3t' (O'

COMPARATIVE STUDIES OF OXALYL.COA DECARBOXYLASE PRODUCED BY SOIL AND RUMINAL BACTERIA

Thesis Submitted for the degree of Master of Agricultural Science in The University of Adelaide Faculty of Agricultural and Natural Resource Sciences

by

STEPHEN BOTTRILL

November 1999

I I Table of Contents

List of Figures VI

List of Tables VM

Abstract IX

Acknowledgements XII

Ståtement XIII

List of Abbreviations XTV

Chapær 1. Liærature Review 1

1.1 Introduction. 1

1.2 Exogenous Sources of Oxalates. 1

1.3 Endogenous Sources of Oxalate. 5

1.4 Poisoning. 9

1.4.1 Acute Poisoning" 10

1.4.2 Subacute Poisoning. 11

1.4.3 Chronic Poisoning. t2

1.4.4 SymPtoms in Humans. 14

1.4.5 Treatment of Poisoning. I4

1.4.6 Management to Prevent Poisoning. 15

1.5 Oxalate-Degrading Microorganisms. 18

1.6 Bacterial Classification 22

1.7 Pathways of Oxalate Degradation. 24

1.8 Formate in the Rumen. 27

1.9 Aims and Objectives. 29

Chapær 2. Materials and Methods 31

2.1 Materials 31

2.1.1 Chemicals 3r

2.1.2 EquiPment 31

2.I.3 Bacterial Strains and Plasmids 32 TI

2.1.4 Composition of Media 34

2.1.4.I Oxalate-Containing Media 34 2.1.4.I.1Liquid 34

2.1.4.1.2 Solid 34

2.1.4.2 O mlob act er formi g enes Media 35 2.I.4.2.I Trace Metals Solution 35

2.I.4.2.2 Medium A 35

2.1.4.2.3 Medium B 36

2.I.4.3 Luria-Bertani (LB) Broth 36

2.I.4.4 SOC Medium 37

2.2 Methods 37

2.2 -I Growth conditions 37

2.2.2 Isolation of oxal ate- de gradin g s oil bacteria 37

2.2.3 Characterisation of soil isolaæs 38

2.2.3.1 MicroscoPY 38

2.2.3.2 Gram stain 38

2.2.3.3 Carbon source utilisation 40

2.2.4.4 Volatile fatty acid anaþsis 40

2.2.4 PhenoVchloroform extractions 4l

2.2.5 Ethanol preciPitations 4l

2.2.6 Chromosomal DNA preparation 42

2.2.7 Plasmid DNA minipreparations 42

2.2.8 Restriction digests 43

2.2.9 Ligations 43

2.2.10 ComPetent cells 44

2.2.I I ElectroPoration 44

2.2.12 Selection for transformants 44

2.2.13 Agarose gel electrophoresis 45

2.2.I4 Conjugation 46 m

2.2.1 5 Southern transfer 46

2.2.16 Prehybridisation 47

2.2.17 Oligolabelling 48

2.2.18 Hybridisation 48

2.2.L9 Washing 48

2.2.19 Stripping the membrane 49

2.2.20 Nested deletions 49

2.2.21DNA sequencing 50

2.2.22 Dot blots 5l

2.2-23 Polymerase chain reaction 51

2.2.24 Restriction Fragment Length Polymorphisms 52

2.2.25 Polyclonal antibody production 53

2.2.26 Enzyme-linked immunosorbent assay 54

2.2.27 Western transfer 57

2.2.28 RNA preparation 58

2.2.29 Northern transfer 60

2.2.30 Polyacrylamide gel electrophoresis 62

2.2.30.I Denaturing (Protein) 62

2.2.30.2 Non-denaturing (protein) 64

2.2.30.3 Denaturing (DNA) 64

2.2.31 Synthesis of OxalYl-CoA 66

2.2.32 Free thiol test 66

2.2.33 Enzyme assays 67

2.2.33.t Oxalyl-CoA decarboxylase 67

2.2.33.2 Formate dehYdrogenase 68/

2.2.33 .3 Glyoxylate dehydro genase 68

2.2.34 Colony lifts 69

2.2.35 Cell-free extracts 69

2.2.36 Protein estimation 70 IV

2.2 -37 PaPer chromatograPhY 7T

2.2.38 Cosmid Packaging 7T

Chapter 3. Isolation and characterisation of Oxalaæ-Degrading Bacteria 73

3.1 Introduction 73

3.2 Results 74

3.2.1 Isolation of oxalate-Degrading Bacteria from the Soil 74

3 .2.2 Chat acteris atio n 76

3.2.2.I B iochemical AnalYsis 76

3.2.2.2 Genetic Analysis 76

3.2.2.2.I Chromosomal DNA Homology 76

3.2.2.2.2 Chrom o som al DNA Restriction Profiles 77

3.2.2.2.3 Restriction Fragment Length

PolYmorPhisms 77

3.2.2.2.4 Sequence Analysis of the 165 Subunit

of rRNA 81

3.2.3 Growth Curves 81

83 3 .2.4 Oxalate Tolerance

3.2.5 Substrate Utilisation 84

3.2.6 Volatile Fatty Acid Analysis 84

3.3 Discussion 86

Chapter 4.Enzyme Systems in the Metabolism of Oxalate 9l

4.1 Introduction 91

4.2 Results 92

4.2.lDetermination of Assay conditions for Paracocc¿rs sp.

OxaIyl-CoA Decarboxylase 92

4.2.I.1 Assay Requirements 93

4.2.1.2 pH Optimum 93

4.2.2 Comparison of Enzyme Systems in Paracocc¿'s sp'

and P s eu do nnna s o xalati c us 94 V

4.2.2.L Oxalyl-CoA Decarboxylase 94

4.2.2.2 Formate Dehydro genase 95

4.2.3 Ind:uction of P. oxalati cus Oxalyl-CoA Decarboxylase 95

4.2.4 Determination of K¡n and Y yn6ç 96

4.3 Discussion 97

Chapter 5. Cloning of the Genes for Oxalaæ Decarboxylation 101

5.l lntroduction 101

5.2 Results 103

5.2.I Plate AssaYs 103

5.2.2 Antlbody Probes 106

5.2.3 Generation of Ox- Mutants 106

5.2.4 Generation of DNA Probes from P. oxalaticus 108

5.2.4.1 Transposon Mutagenesis 108

5-2-4.2 Polymerase Chain Reaction 109

5.2.5 Sequencing rr4

5.2.5.L Mapping LT4

5.2.5.2 Nested Deletions tl4

5.2.5.3 Sequence Data 115

5.2.6 Generation of DNA probes from O. formigenes rt7

5.3 Discussion rt7

Chapter 6. General Discussion and Future Studies t26

Appendix 1 131

Appendix 2 135

Appendix 3 138

References 139 VI

List of Figures

Figure 3.1 Halo formation by OxD on solid Bhat and Barker medium. 75

Figure 3.2Dotblot of oxalate-degrading soil isolates. 78

Figure 3.3 Chromosomal DNA Restriction Prohles' 79

Figure 3.4 Restriction fragment length polymorphisms. 80

Figure 3.5 Growth of soil isolates in Bhat and Barker oxalate medium. 82

Figure 3.6 Growth of OxD in Bhat and Barker oxalate medium. 82

Figure 3.7 Oxalate tolerance. 83

Figure 4.1. Opúmum pH for Paracocc¿rs sp. oxalyl-CoA decarboxylase activity 94

Figure 4.2. OxaIyl-CoA decarboxylase activity in crude cell-free extracts of

Pseudomonas oxnlaticas and Paracoccus sp- 95

Figure 4.3. Formate dehydrogenase activity in crude cell-free extracts of

Pseudamonas oxnlaticus and Paracoccus sp- 95

'tn Figure 4.4. Induction of oxalyl-CoA decarboxylase activity Pseudomonas

oxalaticus and Paracoccus sP. 96

Figure 4.5. Lineweaver-Burk plot for the oxalyl-CoA decarboxylase of

Paracoccus sP. 97

Figure 5.1 Pseudomanas oxalatícus DNA partially digested with Bam HI. 104

Figure 5.2 Randomly picked cosmids from a library of Pseudomonas

oxalaticus DNA cloned in PHC79. 105

Figure 5.3 Western immunoblot of bacterial cell-free extracts- t07

Figure 5.4 Survival of Pseudomonas oxnlaticus aftÊr exposure to ultra violet

radiation. 108 VII

Figure 5.5 Southern blot of the integration of transposonTnl732 into the

chromosome of P seudomona.s oxalaticus. 110

Figure 5.6 PCR of Pseudomnnas oxalatícus DNA. 111

Figure 5.7 Southern transfer of Pseudomonas oxalatic¿¿s DNA probed with a

Ikb Pseudomonas oxalaticus PCR product. rt2

Figure 5.8 Colony ltft of. Escherichia coli colonies- 113

Figure 5.9 Restriction map of the Hind Itr DNA fragment of Pseudomonas

oxnlaticus- rt4

Figure 5.10 Nested deletions. 1r6

Figure 5.11 Testing of PCR probes from Pseudomanas oxalaticus. 118

Figure 5.12 Testing of PCR probes ftom Oxalobacter formígenes. 119

Figure 5.13 Southern transfer of Pseudomanas oxalaticus DNA probed with

a 1 kb Oxalobacter formigenes PCR product. t20 VItr

List of Tables 33 Table 2.L. B acteial Strains 33 Table 2.2. Plasmids 33 Table 2.3. Antibiotics 4t Table 2.4. VFA Analysis Conditions.

Table 3.1 Characærisation of OxD by the Instituæ of Veterinary and Medical 76 Science.

Table 3.2 OxD substrate utilisation and comparison with Pseudnmonas 85 diminuta and P s eudomonas oxal'aticus'

Table 4.1. Cofactors for the decarboxylation of oxalate by oxalyl-CoA

decarboxylase derived from soil isolaæ Paracoccus sp' 93 IX

Abstract

Oxalic acid is an organic dicarboxylic acid which has a marked affinity for calcium salts are sodium, and magnesium, the salts of which are insoluble in water. Its principle plants, some of potassium, and ammonium. The salts of oxalic acid are found in a variety of pastures which form the dominant pasture species. Stock losses as a result of grazing such have been responsible for are common. Oxalate-producing fungi have also been reported to stock losses.

usually Oxalate poisoning of stock can take either of two forms. Acute poisoning plants' occufs when hungry stock are placed on pasture dominated by oxalate-containing deficient in Reduction of rumen microbial activity, usually due to fasting, as well as diets dose as a result calcium, predispose to toxicity. Death usually occurs 4- 12 hours after a lethal 2 or 3 days. of severe metabolic disturbance, although some sheep may linger on for gtazing Oxalis pes- Chronic oxalate toxicity is common in sheep which have been adapæd to of the acid caprae (soursob). They develop a high degree of tolerance to high daily intakes of the oxalate oxalate contained by the plants. However, there is ofæn low-level absorption

with progressive damage to the kidneys as a result of deposition of masses of calcium develop oxalate crystals. Over a period of 2-I2 months on soursob pasture, animals slowly

renal failure and deaths occur sporadically.

the Therefore, the aim of this project was to identify an enzyme responsible for rumen, and clone metabolism of oxalate which would be suitable for degrading oxalate in the

and characterise that gene.

metabolise Oxalate-degrading bacteria were isolated from soil and their ability to a calcium oxalate was compared, based on halo formation on solid growth media containing halo formation, oxalate precipitate. One isolate, designated OxD, which demonstrated rapid of Medical and was characterised by the Clinical Microbiology Department of the Institute and found to be Veterinary Science in Adelaide using the API bacterial identification system water and clinical closely related to Pseudomonas dimirutla, a species originally isolated from X

was closely specimens. However, sequencing of the 165 subunit of rRNA showed that it and related to Paracocc¿rs species. It was studied for growth on oxalate, substrate utilisation volatile fatty acid production. The optimum oxalate concentration in the growth medium was found to be between 56 mM and 224 mMr- Inoculation of a single colony into 100 ml of culture medium produced logarithmic growth with a lag period of 27 hours and entering stationary phase after 38 hours. It was found that the stationary phase was a result of an increase in pH rather than a lack of nutrients. It was able to grow on a range of carbohydraæ oxalate. sources. No volatile fatty acids were found in the growth medium after growth on

Growth rates of all isolates in oxalate were determined and compared with that of pseudom.onas oxalaticus, strain Oxz: (ATCC 11884), a well characterised oxalate-degrading bacterium. Colony morphology, cell morphology, digestion of the DNA with a restriction the endonuclease and separation of the fragments in an agarose gel, dot-btot analysis of

DNA, and analysis of restriction fragment length polymorphism in the 165 subunit of rRNA

showed poor homology belween P. oxalaticus and the other isolates.

paracoccus sp. cells were grown in oxalate and a cell free extract was produced' The

cofactor requirements and optimum conditions for oxalyl-CoA decarboxylase activity were

determined. The assay required MrE2*, thiamine pyrophosphate, oxalyl-CoA, oxalate, and

NAD+. The optimum pH was 6.8. The enzyme appeared to be specific for oxalyl-CoA.

