRs. A: Cryptococcus gattii specific PCR; B: serotype D specific PCR; C: MATa specific PCR; D: serotype D-MATa specific PCR; E: MATα specific PCR and F: serotype D-MATα specific PCR. M: marker lane 1000 bp, 800 bp, 600 bp, 400 bp and 200 bp for panels A, B, C, D and E, but in panel F: 1200 bp, 1000 bp, 800 bp, 600 bp and 400 bp. Lane 1, AMC2011225; lane 2, AMC2010404; lane 3, AMC770616; lane 4, CBS5467 (αD); lane 5, CBS7816 (aD); lane 6, CBS1622 (αB); and lane 7, E566 (aB).

bovers_V4.indd 94 25-10-2007 10:15:53 Chapter 4: C. neoformans – C. gattii BD hybrid

amplified when the STE12α primer pair was used. Amplicons were obtained for CBS7816 with the serotype D-MATa primer set and for CBS5467 with the serotype D -MATα primer set (Figure 5). The primer sets STE12α and MFα (Halliday et al., 1999), which are specific for MATα from C. gattii, also produced an amplicon for the putative BD hybrid strains (data not shown).

Discussion

Serotype AD hybrids combining elements of C. neoformans var. neoformans and C. neoformans var. grubii have been produced in laboratory crosses and have also been isolated from the environment and from patients. BD hybrids have been generated under laboratory conditions (Kwon-Chung et al., 1982b; Varma et al., 2002), but 4 although there have been some speculation about their existence in nature (Chaturvedi et al., 2002; D’Souza et al., 2004), they have not yet been found. All our results confirmed that the three isolates from the two Dutch patients are BD hybrids, that originated from plasmogamy and karyogamy between a serotype B -MATα C. gattii strain of AFLP4 and a serotype D-MATa C. neoformans strain of AFLP2. The BD hybrids described in this study correspond to 1% of the clinical C. neoformans isolates in the Netherlands obtained over the last 27 years which is an indication that BD hybrids should be found more often than they have been to date. Although a rapid screening with CGB medium (Kwon-Chung et al., 1982a) would miss these hybrids, it is odd that BD hybrids have not been described previously, since the widely used serotyping method does distinguish these BD strains. The BD hybrid strains possess two genome copies, and although in all likelihood most of the duplicated genes will eventually be lost, the presence of two copies of one gene present an opportunity for evolving new functions. Within Saccharomyces cerevisiae, which arose through whole genome duplication, it has been shown that some genes have acquired functions differing from those of the corresponding ancestral genes (Kellis et al., 2004). The genus Saccharomyces also contains some species that have arisen by hybridization, such as S. pastorianus and S. bayanus (Vaughan- Martini et al., 1985; Nguyen et al., 2000). Therefore one can speculate that the hybrid between C. neoformans and C. gattii may eventually evolve into a new species, since postzygotic isolation often occurs in hybrids. It is interesting that BD hybrids contained both AFLP2 and AFLP4 sequences for CNLAC1 and RPB2, while IGS sequence analysis yielded only a few AFLP2 clones and ITS analysis exclusively yielded AFLP4 sequences. This finding may be a chance result, but it may also be a result of concerted evolution, leading to homogenization of

bovers_V4.indd 95 25-10-2007 10:15:54 Chapter 4: C. neoformans – C. gattii BD hybrid

DNA sequences that belong to a repetitive family, in this case rDNA. The occurrence of concerted evolution has been detected in a number of different organisms, e.g. Escherichia coli, Haemophilus influenzae, Drosophila melanogaster, Xenopus laevis, X. mulleri and Arabidopsis thaliana (Liao, 1999). Two scenarios can be proposed to explain the formation of our diploid hybrid strains. One is somatic fusion followed by karyogamy of a serotype B-MATα cell and a serotype D-MATa cell. Another is the mating of a serotype B-MATα strain and a serotype D-MATa strain in a cross giving rise to diploid rather than haploid basidiospores. How our hybrid strains actually were formed remains to be elucidated. Curiously, all hybrids found in the C. neoformans – C. gattii species complex (both AD and BD), have a serotype D parental strain, implying that serotype D strains might be more sexually compatible with other genotypic groups in the C. neoformans – C. gattii species complex than the other genotypes. The existence of BD hybrids is not only scientifically interesting, but may also have implications for human health. A hybrid between C. neoformans and C. gattii might become a ‘superpathogen’, that has a worldwide distribution like C. neoformans, and is able to infect immunocompetent humans like C. gattii, thus combining the characteristics of both species. All of our BD hybrid strains were isolated from patients. This shows that these strains can cause disease, but further investigation is needed to determine whether these strains are distinct in their virulence properties.

Acknowledgements

We would like to thank RC May and RC Summerbell for critically reading the manuscript and M Bovers would like to thank the “Odo van Vloten fonds” and the Netherlands-Florida Scholarship Foundation for funding.

bovers_V4.indd 96 25-10-2007 10:15:55 Chapter 4: C. neoformans – C. gattii BD hybrid

References

Baró T, Torres-Rodríguez JM, Hermoso de Mendoza M, Morera Y and Alía C (1998) First identification of autochthonousCryptococcus neoformans var. gattii isolated from goats with predominantly severe pulmonary disease in Spain. J. Clin. Microbiol. 36: 458-461. Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman J, Rivera ING and Paula CR (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J. Clin. Microbiol. 42: 1356-1359 Biswas SK, Wang L, Yokoyama K and Nishimura K (2003) Molecular analysis of Cryptococcus neoformans mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 41: 5572-5576. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WCJ, Abeln ECA, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891-907. Bolano A, Stinchi S, Preziosi R, Bistoni F, Allegrucci M, Baldelli F, Martini A and Cardinali G (2001) Rapid methods to extract DNA and RNA from Cryptococcus neoformans. FEMS Yeast Res. 1: 221-224. Butler MI and Poulter RTM (2005) The PRP8 inteins in Cryptococcus are a source of phylogenetic and epidemiological information. Fungal Genet. Biol. 42: 452-463. 4 Casadevall A and Perfect JR (1998) Cryptococcus neoformans. ASM press, Washington, USA. Chaturvedi V, Fan J, Stein B, Behr MJ, Samsonoff WA, Wickes BL and Chaturvedi S (2002) Molecular genetic analyses of mating pheromones reveal intervariety mating or hybridization in Cryptococcus neoformans. Infect. Immun. 70: 5225-5235. Colom MF, Frasés S, Ferrer C, Jover A, Andreu M, Reus S, Sánchez M and Torres-Rodríguez JM (2005) First case of human Cryptococcosis due to Cryptococcus neoformans var. gattii in Spain. J. Clin. Microbiol. 43: 3548-3550. Darzynkiewicz Z, Crissman HA and Robinson JP (1994) Methods in Cell Biology. Flow Cytometry. Volume II (2nd edition). Academic Press, San Diego, USA. Diaz MR and Fell JW (2005) Use of a suspension array for rapid identification of the varieties and genotypes of the Cryptococcus neoformans species complex. J. Clin. Microbiol. 43: 3662- 3672. Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5:1129-1140. Diaz MR, Boekhout T, Theelen B and Fell JW (2000) Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. D’Souza CA, Hagen F, Boekhout T, Cox GM and Heitman J (2004) Investigation of the basis of virulence in serotype A strains of Cryptococcus neoformans from apparently immunocompetent individuals. Curr. Genet. 46: 92-102. Fulton R, McDade R, Smith P, Kienker L and Kettman J (1997) Advanced multiplexed analysis with the FlowMetrix system. Clin. Chem. 43: 1749-1756. Halliday CL, Bui T, Krockenberger M, Malik R, Ellis DH and Carter DA (1999) Presence of α and a mating types in environmental and clinical collections of Cryptococcus neoformans var. gattii strains from Australia. J. Clin. Microbiol. 37: 2920-2926. Kellis M, Birren BW and Lander ES (2004) Proof and evolutionary analysis of ancient genome duplication in the yeast Saccharomyces cerevisiae. Nature 428: 617-624. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, MacDougall L, Boekhout T, Kwon-Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Colombia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263.

bovers_V4.indd 97 25-10-2007 10:15:56 Chapter 4: C. neoformans – C. gattii BD hybrid

Kwon-Chung KJ and Bennett JE (1984) Epidemiological differences between the two varieties of Cryptococcus neoformans. Am. J. Epidemiol. 120: 123-130. Kwon-Chung KJ, Polacheck I and Bennett JE (1982a) Improved diagnostic medium for separation of Cryptococcus neoformans var. neoformans (serotypes A and D) and Cryptococcus neoformans var. gattii (serotypes B and C). J. Clin. Microbiol. 15:535-537. Kwon-Chung KJ, Bennett, JE and Rhodes JC (1982b) Taxonomic studies on Filobasidiella species and their anamorphs. Antonie van Leeuwenhoek 48: 25-38. Kwon-Chung KJ, Boekhout T, Fell JW and Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804-806. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Lengeler KB, Cox, GM and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122. Liao D (1999) Concerted evolution: molecular mechanism and biological implications. Am. J. Hum. Genet. 64: 24-30. Matheny PB (2005) Improving phylogenetic inference of mushrooms with RPB1 and RPB2 nucleotide sequences (Inocybe; Agaricales). Mol. Phylogenet. Evol. 35: 1-20. Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, Viviani MA, Chindamporn A, Sukroongreung S, John MA, Ellis DH and Sorrell TC (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA - a pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 20: 1790-1799. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal study group (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195. Meyer W, Kidd S, Castañeda A, Jackson S, Huynh M, Latouche GN, Marszewska K, Castañeda E and the South American/Spanish Cryptococcal Study Group (2002) Global molecular epidemiology offers hints towards ongoing speciation within Cryptococcus neoformans. Abstract 5th International Conference on Cryptococcus and Cryptococcosis. Adelaide, Australia, p 88-89. Montagna MT, Viviani MA, Pulito A, Aralla C, Tortorano AM, Fiore L and Barbuti S (1997) Cryptococcus neoformans var. gattii in Italy. Note II. Environmental investigation related to an autochtonous clinical case in Apulia. J. Mycol. Méd. 7: 93-96. Nguyen HV, Lépingle A and Gaillardin C (2000) Molecular typing demonstrates homogeneity of Saccharomyces uvarum and reveals the existence of hybrids between S. uvarum and S. cerevisiae, including the S. bayanus type strain CBS 380. Syst. Appl. Microbiol. 23: 71-85. Ruma P, Chen SC, Sorrell TC and Brownlee AG (1996) Characterization of Cryptococcus neoformans by random DNA amplification. Lett. Appl. Microbiol.23: 312-316. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Sorrell TC (2001) Cryptococcus neoformans variety gattii. Med. Mycol. 39: 155-168. Sorrell TC, Chen SCA, Ruma P, Meyer W, Pfeiffer TJ, Ellis DH and Brownlee AG (1996) Concordance of clinical and environmental isolates of Cryptococcus neoformans var. gattii by random amplification of polymorphic DNA analysis and PCR fingerprinting. J.Clin. Microbiol. 34: 1253-1260. Sugita T, Ikeda R and Shinoda T (2001) Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol. Immunol. 45: 757-768.

bovers_V4.indd 98 25-10-2007 10:15:57 Chapter 4: C. neoformans – C. gattii BD hybrid

Varma A, Boekhout R, Diaz M, Fell J and Kwon-Chung J (2002) Genetic analysis of the progeny obtained from a cross between a Cryptococcus neoformans var. gattii type strain and a serotype D reference strain of Cryptococcus neoformans var. neoformans. Abstract American Society for Microbiology 102nd General Meeting. Salt Lake City, USA, p 202. Vaughan-Martini A and Kurtzman CP (1985) Deoxyribonucleic acid relatedness among species of Saccharomyces sensu stricto. Int. J. Syst. Bacteriol. 35: 508-511. Velegraki A, Kiosses VG, Pitsouni H, Toukas D, Daniilidis VD and Legakis NJ (2001) First report of Cryptococcus neoformans var. gattii serotype B from Greece. Med. Mycol. 39: 419-422. Xu J, Vilgalys R and Mitchell TG (2000) Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 9: 1471- 1481.

bovers_V4.indd 99 25-10-2007 10:15:57 bovers_V4.indd 100 25-10-2007 10:15:58 Chapter 5

Promiscuous mating of Cryptococcus

neoformans and Cryptococcus gattii:

discovery of a novel AB hybrid

M Bovers1, F Hagen1, EE Kuramae1, HL Hoogveld2, F Dromer3, G St-Germain4, T Boekhout1,5

1CBS - Fungal Biodiversity Centre, Utrecht, The Netherlands; 2Netherlands Institute of Ecology (NIOO-KNAW), Centre for Limnology, Nieuwersluis, The Netherlands; 3Unité de Mycologie Moléculaire, CNRS FRE2849, Centre National de Référence Mycologie et Antifongiques, Institut Pasteur, Paris, France; 4Laboratoire Santé Publique Québec, Sainte- Anne-de-Bellevue, Quebec, Canada; 5Department of Internal Medicine and Infectious Diseases, University Medical Centre Utrecht, Utrecht, The Netherlands.

bovers_V4.indd 101 25-10-2007 10:15:58 Chapter 5: C. neoformans – C. gattii AB hybrid

Summary

The closely related pathogenic yeasts Cryptococcus neoformans and Cryptococcus gattii differ in host range and geographic occurrence. Hybrids between the two varieties of C. neoformans are found regularly, but C. neoformans × C. gattii hybrid isolates have only recently been described. In this study we describe a novel C. neoformans × C. gattii hybrid isolate, which had previously been identified as C. gattii. Flow cytometry, serotyping, Amplified Fragment Length Polymorphism (AFLP) analysis, multi-locus sequence typing, and mating- and serotype specific PCRs were used to study this isolate. All results indicated that this isolate is a serotype AB hybrid between C. neoformans var. grubii-AFLP1-serotype A and C. gattii-AFLP4-serotype B. Furthermore, sequencing results showed that the C. gattii parent of all currently known C. neoformans × C. gattii hybrids belongs to a specific subgroup of C. gattii- AFLP4.

102

bovers_V4.indd 102 25-10-2007 10:15:58 Chapter 5: C. neoformans – C. gattii AB hybrid

Introduction

Cryptococcus neoformans and Cryptococcus gattii are pathogenic yeasts that both may cause meningoencephalitis. They differ, however, in their host range and geographic occurrence. Cryptococcus neoformans primarily infects immunocompromised patients, such as AIDS patients, whereas C. gattii mainly infects otherwise healthy individuals (Speed and Dunt, 1995; Mitchell et al., 1995; Casadevall and Perfect, 1998; Sorrell, 2001). Cryptococcus neoformans occurs worldwide, whereas C. gattii was thought to occur only in (sub)tropical regions (Kwon-Chung and Bennett, 1984). However, the recent outbreak of C. gattii on Vancouver Island, Canada (Stephen et al., 2002; Kidd et al., 2004), as well as the identification of C. gattii isolates in Italy, Spain, Greece and in a temperate climate zone in Colombia (Montagna et al., 1997; Baró et al., 1998; Velegraki et al., 2001; Colom et al., 2005; Escandón et al., 2006) show that C. gattii is also able to occur in more temperate regions. Several molecular techniques, e.g. Amplified Fragment Length Polymorphism (AFLP) analysis, can be used to discern six haploid genotypic groups within C. neoformans and C. gattii (Ruma et al., 1996; Boekhout et al., 2001; Chaturvedi et al., 5 2002; Biswas et al., 2003; Latouche et al., 2003; Meyer et al., 2003; Butler and Poulter, 2005; Diaz et al., 2005). Although the two haploid genotypic groups present within C. neoformans have been recognized as separate varieties, namely var. grubii (serotype A=AFLP1) and var. neoformans (serotype D=AFLP2) (Franzot et al., 1999), the four genotypic groups within C. gattii (AFLP4/5/6/7), which all consist of both serotype B and C isolates (Meyer et al., 2003), have not been described as separate taxa. Cryptococcus neoformans and C. gattii predominantly reproduce asexually, but they also possess a bipolar mating system with mating types MATa and MATα (Kwon-Chung, 1976). Mating between C. neoformans var. grubii (serotype A) and var. neoformans (serotype D) may result in serotype AD hybrid progeny (Tanaka et al., 1999; Lengeler et al., 2001; Tanaka et al., 2003, Cogliati et al., 2006; Kwon-Chung and Varma, 2006), whereas serotype BD hybrids may be formed by mating between C. neoformans var. neoformans and C. gattii (Kwon-Chung and Varma, 2006). Recently, three serotype BD C. neoformans var. neoformans × C. gattii hybrid isolates have been isolated from two Dutch patients (Bovers et al., 2006). However, other types of C. neoformans × C. gattii hybrid isolates have not been found yet. This paper is the first description of a clinical C. neoformans var. grubii-serotype A × C. gattii-serotype B hybrid isolate.

103

bovers_V4.indd 103 25-10-2007 10:15:59 Chapter 5: C. neoformans – C. gattii AB hybrid

Materials and Methods

Strains

Isolate LSPQ#308 (=CBS10496) was isolated from a Canadian AIDS patient, who traveled to Mexico approximately 15 months before cryptococcosis was diagnosed. Unfortunately, the patient died despite of the treatment. Isolate LSPQ#308 has previously been identified as a C. gattii isolate (cited as C. neoformans var. gattii) and was found to belong to serotype B (St-Germain et al., 1988). The reference strains included representatives of the two putative parental groups of isolate LSPQ#308, and all the currently isolated C. neoformans × C. gattii hybrids. Isolates CBS1622, CBS6992, CBS9172, E566, H99, WM276, AMC770616 (=CBS10488), AMC2010404 (=CBS10489) and AMC2011225 (=CBS10490) were used as reference strains. All isolates used in this study are described in Table 1.

Table 1. Summary of the strains used in this study. The origin and genetic make-up of the strains are indicated.

Strain* Mating-/ Serotype† AFLP genotype Origin CBS9172 aA 1 Soil sample in garden of patient with neighboring bird colonies, Italy H99 αA 1 Patient with Hodgkin’s disease, USA CBS1622 αB 4 Tumour, France CBS6992 αB 4 Man E566 aB 4 Eucalyptus camaldulensis, Australia WM276 αB 4 Debris of Eucalyptus tereticornis, Australia AMC770616 aD-αB 8 Human CSF, the Netherlands (= CBS10488) AMC2010404 aD-αB 8 Human CSF, the Netherlands (= CBS10489) AMC2011225 aD-αB 8 Human CSF, the Netherlands (= CBS10490) LSPQ#308 αA-?B 9 Human blood, Canada (= CBS10496)

*AMC = Netherlands Reference Laboratory for Bacterial Meningitis, Academic Medical Center, Amsterdam, The Netherlands; CBS = CBS - Fungal Biodiversity Centre, Utrecht, The Netherlands; † ? = mating type unknown.

Ploidy analysis, nuclear staining, CGB medium and serology

The ploidy of isolate LSPQ#308 was determined by flow cytometry as described in Bovers et al. (2006). Briefly, cells were grown in YPG (1% yeast extract, 1% pepton, 2% d-glucose) supplemented with 0.5 M sodium chloride. Propidium iodide was used to quantitatively stain the DNA present in the cells (Darzynkiewicz et al., 1994) and a MoFloTM High- Performance Cell Sorter (Dako Cytomation) was used to measure the fluorescence of at least 15,000 individual cells. The wavelength of the exciting laser beam was 488 nm and

104

bovers_V4.indd 104 25-10-2007 10:16:00 Chapter 5: C. neoformans – C. gattii AB hybrid

fluorescence was measured at 670 nm. The data was represented as a graph where the x-axis represents the fluorescence intensity (logarithmic) and the y-axis represents the amount of measured cells. The ploidy of the isolate was determined by comparison of the obtained results with the results of haploid reference strains H99 and WM276. Nuclei were visualized by staining LSPQ#308 cells with DAPI (4’,6-diamidino- 2-phenylindole) as described in Bovers et al. (2006). Cells were incubated for three hours in a DAPI solution before examination of the stained nuclei with an Axioskop fluorescence microscope and filter set 01 (both: Carl Zeiss). Furthermore, the reaction of isolate LSPQ#308 on CGB medium (Kwon-Chung et al., 1982) was determined at day six and fifteen of culturing at 24 ºC. In addition, the serotype of isolate LSPQ#308 was determined with the Crypto Check serotyping kit (Iatron Laboratories) according to the manufacturer’s instructions.

DNA isolation, AFLP and sequence analysis

Ten single colonies of isolate LSPQ#308 were used for DNA extraction according to Bovers et al. (2006). DNA of these colonies was used for AFLP analysis (Boekhout 5 et al., 2001). The AFLP fingerprint was compared to AFLP fingerprints from AFLP1 reference strains H99 and CBS9172, and AFLP4 reference strains E566 and WM276. The partial sequence of six nuclear regions was determined for isolates LSPQ#308, AMC770616, AMC2011225, AMC2010404, CBS1622 and CBS6992. The selected nuclear regions were Internal Transcribed Spacer (ITS), Intergenic Spacer (IGS), Laccase (CNLAC1), the largest and second largest subunit of RNA polymerase II (RPB1 and RPB2) and Translation Elongation Factor 1α (TEF1α). In addition, two mitochondrial regions, i.e. ATP synthase subunit 6 (ATP6) and mitochondrial large ribosomal subunit RNA (MtLrRNA) were partially sequenced. All PCR reactions were carried out in a total volume of 50 μl containing 0.2 mM dNTPs, 0.6 μM of both primers, 1.0 U Taq DNA polymerase (Gentaur) and 1-2 μl genomic DNA. Primer sequences, buffer composition and amplification conditions are listed in Table 2. Amplicons were purified with the GFXTM PCR DNA and Gel Band Purification Kit (Amersham Biosciences). Purified amplicons of mitochondrial regions ATP6 and MtLrRNA, as well as amplicons obtained for isolates CBS1622 and CBS6992, were directly used for sequencing. Purified amplicons of nuclear regions of isolates LSPQ#308, AMC770616, AMC2012225 and AMC2010404 were first cloned into Escherichia coli DH5α cells using the TA Cloning® Kit (Invitrogen) according to the manufacturer’s instructions. Randomly picked clones, with a maximum of thirty clones, were amplified and sequenced until two alleles were found. Sequencing reactions were carried out with the Big Dye v3.1 Chemistry kit (Applied Biosystems) using primers that had been used in the initial PCR reactions. An ABI 3700XL DNA analyzer (Applied Biosystems) was used to determine the sequences.