These conditions were the same as those for oxalyl-CoA decarboxylase activity in P.

oxalaticus.As with P- oxalaticus, formate dehydrogenase was induced with the oxalyl-CoA

decarboxylase. However, the specific activity of both enzymes in OxD were considerably

higher than in P. oxalaticus.

To clone the genes for oxalyl-CoA decarboxylase, cosmid and plasmid libraries of P.

oxalaticus were created in pHC79 and pUC19 respectively, used to transform Escherichia colonies coli andtested for their ability to produce halos on calcium oxalate plates. No such an oxalate were found. Polyclonal antibodies were raised against a commercial preparation of

decarboxylase from Aspergill.us niger to use as a probe for E. coli prodtcing oxalyl-CoA XI

produced by decarboxylase. However, they did not react with the oxalyl-CoA decarboxylase any of the oxalate-degrading bacterial species.

As there were no DNA probes to select for the oxalyl-CoA decarboxylase gene cloned in E. coli, the plasmid pHC23 was used to create transposon mutants in P. (ox- oxalaticus.These were screened for the loss of halo formation on calcium oxalate plates mutants) The DNA from any such mutants was to be cut with a suitable enzyme and the kanamycin resistance gene of the transposon and any attached P. oxalatícøs chromosomal

DNA was to be cloned. The p. oxalaticus DNA could then be used to probe the libraries of p. oxalaticus DNA tn E. coli. However, no such colonies were detected. Southern analysis

of the DNA demonstrated that the transposon was integrating into the chromosome in a

random manner and some amino acid auxotrophs were recovered.

As transposon mutagenesis was unsuccessful in creating ox- mutants, ultra-violet

mutagenesis was used in an attempt to create ox- mutants which could be used as hosts for a

library of the wild-type P. oxalaticøs DNA. Such a library would have been screened for the

reversion to the ability to metabolise oxalate. However, no ox- mutants were recovered.

As all forms of mutagenesis were unsuccessful in producing ox- mutants, primers,

approximately 1 kb apart, were created from G/C-rich regions of the published sequence of

the oxalyl-CoA decarboxylase gene from Oxalobacter formigenes. These were used to create as a a pCR product approximately 1 kb in length from P. oxalaticus which was used DNA

probe to probe a Southern transfer of P. oxalaficas DNA cut with a range of restriction

endonucleases. The fragment to which the probe hybridised was cloned and sequenced'

However, the sequence showed very strong homology to the elongation factor G gene of a

number of organisms. No other PCR products of approximately 1 kb were produced with

a these primers. This would suggest that the sequence chosen for the primers was not in poor conserved region of the gene and that the P. oxalaticus gene sequence may have

homology with the sequence ftom O. formigenes. This was supported by results using the poorly same primers to produce a probe from O. formigenes DNA. This hybridised very

with p. oxalaticus DNA and attempts to repeat the experiment'were unsuccessful- XII

Acknowledgements

a! I wish to gratefully acknowledge my supervisor, Dr. John Brooker (Rumen Microbial

Genetics Group, Department of Animal Science), for his expert support and guidance of my

project. I would also like to acknowledge the additional support provided by Dr. James

Hackett and Professor Cynthia Bottema (Livestock Genetics Group, Department of Animal

Science).

I am indebted to Bottrill Research Pty. Ltd. for their provision of a generous grant, without

which this work would not have been possible.

I wish to acknowledge the assistance of Dr. Irene Wilkinson (Division of Clinical Microbiology, The Institute of Medical and Veterinary Science) for her assistance in the

classification of an oxalate-utilising soil microbe and Dr. Neil Shirley (Nucleic Acid and

protein Chemistry Unit, Department of Plant Science, The University of Adelaide) for

assistance with nucleic acid sequencing'

I would also like to express my gratitude to Mrs. Deanne Lum and Mrs. Jane McCarthy for

facilitating the day-to-day operations of the laboratory, Mrs. Jenny Prosser and Mr- Rex

Connelly for their support and assistance with the administration of my candidature in

general, and Miss Rachel Lawrie for her assistance in typing this thesis.

Finally, I would like to thank my contemporaries in the Department of Animal Science, in

particular, fellow members of the Rumen Microbial Genetics Group, for making my time as

a research student memorable and enjoyable. i XIII \ì

Statement

.4 f or This work contains no material which has been accepted for the award of any other degree

diploma in any university or other tertiary institution and, to the best of my knowledge and

belief, contains no material previously published or written by another person' except where

due reference has been made in the text.

I give consent to this copy of my thesis, when deposited in the University Library, being

available for loan and photocopying-

I

SIGNED:

I

,.t "t ït '+ ll

I

I XTV

List of Abbreviations

API Anatytical Profile Index

AR Analytical Reagent

ATCC American Type Culture Collection

BDH British Drug Houses

bp base pairs

BSA bovine serum albumin

CoA Coenryme A

CPM counts per minute

Da Daltons

DNA deoxyribonucleic acid

dNTP deoxyribonucleotide triphosphate

DTT dithiothreitol

eg example

ELISA enzyme-linked immunosorbent assay

G/C guanine/cytosine

GC gas chromatograPhY

HPLC high performance liquid chromatography

ie that is

IPTG isopropylthio galacto side

MCS multiple cloning siæ

PAGE polyacrylamide gel electrophoresis

PCR polymerase chain reaction

PEG polyethylene glycol

RNA ribonucleic acid

RO reverse osmosis

per minute I rpm revolutions

rRNA ribosomal RNA

SDS sodium dodecylsulPhate I XV

SSC standard saline citraæ vlv volume per volume

VFA volatile fatty acid ilv weight per volume Xgal 5-bromo-4-chloro-3 -indolyl-ß-D- galactoside Chapter L

Literature Review

Sources, Mechanisms, Treatment and Prevention of Oxalate Poisoning.

1.1 Introduction.

Oxalate poisoning is a widespread phenomenon which is recognised internationally. Sickness and death have been reported in livestock, household pets and humans.

Oxalic acid is an organic, dicarboxylic acid. It is corrosive, soluble in water, and

has a marked affinity for calcium and magnesium, the salts of which are insoluble in

water. Its principle salts are sodium, potassium, and ammonium oxalate, and acid

potassium oxalate. Oxalic acid and its salts are both corrosive and systemic poisons and

the toxic effects these various oxalates have on animals may be modified by the cation

with which they are associated.

Oxalate poisoning in livestock occurs primarily from the ingestion of oxalate-

containing plants. Poisoning in household pets, especially cats and dogs, often results

from ingestion of ethylene glycol which is metabolised to oxalic acid in the body.

Poisoning in humans results from inhalation of oxalate fumes, contact with the skin, and

ingestion of oxalate or oxalate precursors such as ethylene glycol. The sources of oxalate

in oxalate poisoning, and the mechanisms, treatment and prevention of poisoning will be

reviewed.

1.2 Exogenous Sources of Oxalates.

Many species of plants, found mainly in the Oxalidaceae and Chenopodiaceae,

contain significant amounts of oxalates suff,rcient to cause poisoning of livestock. Species 2 which are known to be the cause of significant stock losses include halogeton (Halogeton glomeratus), greasewo od (Sarcobatus vermiculatus), and soursob (Oxalis pes-caprae).

Setaria (Setaria sphacelata), Portulaca spp- and oxalate-producing fungi have also been reported to have been responsible for stock losses'

Halogeton is a poisonous weed, native to southwestern Siberia and northwestern

China, which was introduced into the cold desert region of North America and has become established on more than 10 million acres of ,western rangeland (Cronin, 1965).

It does not appear to have been introduced to Australia. The plant is poisonous to

livestock because of its high oxalate content. The sodium and potassium salts of oxalic

acid account for 17-30 Vo of its dry weight. Conflicting views exist as to the palatability of

halogeton. Cronin (1965) suggests that the palatability of halogeton is very low, and it is

seldom eaten by livestock except where it is one of the few sources of forage. Even when

it is a major part of the vegetation, sheep do not consume large amounts unless seed

remains on the plant. However, James (1972) suggests that sheep and cattle graze

halogeton when there is other adequate forage. Although sheep Eraze these areas

extensively, poisoning only occurs under certain conditions. Even so, deaths in numbers

less than 100 are common. Halogeton is a prolific seed producer and seeds retain a high

degree of viability, even after passing through the digestive tracts of sheep and rabbits. In

this way, the seeds may be scattered over great distances-

Greasewoo d (Sarcobatus vermiculatus) was suspected of causing the death of

livestock in Nevada as early as 1916 but it wasn't until 1921 that deaths occurring in

sheep were anributed to ingestion of the plant (Fleming et al., 1928). On the grazing

ranges of western USA, the greasewood has been regarded as a valuable source of range

feed, particularly for sheep. Sheep Eraze without apparent injury on ranges where the

main source of feed is the greasewood. It is found growing on ranges where there is a

high water table during at least the spring months, and alkali salts have accumulated in

sufficient quantities to allow only alkali-resistent plants to grow freely. Greasewood is

least poisonous during the early spring and it has been suggested that this may be due to 3 the higher moisture content of the leaves at this time. Greasewood is not poisonous when it is eaten with other forage in ordinary amounts. However, poisoning from greasewood leaves comes from eating a quantity approximating stomach capacity in a relatively short period of time. This often occurs when hungry sheep discover vegetation, of which a large component is greasewood, and eat until satisfied. Greasewood is particularly nutritious, being rich in protein, fat and carbohydrates. However, it is also rich in the sodium and potassium salts of oxalic acid which constitute up to l57o of the dry weight

of the leaves. This quantity varies with the age of the leaves, being lowest in spring,

when the leaves are young, and increasing until autumn, when the oxalate content begins

to decline.

Poisoning by the ingestion of soursobs (Oxalis pes-caprae) was first described in

detail by Bull (1929). The plant is native to South Africa, where it is a major weed in the

Cape Province, and it occurs widely in the Mediterranean region (Anon., 1965)' It is a

common naturalised weed in the South-V/est of Western Australia, the southern regions

of South Australia and New South Wales, and Victoria (Gardner and Bennetts, 1956;

Black, 1986; Hurst, 1942; Ewart, 1909). However, it has only caused major stock losses

in the southern and northern Lofty regions of South Australia (Mclntosh,1972).In

Western Australia, outbreaks of oxalate poisoning have been thought to be infrequent and

of no special consequence as a cause of sheep loss, but Gardiner (1963) suggests that

oxalate poisoning may be a more common cause of stock losses in Western Australia than

previously thought. Hurst (1942) suggests that soursobs are not of great economic

importance in New South Wales because, although they are fairly common in that state,

they are not usually eaten by stock. In Victoria, soursobs are highly obnoxious weeds,

especially in gardens, but, although the leaves are nutritious, they are too acid to form

good fodder and are usually left untouched by stock (Ewart, 1909).