105

bovers_V4.indd 105 25-10-2007 10:16:01 Chapter 5: C. neoformans – C. gattii AB hybrid Amplification conditions extension step of 72ºC for 7 min. extension step of 72ºC for 5 min. final extension step of 72ºC for 5 min. final extension step of 72ºC for 7 min. final extension step of 72ºC for 7 min. final extension step of 72ºC for 7 min. final extension step of 72 ºC for 7 min. final extension step of 72 ºC for 7 min. 94ºC for 5 min, followed by 40 cycli of 94ºC for 3 min, followed by 35 cycli of 94ºC for 3 min, followed by 35 cycli of 94ºC for 5 min, followed by 35 cycli of 94 ºC for 5 min, followed by 35 cycli of 94 ºC for 3 min, followed by 35 cycli of 1 min, 57ºC for min and 72ºC 3 with a 1 min, 50ºC for min and 72ºC with a 1 min, 57ºC for min and 72ºC 2 with a 1 min, 62ºC for min and 72ºC 2 with a 1 min, 54 ºC for min and 72 2 with a 1 min, 50 ºC for min and 72 with a 94ºC for 5 min, followed by 35 cycli of 45 96ºC for 5 min, followed by 35 cycli of 30 sec, 52ºC for 1 min and 72ºC 2 min, with a final sec, 59ºC for 30 sec and 72ºC 2 min, with a final , 2005). et al. , 5 nM EDTA, pH 8.8 , 5 nM EDTA, pH 8.3 , 5 nM EDTA, , 5 nM EDTA, pH 8.8 , 5 nM EDTA, , 0.01% gelatin, 0.1% , 0.01% gelatin, 0.1% , 0.01% gelatin, 0.1% , 0.01% gelatin, 0.1% , 0.01% gelatin, 0.1% 2 2 2 2 2 2 2 2 (1 × PCR buffer) Buffer composition Triton X-100, pH 8.3 Triton X-100, pH 8.3 Triton Triton X-100, pH 8.3 Triton X-100, pH 8.3 Triton X-100, pH 8.3 Triton strain JEC21 (Loftus mM MgCl mM MgCl mM MgCl 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, 50 mM KCl, 1.5 10 mM Tris-HCl, mM MgCl mM MgCl mM MgCl mM MgCl mM MgCl 10.4 mM Tris-HCl, 75 mM KCl, 1.5 10.4 mM Tris-HCl, 75 mM KCl, 3.5 10.4 mM Tris-HCl, 10.4 mM Tris-HCl, 75 mM KCl, 3.5 10.4 mM Tris-HCl, (1990) (2000) (2006) (1990) neoformans Reference Diaz et al. This study This study White et al. White et al. Xu et al. (2000) Liu et al. (2006) Litvintseva et al. var. var. Cryptococcus neoformans Primer sequences (5’-3’) LAC-F: GGCGATACTATTATCGTA IG2R: ATGCATAGAAAGCTGTTGG ITS4: TCCTCCGCTTATTGATATGC LAC-R: TTCTGGAGTGGCTAGAGC ITS1: TCCGTAGGTGAACCTGCGG IG1F: CAGACGACTTGAATGGGAACG TEF1-F: AATCGTCAAGGAGACCAACG TEF1-R: CGTCACCAGACTTGACGAAC RPB1-Af: GARTGYCCDGGDCAYTTYGG ATP6-F: ATTACATCTCCACTAGAACAATTC ATP6-F: RPB1-Cf: CCNGCDATNTCRTTRTCCATRTA MtLrRNA-F: GACCCTATGCAGCTTCTACTG ATP6-R: AGTTCAATGGCATCCTTGATATAG ATP6-R: MtLrRNA-R: TTATCCCTAGCGTAACTTTTATC RPB2-Fcrypto: TGGGGYATGGTTTGTCCKGC RPB2-Rcrypto: CCCATGGCTTGTTTRCCCATYGC ) ) RPB1 α TEF1 ( α ) ATP6 )

Overview of sequenced regions, primers and their references, buffer composition and amplification conditions. The chromosomal location of the CNLAC1

) RPB2 Second largest subunit of RNA polymerase II mitochondrial Table 2. Table sequenced region was based on the genome of Region and Chromosomal location Internal transcribed spacer 1and 2 including 5.8S rDNA (ITS) chromosome 2 Intergenic spacer (IGS) chromosome 2 chromosome 7 chromosome 5 Laccase ( Largest subunit of RNA polymerase II ( ( chromosome 4 elongation factor 1 Translation chromosome 13 synthase subunit 6 ( ATP (MtLrRNA) mitochondrial Mitochondrial large ribosomal subunit RNA

106

bovers_V4.indd 106 25-10-2007 10:16:02 Chapter 5: C. neoformans – C. gattii AB hybrid

Mating-serotype analysis

Several specific PCRs were used to determine the mating- and serotype of isolate LSPQ#308 and selected reference strains. MATα (STE12αF809/STE12αR1607) and MATa (STE12aF537/STE12aR1299) specific PCRs were carried out as described in Bovers et al. (2006). In addition, serotype A-MATa (JOHE7270/JOHE7272) and serotype A-MATα (JOHE7264/JOHE7265) specific primers (Barreto de Oliveira et al., 2004) were used as well. The latter two reactions were carried out in 20 μl volumes

containing 1 × PCR buffer (10.4 mM Tris-HCl, 25 mM KCl, 3.5 mM MgCl2, 5 nM EDTA, pH 9.2), 0.1 mM dNTPs, 0.5 U Taq DNA polymerase (Gentaur), 0.5 μM of both primers and 1 μl genomic DNA. Amplification conditions were 96 ºC for 5 min, followed by 30 cycles of 96 ºC for 15 sec, 66 ºC for 15 sec and 72 ºC for 1 min, with a final extension step of 72 ºC for 5 min. Furthermore, a C. gattii (JOHE7773/JOHE7775) specific PCR reaction was performed (D’Souza et al., 2004) in a total volume of 20 μl,

containing 1 × PCR buffer (10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, pH 8.3), 0.1 mM dNTPs, 0.5 U Taq DNA polymerase (Gentaur), 0.5 μM of both primers and 1 μl genomic DNA. Amplification conditions were 94 ºC for 5 5 min, followed by 35 cycles of 94 ºC for 30 sec, 52 ºC for 30 sec and 72 ºC for 1 min, with a final extension step of 72 ºC for 5 min. Amplicons obtained with the MATα-specific primer pair were purified and used for cloning and sequencing as described above.

Results

Ploidy analysis, nuclear staining, CGB medium and serology

The DNA content of isolate LSPQ#308, as determined by flow cytometry, was compared to the DNA content of haploid reference strains H99 and WM276. The G1 peak of the reference strains was located at position 31.6 for isolate H99 and 31.1 for isolate WM276, whereas the G2 peak was placed at position 65.8 for isolate H99 and 56.4 for isolate WM276. The G1 peak of isolate LSPQ#308 was located at position 57.5 and the G2 peak was placed at position 115.7. Thus, the G1 peak of LSPQ#308 coincided with the G2 peak of the haploid reference strains (Figure 1), which indicates that LSPQ#308 has approximately twice the amount of DNA when compared to the haploid strains. We therefore concluded that isolate LSPQ#308 is diploid or aneuploid. In addition, cells of isolate LSPQ#308 were stained with DAPI to determine the number of nuclei per cell. All cells were monokaryotic (Figure 2). The reaction of isolate LSPQ#308 on CGB medium was negative, no color change was observed, which corresponds to a C. neoformans response. The Crypto Check

107

bovers_V4.indd 107 25-10-2007 10:16:03 Chapter 5: C. neoformans – C. gattii AB hybrid

serotyping kit was used to determine the serotype of isolate LSPQ#308. Serum factors five (serotype B) and seven (serotype A) agglutinated. These results indicated that LSPQ#308 is a serotype AB strain.

Fig. 1. Flow cytometry was used to determine the ploidy of isolate LSPQ#308. The first peak corresponds to the G1 phase and the second peak corresponds to the G2 phase. Haploid reference strain WM276 is represented by a dashed line and LSPQ#308 is shown by the solid line. The G1 peak of LSPQ#308 coincided with the G2 peak of strain WM276, which indicated that strain LSPQ#308 has approximately twice the amount of DNA when compared to WM276.

Fig. 2. Nuclear DAPI staining of isolate LSPQ#308 showed that the cells were monokaryotic. Bar represents 10 μm.

108

bovers_V4.indd 108 25-10-2007 10:16:03 Chapter 5: C. neoformans – C. gattii AB hybrid

AFLP and sequence analyses

The AFLP fingerprint obtained by analysis of ten single colonies of isolate LSPQ#308 did not match any of the previously defined AFLP genotypes. The fingerprint of isolate LSPQ#308 was compared to AFLP fingerprints of reference strains H99 and CBS9172, which are both AFLP1 strains, and E566 and WM276, which are both AFLP4 strains. The AFLP fingerprint of isolate LSPQ#308 contained fragments characteristic of both AFLP1 and AFLP4 (Figure 3), which indicated that genetic material from these two genotypes is present in this isolate. Two alleles, namely an AFLP1 and an AFLP4 allele, were found when fragments of RPB1, RPB2, CNLAC1 and IGS of isolate LSPQ#308 were cloned and sequenced. However, even after sequencing thirty clones, only one allele was obtained for TEF1α, i.e. the AFLP4 allele, and ITS, i.e. the AFLP1 allele. An AFLP4 sequence was obtained when the mitochondrial regions ATP6 and MtLrRNA were sequenced. Isolates AMC770616, AMC2011225 and AMC2010404 possessed two alleles of RPB1, RPB2, CNLAC1, TEF1α and IGS, namely an AFLP2 and an AFLP4 allele. However, they possessed only a single ITS allele, namely an AFLP4 allele. The mitochondrial 5 regions of isolate AMC770616 had AFLP4 sequences, whereas the mitochondrial regions of isolates AMC2012255 and AMC2010404 had AFLP2 sequences. Isolates CBS1622 and CBS6992 possessed an AFLP4 allele for all studied regions, i. e. RPB1, RPB2, CNLAC1, TEF1α, ITS, IGS, ATP6 and MtLrRNA. Our results indicated that genetic material from both AFLP1 and AFLP4 were present in isolate LSPQ#308, although only one allele was obtained for TEF1α and ITS. Furthermore, our data showed that the mitochondria of LSPQ#308 were inherited from the C. gattii-AFLP4 parent. Isolates AMC770616, AMC2011225 and AMC2010404 possessed alleles of both AFLP2 and AFLP4, although only the AFLP4 ITS allele could be found. Furthermore, our data showed that the mitochondria of isolate AMC770616 were derived from the C. neoformans var. neoformans (AFLP2) parent, whereas the mitochondria of isolates AMC2011225 and AMC2010404 were inherited from the C. gattii-AFLP4 parent. Isolates CBS1622 and CBS6992 possessed C. gattii-AFLP4 alleles. All sequences were submitted at GenBank (accession numbers DQ286656-DQ286676 and EF102027-EF102072).

Mating-serotype analysis

Amplification of isolate LSPQ#308 with the MATα and the serotype A-MATα specific primer pair resulted in an amplicon. When the MATa and the serotype A -MATa specific PCRs were carried out, no amplicon was obtained. These results indicated that isolate LSPQ#308 has a serotype A-MATα background. All reference

109

bovers_V4.indd 109 25-10-2007 10:16:04 Chapter 5: C. neoformans – C. gattii AB hybrid

Fig. 3. AFLP fingerprint of three single colonies of isolate LSPQ#308 and four reference strains. CBS9172 and H99 are both Cryptococcus neoformans var. grubii (AFLP1) strains, E566 and WM276 are both Cryptococcus gattii (AFLP4) strains. Rectangles indicate AFLP fragments characteristic for AFLP1 or AFLP4 and present in isolate LSPQ#308.

Fig. 4. Mating- and serotype specific PCRs were performed on reference strains CBS9172 (serotype A-MATa); H99 (serotype A-MATα); E566 (serotype B-MATa); WM276 (serotype B-MATα) and on isolate LSPQ#308.

110

bovers_V4.indd 110 25-10-2007 10:16:06 Chapter 5: C. neoformans – C. gattii AB hybrid

strains gave amplicons with the expected primer pairs. H99, a serotype A-MATα strain, was amplified with the MATα and the serotype A-MATα specific primer pairs. CBS9172, a serotype A-MATa strain, yielded amplicons when the MATa and the MATa-serotype A specific PCRs were carried out. In addition, WM276, a serotype B-MATα strain, was amplified with the MATα specific primer pair, and E566, a serotype B-MATa strain, yielded an amplicon when the MATa specific PCR was performed. Furthermore, the C. gattii-specific primer pair (JOHE7773/JOHE7775), which generates a C. gattii-specific amplicon of approximately 1 kb, was used to amplify isolate LSPQ#308. An amplicon of approximately 1 kb was observed. However, an additional product of approximately 400 bp was also present. When this primer set was used to amplify the C. gattii strains E566 and WM276, the expected 1 kb amplicon was obtained. Interestingly, when the C. gattii specific PCR was carried out with the two C. neoformans var. grubii strains CBS9172 and H99, the amplicon of approximately 400 bp was obtained. Apparently, the amplicon of approximately 400 bp is a C. neoformans var. grubii specific product. The amplification of this product in isolate LSPQ#308 indicated that this isolate has a C. neoformans var. grubii (serotype 5 A) background. The results of the mating- and serotype specific PCRs indicated that both a C. gattii and a serotype A-MATα background are present in isolate LSPQ#308 (Figure 4). Because the mating type of the C. gattii background within isolate LSPQ#308 was unknown, thirty MATα clones of isolate LSPQ#308 were sequenced to investigate if a serotype B-MATα allele could be identified. However, all clones were serotype A- MATα, no serotype B-MATα clones were found.

Discussion

Our results indicated that isolate LSPQ#308 is a monokaryotic, diploid or aneuploid strain. When the serotype of this isolate was determined, it was found to be serotype AB. Furthermore, AFLP as well as extensive sequence analysis showed that the isolate contained fragments of both C. neoformans var. grubii (AFLP1) and C. gattii (AFLP4). Therefore, we conclude that this isolate is a novel hybrid between C. neoformans var. grubii (serotype A-AFLP1) and C. gattii (serotype B-AFLP4). LSPQ#308 had previously been identified as a C. gattii isolate based on a weak positive reaction on CGB medium (St-Germain et al., 1988). However, our results indicated that LSPQ#308 was negative on CGB medium. Although a negative response on CGB medium has been shown for other C. neoformans × C. gattii hybrids (St- Germain et al., 1988; Kwon-Chung and Varma, 2006), the presence of a weak positive

111

bovers_V4.indd 111 25-10-2007 10:16:06 Chapter 5: C. neoformans – C. gattii AB hybrid

reaction on CGB medium seems to be associated with the presence of a C. neoformans × C. gattii hybrid isolate (Bovers et al., 2006; Kwon-Chung and Varma, 2006). Isolate LSPQ#308 had been identified as a serotype B isolate by St-Germain et al. (1988). However, our results show that it belongs to serotype AB. Inconsistent serotyping results have also been reported for other serotype AD hybrids (Viviani et al., 1997; Kwon-Chung and Varma, 2006) and may result from differences in specificity and potency among different batches of factor sera. All currently known hybrids within the C. neoformans – C. gattii species complex, i. e. the serotype AD and BD hybrids, have been isolated from patients or the environment and could also be generated in laboratory crosses (Tanaka et al., 1999; Lengeler et al., 2001; Tanaka et al., 2003, Cogliati et al., 2006; Kwon-Chung and Varma, 2006). Furthermore, hybrids usually possess both the MATa and the MATα allele (Lengeler et al., 2001; Cogliati et al., 2001; Yan et al., 2002; Tanaka et al., 2003). This indicates that all these hybrids result from mating. Therefore we expected that the hybrid isolate LSPQ#308 would possess two mating-type loci. However, when the mating- and serotype composition of isolate LSPQ#308 was determined only a serotype A MATα background was observed. Although an amplicon was obtained with the C. gattii specific primer pair, the C. gattii background could not be linked to a mating type. Interestingly, C. gattii-AFLP4 sequences were obtained when the mitochondrial regions were sequenced. The mitochondria are usually inherited from the MATa parent (Yan and Xu, 2003), which would indicate that a C. gattii MATa strain contributed to the formation of isolate LSPQ#308. We therefore concluded that the serotype AB C. neoformans × C. gattii hybrid isolate LSPQ#308 was probably formed by mating of a serotype B-MATa with a serotype A-MATα strain, and subsequent loss of the serotype B-MATa allele. The detection of a single ITS and TEF1α allele in the serotype AB C. neoformans × C. gattii hybrid isolate further strengthens this hypothesis, as it indicates that other alleles were lost as well. The loss of genetic material has also been observed in serotype AD and BD hybrids (Cogliati et al., 2001; Lengeler et al., 2001; Cogliati et al., 2006; Kwon-Chung and Varma, 2006) and seems to be a normal process occurring in cryptococcal hybrids. Interestingly, our results show that the C. gattii parent of the serotype AB C. neoformans × C. gattii hybrid belongs to the AFLP4 genotype, as was the case for the serotype BD C. neoformans × C. gattii hybrids (Bovers et al., 2006). Intriguingly, the C. gattii parental sequence of all serotype BD C. neoformans × C. gattii hybrid isolates was identical to the sequence of AFLP4 strains CBS1622 and CBS6992 for all studied regions. Furthermore, the sequence of the C. gattii parent of the serotype AB hybrid differed at only one position in a total of 3,954 nucleotides from the above mentioned sequences. The detection of one specific C. gattii-AFLP4 subgroup in all isolated C. neoformans × C. gattii hybrids may indicate that this subgroup contains more

112

bovers_V4.indd 112 25-10-2007 10:16:07 Chapter 5: C. neoformans – C. gattii AB hybrid

vigorous maters. Future mating experiments should determine the mating capability of this subgroup and, if an increased mating capability is found, the responsible mechanism should be elucidated. Phylogenetic studies of the C. neoformans – C. gattii species complex show that the C. gattii-AFLP4 genotype is relatively distant from C. neoformans (Diaz et al., 2000; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Butler and Poulter, 2005; Diaz et al., 2005; Bovers et al., 2007). If the specific subgroup of AFLP4 that is present in all isolated C. neoformans × C. gattii hybrids, has a normal mating capability, the discovery of hybrids between C. neoformans and a distant C. gattii genotype suggests that other hybrids, such as hybrids between C. neoformans and more closely related C. gattii groups may exist as well. Furthermore, the genotypic groups within C. gattii are even more closely related, therefore hybrids between two genotypic groups of C. gattii are expected to exist as well. Interestingly, all discovered C. neoformans × C. gattii hybrids are clinical isolates. Hybrids are formed during mating, but mating in C. neoformans is almost absent at the human body temperature of 37 ºC (Dong and Courchesne, 1998). This suggests that C. neoformans × C. gattii hybrids are formed in the environment and subsequently 5 infect humans. Sampling studies in regions were C. neoformans and C. gattii have overlapping niches should be undertaken to investigate whether environmental C. neoformans × C. gattii hybrid isolates can be found.

Acknowledgements

Work of M Bovers is supported by the ‘Odo van Vloten fonds’. F Hagen and EE Kuramae are funded by the Renewal Fund of the Royal Netherlands Academy of Arts and Sciences (RNAAS-KNAW).

113

bovers_V4.indd 113 25-10-2007 10:16:08 Chapter 5: C. neoformans – C. gattii AB hybrid

References

Baró T, Torres-Rodríguez JM, Hermoso de Mendoza M, Morera Y and Alía C (1998) First identification of autochthonousCryptococcus neoformans var. gattii isolated from goats with predominantly severe pulmonary disease in Spain. J. Clin. Microbiol. 36: 458-461. Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman J, Rivera ING and Paula CR (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J. Clin. Microbiol. 42: 1356-1359. Biswas SK, Wang L, Yokoyama K and Nishimura K (2003) Molecular analysis of Cryptococcus neoformans mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 41: 5572-5576. Boekhout T, Theelen B, Diaz M, Fell J W, Hop WC, Abeln EC, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891- 907. Bovers M, Hagen F, Kuramae EE and Boekhout T (2007) Six monophyletic lineages identified within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. PhD Thesis: Chapter 2. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Butler MI and Poulter RTM (2005) The PRP8 inteins in Cryptococcus are a source of phylogenetic and epidemiological information. Fungal Genet. Biol. 42: 452-463. Casadevall A and Perfect JR (1998) Cryptococcus neoformans. ASM press, Washington, USA. Chaturvedi V, Fan J, Stein B, Behr MJ, Samsonoff WA, Wickes BL and Chaturvedi S (2002) Molecular genetic analyses of mating pheromones reveal intervariety mating or hybridization in Cryptococcus neoformans. Infect. Immun. 70: 5225-5235. Cogliati M, Esposto MC, Clarke DL, Wickes BL and Viviani MA (2001) Origin of Cryptococcus neoformans var. neoformans diploid strains. J. Clin. Microbiol. 39: 3889-3894. Cogliati M, Esposto MC, Tortorano AM and Viviani MA (2006) Cryptococcus neoformans population includes hybrid strains homozygous at mating-type locus. FEMS Yeast Res. 6: 608-613. Colom MF, Frasés S, Ferrer C, Jover A, Andreu M, Reus S, Sánchez M and Torres-Rodríguez JM (2005) First case of human Cryptococcosis due to Cryptococcus neoformans var. gattii in Spain. J. Clin. Microbiol. 43: 3548-3550. Darzynkiewicz Z, Crissman HA and Robinson JP (1994) Methods in Cell Biology. Flow Cytometry. Volume II (2nd edition). Academic Press, San Diego, USA. Diaz MR, Boekhout T, Theelen B and Fell JW (2000) Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5: 1129-1140. Dong H and Courchesne W (1998) A novel quantitative mating assay for the fungal pathogen Cryptococcus neoformans provides insight into signaling pathways responding to nutrients and temperature. Microbiology 144: 1691-1697. D’Souza CA, Hagen F, Boekhout T, Cox GM and Heitman J (2004) Investigation of the basis of virulence in serotype A strains of Cryptococcus neoformans from apparently immunocompetent individuals. Curr. Genet. 46: 92-102. Escandón P, Sánchez A, Martínez M, Meyer W and Castañeda E (2006) Molecular epidemiology of clinical and environmental isolates of the Cryptococcus neoformans species complex reveals a high genetic diversity and the presence of the molecular type VGII mating type a in Colombia. FEMS Yeast Res. 6: 625-635.