Due to their vigorous growth, soursobs form the dominant plant species after the

first autumn rains and often remain dominant until the hot days in late spring. In a

comparatively frost-free winter they become particularly luxuriant and dangerous (Smith, 4

1950-51). They were often referred to as a useful pasture plant that provided an abundance of herbage in the early winter months. At the same time, graziers were The quantity reluctant to Eraze animals on them because of their high oxalate content. of oxalate in soursobs was thought to increase during their growth and reach a maximum at the flowering stage. However, measurements made by Hickinbotham and Bennett (1931) suggest that there is no important change in the oxalate content during growth.

Measurements of protein, fat, carbohydrate, fibre and ash also reveal that, contrary to earlier beliefs, soursobs provide very poor pasture.

Setaria is a tropical grass which was introduced to Australia, from Africa, as a pasture grass. It is unusual in being one of the few grass species known to contain

sufficient amounts of oxalate to cause poisoning in cattle which was first reported by

Seawright et al. (1970). It was suggested that four factors contributed to the poisoning.

These were hunger after 40 hours on unpalatable pasture, the comparatively high feed

requirements of the animals which were lactating, the comparativety high oxalate content

of the setaria strain grazed and sudden access to lush green pasture after an extended period of dry pasture due to drought. A similar response to oxalate in setaria was

attempted in sheep but even after extreme stress to promote maximum feed intake, no

animals became ill after grazing setaria for one week. However, their kidneys contained

calcium oxalate crystals and had characteristic chronic lesions (Jones et a1.,1970). Setaria

is thought to contain oxalate as ammonium oxalate (Dougall and Birch, 1967; Seawright

et a1.,1970). The oxalate content may be as high as 6.9% of the dry weight of the plant

(Seawright et a|.,1970). During the early growth stages there is an increase in ammonia

and acidity (Dougall and Birch, 1967). This also occurs in young regrowth material

following defoliation and in the younger leaves of growing plants. When the leaf reaches

maturity, the formation of oxalic acid ceases. With increasing maturity, both acidity and

ammonia decline due to dilution by structural carbohydrates and lignin. Setaria is being

grown increasingly in the higher rainfall areas of tropical and sub-tropical Australia

(Hacker and Jones, 1969). Large areas have been planted to setaria along the moderately

high rainfall coast from northern New South Wales to northern Queensland- Its main 5 advantages are its ability to be established from seed, persistence undet grazing on a wide range of soils, palatability, and relatively high yield of digestible energy. There is considerable variation within the species and this may be manipulated fairly readily by the plant breeder to produce improved strains which have a low oxalate content.

The oxalate-producing fungi, Aspergillus niger and A. flavus, are both capable of producing large quantities of oxalate on feeds such as moist straw (Wilson and Wilson,

1961). At least one case of oxalate nephropathy in a horse has been reported (Andrews,

IgTl) which was ascribed to feeding maize silage infected with oxalate-producing fungi.

1.3 Endogenous Sources of Oxalate.

About 33Vo ofurinary oxalate excreted by the rat is derived from dietary oxalate

(Hodgkinson, 1978). Almost 90Vo of urinary oxalate excreted by humans is derived from

endogenous metabolic processes (Hodgkinson, 1977). A higher proportion of dietary

oxalate is absorbed in the rat intestine compared with humans, and dietary oxalate

accounts for a higher proportion of urinary oxalate in rats than in humans.

Glyoxylic acid is the primary precursor of oxalate, but much of the research with

this compound also includes work with glycollate as they are both effective precursors in

isolated rat hepatocytes (Rofe et a1.,1976).

Sodium glycollate given to rats causes a significant increase in oxalate excretion

(Talwar et a1.,1985). It has been suggested that the liver may be a primary siæ for oxalate

synthesis from glycollate by the actions of glycollic acid oxidase and glycollic acid

dehydrogenase (Varalakshmi and Richardson, 1983). These enzymes are active in the

peroxisomes of the liver (Rofe et a1.,1986). No oxalate synthesis can be demonstrated in

isolated perfused rat kidneys, also suggesting that the liver is the major source of

endogenous oxalate in the rat (Liao and Richardson, 19?2). However, oxalate synthesis 6 from glycollate and glyoxylate occurs in the hepatectomised rat (Farinelli and Richardson,

1933) suggesting that oxalate synthesis occurs in organs other than the liver.

Hydroxypyruvate stimulates total oxalate synthesis (Liao and Richardson, 1978). The major pathway involves decarboxylation of hydroxypyruvate, forming glycolaldehyde which is subsequently oxidized to oxalate via glycollate.

Hydroxypyruvate decarboxylase activity is found mainly in the mitochondria of the hepatocytes and the remainder is found in the cytosol of the hepatocytes (Rofe er a1.,I986). There is no activity in the peroxisomes. Rofe ¿r a/. (1980) suggest that metabolism via hydroxypyruvate is a major route for oxalate production from various carbohydrates, with perhaps the exception of xylitol which appears to have an alternative mechanism for oxalate production.

Oxalate nephrosis occurs in cats and dogs following ingestion of ethylene glycol

(Jubb and Kennedy, 1963). Toxicity appears to be related to the extent to which ethylene

glycol is oxidized to oxalic acid in each species of animal, and this depends upon the

degree of specificity in each species of alcohol dehydrogenase, the enzyme which

catalyzes the oxidation of ethylene glycol to glycolaldehyde (Von Wartberg et al.,1964).

It has been suggested that less than 27o of an ethylene glycol dose is excreted as oxalic

acid (Gessîer et aI., 196l; Bove, 1966). Ethanol is a potent competitive inhibitor of

ethylene glycol oxidation and may be used to reduce the toxic effect of ethylene glycol

(Peterson et al., L963) and this reduction can be enhanced if sodium bicarbonate is given

in addition to ethanol to correct the acidosis (Borden and Bidwell, 1968). Magnesium

deprivation in rats fed ethylene glycol results in the deposition of calcium oxalate in the

tubules of the kidneys (Rushton and Spector,1982).

Oxalate and calcium in the urine are increased significantly after an oral dose of

refined carbohydrates (Nguyen et a1.,1986; Ribaya-Mercado and Gershoff, 1984; Rofe

et a1.,1980). The order ofoxalate production from carbohydrates is fructose > glycerol >

xylitol > sorbitol > glucose (Rofe et aI., 1980). Fructose is rapidly metabolized,

producing glucose, Iactate and pyruvate as the major metabolites. The major metabolites 7 of glycerol, xylitol and sorbitol metabolism are glucose, lactate and glycerophosphate.

Rats fed on diets containing galactose as the source of carbon excrete more endogenously formed oxalic acid in the urine than rats fed glucose, fructose or sucrose (Ribaya-

Mercado and Gershoff, 1984). Rats fed lactose show similar but less marked effects.

Reducing the consumption of sugar and refined carbohydrates produces a significant reduction in the urinary excretion of calcium and oxalate (Rao er a1.,1982)-

Xylitol breakdown may generate oxalate precursors, but the eventual oxidation of these precursors appears to be dependent upon special conditions such as pyridoxine defìciency (Rofe et al.,lg77).Xylitol is metabolizedto produce D-xylulose, by the action of D-xylulose reductaso, and this is metabolized via several pathways to form

glycotaldehyde (James et a1.,1982). The enzymes involved in the pathways have been

isolated from the liver.

There appears to be some confusion as to the effect of ascorbic acid on oxalate

production. Balcke et aI. (1984) found that oxalic acid levels increase over the time of

ascorbic acid administration. Later, Balcke (1985) found that an intravenous dose of

ascorbic acid after dialysis of patients increases plasma oxalic acid. The work of Ono

(1986) is in agreement with this in that there is a strong correlation between plasma

ascorbic acid and oxalate values in dialysis patients. However, Erden et al. (1985) found

that oxalic acid in the urine of healthy subjects is unchanged after daily ingestion of 29 of

ascorbic acid for two months. This is in agreement with Tsao and Salimi (1984) who

found that there is no significant change in oxalate in the blood or urine of healthy

subjects ingesting 10g of ascorbic acid daily. It would appear, from these results, that the

production of oxalate from ascorbic acid, like production from xylitol, is dependent on

special conditions.

Several amino acids are known to be precursors of oxalate. Oxalate synthesis

involves both the transamination to hydroxypyruvate and the conversion to glycine, but

not decarboxylation to ethanolamine (Gambardella and Richardson, 1978). However, the

oxidation appears to proceed via hydroxypyruvate rather than glycine (Liao and 8

Richardson, 1978). Glycine is converted to oxalate in normal subjects (Crawhall et aI-,

1959) via conversion to glyoxylic acid by glycine oxidase but oxalate synthesis from (Elder glycine becomes appreciable only when the glyoxylic acid pool is greatly expanded and Wyngaarden, 1960).

The addition of hydroxyproline to the diet increases urinary and faecal oxalate excretion in rats and reduces growth rate (Ribaya and Gershoff, 1981; Ribaya and

Gershoff, tg82).This effect is observed regardless of diet. Steers fed a low-calcium diet develop renal calculi (Huntington and Emerick, 1984). Increased plasma hydroxyproline, resulting from bone resorption, provides the source of oxalate for calculi and explains the

fewer calculi found in steers fed adequate amounts of calcium.

Oxalate is derived from the side chain moiety of the three aromatic amino acids,

tryptophan, tyrosine and phenylalanine (Cook and Henderson,1969)' However, this is a

minor source for oxalate production. It is estimated that less than 3Vo of the total oxalic

acid excreted by the normal rat is derived from aromatic amino acids.

The effect of protein on oxalate production appears uncertain. Rofe ¿r a/- (1981) (1984) suggest that protein is implicated in oxalate stone formation while Fellstrom et al-

have found that oxalate excretion is not affected by a high-protein diet and that there is not (1982) a significant change in the urinary supersaturation of calcium oxalate. Rao ¿r aI.

found that reducing the consumption of animal protein significantly reduces urinary (1981). excretion of calcium and oxalate, supporting the suggestion of Rofe et aI. The

reason for these conflicting results is unknown.

The effect of pyridoxine on oxalate production is clear. Rats fed diets deficient in

pyridoxine excrete more urinary oxalate, but not faecal oxalate, than control rats (Ribaya the and Gershoff, 1981; Ribaya and Gershoff, 1982). Pyridoxine fed to rats decreases (Ribaya- amount of oxalate excreted by rats fed diets containing oxalate precursors

Mercado and Gershoff, 1984). 9

Enteric hyperoxaluria is not affected by pyridoxine but urinary oxalate excretion in patients with idiopathic hyperoxaluria decreases when they are given an oral dose of pyridoxine (Jaeger et a1.,1986). An oral or intravenous dose of pyridoxine after dialysis patients decreases the mean plasma oxalic acid concentration in chronic haemodialysis with secondary hyperoxaluria (Balcke et a1.,1984; Balcke, 1985).

Watts et aI. (1985) suggest that pyridoxine acts by decreasing oxalate biosynthesis oxalate in some patients with type I hyperoxaluria. The influence of pyridoxine on Richardson, metabolism may be mediated mainly through the liver (Varalakshmi and that 1983). This is contrary to the results of Liao and Richardson (1972) who found stimulate isolated perfused rat livers from pyridoxine and thiamine-deficient rats do not adequate diet' oxalate synthesis above that obtained with livers from rats on a normal, of The apparent inhibition of glycollate appears to be due to a decrease in absoption the dietary glycollate rather than an inhibited metabolic rate. This is in agreement with does not observation of Runyan and Gershoff (1965) that the injection of glyoxylate

increase the excretion of oxalate in the urine of pyridoxine deficient rats.

1.4 Poisoning.

Oxalate poisoning is of great importance throughout the world and occurs in plants. However, livestock, resulting primarily from the ingestion of oxalate-containing vary poisoning is a complex and poorly understood phenomenon. Signs of poisoning

with the animal species and the chemical form of the oxalate. There are apparently as on many dissimilarities as similarities among the effects of the different types of oxalate

the different species of animals-

acute There are three forms of oxalate poisoning which have been reported- The greasewood, setaria and and subacute conditions occur in animals poisoned by halogeton' soursobs' soursob. However, chronic oxalate poisoning is mainly restricted to 10

1.4.1 Acute Poisoning.

on pasture Acute oxalate poisoning usually occurs when hungry stock are placed are in sxcess of I07o dominated by oxalate-containing plants in which the oxalate levels usually due to of the dry matter, setaria excepted. Reduction of rumen microbial activity' to toxicity' Oxalate fasting, as well as diets deficient in calcium, predispose the animals by fungal or ions may cause initial damage to the fumen mucosa' which can be followed Death occurs due bacærial invasion leading to acute rumenitis and intractible indigestion. gastrointestinal to severe metabolic disturbance complicated by renal, pulmonary and of calcium injury. Pathological examination of the kidneys always reveals large amounts wall (Dodson, oxalate crystals and these may also be seen in sections of the ruminal include rapid and 1959; James et aI.,l97l; Seawright, lg82). Signs of acute poisoning (James, 1972; James' I978; laboured respiration, depression, weakness, coma and death some will exhibit a mild James et al.,Ig7l). A few individuals will have convulsions and greasewood tetany. Bloating is characteristic of acute poisoning in sheep gtazing

(Fleming et a1.,1928).

in The gross pathology observed is haemorrhage and oedema of the rumen wall' mucosa' some instances ascites, and sometimes hyperaemia of the abomasal levels decrease Microhaemorrhage may be seen in the medulla oblongata. Serum calcium magnesium while phosphorus, sodium levels increase (James and Butcher, 1972)' Serum but this is not levels decrease slightly. Serum potassium levels increase in some sheep occurs rapidly' consistent. Plasma urea nitrogen levels change only slightly if death 16 of ingestion However, they increase substantially if death does not occur within hours liver is enlarged of oxalate, indicating kidney damage (James et aI., I97l).In cattle, the The mesentery at and the kidneys are swollen, pale and mottled (Seawright et a1.,1970)' quantity of the intestinal attachment and the omentium are oedematous and there is a There is straw-coloured ascitic fluid in the peritoneal and pericardial cavities- present the haemorrhagic inflamation of the lower alimentary tract' Lesions afe in reddened and abomasum, small intestine and large intestine. The lungs are swollen, 11

trachea and bronchi' oedematous, and there are large quantities of pinkish froth in the

Mortality is believed to be due to a combination of kidney, alimentary and respiratory from oxalate lesions resulting in a terminal circulatory failure. An alkalosis may result is an upset of the consumption by sheep and cattle. One suggested cause of the alkalosis Bennens, 1956)' electrolyte equilibrium due to hypocalcaemia (James ' 1972; Gardner and and The other cause suggested results from oxalate being degraded to carbonates bicarbonates by the rumen microflora (James, 1972; Talapatra et aI',1948)'

interfering In acute poisoning, oxalate may interfere with energy metabolism by possibly other with the enzymes succinic dehydrogenase and lactic dehydrogenase, and and James' calcium and magnesium-dependent enzymes (Church, 1979: Van Kampen flaccid I969;James et al.,1967). This is substantiated by the clinical changes in which lactic paralysis of skeletal muscle precedes death. Oxalate is known to inhibit site of the dehydrogenase (Novo a et a1.,1959) by competing with lactate for the active with enzyme, thereby inhibiting lactate oxidation, and by interfering non-competitively that poisoning the reduction of pyruvate (Emerson et aI., 1964). In vitro data suggests (James et a1.,1967)' may involve impaired cellulose fermentation and rumen dysfunction may linger on Death usually occurs 4-12 hours after a lethal dose, although some sheep for2or3days.

1.4.2 Subacute Poisoning.

calcium In the subacute syndrome there is neither sufficiently depressed plasma particularly in the nor renal damage to cause death but marked damage to vascular tissues, is evident and, alimentary tract and lungs. Early microbial invasion of the ruminal mucosa

an intractible indigestion in less acutely affected cattle, this may contribute significantly to (James et I97I)' which would be detrimental to an animal's chances of recovery aI', (Smith' Affected animals may remain in this state for weeks before death or recovery poisoning varies 1950-51). The amount of oxalic acid needed to induce subacute feeding a high- according to the nutritional status of the animal immediately prior to are able to tolerate oxalate diet (Watts, 1959b). Animals with a high nutritional status t2 much larger doses of oxalate than animals with a low nutritional status. It is considered dysfunction that the primary factor in subacute oxalic acid poisoning in sheep is rumen (1970) noted a due to its effect on the pH of the rumen. In cattle, Seawright et al. initially The muzzle was staggering gait and diarrhoea before animals became sternally recumbent. muscles' dry and ruminal movements had ceased. Tetany occurred in some individual improve the especially in the face. Although injections of soluble calcium salts may affected condition, the animals remained lethargic and without appetite. Within 8 days the sick cattle developed extensive subcutaneous oedema of the brisket and dewlap and all gait or animals died within 3 weeks of poisoning. Affected sheep may move with a stiff There is some on their knees (Gardner and Bennetts, 1956; James, 1972; James, 1978)' unlike knuckling over of the fetlocks and the animal may become recumbent' However' cattle, the appetite remains normal.

1.4.3 Chronic Poisoning.

Chronic oxalate toxicity is common in sheep grazing soursob (Bull, 1929; grazing Dodson, 1959; Gardiner, 1963; Mclntosh, 1912; Seawright, 1982)' Animals oxalate soursob develop a high degree of tolerance to high daily intakes of the acid absorption of contained by the plants (Dodson, 1959). There is often persistent low-level

the oxalate with progressive damage to the kidneys and deposition in them of masses of pasture' calcium oxalate crystals (Bull, lg2g). Over a period of 2-12 months on soursob subjected to animals slowly develop renal failure. These sheep may appear normal until be a some form of stress (James, 1972; McBarron, 1977; James, 1978) or there may

gradual decline in condition without any other obvious symptoms (Smith, 1950-51; death within a Gardner and Bennetts, 1956; Mclntosh, Lg72). Collapse, prostration and and short period is not unusual. At necroscopy the kidneys are small, white and fibrotic Smith, contain large amounts of calcium oxalate crystals (Gardner and Bennetts, 1956; is an excess 1950-51; Mclntosh, lg72).In anaemic sheep, the heart is enlarged, and there (Mclntosh, 1972). of pale yellow fluid in both the peritoneal and the pericardial cavities T3

Sheep do not appear to be affected by setaria to the same extent as cattle- Even after being deprived of feed for two days, shorn, chilled by spraying with water to promote the highest possible intake of feed, and allowe d to graze setaria pasture for one week, sheep showed no signs of poisoning (Jones et a1.,1970). However, the kidneys contained calcium oxalate crystals and had characteristic chronic lesions when examined'

Horses are relatively resistant to oxalate poisoning as a nephrosis (Barron, 1977;

Jubb and Kennedy, 1963) and succumb to acute gastroenteritis only after receiving an unusually large dose. However, horses grazlng Cenchrus ciliaris and/or Panicum maximum pastures in southern central Queensland develop lesions of osteodystrophia

fibrosa or nutritional secondary hyperparathyroidism (NSH) (Walthatl and McKenzie,

Ig76).Horses grazing Setaria sphacelata, Brachiaria mutica ot Pennisetum clandestinum fibrous swellings in coastal Queensland also develop the disease. Ill-thrift, lameness and

of nasal bones, maxillae and mandible are observed. Calcium and phosphorus levels of

the pasture are normal but all of the pasture species mentioned above contain oxalates

which are suspected of causing the disease. The disease is now known to be a calcium

deficiency syndrome induced by the oxalate in the pasture plants and Digitaria decumbens

and Chloris guyana have been additionally implicated in the disease (McKenzie and

Schultz, 1983, McKenzie, 1985). Hypocalcaemia and kidney necrosis are observed after

graztng on S. sphacelata.

pigs fed Amaranthus retrof'l.exus develop clinical signs of perirenal oedema

(Osweiler et a1.,1969). Large increases in serum potassium and smaller increases in

serum magnesium levels, and a marked increase in blood urea nitrogen values are also

observed. The leaves of Amnranthus retroflexus contain I2-307o (dry weight) oxalate as

oxalic acid (Marshall et a1.,1967) and it was considered that oxalate was the cause of the

symptoms. However, microscopic examination of the kidneys failed to reveal renal

crystals of calcium oxalate. Oxalate crystals are thought to be deposited in the tissues in

two forms (Zarembski and Hodgkinson, 1967). Crystalline calcium oxalate dihydrate

may be deposited in the kidneys and a non-ctystalline complex of calcium oxalate and I4 lipid may be deposited in the liver and other tissues. The type of crystal formed may account for the failure to observe renal crystals in the pigs-

1.4.4 Symptoms in Humans"

Following ingestion of a toxic dose of oxalic acid, nausea, vomiting, and gastroenteric pain are the first signs of intoxication in humans (Deichmann and Gerarde,

1,964)- The oxalate combines with calcium in the formation of calcium oxalate which induces central nervous system stimulation (irritability, twitchings, tremors, and convulsions). Oxalate crystals in the ureter and bladder may cause pain and haematuria'

Death is due to renal obstruction or to hypocalcaemia leading to cardiac failure.

1.4.5 Treatment of Poisoning.

Hickinbotham and Bennett (1931) recommend drenching with a solution of

calcium chloride and ammonium chloride as treatment for acute and subacute cases of

oxalate poisoning. The calcium chloride renders any oxalic acid in the rumen insoluble so

that it can do no further harm, and the remainder passes through the rumen wall and

corrects the calcium balance of the blood. The ammonium chloride is used to reduce

bloating and for its tonic effects. Smith (1950-51) suggests treatment of acute and

subacute cases of oxalate poisoning by injection of calcium borogluconate under the skin.

There is no effective treatment for halogeton poisoning (James, 1972). There is no

possible treatment for chronic cases of oxalate poisoning as these are a result of physical

damage to the kidneys.

The suggested treatment for oxalate poisoning in humans is evacuation of the

stomach by repeated vomiting or gastric lavage with milk, limewater, or powdered chalk

in water, or by the use of 107o solutions of calcium gluconate, calcium lactate, or calcium

chloride to produce calcium oxalate in the stomach (Deichmann and Gerarde, 1964)- 15

Intravenous administration of glucose and saline should also be considered- If renal function is unimpaired, the victim can be given four litres of fluid per day to prevent precipitation of calcium oxalate in the renal tubules.

1.4.6 Management to Prevent Poisoning.

It is much easier to prevent poisoning than to cure it. Poisoning may be prevented by either removing the offending plants or by adapting animals to an oxalate-rich diet.

Adapting animals to an oxalate-rich diet, however, may not be an effective measure when it is intended that sheep should graze soursobs.

Research has shown that there is a weak point in the growth cycle of soursobs

(Anon., lg62).This occurs when the old bulb has become exhausted and the new bulbs

have not yet appeared. By taking advantage of this weak point in the growth cycle,

soursob control can be made effective for a longer time than attempts at control at other

stages of the growth cycle. Normally the weak point is reached in late May or early June,

when the first flower stalks have appeared. Once the old bulbs are exhausted, the

paddock can be given a thorough cultivation. It is important not to touch the paddock with

any implements before this stage. The paddock is then left undisturbed for six weeks

before cultivating again. This second cultivation checks the rapid regrowth of soursobs

which follows the first cultivation. The paddock is then left for a week before sowing the

crop.