114

bovers_V4.indd 114 25-10-2007 10:16:09 Chapter 5: C. neoformans – C. gattii AB hybrid

Franzot SP, Salkin IR and Casadevall A (1999) Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, Macdougall L, Boekhout T, Kwon-Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263. Kwon-Chung KJ (1976) Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia 68: 821-833. Kwon-Chung KJ and Bennett JE (1984) Epidemiological differences between the two varieties of Cryptococcus neoformans. Am. J. Epidemiol. 120: 123-130. Kwon-Chung KJ and Varma A (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res. 6: 574-587. Kwon-Chung KJ, Polacheck I and Bennett JE (1982) Improved diagnostic medium for separation of Cryptococcus neoformans var. neoformans (serotypes A and D) and Cryptococcus neoformans var. gattii (serotypes B and C). J. Clin. Microbiol. 15: 535-537. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Lengeler KB, Cox GM and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122. 5 Litvintseva AP, Thakur R, Vilgalys R and Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172: 2223-2238. Liu YJ, Hodson MC and Hall BD (2006) Loss of the flagellum happened only once in the Fungal Lineage: Phylogenetic structure of Kingdom Fungi inferred for RNA polymerase II subunit genes. BMC Evol. Biol. 6: 74. Loftus BJ, Fung E, Roncaglia P, Rowley D, Amedeo P, Bruno D, Vamathevan J, Miranda M, Anderson IJ, Fraser JA, Allen JE, Bosdet IE, Brent MR, Chiu R, Doering TL, Donlin MJ, D’Souza CA, Fox DS, Grinberg V, Fu J, Fukushima M, Haas BJ, Huang JC, Janbon G, Jones SJ, Koo HL, Krzywinski MI, Kwon-Chung JK, Lengeler KB, Maiti R, Marra MA, Marra RE, Mathewson CA, Mitchell TG, Pertea M, Riggs FR, Salzberg SL, Schein JE, Shvartsbeyn A, Shin H, Shumway M, Specht CA, Suh BB, Tenney A, Utterback TR, Wickes BL, Wortman JR, Wye NH, Kronstad JW, Lodge JK, Heitman J, Davis RW, Fraser CM and Hyman RW (2005) The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans. Science 307: 1321-1324. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal Study Group (2003) Molecular Typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195. Mitchell DH, Sorrell TC, Allworth AM, Heath CH, McGregor AR, Papanaoum K, Richards MJ and Gottlieb T (1995) Cryptococcal disease of the CNS in immunocompetent hosts: influence of cryptococcal variety on clinical manifestations and outcome. Clin. Infect. Dis. 20: 611-616. Montagna MT, Viviani MA, Pulito A, Aralla C, Tortorano AM, Fiore L and Barbuti S (1997) Cryptococcus neoformans var. gattii in Italy. Note II. Environmental investigation related to an autochtonous clinical case in Apulia. J. Mycol. Méd. 7: 93-96. Ruma P, Chen SC, Sorrell TC and Brownlee AG (1996) Characterization of Cryptococcus neoformans by random DNA amplification. Lett. Appl. Microbiol.23: 312-316. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Sorrell TC (2001) Cryptococcus neoformans variety gattii. Med. Mycol. 39: 155-168.

115

bovers_V4.indd 115 25-10-2007 10:16:10 Chapter 5: C. neoformans – C. gattii AB hybrid

Stephen C, Lester S, Black W, Fyfe M and Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can. Vet. J. 43: 792-794. St-Germain G, Noël G and Kwon-Chung KJ (1988) Disseminated cryptococcosis due to Cryptococcus neoformans variety gattii in a Canadian patient with AIDS. Eur. J. Clin. Microbiol. Infect. Dis. 7: 587-588. Sugita T, Ikeda R and Shinoda T (2001) Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol. Immunol. 45: 757-768. Tanaka R, Nishimura K and Miyaji M (1999) Ploidy of serotype AD strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 40: 31-34. Tanaka R, Nishimura K, Imanishi Y, Takahashi I, Hata Y and Miyaji M (2003) Analysis of serotype AD strains from F1 progenies between urease-positive- and negative-strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 44: 293-297. Velegraki A, Kiosses VG, Pitsouni H, Toukas D, Daniilidis VD and Legakis NJ (2001) First report of Cryptococcus neoformans var. gattii serotype B from Greece. Med. Mycol. 39: 419-422. Viviani MA, Wen H, Roverselli A, Caldarelli-Stefano R, Cogliati M, Ferrante P and Tortorano AM (1997) Identification by polymerase chain reaction fingerprinting ofCryptococcus neoformans serotype AD. J. Med. Vet. Mycol. 35: 355-360. White TJ, Bruns T, Lee S and Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: PCR Protocols: a guide to methods and applications, p 315-322. Edited by Innis MA, Gelfand DH, Sninsky JJ and White TJ. Academic Press, San Diego, USA. Xu J, Vilgalys R and Mitchell TG (2000) Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 9: 1471- 1481. Yan Z and Xu J (2003) Mitochondria are inherited from the MATa parent in crosses of the basidiomycete fungus Cryptococcus neoformans. Genetics 163: 1315-1325. Yan Z, Li X and Xu J (2002) Geographic distribution of mating type alleles of Cryptococcus neoformans in four areas of the United States. J. Clin. Microbiol. 40: 965-972.

116

bovers_V4.indd 116 25-10-2007 10:16:11 Chapter 6

Identification of genotypically

diverse Cryptococcus neoformans

and Cryptococcus gattii isolates

using Luminex xMAP technology

M Bovers1, MR Diaz2, F Hagen1, L Spanjaard3, B Duim4, CE Visser4, HL Hoogveld5, J Scharringa6, IM Hoepelman6, JW Fell2, T Boekhout1,6

1CBS - Fungal Biodiversity Centre, Utrecht, The Netherlands; 2University of Miami, Rosenstiel School of Marine and Atmospheric Science (RSMAS), Key Biscayne, USA; 3The Netherlands Reference Laboratory for Bacterial Meningitis (AMC/RIVM), Department of Medical Microbiology, Academic Medical Center, Amsterdam, The Netherlands; 4Department of Medical Microbiology, Academic Medical Center, Amsterdam, The Netherlands; 5Netherlands Institute of Ecology (NIOO-KNAW), Centre for Limnology, Nieuwersluis, The Netherlands; 6Department of Internal Medicine and Infectious Diseases, University Medical Centre Utrecht, Utrecht, The Netherlands.

J. Clin. Microbiol. (2007) 45: 1874-1883

bovers_V4.indd 117 25-10-2007 10:16:12 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

Summary

A Luminex suspension array, that had been developed for identification of Cryptococcus neoformans and Cryptococcus gattii isolates, was tested by genotyping a set of 58 mostly clinical isolates. All genotypes of C. neoformans and C. gattii were included. In addition, cerebrospinal fluid (CSF) obtained from patients with cryptococcal meningitis was used to investigate the feasibility of the technique for identification of the infecting strain. The suspension array identified haploid isolates correctly in all cases. Furthermore, hybrid isolates possessing two alleles of the Luminex probe region could be identified as hybrids. In CSF specimens, the genotype of the cryptococcal strains responsible for infection could be identified after optimization of the PCR conditions. However, further optimization of the DNA extraction protocol is needed to enhance the usability of the method in clinical practice.

118

bovers_V4.indd 118 25-10-2007 10:16:13 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

Introduction

Cryptococcus neoformans and C. gattii are closely related pathogenic yeasts as indicated by the previous description of C. gattii as a variety of C. neoformans (Kwon-Chung et al., 1982). Recently, C. gattii has been described as a separate species because of differences in ecology, biochemical and molecular characteristics (Kwon-Chung et al., 2002; Kwon-Chung and Varma, 2006). Cryptococcus neoformans and C. gattii both may cause meningo-encephalitis, which is fatal unless treated. Cryptococcus neoformans occurs globally and is found primarily in immunocompromised individuals, e.g. HIV-infected patients. Although the incidence of cryptococcosis in AIDS patients has decreased because of the introduction of the highly active antiretroviral treatment (HAART), cryptococcosis remains a serious disease, with a mortality rate of 10 to 30% in regions where access to treatment is limited (Mirza et al., 2003; Bicanic and Harrison, 2004), and it continues to be the most important cause of fungal meningitis in immunocompromised patients. In contrast to C. neoformans, C. gattii mainly infects immunocompetent individuals and was thought to occur only in (sub)tropical areas. However, one of the genotypic groups of C. gattii is causing an ongoing outbreak on Vancouver Island (Stephen et al., 2002; Hoang et al., 2004; Kidd et al., 2004), which indicates that C. gattii may also occur in more temperate areas. Cryptococcus neoformans and C. gattii do not only differ in host range and geographic distribution, but they also differ in clinical manifestation. Although both species infect 6 the central nervous system, C. gattii appears to invade the brain parenchyma more commonly than C. neoformans. Furthermore, in C. gattii infected patients pulmonary infections are more likely and pulmonary mass-like lesions occur more commonly than in C. neoformans infected patients (Mitchell et al., 1995; Speed and Dunt, 1995). Patients infected with C. gattii seem to have had their symptoms longer before presentation and therapy is often needed for a longer period of time (Mitchell et al., 1995; Speed and Dunt, 1995). Because of the differences in clinical manifestation and the outcome of disease, it is important to accurately identify the species responsible for the infection. Six haploid genotypic groups within C. neoformans and C. gattii can be distinguished by several different molecular methods, e.g. by Amplified Fragment Length Polymorphism (AFLP) analysis (Boekhout et al., 2001), PCR fingerprinting (Meyer et al., 2003) and intergenic spacer (IGS) genotyping (Diaz et al., 2005). The haploid groups within C. neoformans correspond to the two varieties var. grubii and var. neoformans, while C. gattii can be divided into four genotypic groups. Besides these haploid groups, hybrids have been described as well. Hybrids between the two varieties of C. neoformans exist, these are the so-called AD hybrids (Tanaka et al., 1999; Cogliati et al., 2000; Boekhout et al., 2001; Lengeler et al., 2001) and hybrids between C. neoformans var. neoformans and C. gattii have recently been described (Bovers et al.,

119

bovers_V4.indd 119 25-10-2007 10:16:14 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

2006). The different genotypic groups and the relationship between variety, serotype and the different genotyping methods are shown in Table 1. Unfortunately, the diagnostic methods which are currently used, do not discriminate between all genotypic groups. As a consequence, the differences in hostrange and symptoms between the genotypic groups are not known, which is especially true for the genotypic groups within C. gattii. It is likely that more differences in host range and symptoms will be found when the exact genotype of the infecting cryptococcal strain is determined. Another disadvantage of the current diagnostic methods is that they take a considerable amount of time to complete, e.g. culturing, or they can only be used for a limited number of species, e.g. antigen detection. Recently, Luminex xMAP technology has been adapted for the detection of the genotypes within C. neoformans and C. gattii (Diaz and Fell, 2005). The xMAP technology is based on uniquely color- coded microspheres, which allows as many as one hundred different species to be detected in a single reaction. This technology has been used for the detection of several species of bacteria and fungi (Dunbar et al., 2003; Diaz and Fell, 2004; Diaz and Fell, 2005; Page and Kurtzman, 2005; Wilson et al., 2005; Das et al., 2006; Diaz et al., 2006). Recently, xMAP technology has been used in several diagnostic kits for the detection of bacterial and viral pathogens (www.genaco.com). In our study, we used a set of 48 haploid and ten hybrid isolates to test a Luminex suspension array, which had been developed for identification of C. neoformans and C. gattii strains (Diaz and Fell, 2005). Our set contained isolates obtained from Dutch cryptococcosis patients in the period between 1977 and 2001, as well as C. gattii isolates from our own collection. In addition, cerebrospinal fluid (CSF) specimens obtained from patients diagnosed with cryptococcocal meningitis were used to investigate the feasibility of this Luminex suspension array for the identification of cryptococci in clinical specimens.

Table 1. Overview of the varieties, serotypes and genotypes within the Cryptococcus neoformans and Cryptococcus gattii species complex.

AFLP Molecular IGS Luminex Species Serotype 1, 2 genotype 2, 3 genotype 1 genotype 4 probe 5 C. neoformans CNNb C. neoformans var. grubii A 1 VNI/VNII 1A/1B/1C CNN1b C. neoformans var. grubii × var. neoformans hybrid AD 3 VNIII C. neoformans var. neoformans D 2 VNIV 2A/2B/2C CNN2d C. neoformans var. neoformans × C. gattii AFLP4 hybrid BD 8 nd C. gattii CNG C. gattii B/C 4 VGI 4A/4B/4C CNG4c C. gattii B/C 5 VGIII 5 CNG5b C. gattii B/C 6 VGII 3 CNG3 C. gattii B/C 7 VGIV 6 CNG6

1 Meyer et al. (2003); 2 Bovers et al. (2006); 3 Boekhout et al. (2001); 4 Diaz et al. (2005); 5 Diaz and Fell (2005); nd = not determined.

120

bovers_V4.indd 120 25-10-2007 10:16:15 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

Materials and Methods

Genotyping of cryptococcal isolates

Thirty-four isolates obtained from Dutch patients and maintained in the cryptococcal collection of the Netherlands Reference Laboratory for Bacterial Meningitis (Academic Medical Center, Amsterdam, The Netherlands) were used for the genotyping assay. Because almost all of these isolates were C. neoformans, we included twenty additional C. gattii isolates and four additional hybrid isolates from our own collection. The origin of the haploid and hybrid isolates is shown in Tables 2 and 3, respectively. DNA was isolated from cultures as described by Bovers et al. (2006). Isolates that had not been genotyped before were analyzed by AFLP (Boekhout et al., 2001) and C. neoformans mating- and serotype-specific PCR reactions. PCR amplifications were performed in 20 μl volumes containing 1 × PCR buffer (10 mM Tris-HCl, 50 mM KCl,

1.5 mM MgCl2, 0.01% gelatin, 0.1% Triton X-100, pH 8.3), 0.1 mM dNTPs, 0.5 U of Taq DNA polymerase (Gentaur), 2-3 μl template DNA and 0.1 μM of both primers. Amplification conditions were as follows: serotype AD-MATα specific primer pair JOHE1671/1672 (Lengeler et al., 2001), 96 °C for 5 min, followed by 25 cycles of 96 °C for 30 sec, 66 °C for 30 sec and 72 °C for 30 sec, and a final extension step of 72 °C for 5 min; serotype A-specific primer pair JOHE3241/JOHE2596 (Lengeler et al., 2001) and serotype D-specific primer pair JOHE3240/JOHE2596 (Lengeler et al., 2001), 6 96 °C for 5 min, followed by 25 cycles of 96 °C for 30 sec, 55 °C for 30 sec and 72 °C for 45 sec, and a final extension step of 72 °C for 5 min. PCR conditions for the first serotype A-MATa specific primer pair JOHE5169/JOHE5170 (Lengeler et al., 2001), the second serotype A-MATa specific primer pair JOHE7270/JOHE7272 (Barreto de Oliveira et al., 2004), the serotype A-MATα specific primer pair JOHE7264/JOHE7265 (Barreto de Oliveira et al., 2004), the serotype D-MATa specific primer pair JOHE7273/ JOHE7275 (Barreto de Oliveira et al., 2004), and the serotype D-MATα specific primer pair JOHE7267/JOHE7268 (Barreto de Oliveira et al., 2004) were as follows: 96 °C for 5 min, followed by 30 cycles of 96 °C for 15 sec, 66 °C for 15 sec and 72 °C for 1 min, and a final extension step of 72 °C for 5 min.

Flow cytometry and sequencing of hybrid isolates

The diploid nature of all hybrid isolates was confirmed by flow cytometry according to Bovers et al. (2006). Furthermore, partial sequences of the Intergenic Spacer (IGS1) and Laccase (CNLAC1) gene were determined for all hybrid isolates. Primer sequences were those used by Diaz et al. (2000) and Xu et al. (2000). The amplicons were cloned into Escherichia coli DH5α cells with a TA Cloning® Kit (Invitrogen)

121

bovers_V4.indd 121 25-10-2007 10:16:16 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates Reference This study This study This study This study This study This study This study This study This study This study This study This study This study

grubii grubii grubii grubii grubii grubii grubii grubii grubii grubii grubii grubii grubii var. var. var. var. var. var. var. var. var. var. var. var. var. var. (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) Luminex identification C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans probes CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b Positive Luminex A A A A A A A A A A A A A α α α α α α α α α α α α α Serotype Mating and AFLP AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 genotype isolates and an overview of the results obtained by Amplified Fragment Length Location the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands Cryptococcus gattii and 2 man, age 52 man, age 73 Cryptococcus neoformans Source of isolation Source Jugular gland, man, age 19 CSF, HIV-positive man, age 47 HIV-positive CSF, man, age 47 HIV-positive CSF, man, age 44 HIV-positive CSF, CSF, AIDS patient, man, age 29 CSF, Lung, AIDS patient, man, age 43 CSF, HIV-negative woman, age 22 HIV-negative CSF, woman, age 58 HIV-negative CSF, CSF, AIDS suspected, man, age 30 CSF, CSF, immunocompetent man, age 27 CSF, CSF, immunocompetent woman, age 49 CSF, CSF, HIV-negative, immunocompromised HIV-negative, CSF, immunocompromised HIV-negative, CSF, Origin of haploid 1 Table 2. Table Polymorphism (AFLP) analysis, mating-serotype-specific PCRs and Luminex suspension array. Isolate AMC770704 AMC830410 AMC860743 AMC880696 AMC900239 AMC900321 AMC900906 AMC901081 AMC922148 AMC931394 AMC940211 AMC940580 AMC940751

122

bovers_V4.indd 122 25-10-2007 10:16:17 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates (2001) (2001) This study This study This study This study This study This study This study This study This study This study This study This study This study This study Boekhout et al. Boekhout et al.

grubii grubii grubii grubii grubii grubii grubii grubii var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. (AFLP2) (AFLP2) (AFLP2) (AFLP2) (AFLP2) (AFLP2) (AFLP4) (AFLP4) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) (AFLP1) C. gattii C. gattii C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans neoformans neoformans neoformans neoformans neoformans neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans CNG, CNG4c CNG, CNG4c CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN1b CNNb, CNN2d CNNb, CNN2d CNNb, CNN2d CNNb, CNN2d CNNb, CNN2d CNNb, CNN2d A A A A A A A A D D D D B B α α α α α α α α aD aD α α α α AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP1 AFLP2 AFLP2 AFLP2 AFLP2 AFLP2 AFLP2 AFLP4 AFLP4 6 France the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands the Netherlands RV20186: human CSF, RV20186: human CSF, gattii ( var. var. Zaire) C. neoformans of

age 37 age 65 age 41 Tumor, man Tumor, man, age 69 CSF, man, age 46 CSF, man, age 65 CSF, HIV-positive man, age 30 HIV-positive CSF, sarcoidosis, man, age 43 sarcoidosis, CSF, CSF, AIDS patient, man, age 45 CSF, AIDS patient, man, age 35 CSF, AIDS patient, man, age 29 CSF, AIDS patient, man, age 50 CSF, CSF, AIDS patient, woman, age 23 CSF, immunocompromised man, age 58 CSF, prednison usage, HIV-negative, prednison usage, HIV-negative, CSF, CSF, non-Hodgkin lymphoma, woman, CSF, CSF, encephalopathy, AIDS patient, man, encephalopathy, CSF, CSF, HIV-negative, immunocompromised HIV-negative, CSF, HIV-negative, immunocompromised man, HIV-negative, Subculture of type strain AMC951535 AMC981683 AMC990558 AMC2040734 AMC940289I JS9901 MN P1953 AMC890401 AMC940038 AMC941354 AMC2010488 AMC2031402 AMC2020797A CBS1622 CBS6289

123

bovers_V4.indd 123 25-10-2007 10:16:18 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates (2001) (2001) (2001) (2001) (2001) (2001) (2001) (2001) (2001) (2001) (2003) This study Velegraki et al. Velegraki et al. Velegraki Latouche et al. Boekhout et al. Boekhout et al. Boekhout et al. Boekhout et al. Boekhout et al. Boekhout et al. Boekhout et al. Boekhout et al. Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Kidd et al. (2004) Diaz and Fell (2005) (AFLP4) (AFLP4) (AFLP4) (AFLP4) (AFLP5) (AFLP5) (AFLP5) (AFLP5) (AFLP6) (AFLP6) (AFLP6) (AFLP6) (AFLP6) (AFLP6) (AFLP6) (AFLP6) (AFLP7) (AFLP7) (AFLP7) C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii C. gattii CNG, CNG3 CNG, CNG3 CNG, CNG3 CNG, CNG3 CNG, CNG3 CNG, CNG3 CNG, CNG3 CNG, CNG3 CNG, CNG6 CNG, CNG6 CNG, CNG6 CNG, CNG4c CNG, CNG4c CNG, CNG4c CNG, CNG4c CNG, CNG5b CNG, CNG5b CNG, CNG5b CNG, CNG5b B B B B B B B B B B B B B C C C C C nd AFLP4 AFLP4 AFLP4 AFLP4 AFLP5 AFLP5 AFLP5 AFLP5 AFLP6 AFLP6 AFLP6 AFLP6 AFLP6 AFLP6 AFLP6 AFLP6 AFLP7 AFLP7 AFLP7 India China China Greece Greece CSF = Cerebrospinal fluid. Honduras Colombia 2 Seattle, USA California, USA California, USA San Diego, USA the Netherlands Vancouver, Canada Vancouver, Vancouver Island, Canada Vancouver Island, Canada Vancouver Island, Canada Vancouver Island, Canada Vancouver Johannesburg, South Africa Johannesburg, South Africa

var. var. C. hondurianus Filobasidiella shanghaiensis C. neoformans var. var. man age 26 Fir tree Cheetah bacillispora Human CSF shanghaiensis Douglas-Fir tree Clinical specimen HIV-positive human HIV-positive Eucalyptus citriodora Detritus of almond tree Meningitis, type strain of HIV-positive, man, age 47 HIV-positive, Tree stump near Alder-tree Tree CSF, HIV-positive man, age 31 HIV-positive CSF, CSF, type strain of CSF, Immunocompromised woman, C. neoformans Sputum, immunocompetent man Air sample from beneath Douglas- Second isolate of Bronchial wash, immunocompetent Sputum, immunocompetent human Infected skin, syntype AMC = Netherlands Reference Laboratory for Bacterial Meningitis, Academic Medical Center, Amsterdam, The Netherlands; CBS = CBS - Fungal Biodiversity Fungal - CBS = CBS Netherlands; The Amsterdam, Center, Medical Academic Meningitis, Bacterial for Laboratory Reference Netherlands = AMC CBS7229 CBS883 N114 RV54130 CBS6955 CBS6993 CBS8755 WM726 113A-5 AV54 AV55 CBS6956 A1MF3179 A1MR265 ENV133 RB28 B5748 M27055 WM779 1 Meyer; Centre, Utrecht, The Netherlands; WM = Wieland