One year's timed cultivation on its own is not enough to give lasting control on

heavily infested land. This applies particularly to the red brown earth soils found on the

Adelaide plain. Therefore, it was suggested that 2,4,5-trichlorophenoxyacetic acid

(2,4,5-T),an hormonal herbicide, may be used to improve soursob control, provided that

bulb numbers had been reduced to a reasonably low level by cultivation in the previous

year (Anon., 1962; Anon., 1965; Tideman, 1966). To be properly effective, 2,4,5-T

must be applied at the stage of bulb exhaustion. However, the cost of 2,4,5-T is relatively t6 high and cheaper herbicides are now available. Diuron, Amitrole, glyphosate (Roundup), and Chlorsulfuron (Glean) are all used to control soursobs'

It has also been suggested (Anon., 1962) that the shading effects of pasture plants, particularly sub-clover or lucerne may be a valuable aid for extra control on heavily infested land. When sown for this purpose, seeding rates must be high to ensure quick and effective smothering of the soursobs.

Halogeton is particularly diffîcult to eradicate. It is a prolific seed producer and the

seeds retain a high degree of viability. Revegetation of infested areas with crested

wheatgrass has been suggested but this has not been successful in areas where most of

the halogeton infestation occurs because of low rainfall and the high salt content of the

soil. Revegetation with native perennial shrubs has been suggested as being more

desirable than with grass species as these would be more suited to the growth conditions.

Treatments with herbicides may temporarily suppress halogeton, but it is the

pioneer reinvading the site when the toxicity of the herbicide disappears (James and Cronin, lg74)- Halogeton is found to be susceptible to applications of 2,4-

dichlorophenoxyacetic acid (2,4-D) during its vegetative stage of growth (Cronin, 1965).

However, the plant becomes resistant to aqueous sprays of 2,4-D about the time the plant

enters its reproductive phase of growth. Treatment with herbicides such as 2,4-D also

injures the perennial shrubs and increases the space likely to be invaded by halogeton.

James and Cronin (1974) have recommended a number of management practices

which should minimize deaths in sheep from halogeton poisoning and allow improvement

of the ranges for grazing. Avoid overgrazing and all other activities that will remove or

deplete the existing perennial vegetation, allowing invasion by halogeton, develop a

grazingprogram that will allow the range to improve, reduce grazing pressure during

periods of drought, avoid grazing ot graze very lightly during the growing season of the

perennials, supply adequate water and forage of a good variety, watch the livestock,

know what they are grazing, and know what will be available for grazing (have a grazing t7 plan), allow sheep time to adapt to an oxalate-rich diet by grazing safe amounts of oxalate. Grazing plants low in oxalate content will adapt a sheep in about four days, introduce animals to halogeton-infested areas gradually, do not unload animals from a truck into halogeton unless both supplemental feed and rwater are available, never allow found on old bedgrounds, animals to Eraze in large, dense patches of halogeton often into along trails and roads, and around watering places, and do not trail thirsty animals watering places surrounded by halogeton without supplementing them with other food'

These management practices are equally applicable to other plants high in oxalate content.

In addition, it is suggested that the diet be supplemented with calcium, either in the form of licks (Smith, 1950-51), or as lime in the drinking water or in dreches (Hickinbotham at least and Bennett, 1931) and remove animals to pasture other than oxalate-rich plants once every two weeks. Gardiner (1963) also suggests that valuable rams or breeding that ewes should never grazeon pastures containing oxalate-rich plants as it is probable long-term adverse effects on fertility of both sexes may result both from chronic kidney

damage and from interference with calcium metabolism.

Setaria and greasewood are generally considered as being non-toxic to animals

and poisoning only occurs when large amounts of these plants are eaten in a short time by

hungry animals. Therefore, few measures are taken to control greasewood, which is

considered to be a valuable source of range feed, and setaria, which is sown specifically

as a pasture grass.

Talapatra et al. (1948) suggested that the malnutrition and stunted growth of cattle

in areas of India where paddy straw forms the main roughage can be prevented by

suitable processing of the straw. By soaking and washing paddy straw with water, a

considerable quantity of potassium oxalate can be removed. The soluble oxalate can also

be destroyed by ensiling the chopped straw, preferably with molasses, after wetting it

with water.

Ruminants can metabolize and destroy oxalate when they have become adapted to

it (Gardiner, 1963). It can take from four to ten days for animals to become adapted 18

'Watts, (Morris and Garcia-Rivera, 1955; l95l; James et al., 1967; James, 1972;

Gardiner, 1963). Smith (1950-51) suggests that animals should be adapted to an oxalate- rich diet by allowing them to graze on oxalate-rich plants for a limited period of 30 minutes only, at first, and this period can then be gradually lengthened until the animals are fully adapted. Ruminants adapted to oxalate-rich diets are able to tolerate levels of oxalate (16-67o of dry matter intake) that would be lethal to animals that have not been adapted (James and Butcher, 1972). Adaptation to an oxalate-rich diet occurs as the population of oxalate-degrading bacteria in the rumen increases.

1..5 Oxatate-Degrading Microorganisms.

A number of microorganisms have been discovered which are able to utilize

oxalate as a sole carbon source. These microorganisms have been obtained by the

enrichment culture æchnique from soil, air, water and the gastrointestinal tracts of several

organisms, including humans. Their isolation has been simplifred by a modification of the

enrichment medium (Bhat and Barker, 1948).

The isolation of Bacillus extorqLtens by Bassalik (1913) represented the first

report of such a microorganism, but this has since been renamed Pseudomonas

extorquens. It was originally isolaæd from the excreta of an earthrworTn that had ingested

plant material containing crystals of calcium oxalate. Later, it was shown to be present in

the soil. The decomposition of oxalate was shown to be an oxidation to carbon dioxide

and water

Bhat and Barker (194S) reported the isolation of an anaerobic soil bacterium

which they named Vibrio oxaliticus, which was the only oxalate-degrading bacterium in

their enrichment cultures. They suggested that other species of bacteria in the enrichment

cultures might have been living on organic materials synthesized by V. oxaliticus- A

number of soil samples were examined for the presence of V. oxaliticus and positive 19 results were obtained with all samples tested, suggesting that V. oxaliticus is a common soil microorganism.

Jayasuriya (1955) isolated three strains of an oxalate-degrading microorganism from soil which were different from other known oxalate-degrading microorganisms. On morphological grounds, one of the isolates appeared to be a member of the genus

Pseudomonas and was referred to as Pseudomonas OD strain 1' It was an aerobic water' bacterium, growing best at 25" C and decomposing oxalate to carbon dioxide and

It has been suggested that the reaction proceeds via formate but, because the organism is does not grow on formate, an active form of formate may be involved. This mechanism be in accordance with the results of Jacoby et at. (1956) and Quayle (1963b) which will

discussed later.

pseudomonas oxalaticus (Khambata and Bhat, 1953) was isolated from the

intestinal contents of earthworms. Six strains were isolated which were practically

identical in their morphological and cultural characteristics. However, two strains differed

in their ability to utilize certain carbon compounds and in their being pathogenic to white

mice on intraperitonial inoculation. One of the strains (OXl) has been used extensively

for the study of the mechanism of oxalate decomposition (Quayle et al'' 196l; Quayle,

1963b).

It has been known for many years that, after adaptation, ruminants can consume

large quantities of plant oxalates without suffering any apparent ill effects due to oxalate

poisoning. This immunity to oxalate poisoning has been explained generally on the basis

that oxalic acid is degraded by the fumen. It has also been suggested that an appreciable

portion of the oxalates pass through the digestive tract as inert calcium oxalate. However,

this is likely to lead to calcium deficiency problems.

was During a feeding trial in which an oxalate-rich diet was fed to dairy cows, it and observed that no more than trace amounts of oxalates appeared in the blood, urine oxalates faeces (Morris and Garcia-Rivera, 1955). These observations indicate that the 20 had been degraded in the rumen. However, this evidence did not eliminate the possibility that the oxalates had been absorbed and rapidly detoxified. It was demonstated that a full rumen is able to destroy the oxalate ion. Further, the quantity that can be degraded in a given period far exceeds that which is apt to be consumed by a cow while grazing any of the commonly encountered forage grasses. This does not include plants containing high concentrations of oxalates.

It is well documented that animals previously exposed to small quantities of oxalate-rich plants are able to consume greater amounts without any ill effects- It was considered that this relative immunity was due to a greater ability of the ruminal bacteria to degrade oxalic acid rapidly before it could affect the rumen contents (Watts, 1957). It was found that the presence of excess calcium decreased the amount of oxalate degraded.

The effect of adaptation to the oxalate-rich diet did not cease immediately on the cessation

of dosing since samples taken 6 and 12 days after the animal had ceased to be dosed exhibited some residual effect.

Dodson (1959) suggested that a bacterium associated with Oxalis pes-caprae

could be responsible for the degradation of oxalate in the rumen. This suggestion resulted

from the observation that rumen liquor was unable to metabolize oxalates during the dry

summer immediately preceding the growth of O. pes-caprae. Michael (1959) found

bacteria associated with O. pes-caprae that could degrade oxalate, supporting the

suggestion of Dodson (1959). These were isolated from soil under aerobic conditions and

showed similar morphological and cultural reactions to those of. Agrobacterium

ra^diobacter. However, the organism would have to be at least a facultative anaerobe if it

were to exist in the rumen where conditions are strictly anaerobic.

Allison et aI. (1977) discovered that the transition to an oxalate-rich diet for

ruminants was accompanied by a marked increase (l0-fold and greater) in the in vitro

rate of oxalate metabolism by ruminal microbes. A transition period of 3 to 4 days

appeared to be required for selection of the microbial population that rapidly degraded

oxalate. Increased rates of oxalate degradation were also observed in response to infusion 2L of gradually increasing amounts of sodium oxalate into the rumens of sheep' It was found that oxalate degrading capacity was negligible in cell-free ruminal fluid from adapted sheep but was associated with fractions that contained bacærial cells.

Dawson et at. (1980a) were the first to report the isolation of anaerobic oxalate- degrading bacteria from the rumen. These were isolated from enrichment cultures used to gain information about the nature of oxalate-degrading bacteria in the rumen (Dawson øf at.,I980b). The isolated species was an obligatety anaerobic, gram negative, nonmotile, curved rod. Growth in the oxalate-containing enrichment medium was directly related to the concentration of oxalate in the medium and oxalate was stoichiometrically degraded to carbon dioxide and formate. It was distinct from any previously described oxalate- degrading bacæria and was later given the name of Oxnlobacterformigønes (Allison et al.,

198s).

The selection of oxalate-degrading microorganisms, similar to the selection

observed in adapted animals, had been achieved during in vitro continuous culture of

mixed ruminal bacteria (Allison et a1.,1981). Mixed bacterial populations established

during a 3 to 4 day adaptation period had the capacity to degrade oxalate at rates that were

10 to 100-fold greater than rates in the inoculum. Adaptation to oxalate appeared to be due

to selection of increased proportions of oxalate-degrading bacteria. The adaptation of the

population was dependent upon gradual addition of oxalate to the system.

Certain rodents appear to be able to tolerate a considerable amount of soluble

oxalates and to absorb calcium from insoluble calcium oxalate (Shirley and Schmidt-

Nielsen, Ig67).When calcium oxalate or soluble oxalates are ingested by some rodents,

it is degraded. However, injected oxalate is excreted, suggesting that oxalate degradation

takes place in the intestine, presumably by microbial action. An obligately anaerobic,

oxalate-degrading bacterium, similar to ruminal strains of Oxalobacter formigenes,was

later isolated from the cecal contents of rats (Daniel et aI., 1987). 22

Oxalobacter formigenes, first described by Dawson et aI. (1980a) and designated

OxB, is an inhabitant of the rumen and also of the large intestine (colon) of humans and other animals where its actions in the destruction of oxalic acid may be of considerable importance to the host (Allison et aI., 1985).Isolates from the rumen of a sheep, the cecum of a pig, and from human faeces were all similar gram negative, obligately anaerobic rods but differences between isolates in cellular fatty acid composition and in serologic reaction were noted. All strains degraded oxalate stoichiometrically to carbon dioxide and formate and no substances were found that replaced oxalate as the sole carbon source.