124

bovers_V4.indd 124 25-10-2007 10:16:20 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates (2006) (2006) (2006) Reference al. (2001) al. (2001) al. (2001) This study This study This study This study Lengeler et Lengeler et Lengeler et Bovers et al. Bovers et al. Bovers et al. CNLAC1 sequences two alleles two alleles two alleles two alleles two alleles two alleles two alleles two alleles two alleles two alleles IGS1 one allele one allele sequences two alleles two alleles two alleles two alleles two alleles two alleles two alleles two alleles and and and and and (AFLP8) (AFLP8) (AFLP8) grubii grubii grubii grubii grubii (AFLP3) (AFLP3) (AFLP3) (AFLP3) (AFLP3) neoformans neoformans neoformans neoformans neoformans var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. var. C. gattii C. gattii C. gattii (AFLP2) (AFLP2) neoformans neoformans neoformans neoformans neoformans hybrid between hybrid between hybrid between hybrid between hybrid between hybrid between hybrid between hybrid between Luminex identification var. var. var. var. var. var. var. var. var. var. and AFLP4 and AFLP4 and AFLP4 C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans C. neoformans probes CNN2d CNN2d CNN2d CNN2d CNN2d CNG, CNG4c CNG, CNG4c CNG, CNG4c CNNb, CNN2d CNNb, CNN2d CNNb, CNN1b, CNNb, CNN1b, CNNb, CNN1b, CNNb, CNN1b, CNNb, CNN1b, CNNb, CNN2d, CNNb, CNN2d, CNNb, CNN2d, Positive Luminex 6 B B B A A A A A D D α α α α α α α α α α aD- aD- aD- aA- aA- aD- aD- aD- aD- aD- Serotype Mating and CSF = Cerebrospinal fluid. ) are shown. 2 Ploidy diploid diploid diploid diploid diploid diploid diploid diploid diploid diploid CNLAC1 AFLP AFLP3 AFLP3 AFLP3 AFLP3 AFLP3 AFLP3 AFLP3 AFLP8 AFLP8 AFLP8 genotype 2 Origin Netherlands Netherlands Netherlands Netherlands Netherlands Prevention, USA 5-FOAr × JEC171 5-FOAr × JEC171 23, the Netherlands Medical Center, USA Medical Center, CSF, HIV-positive man, the HIV-positive CSF, CSF, idiopathic intracranial CSF, CSF, idiopathic intracranial CSF, hypertension, man, age 35, the hypertension, man, age 36, the Centers for Disease Control and Progeny laboratory crossing H99 Progeny laboratory crossing H99 Permanent strain collection Duke CSF, HIV-positive man, age 44, the HIV-positive CSF, CSF, brain tumor surgery, man, age brain tumor surgery, CSF, CSF, AIDS patient, man, age 31, the CSF, Origin of hybrid isolates and an overview of the results obtained by Amplified Fragment Length Polymorphism (AFLP) analysis, ploidy analysis, 1 AMC = Netherlands Reference Laboratory for Bacterial Meningitis, Academic Medical Center, Amsterdam, The Netherlands; CDC = Center for Disease Table Table 3. mating-serotype-specific PCRs and Luminex In suspension addition, array. the number of alleles obtained by cloning and sequencing part of the intergenic spacer region (IGS1) and part of the laccase gene ( Isolate AMC881205I CDC92-26 Kl#1 Kl#45 ZG287 AMC890351 AMC891529 AMC770616 (=CBS10488) AMC2010404 (=CBS10489) AMC2011225 (=CBS10490) 1 Control and Prevention, Atlanta, USA; Kl = Klaus Lengeler,

125

bovers_V4.indd 125 25-10-2007 10:16:21 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

according to the manufacturer’s instructions. Clones were picked randomly, amplified and purified with the GFXTM PCR DNA and Gel Band Purification Kit (Amersham Biosciences). The BigDye v3.1 Chemistry kit (Applied Biosystems) was used for sequencing and the amplicons were analyzed on an ABI 3700XL DNA analyzer (Applied Biosystems).

Clinical specimens

Clinical specimens were obtained from the Netherlands Reference Laboratory for Bacterial Meningitis, the University Medical Centre in Utrecht, the Erasmus Medical Center in Rotterdam, all in the Netherlands, and the University Hospital Gasthuisberg in Leuven, Belgium. CSF from patients with culture proven cryptococcal meningitis had been stored for up to five years at -80 °C. The origin and volume of the CSF specimens is described in Table 4. After thawing, the CSF samples were centrifuged for 10 min at 16,000 × g and the supernatant was removed. Five hundred microliter distilled water was added and the pellet was resuspended to remove human cells that might be present in the CSF. The samples were centrifuged for 10 min at 16,000 × g and the supernatant was removed. One milliliter of Novozym 234 (1 mg ml-1) (Novo Industri) suspended in sorbitol-buffer (1 M sorbitol, 0.1 M sodiumcitrate; pH 5.5) was added to the samples. The samples were incubated for one hour at 37 °C to generate protoplasts, after which the samples were centrifuged for 5 min at 4,600 × g and the supernatant was removed. The tissue protocol of the QIAamp® DNA Micro kit (Qiagen) was used for DNA isolation. The DNA was eluted with 35 μl of AE buffer from the kit.

Luminex suspension array

The Luminex suspension array, which detects 5’ biotin-labeled PCR amplicons hybridized to specific capture probes, was performed as described by Diaz and Fell (2005). Specific oligonucleotide probes for each of the six haploid genotypic groups within the C. neoformans – C. gattii species complex as well as oligonucleotide probes targeting either C. neoformans or C. gattii were used. All probes had been designed based on the IGS1 region of the ribosomal DNA (Diaz and Fell, 2005). An overview of the targets of each probe is given in Table 1. The probes were synthesized with a 5’-end Amino C-12 modification (Integrated DNA Technologies) and covalently coupled to different sets of 5.6 μm polystyrene carboxylated microspheres using a slightly modified carbodiimide method (Diaz and Fell, 2004). Each microsphere set (MiraiBio) contains a unique spectral address by combining different ratios of red and infrared fluorochromes. In a typical reaction 5 × 106 microspheres were resuspended

126

bovers_V4.indd 126 25-10-2007 10:16:22 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

Table 4. Origin and volume of cerebrospinal fluid of which amplicons could be obtained. The probes which gave a positive signal in the suspension array and the result of the Luminex identification are indicated.

Volume Clinical specimen 1 Origin 2 Positive Luminex probes Luminex identification (μl) AMC2031402 CSF, man, age 65, the Netherlands 400 CNNb, CNN2d C. neoformans var. neoformans (AFLP2) AMC2031845 CSF, man, age 73, the Netherlands 400 CNNb, CNN1b C. neoformans var. grubii (AFLP1) AMC2040592 CSF, AIDS patient, man, age 29, 400 CNNb, CNN1b C. neoformans var. grubii (AFLP1) the Netherlands AMC2010488 CSF, AIDS patient, man, age 50, 385 CNNb, CNN2d C. neoformans var. neoformans (AFLP2) (=JS2002) the Netherlands JS9901 CSF, sarcoidosis, man, age 43, 185 no positive probes the Netherlands AMC2010576 CSF, HIV-positive, man, age 46, 85 no positive probes (=JS2003) the Netherlands L4 CSF, the Netherlands 185 CNNb, CNN2d C. neoformans var. neoformans (AFLP2) L5C (=535615) CSF, some blood present, 1230 CNNb, CNN1b C. neoformans var. grubii (AFLP1) the Netherlands L5D (=536140) CSF, the Netherlands 2230 CNNb, CNN1b, CNN2d hybrid between C. neoformans var. grubii and var. neoformans (AFLP3)

1 AMC = Netherlands Reference Laboratory for Bacterial Meningitis, Academic Medical Center, Amsterdam,The Netherlands; JS and L = University Medical Centre Utrecht, Utrecht, The Netherlands; 2 CSF = Cerebrospinal fluid.

in 25 μl 0.1 M MES (2[N-morpholino]ethanesulfonic acid), pH 4.5 with a determined 6 amount of probe (0.2-0.5 nmol). Probe coupling was performed as described in Diaz and Fell (2004) and the microspheres were subsequently resuspended in 100 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA; pH 8). A microsphere mixture was made by adding approximately 5,000 microspheres for each of the eight probes to an 1.5 × TMAC (3 M tetramethyl ammonium chloride, 50 mM Tris [pH 8], 4 mM EDTA [pH 8], 0.1% Sarkosyl) solution. To amplify the IGS1 region, forward primer IG1F (5’-CAGACGACTTGAATGGG AACG-3’) and reverse primer IG2R (5’-ATGCATAGAAAGCTGTTGG-3’) were used (Diaz et al., 2000). The reverse primer was biotinylated at the 5’ end. The 1 × ® HotStarTaq MasterMix (Qiagen) containing 1.5 mM MgCl2, 0.2 mM dNTPs and 2.5 units of HotStarTaq polymerase was used for all PCR reactions. DNA had been extracted from the cryptococcal isolates prior to amplification, although Diaz and Fell (2005) directly used yeast cells for PCR amplification. PCR reactions were carried out in a total volume of 25 μl. 0.6 μM of primers IG1F and IG2R and 1.5 μl template DNA were added to the MasterMix. Amplification conditions were as follows: 95 °C for 15 min followed by 35 cycles of 95 °C for 30 sec, 50 °C for 30 sec and 72 °C for 30 sec, and a final extension step of 72 °C for 7 min.

127

bovers_V4.indd 127 25-10-2007 10:16:22 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

PCR amplification of the first two clinical samples was carried out using the HotStarTaq MasterMix in a 50 μl total volume containing 3 μl of DNA and 0.4 μM of both primer IG1F and primer IG2R. Amplification conditions were as described above. Optimization of the PCR conditions resulted in the following reaction conditions, which were used for the remaining clinical samples. PCR amplification was carried out with the HotStarTaq MasterMix in a 50 μl total volume containing 0.2% Bovine Serum Albumin (BSA), 8 μl of DNA and 0.6 μM of both primer IG1F and primer IG2R. Amplification conditions were as follows: 95 °C for 15 min followed by 40 cycles of 95 °C for 30 sec, 50 °C for 30 sec and 69 °C for 30 sec, and a final extension step of 69 °C for 9 min. Amplicons were cleaned with the Qiagen Purification Kit (Qiagen) and eluted with EB buffer. To genotype the cryptococcal isolates, 5 μl of biotinylated amplicon was diluted with 12 μl TE buffer (pH 8) and to genotype the clinical samples, 15 μl of biotinylated amplicon was diluted with 2 μl TE buffer (pH 8). Thirty-three microliters of the microsphere mixture were added. Each amplicon was tested in duplicate with the Luminex suspension array. The hybridization reaction was performed as described in Diaz and Fell (2005). The hybridized samples were analyzed on the Luminex 100 analyzer (Luminex Corporation). One hundred microspheres of each set were analyzed, which represents a hundred replicate measurements. Median fluorescence intensity (MFI) values were calculated with a digital signal processor and Luminex 1.7 proprietary software. A positive signal was defined as a signal that is at least twice the background level after subtraction of the background.

Nucleotide sequence accession numbers

All sequences were deposited at GenBank under the accession numbers DQ286656- DQ286661, DQ286665-DQ286670, and EF100569-EF100594.

Results and Discussion

AFLP analysis and mating-serotype-specific PCRs performed on the isolates that had not been genotyped before, showed that twenty-one isolates belonged to C. neoformans var. grubii serotype A-MATα (AFLP1), four isolates were C. neoformans var. neoformans serotype D-MATα (AFLP2) and two isolates were C. neoformans var. neoformans serotype D-MATa (AFLP2). Finally, one isolate belonged to the C. gattii AFLP4 genotype. Some hybrid isolates between the two varieties of C. neoformans

128

bovers_V4.indd 128 25-10-2007 10:16:23 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

were detected: two serotype A-MATa/serotype D-MATα (AFLP3) and two serotype D -MATa/serotype A-MATα (AFLP3) isolates. Results of the AFLP analysis and the mating-serotype-specific PCRs are presented in Tables 2 and 3. All haploid isolates were identified by two Luminex suspension array probes (Figure 1). Probes CNNb and CNN1b identified the AFLP1 isolates as Cryptococcus neoformans var. grubii (AFLP1), and probes CNNb and CNN2d identified the AFLP2 isolates as Cryptococcus neoformans var. neoformans (AFLP2). Probe CNG correctly identified all C. gattii isolates as C. gattii. In addition, probe CNG4c identified the AFLP4 isolates, probe CNG5b identified the AFLP5 isolates, probe CNG3 identified the AFLP6 isolates, and probe CNG6 identified the AFLP7 isolates. These results show that the Luminex suspension array correctly genotyped all haploid strains (Table 2). The Luminex suspension array was also used to genotype ten hybrid isolates. Five out of seven serotype AD (AFLP3) hybrid isolates, namely AMC881205I, CDC92- 26, Kl#1, Kl#45 and ZG287, were identified as hybrids between the two varieties of C. neoformans by probes CNNb, CNN1b and CNN2d (Figure 2a). However, two serotype AD (AFLP3) hybrid isolates, namely AMC890351 and AMC891529, were identified as C. neoformans var. neoformans by probes CNNb and CNN2d (Figure 2b). The three serotype BD (AFLP8) hybrid isolates were identified as hybrids between C. neoformans var. neoformans and C. gattii-AFLP4 by probes CNG, CNG4c, CNNb and CNN2d (Figure 3). Interestingly, when the suspension array identified a hybrid isolate, low signal intensities, namely 16 to 53% of an average positive signal, were obtained 6 for probes which identified one of the parental genotypes. The results of the suspension array correlated with the number of clones that were found for each allele. For example, more AFLP4 than AFLP2 IGS1 clones were obtained for the serotype BD hybrid isolates. The Luminex probes gave a similar outcome: the signals for probes CNG and CNG4c, which identify the C. gattii AFLP4 genotype, had normal intensities, i.e. 546 to 940 MFI. The probes which identify C. neoformans var. neoformans (AFLP2), namely CNNb and CNN2d, were positive with MFI values ranging from 119 to 311, but the MFI values that were obtained were only 16 to 19% of an average positive signal (Figure 3). Flow cytometry confirmed that all hybrid isolates were diploid or close to diploid (data not shown). In addition, when a part of the CNLAC1 region was cloned and sequenced two alleles could be obtained for all hybrid isolates. However, when the IGS1 region was used for cloning and sequencing, two alleles were obtained for five serotype AD (AFLP3) hybrid isolates, namely AMC881205I, CDC92-26, Kl#1, Kl#45 and ZG287, but only one IGS1 allele was found in two serotype AD (AFLP3) hybrid isolates, namely AMC890351 and AMC891529, even though thirty clones were sequenced. All three serotype BD (AFLP8) hybrid isolates possessed two IGS1 alleles. Our results show that all hybrid isolates were diploid or close to diploid, possessed two CNLAC1 alleles and most hybrid isolates possessed two IGS1 alleles. All hybrid isolates that possessed two IGS1 alleles, the

129

bovers_V4.indd 129 25-10-2007 10:16:24 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

1500

1000

Median Fluorescence Intensity (MFI) 500

A 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes AMC770704 AMC940751 MN 1500

1000

500 Median Fluorescence Intensity (MFI)

C 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes CBS1622 CBS6289 N114

1500

1000

Median Fluorescence Intensity (MFI) 500

E 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes

113A-5 AV55 A1MF3179

130

bovers_V4.indd 130 25-10-2007 10:16:25 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

2000

1500

1000 Median Fluorescence Intensity (MFI)

500 B 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes AMC890401 AMC940038 AMC2010488 1500

1000

500 Median Fluorescence Intensity (MFI) 6 D 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes CBS6955 CBS6993 CBS8755

2500

2000

1500

1000 Median Fluorescence Intensity (MFI)

500 F 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes B5748 M27055 WM779

Fig. 1. Results obtained with the Luminex suspension array for all six haploid groups within Cryptococcus neoformans and Cryptococcus gattii. Examples of the results obtained with AFLP1, 2, 4, 5, 6 and 7 genotypic groups are depicted in Figures 1a, 1b, 1c, 1d, 1e and 1f, respectively.

131

bovers_V4.indd 131 25-10-2007 10:16:27 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

2000

1500

1000 Median Fluorescence Intensity (MFI) 500

A 0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes

AMC881205I CDC92-26 Kl#1 Kl#45 ZG287

2000

1500

1000

B Median Fluorescence Intensity (MFI) 500

0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes

AMC890351 AMC891529

Fig. 2. Results obtained with the Luminex suspension array for all of the serotype AD (AFLP3) hybrids of Cryptococcus neoformans. Figure 2a shows five serotype AD hybrids that were identified by three probes and Figure 2b shows two serotype AD hybrids that were identified by two probes.

region on which the Luminex probes are based, could be identified as hybrids. In order to further improve the identification of cryptococcal hybrids, a probe derived from another gene could be included. In a multigene study of thirty-one serotype AD hybrid isolates (AFLP3), five isolates possessed two IGS1 alleles, but twenty-seven isolates had two TEF1α alleles, twenty-six isolates possessed two RPB1 alleles, and twenty-three isolates had two CNLAC1 alleles (M. Bovers, unpublished data). This indicates that CNLAC1, RPB1 and TEF1α are potential regions that could be used to improve the identification of cryptococcal hybrids.

132

bovers_V4.indd 132 25-10-2007 10:16:28 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

1000

500 Median Fluorescence Intensity (MFI)

0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes

AMC770616 AMC2010404 AMC2011225

Fig. 3. Results obtained with the Luminex suspension array for the serotype BD (AFLP8) hybrid isolates.

The detection limit of the suspension array was calculated to vary from 4 x 101 to 2 x 103 cells for the different probes (Diaz and Fell, 2005). In clinical practice, the concentration of cryptococcal cells ranges from 1,000 to 10,000,000 cells per ml of CSF (Perfect et al., 1983). Therefore, the Luminex technology is a powerful tool for the detection and identification of cryptococcal cells in CSF. CSF specimens from a Belgian hospital and from various Dutch hospitals that had been stored for up 6 to five years at -80 °C were used to test the Luminex suspension array on clinical specimens. Only nine out of twenty CSF specimens obtained from patients with culture proven cryptococcal meningitis gave an amplicon of the targeted IGS locus. Unfortunately, we do not have additional information, i.e. about the number of (undamaged) cells or about the presence of interfering substances (Wilson, 1997) in the samples, to explain why an amplicon could not be obtained. Amplicons of the PCR positive samples were subsequently used for genotypic identification by the suspension array (Figure 4) and the results are shown in Table 4. The first two samples that were analyzed, namely JS9901 and AMC2010576, had probe signals that were too low to be considered positive. Optimization of the PCR conditions, i.e. adding 0.2% BSA and increasing the amount of DNA and primers in the reaction mix as well as decreasing the temperature of the elongation step to 69 °C, improved detection. As a consequence, the infecting agent of the remaining seven samples could successfully be identified at species and genotypic levels, but because no CSF of JS9901 and AMC2010576 remained, the genotype of the infecting agent could not be determined for those two samples. Probes CNNb and CNN1b, with MFI signals ranging from 260 to 1402, identified the infecting agent in L5c, AMC2040592 and AMC2031845, as C. neoformans var. grubii. Probes CNNb and CNN2d identified

133

bovers_V4.indd 133 25-10-2007 10:16:29 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

2000

1500

1000 Median Fluorescence Intensity (MFI) 500

0 CNNb CNN1b CNN2d CNG CNG4c CNG5b CNG3 CNG6 Probes

JS9901 AMC2010576 AMC2010488 L4 L5c L5d AMC2031402 AMC2031845 AMC2040592

Fig. 4. Luminex suspension array results for the amplicons obtained from CSF specimens.

the source of infection of AMC2010488, L4 and AMC2031402, as C. neoformans var. neoformans, with MFI signals ranging from 112 to 1780. Probes CNNb, CNN1b and CNN2d, with MFI signals ranging from 199 to 1446, identified the cryptococcal strain responsible for infection of the patient of specimen L5d as a serotype AD (AFLP3) strain of C. neoformans. Interestingly, CSF specimens L5c and L5d were obtained from the same patient, thus suggesting a dual infection by a haploid C. neoformans var. grubii and a serotype AD (AFLP3) hybrid strain. Our results show that the suspension array is highly specific as both varieties of C. neoformans (var. grubii and var. neoformans) and a hybrid could be identified in CSF specimens. The clinical applicability of the Luminex suspension array might be improved by optimization of the DNA isolation protocol as this is one of the critical steps in any molecular detection system (Baums et al., 2007). In addition, to determine the robustness of the method, fresh clinical specimens of which the amount of cryptococcal cells and the antigen titers are known, should be tested and follow up studies should be performed on samples with false negative results. In summary, the Luminex suspension array has the potential to become an efficient diagnostic method with high specificity that not only identifies cryptococcal isolates at species and genotype level, but that also allows identification of hybrid isolates that possess two IGS1 alleles. Furthermore, our results show that the Luminex suspension array is able to identify cryptococci in CSF specimens. Identification in CSF occurs at species, genotype and hybrid levels, but optimization of DNA extraction methods is needed before the method is suited for routine use in clinical laboratories.

134

bovers_V4.indd 134 25-10-2007 10:16:31 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

Acknowledgements

Our special gratitude goes to K Lagrou (University Hospital Leuven, Leuven, Belgium) and A van Belkum (Erasmus Medical Center, Rotterdam, The Netherlands) for sending us clinical specimens. This research was partially funded by National Institutes of Health grant 1-UO1 AI53879-01, the ‘Odo van Vloten fonds’ and the ‘Netherlands-Florida Scholarship Foundation’.

135

bovers_V4.indd 135 25-10-2007 10:16:31 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

References

Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman J, Rivera ING and Paula CR (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J. Clin. Microbiol. 42:1356-1359. Baums IB, Goodwin KD, Kiesling T, Wanless D and Fell JW (2007) Luminex detection of fecal indicators in river samples, marine recreational water, and beach sand. Mar. Pollut. Bull. 54: 521-536. Bicanic T and Harrison TS (2004) Cryptococcal meningitis. Br. Med. Bull. 72: 99-118. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WC, Abeln EC, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891- 907. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006). Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Cogliati M, Allaria M, Liberi G, Tortorano AM and Viviani MA (2000) Sequence analysis and ploidy determination of Cryptococcus neoformans var. neoformans. J. Mycol. Med. 10: 171- 176. Das S, Brown TM, Kellar KL, Holloway BP and Morrison CJ (2006) DNA probes for the rapid identification of medically importantCandida species using a multianalyte profiling system. FEMS Immunol. Med. Microbiol. 46: 244-250. Diaz MR and Fell JW (2004) High-throughput detection of pathogenic yeasts of the genus Trichosporon. J. Clin. Microbiol. 42: 3696-3706. Diaz MR and Fell JW (2005) Use of a suspension array for rapid identification of the varieties and genotypes of the Cryptococcus neoformans species complex. J. Clin. Microbiol. 43: 3662- 3672. Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5: 1129-1140. Diaz MR, Boekhout T, Theelen B, Bovers M, Cabañes FJ and Fell JW (2006) Microcoding and flow cytometry as a high-throughput fungal identification system forMalassezia species. J. Med. Microbiol. 55: 1197-1209. Diaz MR, Boekhout T, Theelen B and Fell JW 2000. Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast, Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. Dunbar SA, Vander Zee CA, Oliver KG, Karem KL and Jacobson JW (2003) Quantitative, multiplexed detection of bacterial pathogens: DNA and protein applications of the Luminex LabMAPTM system. J. Microbiol. Methods 53: 245-252. Hoang LMN, Maguire JA, Doyle P, Fyfe M and Roscoe DL (2004) Cryptococcus neoformans infections at Vancouver hospital and health sciences centre (1997-2002): epidemiology, microbiology and histopathology. J. Med. Microbiol. 53: 935-940. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, Macdougall L, Boekhout T, Kwon-Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263. Kwon-Chung KJ, Bennett JE and Rhodes JC (1982) Taxonomic studies on Filobasidiella species and their anamorphs. Antonie van Leeuwenhoek 48: 25-38. Kwon-Chung KJ, Boekhout T, Fell JW and Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804-806.

136

bovers_V4.indd 136 25-10-2007 10:16:32 Chapter 6: Luminex identification of C. neoformans and C. gattii isolates

Kwon-Chung KJ and Varma A (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res. 6: 574-587. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Lengeler KB, Cox GM, and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal Study Group (2003) Molecular Typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195. Mirza SA, Phelan M, Rimland D, Graviss E, Hamill R, Brandt ME, Gardner T, Sattah M, de Leon GP, Baughman W and Hajjeh RA (2003) The changing epidemiology of cryptococcosis: an update from population-based active surveillance in 2 large metropolitan areas, 1992-2000. Clin. Infect. Dis. 36: 789-794. Mitchell DH, Sorrell TC, Allworth AM, Heath CH, McGregor AR, Papanaoum K, Richards MJ and Gottlieb T (1995) Cryptococcal disease of the CNS in immunocompetent hosts: influence of cryptococcal variety on clinical manifestations and outcome. Clin. Infect. Dis. 20: 611-616. Page BT and Kurtzman CP (2005) Rapid identification of Candida species and other clinically important yeast species by flow cytometry. J. Clin. Microbiol.43: 4507-4514. Perfect JR, Durack DT and Gallis HA (1983) Cryptococcemia. Medicine 62: 89-109. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Stephen C, Lester S, Black W, Fyfe M and Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can. Vet. J. 43: 792-794. Tanaka R, Nishimura K and Miyaji M (1999) Ploidy of serotype AD strains of Cryptococcus 6 neoformans. Jpn. J. Med. Mycol. 40: 31-34. Velegraki A, Kiosses VG, Pitsouni H, Toukas D, Daniilidis VD and Legakis NJ (2001) First report of Cryptococcus neoformans var. gattii serotype B from Greece. Med. Mycol. 39: 419-422. Wilson IG (1997) Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63: 3741-3751. Wilson WJ, Erler AM, Nasarabadi SL, Skowronski EW and Imbro PM (2005) A multiplexed PCR- coupled liquid bead array for the simultaneous detection of four biothreat agents. Mol. Cell. Probes 19: 137-144. Xu J, Vilgalys R and Mitchell TG (2000) Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 9: 1471- 1481.

137

bovers_V4.indd 137 25-10-2007 10:16:32 bovers_V4.indd 138 25-10-2007 10:16:33 Chapter 7

General discussion and Summary

bovers_V4.indd 139 25-10-2007 10:16:33 Chapter 7: General discussion and Summary

Cryptococcus neoformans and Cryptococcus gattii are closely related basidiomycetous yeasts that both may cause meningo-encephalitis, which is fatal if left untreated. Cryptococcus gattii had been described as a variety of C. neoformans (Kwon-Chung et al., 1982a), but differences in epidemiology, geographic occurrence, physiological and molecular characteristics, as well as the absence of genetic recombination in progeny of crosses between C. neoformans var. neoformans and C. neoformans var. gattii, have resulted in the description of C. gattii as a separate species (Kwon-Chung et al., 2002). The most striking differences between C. neoformans and C. gattii are their host range and geographic occurrence. Cryptococcus neoformans mainly infects immunocompromised people and occurs worldwide, whereas C. gattii may cause infections in otherwise healthy people and is found predominantly in (sub)tropical regions (Kwon-Chung and Bennett, 1984; Rozenbaum and Goncalves, 1994; Speed and Dunt, 1995; Mitchell et al., 1995; Chen et al., 2000). However, the recent outbreak of C. gattii on Vancouver Island, Canada (Stephen et al., 2002; Kidd et al., 2004), as well as the identification of C. gattii isolates in Southern Europe and in a temperate climate zone in Colombia (Montagna et al., 1997; Baró et al., 1998; Velegraki et al., 2001; Colom et al., 2005; Escandón et al., 2006) indicate that C. gattii may also occur in more temperate regions. Cryptococcus neoformans and C. gattii predominantly reproduce asexually, i.e. by budding. In addition, mating may occur when cells of MATa and MATα meet (Kwon-Chung, 1975; Kwon-Chung, 1976a). Several molecular studies that used RFLP, PCR or AFLP fingerprints, RAPD patterns or sequence analysis, showed that genotypic groups can be distinguished within C. neoformans and C. gattii (Meyer et al., 1993; Ruma et al., 1996; Boekhout et al., 1997; Diaz et al., 2000; Ellis et al., 2000; Xu et al., 2000; Boekhout et al., 2001; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Latouche et al., 2003, Meyer et al., 2003; Katsu et al., 2004; Butler and Poulter, 2005; Diaz et al., 2005; Fraser et al., 2005; Kidd et al., 2005; Bovers et al., 2007b; Bovers et al., 2007c). Six major haploid genotypic groups have consistently been found. Two of them correspond to the varieties of C. neoformans (Franzot et al., 1999): var. grubii contains three genotypic subgroups, i.e. AFLP1=VNI, AFLP1A=VNB and AFLP1B=VNII (Boekhout et al., 2001; Meyer et al., 2003; Barreto de Oliveira et al., 2004; Litvintseva et al., 2006; Bovers et al., 2007b), which form one major genotypic group, and var. neoformans corresponds to the major genotypic group AFLP2=VNIV (Boekhout et al., 2001; Meyer et al., 2003). The two varieties of C. neoformans can also be distinguished by their serotype. The separation into serotypes is based on antigenic differences resulting from variation in polysaccharide structure of the capsule. Serotype A is present in var. grubii, whereas serotype D can be found in var. neoformans (Franzot et al., 1999). Within C. gattii four major genotypic groups have consistently been found, namely AFLP4=VGI, AFLP5=VGIII, AFLP6=VGII and AFLP7=VGIV (Boekhout et al., 2001; Meyer et al.,

140

bovers_V4.indd 140 25-10-2007 10:16:34 Chapter 7: General discussion and Summary

2003; Kidd et al., 2004). The genotypic groups of C. gattii cannot be distinguished by their serotype because serotypes B and C are present in all four genotypic groups (Meyer et al., 2003). In contrast to the genotypic groups of C. neoformans, the genotypic groups of C. gattii have not been described as separate taxa. The goal of the research described in this thesis was to investigate the taxonomic status of the major genotypic groups within the C. neoformans – C. gattii species complex and to study the interactions between them.

To investigate whether haploid C. neoformans and C. gattii isolates consistently cluster within one genotypic group six nuclear regions were sequenced (Bovers et al., 2007b). All haploid genotypic groups were represented. Although several genotypic groups have been distinguished in previous studies on C. neoformans and C. gattii, most studies have used only one region and it is difficult to compare genealogies because the sets of isolates differ between studies. Our analyses confirmed the existence of six major monophyletic lineages within the C. neoformans – C. gattii species complex, which correspond to the previously described genotypic groups (Meyer et al., 2003). In addition, our analyses showed that C. neoformans and C. gattii are sister groups. The two varieties of C. neoformans each corresponded to a monophyletic lineage and these two monophyletic lineages formed sister groups. Furthermore, four monophyletic lineages, corresponding to AFLP4, AFLP5, AFLP6 and AFLP7, could be distinguished within C. gattii. Our analyses indicated that AFLP4 and AFLP5 were sister groups and showed that AFLP6 is basal to all other C. gattii genotypes. All isolates clustered in the same major monophyletic lineage for all regions studied, which indicates that recombination between the monophyletic 7 lineages had not occurred. In addition, two mitochondrial regions were analysed to further investigate the genotypic structure of C. gattii (Bovers et al., 2007c). Monophyletic lineages formed by AFLP5, AFLP6 and AFLP7 isolates coincided with those found by analyses of nuclear regions (Bovers et al., 2007b). Phylogenetic analyses of the mitochondrial regions indicated that AFLP6 was basal to all other C. gattii genotypes. In addition, AFLP5 appeared to be the most derived genotype in analyses of the two mitochondrial regions. In contrast to the results obtained by analyses of nuclear regions, AFLP4 isolates did not form a monophyletic lineage when mitochondrial regions were studied. Five mitochondrial genotypes could be distinguished within AFLP4. One of these genotypes, namely AFLP4-M1, formed a clade together with the AFLP5 and AFLP7 monophyletic lineages, similar to the topology found using nuclear regions (Bovers et al., 2007b). Therefore, this genotype appears to be the core AFLP4 mitochondrial genotype. All other AFLP4 genotypes, corresponding to 65% (n=13) of the studied AFLP4 isolates, possessed sequences that were either completely or partially identical

141

bovers_V4.indd 141 25-10-2007 10:16:35 Chapter 7: General discussion and Summary

to those found in AFLP6 isolates. The existence of isolates that possess AFLP4 as well as AFLP6 mitochondrial sequences indicates that recombination has occurred between mitochondria of different C. gattii genotypes. The ploidy of the AFLP4 isolates was determined by flow cytometry. At least one isolate per mitochondrial genotype was investigated and no diploid or aneuploid isolates were found. In addition, when six nuclear regions were investigated no AFLP6 sequences were found in AFLP4 isolates (Bovers et al., 2007b). These results indicate that these isolates are not hybrids. The presence of isolates with a nuclear AFLP4 genome and (partial) AFLP6 mitochondrial regions indicates that either somatic fusion or mating has occurred between AFLP4 and AFLP6 cells. To our best knowledge, somatic fusion without mating has never been reported in C. gattii. Therefore, our data suggests that mating between AFLP4 and AFLP6 isolates may occur. Diploid or aneuploid C. neoformans isolates, the so-called AD hybrids, are formed by mating between the two varieties of C. neoformans (Tanaka et al., 1999; Sia et al., 2000; Lengeler et al., 2001; Tanaka et al., 2003; Cogliati et al., 2006; Kwon-Chung and Varma, 2006). AD hybrids have been isolated from patients and the environment (Hironaga et al., 1983; Kwon-Chung and Bennett, 1984; Takeo et al., 1993; Brandt et al., 1995; Sukroongreung et al., 1996; Tanaka et al., 1996; Tortorano et al., 1997; Meyer et al., 1999; Cogliati et al., 2001; Nishikawa et al., 2003; Trilles et al., 2003; Tintelnot et al., 2004; Litvintseva et al., 2005a; Litvintseva et al., 2005b; Baroni et al., 2006; Saracli et al., 2006; Viviani et al., 2006). In addition, diploid or aneuploid BD hybrids have been generated by mating between C. neoformans var. neoformans and C. gattii (Kwon-Chung and Varma, 2006). However, a hybrid between C. neoformans and C. gattii had never been isolated from a patient or the environment. Surprisingly, during an investigation of Dutch clinical C. neoformans isolates three isolates were discovered that did not fit to the previously defined AFLP genotypes. These isolates were investigated using several molecular and conventional techniques and were shown to be diploid or aneuploid BD hybrids between C. neoformans var. neoformans and C. gattii AFLP4 (Bovers et al., 2006). These BD hybrids possessed both a C. gattii-MATα and a C. neoformans var. neoformans-MATa allele. The presence of both mating type alleles suggests that these isolates originated from mating between isolates of the two species. Recently, another aberrant AFLP pattern was observed in a clinical isolate that had been isolated from a Canadian patient. This isolate was shown to be a diploid or aneuploid AB hybrid between C. neoformans var. grubii and C. gattii AFLP4 (Bovers et al., 2007d). Only one mating type allele could be identified, namely a C. neoformans var. grubii-MATα allele. However, sequence analyses of two mitochondrial regions showed that the mitochondria were derived from the C. gattii AFLP4 parent. Mitochondria are usually inherited from the MATa parent in C. neoformans matings (Yan and Xu, 2003; Toffaletti et al., 2004; Yan et al., 2004; Yan et al., 2007a; Yan et al., 2007b), which suggest that the

142

bovers_V4.indd 142 25-10-2007 10:16:36 Chapter 7: General discussion and Summary

MATa parent of the AB hybrid was a C. gattii AFLP4 isolate. These data suggests that the AB hybrid originated from mating or somatic fusion between a C. neoformans var. grubii-MATα and a C. gattii AFLP4-MATa isolate with subsequent loss of the MATa region. Interestingly, the C. gattii parent of all BD and AB hybrid isolates belonged to one specific subgroup of AFLP4, suggesting that this subgroup might have an increased mating capability. Currently, three hybrid and six haploid genotypes are recognized within the C. neoformans – C. gattii species complex. A Luminex suspension array developed for identification of C. neoformans and C. gattii isolates was validated for eight of these genotypes (Bovers et al., 2007a). DNA of all haploid genotypes was correctly identified. Furthermore, if two alleles of the probe region, i.e. the intergenic spacer of the ribosomal DNA, were present, hybrid genotypes could be identified. In addition, haploid as well as hybrid genotypes could be detected in cerebrospinal fluid obtained from patients diagnosed with cryptococcosis. The ninth genotype, which is formed by the AB hybrid, was not included in this study because at the time of the experiments it had not been discovered.

Analyses of six nuclear regions consistently demonstrated the presence of six major monophyletic lineages, which correspond to the previously distinguished haploid genotypic groups. These results indicate that these genotypic groups deserve distinction as separate taxa. However, should they be described as species or as varieties? To answer this question the definition of a species should be established first. Although many different species definitions exist, the three most widely used species concepts are the Phenetic Species Concept (PSC), the Biological Species Concept 7 (BSC), and the Phylogenetic Species Concept based on Genealogical Concordance (GCPSC).

The PSC describes a species as “the smallest group that is consistently and persistently distinct and can be distinguished morphologically (phenotypically)” (Cronquist, 1978). The teleomorphs Filobasidiella neoformans (anamorph: Cryptococcus neoformans) and Filobasidiella bacillispora (anamorph: Cryptococcus gattii) clearly differ morphologically. Filobasidiella neoformans forms subglobose to ellipsoidal, finely roughened basidiospores, whereas F. bacillispora produces basidiospores that are narrow, smooth and rod-shaped (Kwon-Chung, 1976b). The anamorphs are more difficult to distinguish by morphology, although there are some differences. Cultures of C. gattii are generally more mucoid than those of C. neoformans (Kwon- Chung and Varma, 2006). In addition, yeast cells of C. gattii are globose, ovoidal to pyriform, whereas pyriform cells are uncommon in C. neoformans (Kwon-Chung et

143

bovers_V4.indd 143 25-10-2007 10:16:37 Chapter 7: General discussion and Summary

al., 1982a). However, it is easier to distinguish C. neoformans and C. gattii isolates by their physiological differences. Cryptococcus gattii isolates are resistant to l- canavanine and can use glycine as a sole source of carbon and nitrogen, whereas the few C. neoformans isolates that are resistant to l-canavanine cannot assimilate glycine (Kwon-Chung et al., 1982b). Therefore, C. gattii isolates can grow on canavanine- glycine-bromothymol blue (CGB) medium, resulting in a color change, whereas C. neoformans isolates cannot grow on this medium (Kwon-Chung et al., 1982b). Incubation on an EDTA containing medium suppressed urease activity in C. gattii isolates, but not in C. neoformans (Kwon-Chung et al., 1987). In addition, C. gattii isolates can degrade creatinine in the presence of ammonium, use d-proline as a sole nitrogen source, and assimilate d-tryptophan, whereas C. neoformans isolates cannot (Polacheck and Kwon-Chung, 1980; Dufait et al., 1987; Mukamurangwa et al., 1995). Cryptococcus gattii and C. neoformans can also be distinguished using creatinine-dextrose-bromothymol blue-thymine (CDBT) medium (Irokanulo et al., 1994). The color of this medium changes from gold into blue-green when C. gattii isolates are inoculated, but remains unchanged or changes into bright orange when C. neoformans isolates are inoculated. The different response on CDBT medium is probably caused by differences in creatinine assimilation between C. gattii and C. neoformans (Irokanulo et al., 1994). In addition, C. gattii and C. neoformans can be distinguished by serotype. Isolates belonging to serotypes B or C are found in C. gattii, whereas isolates belonging to serotypes A or D correspond to the varieties of C. neoformans (Kwon-Chung et al., 1982a; Kwon-Chung et al., 2002). The two varieties of C. neoformans also differ physiologically. Cryptococcus neoformans var. neoformans isolates can assimilate thymine, whereas C. neoformans var. grubii isolates cannot. This property has been used in creatinine-dextrose- bromothymol blue-thymine (CDBT) medium, which may be used to distinguish the two C. neoformans varieties (Irokanulo et al., 1994). The golden color of CDBT medium remains unchanged and colonies remain pale when C. neoformans var. grubii isolates are inoculated, whereas the color of the medium changes into bright orange and colonies turn bright red when C. neoformans var. neoformans isolates are inoculated (Irokanulo et al., 1994). In addition, the two varieties can be distinguished by serotype. Isolates belonging to serotype A are found within C. neoformans var. grubii and isolates belonging to serotype D are found within C. neoformans var. neoformans (Franzot et al., 1999). Morphological or physiological differences have not been described for the genotypic groups of C. gattii. In our laboratory, several physiological tests have been performed on isolates belonging to the four C. gattii genotypic groups. The responses of isolates within a genotypic group were highly variable and no physiological characteristics were identified that could be used to distinguish the C. gattii genotypic

144

bovers_V4.indd 144 25-10-2007 10:16:38 Chapter 7: General discussion and Summary

groups (unpublished data). In addition, although two different serotypes are present within C. gattii (Kwon-Chung et al., 2002) the serotype cannot be used to distinguish between the genotypic groups as isolates of both serotype B and C are present in all four C. gattii genotypic groups (Meyer et al., 2003). These results confirm that, according to the PSC, C. neoformans and C. gattii are different species. In addition, the two varieties of C. neoformans might be described as different species. The genotypic groups present within C. gattii are morphologically and physiologically indistinguishable and are therefore not considered distinct species according to the PSC.

“A group of actually or potentially interbreeding natural populations which are reproductively isolated from other such groups” is considered a species under the BSC (Mayr, 1940; Taylor et al., 2000). Unfortunately, only few researchers have examined mating between different genotypic groups of C. neoformans and C. gattii. Mating of AFLP5 isolates with isolates of AFLP6 resulted in the production of basidiospores (Schmeding et al., 1981; Fraser et al., 2003). Furthermore, Schmeding et al. (1981) observed basidiospores when C. neoformans var. neoformans was crossed with C. neoformans var. grubii and C. gattii AFLP5 and AFLP6 (Schmeding et al., 1981). In addition, basidiospores were observed when C. neoformans var. grubii was mated with C. gattii AFLP6 (Schmeding et al., 1981). Unfortunately, the viability and ploidy of these basidiospores was not determined. Other authors did examine basidiospores derived from intergenotypic matings. Kwon-Chung et al. (1982a) carried out two mating experiments between isolates of C. neoformans and C. gattii. In one mating experiment involving isolates 7 of C. neoformans var. neoformans (B3502) and C. gattii AFLP4 (CBS6289), 62 of the isolated basidiospores were viable, which corresponded to 25-30% of the total number of isolated basidiospores. The majority of these basidiospores, namely 97%, were serotype D. In addition, self-fertile isolates (27%) were found which were all serotype D. Furthermore, recombinant phenotypes were observed (53%) (Kwon- Chung et al., 1982a). Single basidiospore isolates were preserved and recently sixteen of these isolates were studied in more detail (Kwon-Chung and Varma, 2006). The majority (81%) of these isolates was serotype D and the remaining isolates switched from serotype BD to D in subsequent tests. All recovered haploid isolates (44%), were identical to the serotype D parent. The remaining isolates (56%) were diploid or aneuploid. Some isolates (31%) possessed two alleles for all four studied genes, whereas other isolates (25%) possessed two alleles for at least one of the studied genes. All self-fertile isolates that had been described in the original study were diploid. Although recombinant phenotypes had been found in the original study, no recombinant isolates were discovered when molecular techniques were used. In

145

bovers_V4.indd 145 25-10-2007 10:16:38 Chapter 7: General discussion and Summary

the original study, mating was also carried out between C. neoformans var. neoformans (B3502) and C. gattii AFLP6 (CBS6956), which resulted in the isolation of 43 viable basidiospores, corresponding to 51% of the total number of isolated basidiospores. All recovered progeny was serotype D, and 47% of the progeny had a recombinant phenotype (Kwon-Chung et al., 1982a). Unfortunately, in this case the progeny was not studied into more detail.

Three studies have examined F1 progeny resulting from mating between the two

varieties of C. neoformans. Kwon-Chung and Varma (2006) examined twenty F1 isolates. Two isolates (10%) were identical to the serotype D parent, but the majority of isolates was diploid (20%) or aneuploid (55%). In addition, three recombinant isolates (15%) were discovered. These isolates were haploid and possessed genes derived from both

parents. Cogliati et al. (2006) examined ten F1 isolates of which three isolates (30%) were haploid and identical to the serotype D parent, three isolates (30%) were diploid

and four isolates (40%) were aneuploid. Twenty-one F1 isolates were examined by Tanaka et al. (2003). The majority of these isolates (52%) was haploid and identical to the serotype D parent, 14% of the isolates was diploid and 10% was aneuploid. In addition, five haploid isolates (24%) possessed recombinant phenotypes. However, when two of these isolates were examined in more detail they possessed a parental genotype. Unfortunately, the other three isolates were not further examined. In addition, some mating experiments have been carried out between isolates of different C. gattii genotypic groups. Mating between C. gattii AFLP5 (CBS6955) and C. gattii AFLP6 (CBS6956) resulted in the formation of viable basidiospores and led to the description of Filobasidiella bacillispora, the teleomorph of C. gattii (Kwon-Chung, 1976b). In addition, C. gattii AFLP4 (CBS6289) was crossed with C. gattii AFLP5 (CBS6955) and viable basidiospores (30%) were formed. About 30% of the viable progeny was self-fertile (MATa-MATα) (Kwon-Chung et al., 1982a). The results obtained in all of these studies indicate that mating between different genotypic groups of the C. neoformans – C. gattii species complex may generate viable offspring. The viability of the basidiospores ranged from 25 to 51% (Kwon-Chung et al., 1982a). These percentages are similar to those reported for mating within C. neoformans var. grubii, which resulted in 25% viable basidiospores (Nielsen et al., 2003), and within C. neoformans var. neoformans, which generated 50.8% viable basidiospores (Wickes et al., 1996). However, much higher percentages of viable basidiospores, namely 82.9 and 90%, have also been reported for mating within C. neoformans var. neoformans (Kwon-Chung et al., 1982c; Wickes et al., 1996). These results indicate that the percentage of viable basidiospores is highly variable and shows that the percentage of viable basidiospores obtained in intergenotypic matings does not differ from the percentages that have been found for some intragenotypic matings.