Other oxalate-degrading bacteria have been isolated from a number of

environments (Muller, 1950; Stocks and McCleskey, 1964; Blackmore and Quayle,

1970; Anthony and Zatman,1964; Mehta, 1973; Chandra and Shethna,1975; Robbel and

Kutzner, 1973 Bhat, 1966; Dehning and Schink, 1989; Smith et a1.,1985)

1.6 Bacterial Classification

Historically, bacterial classification has been based on phenotypic properties

ranging from shape, size, extracellular structut'es, metabolic rates, etc. Unfortunately,

many bacteria can not be differentiated by these methods. There are many examples

where the same species, established by the traditional methods, were later shown to be

members of a different species, such as Escherichia hermannii (Brenner et al', 1982),

Vibrio extorquens (Stocks and McCleskey, 1964), and Fibrobacter succinogenes

(Montgomery et a1.,1988). Nucleic acid reassociation or DNA-DNA homology has been

used for bacterial taxonomy studies (Johnson, 1973), providing a common base for

establishing bacterial groups. More recently, DNA probes have been used successfully in

bacterial identification and enumeration. For example, species-specific chromosomal

DNA probes have been used in the identification of ruminal bacterial species Prevotella 23

(Bacteroides) ruminicola (Attwoo d et a1.,1988), Prevotella and Buryrivibrio (Hudman and Gregg, 1939) and Fibrobacter succinoSenes (Stahl et a1.,1988).

Bacterial isolates can also be identified and differentiated through chromosomal

DNA lrngerprinting analysis. Marshall et aI. (1985) established that a single E. coli strain was responsible for an outbreak of human diarrhoea through DNA fingerprinting analysis of the chromosomal DNA from different pathogenic E coli isolates. Bacterial plasmid profile analysis has also been used for bacterial identification. Olsvik et al. (1985) identified the transmission of Salmonella typhimurium from cattle to humans through bacterial plasmid prohle analysis.

Although the above techniques of bacterial identification have been shown to be

more sensitive and less biased than the traditional approaches, they still have limited

specificity of are labour-intensive. An ideal bacterial identification protocol should be

sensitive enough to allow detection of bacteria at very low concentrations and have the

ability to discriminate among a wide range of bacterial taxa, such as might be found in a

sample taken from a natural environment. Direct analysis of the PCR-amplified sequences

of 165 subunit of rRNA by restriction enzyme digestion has been developed (Avaniss-

Aghajani et al., 1994; Avaniss-Aghajani et a1.,1996) and similar techniques have been

used successfully to define the diversity and structure of natural microbial communities (Amann et aI., 1995; Delong, 1992; Delong et al., 1994; Fuhrman et al., 1993;

Giovannoni et a1.,1990; Moyer et a1.,I994;Pace et aI., 1986; Picard et aI., 1992; Raskin

et aI., 1994: Schmidt et a1.,1991; Stahl ¿r a1.,1985; Ward et a1.,1990). Brunk et al.

(1996) examined I,484 bacterial 165 subunit rRNA gene sequences available in the

Ribosomal Database Project (Larsen et a1.,1993) database to determine highly conserved

regions of sequence for suitable PCR primers and suitable enzymes for analysis of

restriction fragment length polymorphisms. Their results indicated that this approach

should readily resolve very complex bacterial populations. It would most probably

underestimate the diversity in a complex population because closely related species have

very similar DNA sequences for the 165 subunit of rRNA and therefore, similar, if not 24 identical, restriction maps. However, it does give a conservative estimate of that diversity.

Restriction fragment length polymorphisms of the 165 subunit of rRNA gives an estimate of the diversity within a population of bacæria but to determine which species are present, it is necessary to isolate the individual species and analyse them independently. The 165 subunit of rRNA contains a number of conserved and variable regions.

Sequence analysis of the 165 subunit of rRNA is useful in identifying species as the variable regions are species-specific. Traditional methods can then be used to confirm the results.

1.7 Pathways of Oxalate Degradation.

At least three pathways have been elucidated by which oxalates are catabolized by

soluble enzyme systems. These involve oxidation, decarboxylation, or activated

decarboxylation.

The oxidation of oxalic acid, resulting in the formation of carbon dioxide and

hydrogen peroxide (equation 1), has been found in mosses and in higher plants (Datta

and Meeuse, 1955).

COOH 248.8 kJ/mol (1) | + HzOz ÂG'= COOH

The moss enzyme has been found to be stimulated by flavin mononucleotide

(FMN) or riboflavin but not by flavin adenine dinucleotide (FAD) (Datta and Meeuse,

1955) but vigorous proof of flavin participation as a coenzyme is not available.

Two mechanisms for the decaboxylation of oxalate have been established' Both

mechanisms involve an oxalate decarboxylase, but these differ in their properties- Oxalaæ

decarboxylase was first discovered in the white-rot, wood-destroying fungus, Collybia 25 velutipes (Shimazono, 1955). The purified oxalate decarboxylase is a stable enzyme' highly specific for oxalate decarboxylation, degrading oxalate stoichiometrically to formate and carbon dioxide (equation 2).Free energy change is calculate according to

Thauer et al. (1977)

COOH (2) | ------> COOH

The enzyme is peculiar in that catalytic quantities of oxygen are required for the reaction to proceed although the overall process does not utilise oxygen stoichiometrically

and oxygen cannot be replaced by a variety of compounds. The enzyme is most active at pH 3.0 and most stable at pH 4.5 (Shimazono and Hayaishi, 1957). The apparent

dissociation constant (Km) of the enzyme and substrate is approximately 2 mM. Because

oxygen is required in catalytic quantities, it was hypothesised that the reaction proceeded

according to reactions 3 and 4.

COOH ÀG'= -248.8 kJ/mol COOH

COOH cooH

However, when hydrogen peroxide was added directly or generated in siru under

anaerobic conditions, it did not replace oxygen. The addition of catalase or catalase with

ethanol did not inhibit enzyme activity under aerobic conditions. Therefore, involvement

of hydrogen peroxide in the direct decarboxylation of oxalate did not appear likely

(Shimazono and Hayaishi, 1957).

Emiliani and Bekes (1964) isolated an oxalate decarboxylase from Aspergillus niger which was similar to the enzyme isolated from C. velutipes in its oxygen

requirement, but it differed in some characteristics. Unlike the induction of the enzyme in

C- velutipes, which was induced by the addition of oxalate, the production of oxalate 26

decarboxylase in A. niger appears to be induced by low pH. The greatest activity of

oxalate decarboxylase was achieved at pH 1.1 with no oxalate in the culture medium'

However, small amounts of oxalate were identiflred in the mycelia and A. niger is known

to produce quite large amounts of oxalic acid, especially in hay and oats (Wilson and

Wilson, 1961). It is believed that under natural conditions oxalate decarboxylase is

produced when the pH is reduced by the production of oxalic acid.

Maximum activity for the A. niger oxalate decarboxylase was achieved at pH 5.2

(c.f. pH 3.0 for the C. velutipes enzyme) with a dissociation constant (Kr') of 4 mM.

However, when gelatin was added to the assay, maximal activity was achieved atpH 4-7 the with a dissociation constant of 2 mM. The mechanism of oxalate decarboxylation by

A. niger oxalate decarboxylase has not yet been established, but the oxygen requirement

would suggest that the mechanism is similar to that found in C. velutipes.

Lillehoj and Smith (1965) discovered that extracts from spores and mycelia of to the one found in T Myrotheciumverrucarl¿ contain an oxalic acid decarboxylase similar Lf C. velutipes. The enzyme was highly specific for oxalic acid and was inactive under

anaerobic conditions. The dissociation constant (K-) of 1.7 mM was close to those

reported for C. velutipes andA. niger.Unlike the C. velutipes enzyme, flushing with

oxygen was required to restore activity after anaerobic incubation and this effect appeared

to be quite specific.

The second decarboxylation pathway to be established was the activation of

oxalate prior to decarboxylation (Jakoby et a1.,1956). This pathway is found in oxalate-

degrading bacteria which have been growing on oxalate. The system requires substrate

quantities of ATP and catalytic amounts of acetate, coenzyme A, thiamine pyrophosphate

and magnesium ions. Coenzyme A, ATP and acetate could be replaced by acetyl-CoA'

The suggested mechanism for the activated decarboxylation of oxalate is given in

equations 5, 6 and 7.

(5) acetyl-CoA + oxalate ----->

I 27

(6) oxalyl-CoA -----> ÂG' = -25.8 kJ/mol.

Ø formyl-CoA + HzO ----->

Later work by Quayle et aI. (1961) and Quayle (1963b) with Pseudomonas

oxalaticus demonstrated that two enzymes are involved in the activated decarboxylation by of oxalate. Quayle et aI. (1961) suggested that oxalyl-CoA was synthesised and oxalate transferase action between succinyl-CoA and oxalate, rather than acetyl-CoA an enzyme as suggested by Jakoby et aI. (1956). However, there is no evidence of such

having been purifred and the specihcity of the enzyme is unlnown.

of euayle (1963b) later isolated an enzyme which catalysed the decarboxylation oxalyl-CoA to formyl-CoA. The oxalyl-CoA decarboxylase required thiamine

pyrophosphate as a cofactor and was stimulated by the presence of magnesium or

manganese ions. The pH optimum for the decarboxylation was 6.6 and the reaction and the appeared to be irreversible. The dissociation constant (K-) was found to be 1 mM 'l iT enzyme did not catalyse the decarboxylation of oxalate, malonate, succinate, malonyl- i CoA or succinyl-CoA. Unlike the fungal enzyme, this enzyme does not have an oxygen

requirement and would therefore be very useful for the degradation of oxalate in the

rumen.

1.8 Formate in the Rumen.

Small amounts of formic acid can be detected in the steam-volatile fatty acids of

fumen liquor. However, Annison (1954) has suggested that formate in the peripheral

circulation of sheep probabty was not derived from this source. Blood concentrations of

formate, unlike those of acetate, do not rise during feeding, and only fall slightly during a t r 48 hour fast (Vercoe and Blaxter, 1965).

; give It has been shown that formate added to rumen liquor is dissimilated to and carbon dioxide and methane ([,ewis, 1951; Beijet,1952;Doetsch et al-,1953; Canoll r 28

Hungate, 1955). Matsumoro (1961) showed that the rate of disappearance of formate

from the rumen was constant in the short-term, was unaffected by formate concentration

and was associated with an increase in the concentration of methane and a decrease in the

concentration of carbon dioxide in the gas phase of the rumen.

Formic acid is usually regarded as the most likely source of hydrogen for the

reduction of carbon dioxide to form methane in the rumen. The reduction proceeds in two

steps (equations 8 and 9) (Canol and Hungate, 1955)

AG'= -43.3 kJ/mol

ÂG' = -131.0 kJ/mol

so that the overall reaction is (equation 10)

The rate conversion of hydrogen and carbon dioxide to methane is greater than the rate -l of ,q significant "l of formate degradation and therefore hydrogen does not accumulate in

concentrations.