146

bovers_V4.indd 146 25-10-2007 10:16:39 Chapter 7: General discussion and Summary

Unfortunately, experiments to establish the fertility of progeny of intergenotypic matings have only rarely been carried out. Heitman et al. (1999) reported that mating between the two varieties of C. neoformans with subsequent backcrosses to C. neoformans var. grubii isolates resulted in viable and fertile progeny for four to six backcrosses. However, beyond this stage some isolates lost their ability to sexually reproduce, whereas other isolates became self-fertile. The fertility of progeny resulting from interspecies mating or from mating between different genotypic groups of C. gattii has never been studied. Therefore, it is not known whether the offspring of these matings may reproduce sexually. However, a large spectrum of reproduction possibilities has been described for C. neoformans and C. gattii. Self-fertile diploid isolates have been observed (Takeo et al., 1993, Tanaka et al., 1999; Cogliati et al., 2001; Lengeler et al., 2001; Kwon-Chung and Varma, 2006), and although the viability of the resulting basidiospores is low (5.5%) (Lengeler et al., 2001) this indicates that diploid isolates can reproduce. Self-fertile isolates usually produce diploid progeny (Tanaka et al., 1999; Cogliati et al., 2001; Lengeler et al., 2001). Diploid isolates which behave as MATα isolates in mating experiments have also been described (Takeo et al., 1993, Tanaka et al., 1999; Cogliati et al., 2001; Lengeler et al., 2001). In addition, haploid C. neoformans and C. gattii isolates could reproduce by haploid fruiting or same-sex mating (Wickes et al., 1996, Tscharke et al., 2003; Fraser et al., 2005; Lin et al., 2005; Yan et al., 2007a). Haploid fruiting and same-sex mating involves self-diploidization or cell- cell fusion and may occur between isolates of a single mating type (Wickes et al., 1996, Tscharke et al., 2003; Lin et al., 2005). Haploid recombinant isolates may reproduce by haploid fruiting although it is less efficient than mating (Wickes et al., 1996). Usually, C. neoformans and C. gattii generate offspring asexually, i.e. by budding. Combined, 7 these reproduction mechanisms indicate that the progeny of intergenotypic matings are not dead ends in evolution, but may reproduce asexually or sexually. The mating experiments described above have all been performed under laboratory conditions, which raises the question about the relevance of these findings to the situation in nature. Mating has never been observed in nature, although evidence of recombination has been found in subpopulations of C. neoformans and C. gattii (Litvintseva et al., 2003; Campbell et al., 2005; Litvintseva et al., 2005a). In addition, hybrids between the two varieties of C. neoformans and hybrids between C. neoformans and C. gattii have been found. These observations indicate that mating does occur in nature. Currently, only four C. neoformans × C. gattii hybrid isolates have been identified (Bovers et al., 2006; Bovers et al., 2007d), which suggests that mating between C. neoformans and C. gattii is rare. In contrast, hybrids between the two varieties of C. neoformans are found more often, especially in Europe (Kwon-Chung and Bennett, 1984; Cogliati et al., 2001; Viviani et al., 2006). Countries in Southern Europe, such as Spain, Greece and Portugal, have high percentages of clinical AD hybrid isolates,

147

bovers_V4.indd 147 25-10-2007 10:16:40 Chapter 7: General discussion and Summary

ranging from 45 to 50% (Viviani et al., 2006). Furthermore, the identification of five hybridization events in fourteen AD hybrid isolates (Xu and Mitchell, 2003) shows that mating between the two varieties of C. neoformans is common. What are the implications of these observations for the number of species according to the BSC? Mating between C. neoformans and C. gattii does occur in nature, as is indicated by the presence of hybrids between the two species. However, the number of observed hybrids is low, which suggests that interspecies mating is a rare event. In addition, laboratory matings between C. neoformans and C. gattii have never resulted in the generation of haploid recombinants. These observations indicate that the fertilization barrier between C. neoformans and C. gattii is quite strong, and therefore, the division into two species might be correct. Mating between the two varieties of C. neoformans occurs more often, as is indicated by the number of hybridization events that have been identified in fourteen isolates. In addition, intervarietal progeny was fertile for several generations and haploid recombinant progeny has been generated in laboratory matings. These observations, combined with the high number of reproduction possibilities, indicate that progeny of mating between the two varieties of C. neoformans are not dead ends in evolution. These results suggest that the two varieties of C. neoformans need not be raised to species level and warrant the current varietal status. Unfortunately, only few data is available on mating between C. gattii genotypic groups. However, laboratory crossings between genotypic groups of C. gattii have resulted in viable basidiospores and C. gattii isolates that possess nuclear and mitochondrial regions belonging to different genotypic groups have been found (Bovers et al., 2007c), indicating that mating between different genotypic groups of C. gattii may occur in nature. In addition, the sequence similarity between the genotypic groups of C. gattii is higher than the sequence similarity between the two varieties of C. neoformans. The similarity of PRP8 intein sequences was 97% between C. gattii genotypic groups and 94 to 95% between the two varieties of C. neoformans (Butler and Poulter, 2005). In addition, sequence comparison of the IGS1 and IGS2 intergenic spacer regions resulted in a sequence similarity of 90.9-96% among the C. gattii genotypic groups, and a similarity of 74.8 to 79.6% between the C. neoformans varieties (Diaz et al., 2005). Furthermore, sequence comparison of six concatenated nuclear regions indicated that the genotypic groups of C. gattii were 95 to 96% similar, whereas the two varieties of C. neoformans were 91 to 92% similar (Bovers et al., 2007b). These results indicate that genotypic groups of C. gattii are more similar to each other than the two varieties of C. neoformans, and suggests that mating between C. gattii genotypic groups might be easier than mating between the two varieties of C. neoformans. Although only few data is available, these results might suggest that the genotypic groups of C. gattii are not distinct species under the BSC.

148

bovers_V4.indd 148 25-10-2007 10:16:41 Chapter 7: General discussion and Summary

However, the fertility of intergenotypic progeny should be studied for all possible intergenotypic matings to determine the number of species under the BSC with certainty. In addition, the BSC has been developed for sexual organisms (animals) and may not be applicable to predominant asexual organisms such as C. neoformans and C. gattii.

According to the GCPSC a species is “a basal, exclusive group of organisms all of whose genes coalesce more recently with each other than with those of any organism outside the group, and that contains no exclusive group within it” (Baum and Donoghue, 1995; Taylor et al., 2000). Or in simpler words: a species is a group of organisms, of which all genes show the same genealogy. Cryptococcus neoformans and C. gattii are sister groups for all regions studied (Diaz et al., 2000; Xu et al., 2000; Biswas et al., 2003; Katsu et al., 2004; Diaz et al., 2005; Bovers et al., 2007b) and no recombination between C. neoformans and C. gattii was observed (Bovers et al., 2007b). In addition, the two varieties of C. neoformans formed two monophyletic lineages for all nuclear and mitochondrial regions studied (Diaz et al., 2000; Xu et al., 2000; Sugita et al., 2001; Chaturvedi et al., 2002; Biswas et al., 2003; Katsu et al., 2004; Butler and Poulter, 2005; Diaz et al., 2005; Bovers et al., 2007b; M. Bovers, unpublished data) and isolates clustered in the same monophyletic lineage for six nuclear regions (Bovers et al., 2007b). The four C. gattii genotypic groups formed four monophyletic lineages for all studied nuclear regions (Chaturvedi et al., 2002; Biswas et al., 2003; Butler and Poulter, 2005; Diaz et al., 2005; Fraser et al., 2005; Kidd et al., 2005; Bovers et al., 2007b) and isolates consistently clustered within the same monophyletic lineage for six nuclear regions (Bovers et al., 2007b). However, analyses of mitochondrial regions showed that C. gattii AFLP4 isolates did not form a monophyletic lineage (Bovers et al., 2007c). Surprisingly, the majority of 7 studied C. gattii AFLP4 isolates possessed mitochondrial sequences identical to those found in C. gattii AFLP6 isolates. These results show that within C. gattii the genealogies obtained by analyses of nuclear and mitochondrial regions were not the same. In most AFLP4 isolates studied, the mitochondrial regions coalesced most recently with AFLP6 mitochondrial regions, which indicates that the four genotypic groups of C. gattii are not distinct species according to the GCPSC. However, according to the GCPSC, C. neoformans var. neoformans, C. neoformans var. grubii and C. gattii are distinct species.

The development of a species is not a sudden, but rather a continuous event. At first, differences in reproductive potential arise, and mating between different groups within a species generates less progeny or progeny with a reduced viability when compared to mating within a group. Later, hybrids may be formed when members of different groups mate. These hybrids may be sterile, because of difficulties in chromosome pairing. However, initially, hybrid sterility is only partial, and some fertile offspring may be produced. A little further in the speciation process, the two genomes will have

149

bovers_V4.indd 149 25-10-2007 10:16:42 Chapter 7: General discussion and Summary

differentiated and will not be able to cooperate, leading to hybrid inviability. Eventually, a pre-zygotic barrier will arise, resulting in two species that are unable to mate. Translating these processes to the C. neoformans – C. gattii species complex, one could imagine that C. neoformans and C. gattii have almost completed speciation, they are morphologically and physiologically different and are sister groups for all studied regions. However, they are still capable of forming viable hybrids, but these are only rarely found (Bovers et al., 2006; Kwon-Chung and Varma, 2006; Bovers et al., 2007d), suggesting that most hybrids are inviable. The separation of the two varieties within C. neoformans started more recently and has resulted in some physiological differences. In addition, the two varieties consistently formed monophyletic lineages for all nuclear and mitochondrial regions studied. However, hybrids are formed when the two varieties mate (Tanaka et al., 2003; Cogliati et al., 2006; Kwon-Chung and Varma, 2006). These hybrids have been generated at multiple occasions (Xu and Mitchell, 2003) and are found regularly in Southern Europe (Cogliati et al., 2001; Viviani et al., 2006). In addition, mating between the two varieties resulted in viable progeny which was fertile for four to six generations (Heitman et al., 1999). Furthermore, haploid recombinants were formed when the two varieties were mated (Kwon-Chung and Varma, 2006). These observations indicate that the two varieties of C. neoformans are still able to produce normal haploid recombinant offspring although mating more often results in the formation of hybrids. The genotypic groups of C. gattii started to diverge even more recently and have not yet developed physiological characteristics by which they can be distinguished. Analyses of nuclear regions showed a consistent placement of isolates into one of the four monophyletic lineages, which however, could not be reproduced in the analyses of mitochondrial regions. The latter study showed that certain AFLP4 isolates possessed AFLP6 mitochondrial sequences (Bovers et al., 2007c), indicating that mating may have occurred between these two C. gattii genotypic groups. Interestingly, analysis of six concatenated nuclear regions indicated that these two C. gattii genotypes are the most diverged genotypic groups of C. gattii (Bovers et al., 2007b). Therefore, it is likely that mating could also occur between more closely related C. gattii genotypic groups. The sequence similarity among the C. gattii genotypic groups is higher than the similarity between the two varieties of C. neoformans. Therefore, one could speculate that mating is more likely to be successful between genotypic groups of C. gattii than between the two varieties of C. neoformans. Unfortunately, only few mating experiments with C. gattii isolates that belong to different genotypic groups have been carried out. Basidiospores were observed when C. gattii AFLP5 was crossed with either C. gattii AFLP4 or AFLP6 (Schmeding et al., 1981; Kwon-Chung et al., 1982a; Fraser et al., 2003). In addition, hybrids between different C. gattii genotypes have not been found. These observations indicate that mating between genotypic groups of C. gattii is likely to occur, although it is possible that these intergenotypic matings may generate less, or less viable progeny.

150

bovers_V4.indd 150 25-10-2007 10:16:43 Chapter 7: General discussion and Summary

Based on these results, the current two species status of C. neoformans and C. gattii is justified. The high number of isolated C. neoformans hybrids and the formation of fertile progeny and haploid recombinants in mating experiments carried out with the two varieties of C. neoformans indicates that the two groups are not yet species, but varieties. The speciation process within C. gattii is even further from completion, although four genotypic groups can be distinguished by differences in the nuclear genome using, e.g. Luminex xMAP technology (Bovers et al., 2007a). These four genotypic groups might be described as separate varieties.

151

bovers_V4.indd 151 25-10-2007 10:16:44 Chapter 7: General discussion and Summary

References

Baró T, Torres-Rodríguez JM, Hermoso de Mendoza M, Morera Y and Alía C (1998) First identification of autochthonousCryptococcus neoformans var. gattii isolated from goats with predominantly severe pulmonary disease in Spain. J. Clin. Microbiol. 36: 458-461. Baroni F de A, Paula CR, Silva EG, Viani FC, Rivera IN, Oliveira MT and Gambale W (2006) Cryptococcus neoformans strains isolated from church towers in Rio de Janeiro City, RJ, Brazil. Rev. Inst. Med. trop. S. Paulo 48: 71-75. Barreto de Oliveira MT, Boekhout T, Theelen B, Hagen F, Baroni FA, Lazera MS, Lengeler KB, Heitman J, Rivera ING and Paula CR (2004) Cryptococcus neoformans shows a remarkable genotypic diversity in Brazil. J. Clin. Microbiol. 42: 1356-1359. Baum DA and Donoghue MJ (1995) Choosing among alternative phylogenetic species concepts. Syst. Bot. 20: 560-573. Biswas SK, Wang L, Yokoyama K and Nishimura K (2003) Molecular analysis of Cryptococcus neoformans mitochondrial cytochrome b gene sequences. J. Clin. Microbiol. 41: 5572- 5576. Boekhout T, Theelen B, Diaz M, Fell JW, Hop WCJ, Abeln ECA, Dromer F and Meyer W (2001) Hybrid genotypes in the pathogenic yeast Cryptococcus neoformans. Microbiology 147: 891-907. Boekhout T, van Belkum A, Leenders ACAP, Verbrugh HA, Mukamurangwa P, Swinne D and Scheffers WA (1997) Molecular typing of Cryptococcus neoformans: taxonomic and epidemiological aspects. Int. J. Syst. Bacteriol. 47: 432-442. Bovers M, Diaz MR, Hagen F, Spanjaard L, Duim B, Visser CE, Hoogveld HL, Scharringa J, Hoepelman IM, Fell JW and Boekhout T (2007a) Identification of genotypically diverse Cryptococcus neoformans and Cryptococcus gattii isolates using Luminex xMAP technology. J. Clin. Microbiol. 45: 1874-1883. Bovers M, Hagen F, Kuramae EE and Boekhout T (2007b) Six monophyletic lineages identified within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. PhD Thesis: Chapter 2. Bovers M, Hagen F, Kuramae EE and Boekhout T (2007c) The mitochondrial genome of Cryptococcus gattii shows evidence of recombination. PhD Thesis: Chapter 3. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G and Boekhout T (2007d) Promiscuous mating of Cryptococcus neoformans and Cryptococcus gattii: discovery of a novel AB hybrid. PhD Thesis: Chapter 5. Brandt ME, Hutwagner LC, Kuykendall RJ, Pinner RW and the cryptococcal disease active surveillance group (1995) Comparison of multilocus enzyme electrophoresis and Random Amplified Polymorphic DNA analysis for molecular subtyping of Cryptococcus neoformans. J. Clin. Microbiol. 33: 1890-1895. Butler MI and Poulter RTM (2005) The PRP8 inteins in Cryptococcus are a source of phylogenetic and epidemiological information. Fungal Genet. Biol. 42: 452-463. Campbell LT, Currie BJ, Krockenberger M, Malik R, Meyer W, Heitman J and Carter D (2005) Clonality and recombination in genetically differentiated subgroups of Cryptococcus gattii. Eukaryot. Cell 4: 1403-1409. Chaturvedi V, Fan J, Stein B, Behr MJ, Samsonoff WA, Wickes BL and Chaturvedi S (2002) Molecular genetic analyses of mating pheromones reveal intervariety mating or hybridization in Cryptococcus neoformans. Infect. Immun. 70: 5225-5235.

152

bovers_V4.indd 152 25-10-2007 10:16:44 Chapter 7: General discussion and Summary

Chen S, Sorrell T, Nimmo G, Speed B, Currie B, Ellis D, Marriott D, Pfeiffer T, Parr D, Byth K and the Australasian Cryptococcal Study Group (2000) Epidemiology and host- and variety- dependent characteristics of infection due to Cryptococcus neoformans in Australia and New Zealand. Clin. Infect. Dis. 31: 499-508. Cogliati M, Esposto MC, Clarke DL, Wickes BL and Viviani MA (2001) Origin of Cryptococcus neoformans var. neoformans diploid strains. J. Clin. Microbiol. 39: 3889-3894. Cogliati M, Esposto MC, Tortorano AM and Viviani MA (2006) Cryptococcus neoformans population includes hybrid strains homozygous at mating-type locus. FEMS Yeast Res. 6: 608-613. Colom MF, Frasés S, Ferrer C, Jover A, Andreu M, Reus S, Sánchez M and Torres-Rodríguez JM (2005) First case of human Cryptococcosis due to Cryptococcus neoformans var. gattii in Spain. J. Clin. Microbiol. 43: 3548-3550. Cronquist A (1978) Once again, what is a species? Beltsville Symp. Agricult. Res. 2: 3-20. Diaz MR, Boekhout T, Kiesling T and Fell JW (2005) Comparative analysis of the intergenic spacer regions and population structure of the species complex of the pathogenic yeast Cryptococcus neoformans. FEMS Yeast Res. 5:1129-1140. Diaz MR, Boekhout T, Theelen B and Fell JW (2000) Molecular sequence analyses of the intergenic spacer (IGS) associated with rDNA of the two varieties of the pathogenic yeast Cryptococcus neoformans. Syst. Appl. Microbiol. 23: 535-545. Dufait R, Velho R and De Vroey C (1987) Rapid identification of the two varieties ofCryptococcus neoformans by d-proline assimilation. Mykosen 30: 483. Ellis D, Marriott D, Hajjeh RA, Warnock D, Meyer W and Barton R (2000) Epidemiology: surveillance of fungal infections. Med. Mycol. 38: 173-182. Escandón P, Sánchez A, Martínez M, Meyer W and Castañeda E (2006) Molecular epidemiology of clinical and environmental isolates of the Cryptococcus neoformans species complex reveals a high genetic diversity and the presence of the molecular type VGII mating type a in Colombia. FEMS Yeast Res. 6: 625-635. Franzot SP, Salkin IR and Casadevall A (1999) Cryptococcus neoformans var. grubii: separate varietal status for Cryptococcus neoformans serotype A isolates. J. Clin. Microbiol. 37: 838-840. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, Diezmann S, Allen A, Stajich JE, Dietrich FS, Perfect JR and Heitman J (2005) Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360-1364. 7 Fraser JA, Subaran RL, Nichols CB and Heitman J (2003) Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: implications for an outbreak on Vancouver Island, Canada. Eukaryot. Cell 2: 1036-1045. Heitman J, Allen B, Alspaugh JA and Kwon-Chung KJ (1999) On the origins of congenic MATα and MATa strains of the pathogenic yeast Cryptococcus neoformans. Fungal Genet. Biol. 28: 1-5. Hironaga M, Ikeda R, Fukazawa Y and Watanabe S (1983) Mating types and serotypes of Cryptococcus neoformans isolated in Japan. Sabouraudia 21: 73-78. Irokanulo EAO, Akueshi CO and Makinde AA (1994) Differentiation of Cryptococcus neoformans serotypes A and D using creatinine dextrose bromothymol blue thymine medium. Br. J. Biomed. Sci. 51: 100-103. Katsu M, Kidd S, Ando A, Moretti-Branchini ML, Mikami Y, Nishimura K and Meyer W (2004) The internal transcribed spacers and 5.8S rRNA gene show extensive diversity among isolates of the Cryptococcus neoformans species complex. FEMS Yeast Res. 4: 377-388. Kidd SE, Guo H, Bartlett KH, Xu J and Kronstad JW (2005) Comparative gene genealogies indicate that two clonal lineages of Cryptococcus gattii in British Columbia resemble strains from other geographical areas. Eukaryot. Cell 4: 1629-1638.

153

bovers_V4.indd 153 25-10-2007 10:16:45 Chapter 7: General discussion and Summary

Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, MacDougall L, Boekhout T, Kwon-Chung KJ and Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Colombia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263. Kwon-Chung KJ (1975) A new genus, Filobasidiella, the perfect state of Cryptococcus neoformans. Mycologia 67: 1197-1200. Kwon-Chung KJ (1976a) Morphogenesis of Filobasidiella neoformans, the sexual state of Cryptococcus neoformans. Mycologia 68: 821-833. Kwon-Chung KJ (1976b) A new species of Filobasidiella, the sexual state of Cryptococcus neoformans B and C serotypes. Mycologia 68: 942-946. Kwon-Chung KJ and Bennett JE (1984) Epidemiological differences between the two varieties of Cryptococcus neoformans. Am. J. Epidemiol. 120: 123-130. Kwon-Chung KJ and Varma A (2006) Do major species concepts support one, two or more species within Cryptococcus neoformans? FEMS Yeast Res. 6: 574-587. Kwon-Chung KJ, Bennett, JE and Rhodes, JC (1982a) Taxonomic studies on Filobasidiella species and their anamorphs. Antonie van Leeuwenhoek 48: 25-38. Kwon-Chung KJ, Boekhout T, Fell JW and Diaz M (2002) Proposal to conserve the name Cryptococcus gattii against C. hondurianus and C. bacillisporus (Basidiomycota, Hymenomycetes, Tremellomycetidae). Taxon 51: 804-806. Kwon-Chung KJ, Polacheck I and Bennett JE (1982b) Improved diagnostic medium for separation of Cryptococcus neoformans var. neoformans (serotypes A and D) and Cryptococcus neoformans var. gattii (serotypes B and C). J. Clin. Microbiol. 15: 535-537. Kwon-Chung KJ, Polacheck I and Popkin RJ (1982c) Melanin-lacking mutants of Cryptococcus neoformans and their virulence for mice. J. Bacteriol. 150: 1414-1421. Kwon-Chung KJ, Wickes BL, Booth JL, Vishniac HS and Bennett JE (1987) Urease inhibition by EDTA in the two varieties of Cryptococcus neoformans. Infect. Immun. 55: 1751- 1754. Latouche GN, Huynh M, Sorrell TC and Meyer W (2003) PCR-restriction fragment length polymorphism analysis of the phospholipase B (PLB1) gene for subtyping of Cryptococcus neoformans isolates. Appl. Environ. Microbiol. 69: 2080-2086. Lengeler KB, Cox GM and Heitman J (2001) Serotype AD strains of Cryptococcus neoformans are diploid or aneuploid and are heterozygous at the mating-type locus. Infect. Immun. 69: 115-122. Lin X, Hull CM and Heitman J (2005) Sexual reproduction between partners of the same mating type in Cryptococcus neoformans. Nature 434: 1017-1021. Litvintseva AP, Kestenbaum L, Vilgalys R and Mitchell TG (2005a) Comparative analysis of environmental and clinical populations of Cryptococcus neoformans. J. Clin. Microbiol. 43: 556- 564. Litvintseva AP, Marra RE, Nielsen K, Heitman J, Vilgalys R and Mitchell TG (2003) Evidence of sexual recombination among Cryptococcus neoformans serotype A isolates in sub-Saharan Africa. Eukaryot. Cell 2: 1162-1168. Litvintseva AP, Thakur R, Reller LB and Mitchell TG (2005b) Prevalence of clinical isolates of Cryptococcus gattii serotype C among patients with AIDS in sub-saharan Africa. J. Infect. Dis. 192: 888-892. Litvintseva AP, Thakur R, Vilgalys R and Mitchell TG (2006) Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics 172: 2223-2238. Mayr E (1940) Speciation phenomena in birds. Am. Nat. 74: 249-278. Meyer W, Castañeda A, Jackson S, Huynh M, Castañeda E and the IberoAmerican Cryptococcal study group (2003) Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg. Infect. Dis. 9: 189-195.

154

bovers_V4.indd 154 25-10-2007 10:16:46 Chapter 7: General discussion and Summary

Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, Viviani MA, Chindamporn A, Sukroongreung S, John MA, Ellis DH and Sorrell TC (1999) Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA - a pilot studyto standardize techniques on which to base a detailed epidemiological survey. Electrophoresis 20: 1790-1799. Meyer W, Mitchell TG, Freedman EZ and Vilgalys R (1993) Hybridization probes for conventional DNA fingerprinting used as single primers in the polymerase chain reaction to distinguish strains of Cryptococcus neoformans. J. Clin. Microbiol. 31: 2274-2280. Mitchell DH, Sorrell TC, Allworth AM, Heath CH, McFregor AR, Papanaoum K, Richards MJ and Gottlieb T (1995) Cryptococcal disease of the CNS in immunocompetent hosts: influence of cryptococcal variety on clinical manifestations and outcome. Clin. Infect. Dis. 20: 611- 616. Montagna MT, Viviani MA, Pulito A, Aralla C, Tortorano AM, Fiore L and Barbuti S (1997) Cryptococcus neoformans var. gattii in Italy. Note II. Environmental investigation related to an autochtonous clinical case in Apulia. J. Mycol. Méd. 7: 93-96. Mukamurangwa P, Raes-Wuytack C and De Vroey Ch. (1995) Cryptococcus neoformans var. gattii can be separated from var. neoformans by its ability to assimilate d-tryptophan. J. Med. Vet. Mycol. 33: 419-420. Nielsen K, Cox GM, Wang P, Toffaletti DL, Perfect JR and Heitman J (2003) Sexual cycle of Cryptococcus neoformans var. grubii and virulence of congenic a and α isolates. Infect. Immun. 71: 4831-4841. Nishikawa MM, Lazéra MS, Barbosa GG, Trilles L, Balassiano BR, Macedo RCL, Bezerra CCF, Pérez MA, Cardarelli P and Wanke B (2003) Serotyping of 467 Cryptococcus neoformans isolates from clinical and environmental sources in Brazil: analysis of host and regional patterns. J. Clin. Microbiol. 41: 73-77. Polacheck I and Kwon-Chung KJ (1980) Creatine metabolism in Cryptococcus neoformans and Cryptococcus bacillisporus. J. Bacteriol. 142: 15-20. Rozenbaum R and Goncalves AJ (1994) Clinical epidemiological study of 171 cases of cryptococcosis. Clin. Infect. Dis. 18: 369-380. Ruma P, Chen SC, Sorrell TC and Brownlee AG (1996) Characterization of Cryptococcus neoformans by random DNA amplification. Lett. Appl. Microbiol.23: 312-316. 7 Saracli MA, Yildiran ST, Sener K, Gonlum A, Doganci L, Keller SM and Wickes BL (2006) Genotyping of Turkish environmental Cryptococcus neoformans var. neoformans isolates by pulsed field gel electrophoresis and mating type. Mycoses49: 124-129. Schmeding KA, Jong SC and Hugh R (1981) Sexual compatibility between serotypes of Filobasidiella neoformans (Cryptococcus neoformans). Curr. Microbiol. 5: 133-138. Sia RA, Lengeler KB and Heitman J (2000) Diploid strains of the pathogenic basidiomycete Cryptococcus neoformans are thermally dimorphic. Fungal Genet. Biol. 29: 153-163. Speed B and Dunt D (1995) Clinical and host differences between infections with the two varieties of Cryptococcus neoformans. Clin. Infect. Dis. 21: 28-34. Stephen C, Lester S, Black W, Fyfe M and Raverty S (2002) Multispecies outbreak of cryptococcosis on southern Vancouver Island, British Columbia. Can. Vet. J. 43: 792-794. Sugita T, Ikeda R and Shinoda T (2001) Diversity among strains of Cryptococcus neoformans var. gattii as revealed by a sequence analysis of multiple genes and a chemotype analysis of capsular polysaccharide. Microbiol. Immunol. 45: 757-768. Sukroongreung S, Nilakul C, Ruangsomboon O, Chuakul W and Eampokalap B (1996) Serotypes of Cryptococcus neoformans during the AIDS era in Thailand. Mycopathologia 135: 75-78. Tanaka R, Nishimura K and Miyaji M (1999) Ploidy of serotype AD strains of Cryptococcus neoformans. Jpn. J. Med. Mycol. 40: 31-34.

155

bovers_V4.indd 155 25-10-2007 10:16:47 Chapter 7: General discussion and Summary

Tanaka R, Nishimura K, Imanishi Y, Takahashi I, Hata Y and Miyaji M (2003) Analysis of serotype AD strains from F1 progenies between urease-positive- and negative-strains. Jpn. J. Med. Mycol. 44: 293-297. Tanaka R, Taguchi H, Takeo K, Miyaji M and Nishimura K (1996) Determination of ploidy in Cryptococcus neoformans by flow cytometry. J. Med. Vet. Mycol.34: 299-301. Takeo K, Tanaka R, Taguchi H and Nishimura K (1993) Analysis of ploidy and sexual characteristics of natural isolates of Cryptococcus neoformans. Can. J. Microbiol. 39: 958-963. Taylor JW, Jacobson DJ, Kroken S, Kasuga T, Geiser DM, Hibbett DS and Fisher MC (2000) Phylogenetic species recognition and species concepts in fungi. Fungal Genet. Biol. 31: 21-32. Tintelnot K, Lemmer K, Losert H, Schär G and Polak A (2004) Follow-up of epidemiological data of cryptococcosis in Austria, Germany and Switzerland with special focus on the characterization of clinical isolates. Mycoses 47: 455-464. Toffaletti DL, Nielsen K, Dietrich F, Heitman J and Perfect JR (2004) Cryptococcus neoformans mitochondrial genomes from serotype A and D strains do not influence virulence. Curr. Genet. 46: 193-204. Tortorano AM, Viviani MA, Rigoni AL, Cogliati M, Roverselli A and Pagano A (1997) Prevalence of serotype D in Cryptococcus neoformans isolates from HIV positive and HIV negative patients in Italy. Mycoses 40: 297-302. Trilles L, Lazéra M, Wanke B, Theelen B and Boekhout T (2003) Genetic characterization of environmental isolates of the Cryptococcus neoformans species complex from Brazil. Med. Mycol. 41: 383-390. Tscharke RL, Lazéra M, Chang YC, Wickes BL and Kwon-Chung KJ (2003) Haploid fruiting in Cryptococcus neoformans is not mating type α-specific. Fungal Genet. Biol. 39: 230-237. Velegraki A, Kiosses VG, Pitsouni H, Toukas D, Daniilidis VD and Legakis NJ (2001) First report of Cryptococcus neoformans var. gattii serotype B from Greece. Med. Mycol. 39: 419-422. Viviani MA, Cogliati M, Esposto MC, Lemmer K, Tintelnot K, Colom Valiente MF, Swinne D, Velegraki A, Velho R and the European Confederation of Medical Mycology (ECMM) Cryptococcosis working group (2006) Molecular analysis of 311 Cryptococcus neoformans isolates from a 30-month ECMM survey of cryptococcosis in Europe. FEMS Yeast Res. 6: 614-619. Wickes BL, Mayorga ME, Edman U and Edman JC (1996) Dimorphism and haploid fruiting in Cryptococcus neoformans: association with the α-mating type. Proc. Natl. Acad. Sci. USA 93: 7327-7331. Xu J and Mitchell TG (2003) Comparative gene genealogical analyses of strains of serotype AD identify recombination in populations of serotypes A and D in the human pathogenic yeast Cryptococcus neoformans. Microbiology 149: 2147-2154. Xu J, Vilgalys R and Mitchell TG (2000) Multiple gene genealogies reveal recent dispersion and hybridization in the human pathogenic fungus Cryptococcus neoformans. Mol. Ecol. 9: 1471- 1481 Yan Z and Xu J (2003) Mitochondria are inherited from the MATa parent in crosses of the basidiomycete fungus Cryptococcus neoformans. Genetics 163: 1315-1325. Yan Z, Hull CM, Heitman J, Sun S and Xu J (2004) SXI1α controls uniparental mitochondrial inheritance in Cryptococcus neoformans. Curr. Biol. 14: 743-744. Yan Z, Hull CM, Sun S, Heitman J and Xu J (2007a) The mating type-specific homeodomain genes SXI1α and SXI2a coordinately control uniparental mitochondrial inheritance in Cryptococcus neoformans. Curr. Genet. 51: 187-195. Yan Z, Sun S, Shahid M and Xu J (2007b) Environment factors can influence mitochondrial inheritance in the fungus Cryptococcus neoformans. Fungal Genet. Biol. 44: 315-322.

156

bovers_V4.indd 156 25-10-2007 10:16:48 Samenvatting

bovers_V4.indd 157 25-10-2007 10:16:48 Samenvatting

Cryptococcus neoformans en Cryptococcus gattii zijn twee schimmelsoorten, die erg op elkaar lijken. Cryptococcus neoformans en C. gattii zijn gisten, dit zijn ronde losliggende cellen, die zich normaal gesproken asexueel voortplanten door zich te delen. Daarnaast kunnen C. neoformans en C. gattii zich sexueel voortplanten. Wanneer twee cellen van een verschillend mating-type (♀ en ♂) elkaar tegenkomen kunnen deze cellen samensmelten en hyfen (schimmeldraden) vormen. Uiteindelijk worden er uit deze hyfen vruchtlichamen gevormd met daarop sexuele (basidio-) sporen van beide mating-typen (♀ en ♂). Zowel C. neoformans als C. gattii zijn ziekteverwekkers, die long- en hersenvliesontsteking kunnen veroorzaken. De soorten verschillen echter in hun verspreidingsgebied en infectievermogen. Cryptococcus neoformans komt over de hele wereld voor en infecteert mensen met een onderdrukt of (sterk) verzwakt afweersysteem, zoals bijvoorbeeld bij AIDS patiënten het geval is. Cryptococcus gattii komt voornamelijk voor in (sub)tropische gebieden en kan gezonde mensen infecteren. Cryptococcus gattii blijkt echter ook de veroorzaker van een recente uitbraak van cryptococcose op Vancouver Island (Canada) en is ook aangetroffen in Zuid- Europa en in een gematigde klimaatzone van Colombia. Dit betekent, dat C. gattii ook kan voorkomen in meer gematigde streken. Binnen C. neoformans en C. gattii kunnen zes groepen worden onderscheiden. Dit kan met behulp van moleculaire technieken, zoals AFLP. Cryptococcus neoformans bestaat uit twee van deze groepen (AFLP1 en AFLP2), die beschreven zijn als de variëteiten grubii en neoformans. Deze twee variëteiten kunnen o.a. herkend worden door hun serotype. Het onderscheid in serotype wordt veroorzaakt door verschillen in de structuur van het kapsel. Het kapsel is een kenmerkende structuur voor zowel C. neoformans als C. gattii en beschermt de cel tegen invloeden van buitenaf. Variëteit grubii komt overeen met serotype A, terwijl variëteit neoformans overeenkomt met serotype D. Cryptococcus gattii bevat vier groepen (AFLP4 t/m AFLP7), maar deze groepen zijn niet beschreven als variëteiten of soorten. Alhoewel ook binnen C. gattii verschillende serotypes voorkomen, kunnen deze niet gebruikt worden om de vier groepen te onderscheiden, omdat zowel serotype B als serotype C in alle groepen voorkomen. Een overzicht van de verschillende groepen en hun belangrijkste eigenschappen wordt gegeven in Tabel 1.

Tabel 1. Overzicht van de verschillende groepen binnen Cryptococcus neoformans en Cryptococcus gattii en hun belangrijkste eigenschappen.

Moleculaire Soort Infectievermogen Verspreiding Variëteiten Serotype groepen (AFLP) C. neoformans mensen met een onderdrukt of wereldwijd var. grubii A AFLP1 (sterk) verzwakt immuunsysteem var. neoformans D AFLP2 C. gattii gezonde mensen (sub)tropen, maar n.v.t. B en C AFLP4

tegenwoordig n.v.t. B en C AFLP5 ook in gematigde n.v.t. B en C AFLP6 klimaatzones n.v.t. B en C AFLP7

158

bovers_V4.indd 158 25-10-2007 10:16:49 Samenvatting

Het doel van het onderzoek was om te onderzoeken of de zes groepen, die voorkomen binnen C. neoformans en C. gattii, voldoende van elkaar verschillen om ze te beschrijven als variëteiten of zelfs als soorten. Ook is er gekeken naar interacties tussen de verschillende groepen. In hoofdstuk 2 en 3 werd onderzocht of er sex kan plaatsvinden tussen isolaten uit verschillende groepen. Een isolaat bestaat uit veel afzonderlijke cellen, maar omdat al deze cellen afkomstig zijn van één voorouder cel is een isolaat te beschouwen als één individu. Wanneer er sex plaatsvindt tussen twee isolaten ontstaan er sexuele sporen. Eén spore, een nakomeling, bevat een combinatie van DNA van beide ouder isolaten. Vergelijk dit met een mens, deze erft ook eigenschappen van zowel moeder als vader. Om te onderzoeken of er sex heeft plaatsgevonden tussen isolaten uit verschillende groepen kan er dus gekeken worden of er isolaten zijn die DNA bezitten van twee verschillende groepen. In hoofdstuk 2 werd het kern DNA onderzocht van honderd zeventien isolaten afkomstig uit alle zes de groepen. De DNA sequentie (volgorde) van zes fragmenten werd bepaald en van elk van de zes fragmenten werd een stamboom gemaakt. In de stambomen waren telkens zes hoofdgroepen te herkennen. Cryptococcus neoformans en C. gattii isolaten vormden twee aparte clusters. Het C. neoformans cluster bestond uit twee groepen (AFLP1 en AFLP2), die overeenkwamen met de beschreven variëteiten. Binnen het C. gattii cluster kwamen vier groepen voor, overeenkomend met de AFLP groepen (AFLP4 t/m AFLP7). De AFLP4 en AFLP5 groepen vormden samen een cluster en dit cluster clusterde weer samen met de AFLP7 groep. De AFLP6 groep clusterde apart van de andere C. gattii groepen, maar viel wel binnen het totale C. gattii cluster. Eén van de stambomen is weergegeven in Figuur 1. De isolaten clusterden bij elk DNA fragment in dezelfde groep. Wanneer er sex tussen isolaten van verschillende groepen geweest zou zijn zouden er isolaten gevonden zijn die bij verschillende DNA fragmenten in verschillende groepen clusterden. Het ene DNA fragment zou namelijk van de vader afkomstig zijn, terwijl een ander DNA fragment van de moeder zou komen. De gevonden resultaten komen echter overeen met asexuele voortplanting, waarbij isolaten zich voortplanten door te delen. De nakomelingen zijn in dat geval identiek aan de ouder en clusteren dus bij alle DNA fragmenten steeds in dezelfde groep. In hoofdstuk 3 werd het mitochondriële DNA bestudeerd van eenenvijftig C. gattii isolaten afkomstig uit alle vier de C. gattii groepen. Mitochondriën zijn organellen, die zorgen voor de energie huishouding van een cel en zelf ook DNA hebben. Het DNA van mitochondriën wordt op een andere manier overgeërfd dan het kern DNA. Bij mensen worden de mitochondriën maternaal overgeërfd: de mitochondriën zijn afkomstig van de moeder. Ook bij C. neoformans en C. gattii is dit het geval, alhoewel er onder stress omstandigheden ook mitochondriën van de vader geërfd kunnen worden. Omdat mitochondrieel DNA op een andere manier

159

bovers_V4.indd 159 25-10-2007 10:16:49 Samenvatting

AFLP4

AFLP5 Cryptococcus gattii

AFLP7

AFLP6

var. grubii AFLP1/1A/1B

Cryptococcus neoformans

var. neoformans AFLP2

Fig. 1. Stamboom van Cryptococcus neoformans en Cryptococcus gattii verkregen door analyse van het DNA fragment RPB1.

overerft dan het kern DNA is het interessant om te kijken hoe de stambomen van mitochondriële DNA fragmenten eruit zien. De DNA sequentie (volgorde) van twee mitochondriële DNA fragmenten werd bepaald en met behulp van deze sequenties werden stambomen gemaakt. In deze stambomen vormden drie van de vier C. gattii groepen (AFLP5 t/m AFLP7) drie aparte clusters, wat overeenkomt met de resultaten die werden gevonden met kern DNA (hoofdstuk 2). Echter, AFLP4 isolaten vormden

160

bovers_V4.indd 160 25-10-2007 10:16:51 Samenvatting

een aantal verschillende subgroepen die niet bij elkaar clusterden (Fig. 2). In totaal werden er vijf mitochondriële typen gevonden voor AFLP4. Eén van deze typen (AFLP4-M1) vormde één cluster samen met de AFLP5 en AFLP7 groepen. Deze clustering komt overeen met de C. gattii structuur zoals die werd gevonden voor het kern DNA. Dit betekent dat de AFLP4-M1 isolaten waarschijnlijk behoren tot het oer AFLP4 type. Alle andere typen bezaten (geheel of gedeeltelijk) mitochondriële sequenties die ook voorkwamen in AFLP6 isolaten. Vreemd genoeg bezaten deze AFLP4 isolaten geen kern DNA van AFLP6 (hoofdstuk 2). Het bestaan van AFLP4 isolaten met mitochondriële sequenties die gedeeltelijk van AFLP4 en gedeeltelijk van AFLP6 afkomstig zijn betekent dat er uitwisseling van DNA (recombinatie) heeft plaatsgevonden tussen mitochondriën van verschillende groepen. Ook betekent dit dat AFLP4 en AFLP6 cellen contact met elkaar hebben gemaakt, mogelijk heeft er sex plaatsgevonden tussen deze twee groepen. In tegenstelling tot de resultaten in hoofdstuk 2 lijkt het er dus op dat er wel degelijk sex heeft plaatsgevonden tussen isolaten van verschillende C. gattii groepen. Binnen het C. neoformans en C. gattii complex komt naast de zes eerder genoemde groepen ook een hybride groep voor. Normaal gesproken zijn C. neoformans en

AFLP6

AFLP4-M4 en M5 AFLP4-M3

AFLP4-M2 Cryptococcus gattii

AFLP7

AFLP4-M1

AFLP5

Fig. 2. Stamboom van Cryptococcus gattii verkregen door analyse van het mitochondriële DNA fragment ATP6. Drie van de C. gattii groepen (AFLP5 t/m AFLP7) vormden aparte clusters, maar de isolaten van AFLP4 vormden vier verschillende subgroepen, die niet allemaal bij elkaar clusterden.

161

bovers_V4.indd 161 25-10-2007 10:16:53 Samenvatting

C. gattii isolaten haploïd, dit betekent dat ze van elk DNA fragment één kopie hebben. De hybride isolaten zijn diploïd, zij bezitten van elk DNA fragment twee kopieën. Mensen zijn ook diploïd, zij bezitten twee kopieën van elk DNA fragment: één kopie die afkomstig is van de moeder en één kopie die afkomstig is van de vader. Binnen het C. neoformans en C. gattii soorten complex is een hybride isolaat te herkennen doordat zo’n isolaat twee kopieën van elk DNA fragment heeft. Tot nu toe was er maar één hybride type bekend, namelijk tussen de twee variëteiten van C. neoformans. Deze AD hybriden (AFLP3) komen vooral veel voor in Zuid-Europa en kunnen ontstaan wanneer er sex plaatsvindt tussen de twee variëteiten. In hoofdstuk 4 en 5 wordt de ontdekking van twee nieuwe hybride typen beschreven. In hoofdstuk 4 werden drie isolaten met een afwijkend moleculair patroon beter bestudeerd. Deze isolaten waren afkomstig van Nederlandse patiënten en bleken hybriden te zijn tussen C. neoformans en C. gattii. De isolaten bezaten van verschillende DNA fragmenten twee kopieën. Deze kopieën bleken overeen te komen met DNA fragmenten die voorkomen in C. neoformans var. neoformans en in C. gattii AFLP4 isolaten. Ook bezaten de isolaten beide mating-typen (♀ en ♂). Deze resultaten geven aan dat er waarschijnlijk sex is geweest tussen C. neoformans var. neoformans en C. gattii AFLP4 en dat deze BD hybriden (AFLP8) hieruit zijn ontstaan. Ook in hoofdstuk 5 werd er een isolaat met een afwijkend moleculair patroon bestudeerd. Dit isolaat was afkomstig van een Canadese patiënt en ook dit isolaat bleek een hybride te zijn tussen C. neoformans en C. gattii. Het isolaat bezat twee kopieën van verschillende DNA fragmenten en ditmaal kwamen deze kopieën overeen met DNA fragmenten die voorkomen in C. neoformans var. grubii en C. gattii AFLP4 isolaten. Het isolaat had maar één mating-type (♂) afkomstig van C. neoformans var. grubii. Het mitochondriële DNA bleek overeen te komen met het mitochondriële DNA van C. gattii AFLP4 isolaten. Mitochondriën worden bij C. neoformans en C. gattii meestal geërfd van de moeder. Waarschijnlijk is de moeder van deze AB hybride (AFLP9) dus een C. gattii AFLP4 isolaat geweest, terwijl de vader een C. neoformans var. neoformans isolaat was. Deze hybride is dus waarschijnlijk ontstaan door sex tussen C. neoformans var. neoformans en C. gattii AFLP4.