In long-term experiments, Vercoe and Blaxter (1965) infused increasing amounts

of formic acid into the rumen over three to five days until 1.5 moles/day were being

infused at constant rates. It was found that both methane and carbon dioxide production

increased. There was no significant change in oxygen consumption. Intravenous infusion

did not affect methane or carbon dioxide production but the urinary excretion of steam-

volatile fatty acids was increased. It was concluded that formic acid, when supplied to the

animal at slow, constant rates, is rapidly dissimilated quantitatively by rumen bacteria but

rapid infusion of 2.0 moles of formic acid into the rumen over 30-40 minutes depressed

the total metabolism, probably by interference with microorganisms other than those

genesis. i concerned with methano

Ì 29

Of the carboxylic acids, formic acid is the most suitable chemical preservative for feeds because of its high bactericidal and fungicidal properties (Tagaev et a1.,1985). It has no adverse effect on farm animals and, when added to the diet, increases body weight gain and milk yield. Formate may also be useful in preventing nitrate toxicity in ruminants, where this is a potential danger, by acting as a hydrogen donor in its reduction by rumen microorganisms (Nakamvta et a1.,1985)-

When fed with silage, sodium formate reduces ammonia formation in the rumen and increases the nitrogen content of the duodenal fluid, absorption of protein nitrogen and nitrogen utilization (Mukhamedyanov and Dukhin, 1984). Apart from increasing milk yield in lactating cows (Mukhamedyanov, 1983) and body weight gain in sheep

(Mukhamedyanov and Koromyslova, 1984), sodium formate in the feed increases the wool yield and decreases the fibre diameter in fine-wooled rams (Mukhamedyanov and

Koromyslova, 1984)"

Hungate et aI. (1970) reported the inability of a coccobacillary methanogenic

isolate from the rumen to utilise formate down to the concentrations found in the rumen.

This led to the conclusion that methanogenic bacteria do not metabolize formate in the

rumen. However, there are physiologically diverse populations of coccobacillary

methanogenic bacteria in the rumen that can interact competitively and cooperatively.

Lovley et aI. (1984) have since isolated several strains of coccobacillary methanogenic

bacteria which are able to metaboli zn formate at the concentrations that have been reported

for the rumen. Methanogenic bacteria with a coccobacillus morphology are the only

hydrogen-utilizing methanogenic organisms that are consistently isolated from the rumen

in high numbers.

1.9 Aims and Objectives.

In 1985, Allison et al. descnbed a new group of anaerobic bacteria that degrade

oxalate. The new genus and species, Oxalobacter formigenes, are inhabitants of the 30 rumen and also of the large bowel of humans and other animals where their actions in the destruction of oxalic acid may be of considerable importance to the host. Baetz and

Allison (1989) purified and characterised the oxalyl-Coenzyme A Decarboxylase from this organism and its requirements for maximal activity suggested a similarity between it and the enzyme isolated from P. oxalaticus by Quayle (1963b). It had a pH optimum of

6.7, compared with 6.6 for P. oxalaticøs, and a Krnval:u¡e for oxalyl-CoA of 0'24 mM' compared with 1.0 mM for P. oxalaticus. The gene was for oxalyl-CoA decarboxylase was cloned and sequenced (Lung et aI., 1994) and two other genes involved in the metabolism of oxalate, an oxalate:formate antiport protein for the transport of oxalate into the cell (Abe er at., 1996) and formyl-CoA transferase for the transfer of Coenzyme A from formyt-CoA to oxalate (Sidhu et a1.,1997), were cloned and sequenced'

livestock can be Although O. formigenes is a natural inhabitant of the rumen and the adapted to high levels of oxalate in the diet, not all of the oxalate is metabolised by

bacteria. Small amounts are absorbed and crystalise with calcium in the kidneys,

eventually leading to kidney failure. The aim of this project is to survey the populations of

oxalate-degrading bacteria in the soil in terms of numbers of oxalate-degrading bacteria

and the species represented. A species which is easily cultured and degrades oxalate

rapidly will be selected and used for cloning the gene for oxalyl-CoA decarboxylase. The

sequence will be compared with that from O. formigenes. As O. formigenes is the only

species from which oxalyl-CoA decarboxylase has been cloned, there is little known

about which regions of the amino acid sequence are involved in enzyme activity.

Comparison with the amino acid sequence of oxalyl-CoA decarboxylase from other

species would give some insight into these regions and determine whether the enzymes

are derived from a common ancestor or whether they have evolved independently. 31

Chapter 2

Materials and Methods

2.1 Materials

2.L.1 Chemicals

All chemicals were reagent grade. Hydrogen and carbon dioxide were obtained from

Commomwealth Industrial Gases Ltd. (Adelaide, South Australia). The suppliers of special chemicals are indicated in the section describing their use'

2.1.2 Equipment

Fifteen ml Hungate tubes (Bellco Glass Co., N.J', USA) were used for the growth of anaerobic microorganisms. Aerobic microorganisms were grown in 25 ml (10 ml culture), 300 ml (50-100 ml culture) or 2 I (1 I culture) conical flasks.

Anaerobic Hood Coy Laboratory Products Inc.

Autoclave Athena 14x14x24 Pressure Sterilizer

Automated Sequencer Applied Biosystems model 37 3A

Cameras Penrax (Visible Light)

Polaroid Land Camera (UV Light)

Centrifuges Beckman Model TJ-6

Beckman Model J2-HS

Beckman Model L8-M

Phoenix Microcentrifu ge

Continuous Fermentor New Brunswick Scientific

Digital Gel Recording Bio-Rad Gel Doc 1000

Dot Blot Apparatus Schleicher and Schuell

Electroporator Bio-Rad Gene Pulser

Freezers (-80) Revco 32

Kelvinator Series 500

Gel Dryer Model583 (Bio-Rad)

Gel Tanks Bio-Rad Mini SubrM DNA Cell

Bio-Rad Wide Mini SubrM DNA Cell

Bio-Rad Mini ProteanrM II

Bio-Rad ProteanrM II

Gel Tank Power SuPPIY Bio-Rad Model 1000/500

Hybridisation Oven Hybaid Mini Hybridisation Oven

Incubators Orbital shaker (37" C) (Ratek Instruments)

Benchtop Orbital Shaker Incubator Model 0L 2116

(room temperature) (Paton Scientific)

Contherm Series Five Incubator

Laminar Flow Hood Gelman, Model CF 43 S

Microscope Olympus BH-z microscope (Olympus Optical Co.,

Tokyo, JaPan)

DNAThermal Cycler Perkin Elmer Cetus

Scintillation Counter Beckman LS 3801

Sonicator Branson 450 Sonifier

Spectrophotometer Shimadzu UV- 160 UV-Visible Recording

SpectroPhotometer

Speed Vac Concentrator Model RH 40-11 (Savant Instruments Inc')

UV-Transilluminator Ultra-Violet Products Inc.

X-ray Film Fuji Medical X-Ray Film RX (Fujifilm)

2.1.3 Bacterial Strains, Plasmids and Antibiotics

The bacærial strains used in this work are summerised in Table 2.1

The plasmids used in this work are summerised in Table 2.2'

The antibiotics used for the preparation of selective media are listed in Table 2-3. 33

Table 2.I. Bactenal Strains Strain Source E. coli K-12 strain DHl. fF-,recAL, endAl, gyrA96, thi-L, J. Hackett, Adelaide hsdRl7 m+k), supE44, Â-, NaF.] Uni.,S.A., Australia. E. coli K-12 strain H8101. lF-,hsdS2} (r-t, m-t), recAl3, Laboratory strain ara-14, proA2, lacYl, galK2, rpsL2} (Strepr), )cyl-s, mtl-L, L-.1 E. coli K-12 strain 517-1. lF+,thi, pro, hsdR-, hsdM+, Laboratory strain recA, E. coli K-12 strain ED8299 B. White, Uni. of Illinois, USA. 11884 P s eudomnnas oxalati cus strain ATCC Pseudomonas inosa strain R84 Laboratory strain Oxnlobacter formigenes strain OxB M. Allison, USDA, Ames, IA., USA

Table 2.2. Plasmids

Plasmid Features Reference/Source (1980) P}JC'I9 AmpR, TetR, cos Hone and Collins

pJRD215 SmR, KnR, cos, mob Davison et aI. (1987) (1983) PUC19 AmpR,lacZ Norrander et aI.

SuperCos AmpR, NeoR, cos Stratagene

pMU9 ErmR Achen et al. (1986)

pHC23 CmR, KnR, mob, TnI'732 R. Lockington, Adelaide Uni, S.4., Australia.

Table 2.3. Antibiotics Antibiotic Stock (mg/ml) Final (pelml) Solvent Ampicillin Prepared fresh 50-100 Distilled water Chloramphenicol 50 50 I007o ethanol Teüacycline 10 10 807o ethanol Kanamycin 50 50 Distilled water Streptomycin 50 50 Distilled water 34

2.1.4 Composition of Media

2.1.4.1 oxalate-containing Media (Bhat and Barker, 1948)

2.t.4.1.1 Liquid (g/l)

1.409 KHzPO¿ I.70g KzHPO¿ 0.509 (NH¿)zSO+ 0.209 MgSOa.TH2O 8.009 NazCzO¿

1.009 Yeast extract (Oxoid)

1 mg Phenol red (Ajax Chemicals)

The medium ìù/as dispensed into the flasks in which it was to be used and autoclaved.

2.1.4.1.2 Agar (g/l)

0.50g K2HPOa

0.10g MgSO+.7HzO

0.15g FeSO+.7HzO

1.00g (NH+)zCzO¿

1.00g yeast extract (Oxoid)

15.0g agar (Oxoid)

The medium was autoclaved, allowed to cool and poured into 15 cm disposable petri

dishes. It was allowed to set before adding lml sterile 2Vo CaClz. The plates were left

standing for a few minutes to allow a precipitate to form, the excess liquid was poured off

and the plates were allowed to dry in a laminar flow cabinet. 35

2.1"4.2 Oxølobøcter formígenes Media (Allison et al., 1985)

2.1.4.2.1 Trace Metals Solution (mg/100 ml) (Pfennig and Lippert, 1966)

50 mg EDTA

20 mg FeSO¿.7HzO

0.3 mg MnC12.4H20

1.0 mg ZnSO+.7HzO

3.0 mg H¡BO¿

2.0 mg CoClz.6HzO

0.1 mg CuCl2.2H2O

0.2 mg NiClz.6HzO

0.3 mg NaMoO+.2HzO

2.1.4.2.2 Medium A (g/l)

O.25 g KHzPO¿ 0.25 g KzHPO¿ 20 ml trace metals solution 82mg sodium acetate lmg resazurin

0.5 g Yeast extract 1.0 g CaCL2.ZH2O 5.68 g ammonium oxalate 4.0 g Na2CO3 0.33 g cYsteine.HCl.HzO 0.33 g Na2S.9H2O 22 e agar (Oxoid)

Ingredients other than the last four were mixed and pH was adjusted to 6.8. The mixture

was boiled under an atmosphere of CO2 and after it had cooled, sodium carbonate, 36 cysteine, sodium sulfide and agar were added. The medium was sterilised by autoclaving, allowed to cool to approximately 60" C and poured into 15 cm disposable petri dishes.

When the agar had set, the petri dishes were placed in an anaerobic chamber ovemight to equilibraæ with the CO2 afnosphere.

2.1.4.2.3 Medium B (g/l)

0.25 g KzHPO¿ 0.25 g KH2POa 0.5 g (NH¿)zSO¿

25 mg MgSO+.7HzO

20 ml trace metals solution 0.82 g sodium acetzlÊ

1 mg resazurin (Sigma) 1.0 g yeast extract (Oxoid)

10.0 g sodium oxalate 4.0 g NazCOg 0.5 g cysteine.HCl.HzO

The constituents of medium B other than the last two were dissolved in 1l of water in a 1l

bottle (Schott,'West Germany) and adjusted to the correct pH. The medium was then

brought to the boil and held at boiling temperature until the resazurin changed from red to

colourless. The flask was then transferred to an anaerobic chamber and allowed to cool'

Sodium carbonate and cysteine were added and the medium was dispensed into 15 ml

Hungate tubes. These were then sealed, removed from the chamber and autoclaved.