Cryptococcus neoformans en C. gattii zijn ziekteverwekkers, die verschillen in hun infectievermogen. Cryptococcus neoformans infecteert mensen met een onderdrukt of (sterk) verzwakt afweersysteem, terwijl C. gattii gezonde mensen kan infecteren. Zowel C. neoformans als C. gattii kunnen hersenvlies- en longontsteking veroorzaken. Echter, longinfecties komen vaker voor bij mensen die geïnfecteerd zijn met C. gattii dan bij mensen die geïnfecteerd zijn met C. neoformans. Ook tussen de variëteiten van C. neoformans bestaan verschillen: oudere mensen en mensen die corticosteroïden gebruiken zijn vaker geïnfecteerd met C. neoformans var. neoformans

162

bovers_V4.indd 162 25-10-2007 10:16:54 Samenvatting

dan met C. neoformans var. grubii. Het is belangrijk om te weten welke groep precies een infectie veroorzaakt. Daarom is er een methode (Luminex) ontwikkeld die C. neoformans en C. gattii kan detecteren en de verschillende groepen kan identificeren. Dit kan door gebruik te maken van een DNA fragment dat verschilt tussen de groepen. Het voordeel van de Luminex methode is dat tegelijkertijd getest kan worden op het voorkomen van honderd verschillende organismen. In hoofdstuk 6 werd de al ontwikkelde methode getest met isolaten afkomstig van Nederlandse patiënten, maar ook met ruggenmergvocht dat afkomstig was van patiënten met cryptococcosis. De zes haploïde en de twee geteste hybride groepen konden correct geïdentificeerd worden. De hybride isolaten werden alleen herkend als hybriden wanneer er twee kopieën van het DNA fragment waar deze methode gebruik van maakt aanwezig waren. Ook konden haploïde en hybride groepen aangetoond worden in ruggenmergvocht.

Zoals al eerder gezegd was het doel van mijn onderzoek om te onderzoeken of de zes haploïde groepen, die voorkomen binnen C. neoformans en C. gattii, voldoende van elkaar verschillen om ze te beschrijven als variëteiten of zelfs als soorten. De resultaten in hoofdstuk 2 laten zien dat er zes verschillende groepen zijn, maar wanneer worden groepen beschouwd als verschillende soorten? Dit hangt af van de definitie van een soort. Er bestaan namelijk verschillende opvattingen over wat een soort nu precies is. Drie veelgebruikte soortconcepten zijn het morfologisch soortconcept, het biologisch soortconcept en het fylogenetisch soortconcept. 1) Het morfologisch soortconcept is gebaseerd op morfologie, het uiterlijk van een organisme. Soorten bestaan in dit geval uit een groep organismen met een vergelijkbaar uiterlijk. Soms zijn er maar weinig verschillen in het uiterlijk, dit is bijvoorbeeld het geval bij gisten. In dit geval wordt er vaak gebruik gemaakt van fysiologische testen. Met een fysiologische test wordt gekeken hoe een organisme op een bepaalde chemische stof reageert. Een soort is in dat geval een groep organismen die hetzelfde reageren op een serie van verschillende chemische stoffen. De sexuele sporen van C. neoformans en C. gattii zien er verschillend uit en zouden gebruikt kunnen worden om deze twee groepen te onderscheiden. Bovendien zijn er verschillende stoffen bekend waarop C. gattii wel kan groeien, maar C. neoformans niet. Ook de twee variëteiten van C. neoformans zijn te onderscheiden door hun reactie op verschillende chemische stoffen. Tot nu toe zijn er echter geen fysiologische verschillen gevonden tussen de vier groepen van C. gattii. Dit betekent dat volgens het morfologische soortconcept C. neoformans en C. gattii aparte soorten zijn. Ook de twee variëteiten van C. neoformans zijn volgens het morfologisch soortconcept aparte soorten. Echter, de vier groepen van C. gattii zijn niet van elkaar te onderscheiden en zijn dus geen soorten volgens het morfologisch soortconcept.

163

bovers_V4.indd 163 25-10-2007 10:16:54 Samenvatting

2) Het biologisch soortconcept is gebaseerd op de voortplanting. Een soort is in dit geval een groep organismen die zich met elkaar kan voortplanten. Er zijn hybriden gevonden die waarschijnlijk ontstaan zijn door sex tussen C. neoformans en C. gattii. Echter, deze hybriden zijn erg zeldzaam. Tot nu toe zijn er maar drie verschillende isolaten gevonden. Waarschijnlijk betekent dit dat sex tussen C. neoformans en C. gattii maar zelden voorkomt. Ook zijn er bij kruisingsexperimenten tussen C. neoformans en C. gattii alleen nakomelingen gevonden die of identiek zijn aan één van beide ouders of hybriden zijn. Dit geeft aan dat er waarschijnlijk een sterke kruisingsbarrière bestaat tussen C. neoformans en C. gattii. Ook tussen de variëteiten van C. neoformans zijn hybriden gevonden, die ontstaan zijn door sex tussen de twee variëteiten. In sommige gebieden worden deze hybriden vaak gevonden: zo’n 45-50% van de klinische isolaten in Portugal, Spanje en Griekenland bestaat uit deze AD hybriden. Bovendien zijn AD hybriden verschillende malen ontstaan. Ook zijn er bij kruisingsexperimenten tussen de twee variëteiten van C. neoformans nakomelingen ontstaan die haploïd zijn, dus maar één kopie van elk DNA fragment bevatten, maar die wel DNA fragmenten bezitten van beide variëteiten. Verder bleken nakomelingen van kruisingexperimenten tussen de twee variëteiten van C. neoformans vier tot zes generaties vruchtbaar zijn. Deze gegevens laten zien dat de kruisingsbarrière tussen de twee variëteiten van C. neoformans niet volledig is en dat kruisingen tussen beide variëteiten vruchtbare nakomelingen kunnen opleveren. Helaas zijn er niet zoveel gegevens over het voorkomen van sex tussen de verschillende C. gattii groepen. Er zijn geen hybriden gevonden. Kruisingsexperimenten tussen verschillende C. gattii groepen hebben levensvatbare sporen opgeleverd, maar deze sporen zijn niet nader bestudeerd. Er zijn echter wel natuurlijke isolaten gevonden die kern DNA van C. gattii AFLP4 bezaten, terwijl het mitochondriële DNA afkomstig was van C. gattii AFLP6. Dit duidt erop dat er sex is geweest tussen beide groepen. Bovendien zijn de verschillen in DNA sequenties tussen de C. gattii groepen kleiner dan tussen de variëteiten van C. neoformans. Omdat er sex plaats kan vinden tussen de meer van elkaar verschillende variëteiten van C. neoformans zou je verwachten dat er zeker sex plaats zal kunnen vinden tussen de groepen van C. gattii. Experimenten zullen moeten uitwijzen of dit het geval is. De kruisingsbarrière tussen C. neoformans en C. gattii is waarschijnlijk erg sterk, dit zou kunnen betekenen dat de beschrijving van C. neoformans en C. gattii als twee aparte soorten correct is. Kruisingen tussen de twee variëteiten van C. neoformans hebben vruchtbare nakomelingen opgeleverd. Dit betekent dat volgens het biologisch soortconcept deze twee groepen niet beschouwd kunnen worden als twee soorten en dus dat de huidige beschrijving als variëteit correct is. Alhoewel er erg weinig

164

bovers_V4.indd 164 25-10-2007 10:16:55 Samenvatting

gegevens beschikbaar zijn over de C. gattii groepen zijn er aanwijzingen dat er sex kan plaatsvinden tussen de verschillende C. gattii groepen. Het voorkomen van sex zou betekenen dat deze groepen volgens het biologische soortconcept niet beschouwd mogen worden als aparte soorten. 3) Het fylogenetisch soortconcept is gebaseerd op DNA. Een soort is in dit geval een groep organismen waarvan het DNA erg op elkaar lijkt. Het DNA binnen een soort lijkt meer op elkaar dan dat tussen soorten. De DNA sequenties tussen Cryptococcus neoformans en C. gattii verschillen meer van elkaar dan de DNA sequenties van isolaten binnen C. neoformans of binnen C. gattii. Hierdoor laten de stambomen ook twee groepen zien: één voor C. neoformans en één voor C. gattii. Dit betekent dat volgens het fylogenetisch soortconcept C. neoformans en C. gattii aparte soorten zijn. Ditzelfde geldt voor de variëteiten van C. neoformans. Ook hier verschillen de DNA sequenties tussen de twee variëteiten meer van elkaar dan de DNA sequenties die gevonden worden binnen een variëteit. Beide variëteiten worden dan ook beschouwd als soorten volgens het fylogenetisch soortconcept. Ook bij de C. gattii groepen verschilt het kern DNA meer tussen de groepen dan binnen een groep. Echter, het mitochondriële DNA laat zien dat er in de meerderheid van de AFLP4 isolaten mitochondriële sequenties gevonden worden die meer overeenkomen met de sequenties van AFLP6 isolaten dan met sequenties van de oer AFLP4 isolaten. Omdat het fylogenetisch soortconcept aangeeft dat de overeenkomst van alle bestudeerde DNA fragmenten groter moet zijn binnen een soort dan daarbuiten, betekent dit dat volgens het fylogenetisch soortconcept de C. gattii groepen geen aparte soorten zijn.

Soorten ontstaan niet van de ene op de andere dag. Soortvorming begint wanneer het aantal nakomelingen bij kruisingen tussen groepen kleiner is dan bij kruisingen binnen een groep. Op een gegeven moment bestaan er zoveel verschillen tussen de groepen dat kruisingen tussen leden van verschillende groepen hybride nakomelingen geven. Deze hybriden zullen onvruchtbaar zijn wanneer het DNA teveel van elkaar verschilt, maar zeker in het begin zullen er ook vruchtbare hybride nakomelingen gevormd worden. Op een bepaald moment zullen de groepen zoveel van elkaar verschillen dat het DNA niet meer met elkaar kan samenwerken. Vanaf dat moment zijn de hybriden die gevormd worden niet meer levensvatbaar. Uiteindelijk zullen de groepen zoveel van elkaar gaan verschillen dat het zelfs niet meer mogelijk is om met elkaar te kruisen. Wanneer het proces van soortvorming vertaalt wordt naar C. neoformans en C. gattii kan er geconcludeerd worden dat C. neoformans en C. gattii het proces van soortvorming bijna voltooid hebben. Ze verschillen morfologisch en fysiologisch van elkaar. Bovendien lijken de DNA sequenties binnen C. neoformans en binnen C. gattii

165

bovers_V4.indd 165 25-10-2007 10:16:56 Samenvatting

meer op elkaar dan de DNA sequenties tussen C. neoformans en C. gattii. Echter, er ontstaan nog steeds hybriden wanneer C. neoformans en C. gattii sex met elkaar hebben, maar deze hybriden zijn tot nu toe slechts zelden gevonden wat aangeeft dat de hybriden waarschijnlijk verminderd levensvatbaar zijn. De twee variëteiten van C. neoformans zijn iets minder ver gevorderd in het proces van soortvorming. Er zijn slechts enkele fysiologische verschillen tussen beide variëteiten, maar ook hier zijn de DNA sequenties binnen een variëteit meer gelijk aan elkaar dan tussen de variëteiten. Wanneer de twee variëteiten met elkaar kruisen, ontstaan er vaak hybriden. Deze hybriden zijn in de natuur verschillende malen ontstaan en worden vooral in Zuid-Europa regelmatig aangetroffen. Bij kruisingen zijn echter ook vruchtbare nakomelingen ontstaan, die vier tot zes generaties lang vruchtbaar bleven. Ook hebben kruisingen tussen de twee variëteiten haploïde nakomelingen opgeleverd, die maar één kopie van elk DNA fragment bevatten, maar die wel DNA fragmenten van beide variëteiten bezitten. De vier groepen van C. gattii zijn meer recent begonnen met hun proces van soortvorming. Er zijn nog geen fysiologische verschillen ontstaan tussen de groepen. De sequenties van het kern DNA laten zien dat de sequenties meer verschillen tussen groepen dan binnen een groep. Echter, de sequenties van mitochondrieel DNA geven niet hetzelfde beeld. Het merendeel van de AFLP4 isolaten bezit mitochondriële sequenties die meer overeenkomen met de sequenties van AFLP6 isolaten dan met de sequenties van oer AFLP4 isolaten. Ook betekenen deze resultaten dat er waarschijnlijk sex heeft plaatsgevonden tussen beide C. gattii groepen. Er zijn tot nu toe geen hybriden bekend tussen verschillende C. gattii groepen. Helaas zijn er weinig kruisingsexperimenten uitgevoerd met C. gattii isolaten, het is dus niet bekend of deze kruisingen minder levensvatbare nakomelingen opleveren. Deze resultaten geven aan dat de huidige status van C. neoformans en C. gattii als aparte soorten gerechtvaardigd is. Het voorkomen van hybriden tussen de twee variëteiten van C. neoformans en het ontstaan van vruchtbare nakomelingen wanneer deze variëteiten gekruist worden, geeft aan dat deze twee groepen inderdaad nog geen aparte soorten zijn. De gegevens bevestigen de huidige status van aparte variëteiten. Het proces van soortvorming binnen het C. gattii cluster is recenter begonnen dan binnen het C. neoformans cluster. Alhoewel de groepen wel apart geïdentificeerd kunnen worden, bijvoorbeeld met behulp van de Luminex identificatie methode, zijn deze groepen nog niet zover in het proces van soortvorming dat ze beschreven kunnen worden als aparte soorten. Deze groepen zouden eventueel beschreven kunnen worden als aparte variëteiten.

166

bovers_V4.indd 166 25-10-2007 10:16:57 Dankwoord

bovers_V4.indd 167 25-10-2007 10:16:58 bovers_V4.indd 168 25-10-2007 10:16:58 Dankwoord

Op deze plek wil ik graag iedereen bedanken die mij tijdens mijn promotie onderzoek geholpen, gesteund of aan mij gedacht heeft. Dus hierbij:

Bedankt!!

Bedankt!

Bedankt! Bedankt! Bedankt!Bedankt! Bedankt! Bedankt! Bedankt! Bedankt! Bedankt!

169

bovers_V4.indd 169 25-10-2007 10:16:59 Dankwoord

Dan hier voor iedereen die mijn boekje écht leest, het echte dankwoord. Ruim vier jaar nadat ik met mijn promotie onderzoek ben begonnen is het af! Ik kijk terug op een tijd die ik erg intens beleefd heb en die met het nodige doorzettingsvermogen geleid heeft tot dit mooie resultaat. Hieronder wil ik een aantal mensen bedanken die voor mij erg belangrijk waren tijdens mijn promotie onderzoek. Ik wil als eerste degene bedanken die de kiem legde voor dit onderzoek. Teun, jij gaf mij de kans om me te verdiepen in een heel nieuw vakgebied. Wat ik met name aan jou bewonder is de grote hoeveelheid ideeën die er dag in dag uit bij jou ontstaan. Ik hoop dat je nog lang van deze onuitputtelijke bron gebruik kunt maken. Andy, onze korte ontmoetingen waren altijd to-the-point en beantwoorden alle vragen waar ik mee zat. Bedankt voor je optimisme. Kenneth, mede-OIO binnen onze groep. Altijd rustig en schijnbaar onbewogen. Wat heb ik jou soms benijd om jouw kalmte! Ik hoop dat je een fijne tijd tegemoet gaat in Thailand en wens je veel succes met het afronden van de allerlaatste dingetjes voor jouw promotie. Ferry, jij was degene die me de crypto wereld binnen leidde. Jouw grote kennis van het crypto-onderzoek heeft me vele keren geholpen. Het was erg prettig om met jou samen te werken. Jouw aanwezigheid en je talent voor het (laten) organiseren van veel ‘AIO etentjes’ zorgen voor veel gezelligheid op het CBS. Ik ben erg blij dat jouw wens om ook te promoveren nu eindelijk in vervulling aan het gaan is! Eiko, you were my room mate since my first day at CBS. I know I can be quite annoying, especially when it comes to teaching Dutch. “Wat zeg je? “. I really enjoyed the time we spent together. The discussions with you about results and about our private lives helped me to make decisions. Thanks for being my “second opinion” if I needed one. Something that other people might not know is that you are quite an artist! Thank you for creating the beautiful painting that is now part of the cover of this thesis! I would also like to thank Robin May. I really enjoyed working with you and your worms. Unfortunately, our research has not been published yet, but I’ll always remember our nice collaboration. Ik wil ook graag Bart, Carlos en al mijn andere CBS collega’s bedanken. Met de onderzoekers heb ik vele nuttige discussies en gesprekken gevoerd. En wat is het toch een luxe als je naar beneden kunt lopen en daar alle stammen en media platen vindt die je maar nodig kunt hebben en daarnaast ook nog een gezellig praatje kunt maken. Mensen van de collectie en de media keuken, bedankt! Canan, Sander en Jelle, bedankt voor al het praktische werk dat jullie mij als stagiaires uit handen genomen hebben. Ik hoop dat ik jullie veel heb geleerd, maar ik weet zeker dat ik veel van jullie geleerd heb. Mike wil ik graag bedanken voor het maken van het figuur in hoofdstuk 1.

170

bovers_V4.indd 170 25-10-2007 10:16:59 Dankwoord

I would also like to thank the Netherlands-Florida Scholarship Foundation. Their scholarship enabled me to go to Florida and to experience its nature and culture. I also wish to thank the family I stayed with: John, Susan and Sophia Barimo. Thanks to you my time in Florida was wonderful! In the lab it was Gloria who made me feel at home. It was nice to be able to discuss the crazy American habits with another European. Iedere dinsdagavond tijd voor muziek! De avonden met de andere meiden van Ladyla waren altijd gezellig en een bron van muzikale ontspanning. Verder wil ik graag alle vrienden bedanken die ik het afgelopen jaar ernstig verwaarloosd heb. Bedankt dat jullie met mij mee leefden en zorgden voor de nodige afleiding. Pap en mam, jullie opvoeding heeft mij gemaakt tot wie ik ben. Bedankt voor de rustpuntjes tijdens de laatste fase van mijn promotie onderzoek. Sandra, ik geloof dat het nooit helemaal is gelukt om je duidelijk te maken wat er nu zo interessant is aan het DNA van schimmels (maar misschien gaat dat ooit nog lukken!). Jouw tips hebben me erg geholpen bij het begeleiden van stagiaires. Last, but certainly not least! Ruben, wat een geluk dat ik die ochtend juist op dat tijdstip met de bus mee ging. Het was het begin van iets dat langzaam opbloeide, maar dat na een periode van vier jaar veel reizen, nu eindelijk zijn bekroning heeft gevonden in het samenwonen. Jouw steun was voor mij erg belangrijk en heeft mij de afgelopen tijd erg geholpen. Bedankt voor de rust die je me geeft en vooral voor al je liefde.

Marjan

171

bovers_V4.indd 171 25-10-2007 10:17:00 bovers_V4.indd 172 25-10-2007 10:17:00 Curriculum Vitea

List of publications

bovers_V4.indd 173 25-10-2007 10:17:01 Curriculum Vitea

Curriculum Vitae

Marjan Bovers was born on September 7th 1979 in Eindhoven, the Netherlands. In 1997, she graduated from “de Ring van Putten” secondary school in Spijkenisse and obtained her VWO-diploma. In the same year she started with the study ‘Plant Breeding and Crop Protection’ at Wageningen University. In 1999/2000 she interrupted her study for one year to be one of the six members of the ‘Commissie Algemene Introductie Dagen’, a committee that organizes the introduction program for first year students. She did her undergraduate thesis at the Laboratory of Plant Breeding under supervision of ir. M. J. D. de Kock and dr. P. Lindhout. The aim of her undergraduate thesis was to clone the resistance gene Cf-Ecp3, in tomato, and the avirulence factor Ecp3, in Cladosporium fulvum, both involved in the Cladosporium fulvum - tomato interaction. A practical internship on short cucumbers and pickles was done at Nunhems Zaden. In September 2002 she graduated from Wageningen University. In 2003, she started her PhD at the Fungal Biodiversity Centre in Utrecht under the supervision of dr. T. Boekhout. The research on the Cryptococcus neoformans – Cryptococcus gattii species complex carried out during her PhD is described in this thesis. Since July 2007, she is the coordinator of the subcommittee on agriculture of the Netherlands Commission on Genetic Modification.

174

bovers_V4.indd 174 25-10-2007 10:17:01 Curriculum Vitea

List of publications

Summerbell R, Levesque C, Seifert K, Bovers M, Fell J, Diaz M, Boekhout T, de Hoog G, Stalpers J and Crous P (2005) Microcoding: the second step in DNA barcoding. Philos. Trans. R. Soc. 360: 1897-1903. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, Hoogveld HL and Boekhout T (2006) Unique hybrids between fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 6: 599-607. Diaz M, Boekhout T, Theelen B, Bovers M, Cabañes F and Fell J (2006) Microcoding and flow cytometry as a high-throughput fungal identification system forMalassezia species. J. Med. Microbiol. 55: 1197-1209. Bovers M, Diaz MR, Hagen F, Spanjaard L, Duim B, Visser CE, Hoogveld HL, Scharringa J, Hoepelman IM, Fell JW and Boekhout T (2007) Identification of genotypically diverse Cryptococcus neoformans and Cryptococcus gattii isolates using Luminex xMAP technology. J. Clin. Microbiol. 45: 1874-1883. Bovers M, Hagen F and Boekhout T (2008) Diversity of the Cryptococcus neoformans-Cryptococcus gattii species complex. Rev. Iberoamer. Micol. (in Press). Bovers M, Hagen F, Kuramae EE and Boekhout T (2007) Six monophyletic lineages identified within Cryptococcus neoformans and Cryptococcus gattii by multi-locus sequence typing. (in preparation). Bovers M, Hagen F, Kuramae EE and Boekhout T (2007) The mitochondrial genome of Cryptococcus gattii shows evidence of recombination. (in preparation). Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G and Boekhout T (2007) Promiscuous mating of Cryptococcus neoformans and Cryptococcus gattii: discovery of a novel AB hybrid. (in preparation).

175

bovers_V4.indd 175 25-10-2007 10:17:01 bovers_V4.indd 176 25-10-2007 10:17:01