2.1.4.3 Luria-Bertani (LB) Broth (g/t) (Atlas, 1993)

10 g Tryptone (Oxoid)

5 g Yeast extract (Oxoid) 10 g NaCl

10 g of agar (Oxoid) was added for plates. 37

2.1.4.4 SOC Medium (g/l) (Hanahan' 1985)

2oe Tryptone (Oxoid)

5g Yeast extract (Oxoid)

0.6 g NaCl

0.199 KCI

2.5 g MgS04.7H2O

2-o e MgCl2 7ml Glucose (507o wt/vol)

2.2 Methods

2.2.1 Growth conditions

All growth and manipulation of recombinant organisms was carried out in a P2 laboratory. Liquid cultures of E. coli were grown in a shaking incubator at3l" C while plates were placed in incubators at 37" C. Liquid cultures of aerobic oxalate-degrading

bacteria were grown in a shaking incubator at room temperature while plates were

incubated on the bench at room temperature. Liquid cultures of O. formigenes werc

incubated at39" C without shaking while plates were incubated inside the anaerobic hood

at 39" C.

2.2.2 Ilsolation of oxalate-degrading soil bacteria

Oxalate-degrading soil bacteria were isolated by suspending 0.1 g soil in 100 ml sterile

distilled water. From the suspension, 100 pl was spread on an agar medium containing a

calcium oxalate precipitate (2.I.5.I.2). Colonies which could utilise oxalate, as indicated

by the formation of a clear halo around the colony, were streaked and restreaked on fresh

plates of the same medium until pure, then maintained on that medium. 38

2.2.3 Characterisation of soil isolates

The diversity of oxalate-degrading soil isolates was determined by restriction fragment length polymorphism (RFLP) and sequencing of the 165 subunit of ribosomal RNA-

Isolates with different RFLPs were characterised by morphological characteristics as observed by phase-contrast microscopy and Gram stain. One isolate which formed haloes particularly rapidly was further characterised by substrate utilisation, fermentation products, and by use of the analytical profile index used by the Institute of Medical and

Veterinary Science (Adel aide, S ou th Australia).

2.2.3.1 Microscopy

Light microscopy was carried out using an Olympus BH-2 microscope (Olympus Optical

Co., Tokyo, Japan). For Phase-Contrast microscopy Olympus 40x and 100x positive

phase contrast objectives and a phase condenser were used.

2.2.3.2 Gram stain

Gram staining was performed using Hucker's modified procedure as described by Lanyi

(1e87).

Crystal Violet

)o crystal violet (Sigma)

10 ml 957o erhanol

90 ml Hzo

Oxalate Solution

I g of sodium oxalate in 100 ml dHzO 39

Lugol's Solution

0.1 g Iz 0.2 e KI 30 ml IJzO A few ml of distilled watef were added to the 12and the K[, mix, small amounts

of water were added gradually until the substances were dissolved, then the

volume was brought to 30 ml. The solution was stored in a glass-stoppered bottle

protected from light"

Carbol Fuchsin Solution

1 g basic fuchsin (George T Gurr Ltd., London)

10 ml 95Vo ethanol

90 ml 5Vo aqueous Phenol solution

The constituents were mixed and filtered through paper.

Dilute Carbol Fuchsin Solution

1ml carbol fuchsin 9ml Hzo

Safranin Solution

0.25g safraninO(Sigma)

10 ml 95Vo elhanol

90 ml dHzO

Cultures were suspended in small drops of water placed on a slide and smears were

prepared. The bacteria were fixed to the slide by passing it rapidly through a flame three

times. The bacteria were stained for 1 minute with a mixture of 1 volume of crystal violet

and,4 volumes of a lflo oxalate solution. The slide was washed with water, then Lugol's

solution was applied for I minute. The slide was again washed with water and blotted 40 dry. The bacteria were decolourised by allowin g957o ethanol to drip onto one end of the inclined slide so as to flow evenly over the smears until the solvent flowed colourlessly from the slide. The slide was washed with water, then stained with dilute carbol fuchsin solution for not more than 20 seconds. Alternatively, the slide could be stained with safranin solution for 2-3 minutes. The slide was washed with water, excess water was blotted off and the slide was dried and examined under the microscope.

2.2.3.3 Carbon source utilisation

Carbon source utilisation was determined by the amount of growth of an isolate on basal

liquid medium in the presence and absence of the particular substrate. Cells were grown

for approximately 36 hours in oxalate-containing liquid medium (2.1.5.1.1), harvested

by centrifugation, washed with liquid medium (2.1.5.1.1) minus any carbon source and

resuspended in the same medium" Liquid media (2.1.5.1.1) with oxalate replaced by a

range of carbon sources was inoculated with 1 pl of the cell suspension and incubated at

room temperature in a shaking incubator for 5 days and 7 days. The amount of growth

was determined by diluting the cells 1:103 and 1:106 in tiquid medium (2.L.5J.I) minus

any carbon source, spreading 100 pl of the dilution on agar medium containing a calcium

oxalate precipitaæ (2.1.5-I.2) and counting the number of colonies formed.

2.2.4.4 Volatile fatty acid analysis

The products from growth on oxalate were determined by gas/liquid chromatography.

Protein precipiønt (1 ml of a 100 ml solution containing 18.75 g metaphosphoric acid and

25 mlformic acid) and I ml of internal standard (I07o n-hexanoic acid) were added to 5

ml of culture supernatant and mixed. After centrifugation to remove protein, 2 pl of the

supernatant was injected into a Hitachi gas liquid chromatograph for VFA analysis under

the following conditions (Table 2.4): 4T

Table 2.4. VFA Anal sis Conditions. Column description: Test conditions: Code:25QC2lfnAl Carrier H2 flow: 6lblirl2

Part No.: 052208 Sample size:2 ¡tI

Serial No.: 35057 Column temperature: 145' C

Iængth: 25 cm Injection temperature : 240" C

Type: liquid phase Detector temperature: 280" C

Material: fused silica Gas velocity : 42.3 cm/second

Film thickness: FFAP

2.2.4 Phenol/chloroform extractions (Ausubel et al., 1994)

Redistitted phenol was melted at 68'C. The phenol was equilibrated with an equal volume of 1.0 M Tris.HCl (pH 8) overnight with stirring. The upper aqueous phase was

removed and an equal volume of 0.1 M Tris.HCl (pH S) was added and equilibrated until

the pH of the aqueous phase was approximately 7.6. The eqilibrated phenol was stored

under the 0.1 M Tris.HCl buffer at4"C.

PhenoVchloroform extractions were carried out by adding an equal volume of buffer-

saturated phenol to the solution to be extracted, mixing gently by inversion and

centrifuging to separate the two layers. Small volumes were centrifuged in Eppendorf

tubes for 5 min at low speed in a benchtop microfuge while larger volumes (>1 ml) were

centifuged in Corex tubes in a BeckmanL 20 centifuge at 3,000 x g for 5 min. After

centrifugation, the upper aqueous phase was removed to a fresh tube and re-extracted

with an equal volume of chloroform. The aqueous phase was removed to a fresh tube for

ethanol precipitation.

2.2.5 F;tlr'anol precipitations (Maniatis et al., 1982)

DNA in solution was precipitated by the addition of a one tenth volume of 3 M sodium

acetate and 2 volumes of ethanol. The mixture was cooled to -20oC for t hr. The 42 precipirated DNA was recovered by centrifugation at 4"C for 10 min at high speed in a benchtop microcentrifuge or at 15,000 x g in a Beckman L 20 centrifuge. The supematant was poured off and the DNA pellet was washed with 807o ethanol. After centrifugation, the supernatant was poured off and the pellet was dried in a vacuum drier, then dissolved in distilled water

2.2.6 Chromosomat DNA preparation (Mani atis et al., 1982)

TEG (e/100 ml)

0.90 g glucose 0.37 g EDTA 0.30 g Tris.base (Trizma, Sigma)

The pH was adjusted to 8.0 using lN HCI

Cells were grown overnight in a 100 ml culture and harvested by centrifugation at 5000

rpm for 5 minutes. The pellet was washed with 20 ml TEG buffer, then centrifuged at

5000 rpm for 5 minutes. The cells were suspended in 9 ml TEG with 2 mglml freshly

added lysozyme, then incubated for 90 minutes at 37" C. Protease K (0'3 mg) and 1 ml

107o SDS were added and the cells were incubated at37" C for a further hour. An equal

volume of phenol was added and the mixture was gently shaken. The mixture was

centrifuged at 5000 rpm for 5 minutes and the aqueous phase was transferred to a fresh

tube. The aqueous phase was re-extracted with an equal volume of chloroform and

centrifuged at 5000 rpm for 5 minutes. The DNA was then ethanol precipitated.

2.2.7 Plasmid DNA minipreparations (Maniatis et ø1., 1982)

Plasmid DNA was extracted from E. coli following a modified method of Maniatis et al-

(1982). 1 ml of an overnight E. coli culture was centrifuged in an Eppendorf tube for 5

minutes at low speed in a benchtop microcentrifuge and the supernatant removed. The

bacterial pellet was resuspended in 100 pl of ice cold TEG to which 2m{ml of lysozyme

was added. The suspension was left on ice for 30 minutes after which 200 pl of a 0.2 M 43

NaOFVlTo SDS solution was added and mixed quickly by rapid inversion of the tube several times. The tube was placed on ice for 5 minutes and then 150 pl of an ice cold solution of 3 M potassium acetate (pH a.8) was added and mixed quickly by rapid inversion of the tube. After incubation on ice for a further t hour the mixture was centrifuged at low speed for 5 minutes in a benchtop microcentrifuge at 4"C- The supernatant was transferred to a fresh tube and the DNA was precipitated by the addition of 500 pl of isopropanol and incubation at room temperature for 30 minutes- The precipitaæd DNA was collected by centrifugation at high speed in a microcentrifuge for 5 minutes at room temperature. The supernatant was poured off and the pellet was redissolved in 100 pl of water and ethanol precipitated. The precipitate was recovered by centrifugation at high speed in a microcentrifuge at room temperature, washed in 80Vo ethanol, dried and redissolved in 20 pl of distilled water.

2.2.8 Restriction digests (Maniatis et al., 1982)

Restriction endonuclease (Promega or Boehringer Mannheim) digests were carried out

using the buffers supplied by the manufacturer. Digests were carried out in 1-5 ml

Eppendorf microcentrifuge tubes and usually contained 0.5 to 1.0 pg of DNA dissolved

in 8 pl of distilled water, mixed with 1 pl of the supplied 10x buffer and 1 pl (1-10 units)

of restriction endonuclease. The contents of the tube were mixed by stirring with the

pipette tip as the enzyme was added. The digests were incubated at the recommended

temperature for the enzyme (usually 37" C) for t hour or overnight. Gel loading buffer (1

pt) was added directly to digests for agarose gel electrophoresis. Digests used for other

purposes were ethanol precipitated.

2.2.9 Ligations (Maniatis et al., 1982)

The compatible DNA fragments to be ligated were mixed in a molar ratio of 1:3,

vector:insert to give a final volume of 8 pl. One pl of 10x ligation buffer supplied by the

manufacturer and 1 pl of T4 DNA ligase (Boehringer Mannheim) were added, mixed and 44 incubated overnight at room temperature. The ligated DNA was ethanol precipitated and dissolved in distilled water for electroporation.

2.2.10 Competent cells (Ausubel et al., 1994)

Competent cells of E. coli and P. oxalaticus for transformation by electroporation were grown in a 500 ml culture to mid log. The cells were harvested by centrifugation at 5000 rpm for 5 minutes and washed with 50 ml sterile distilled HzO. The cells were centrifuged at 5000 rpm for 5 minutes and washed with 25 ml sterile distilled H2O. The cells were again centrifuged at 5000 rpm for 5 minutes and washed with l0 ml lÙVo sterile glycerol. The cells were centrifuged a final time at 5000 rpm for 5 minutes and suspended in 1.6 ml særile I\Vo glycerol. Aliquots of 80 pl were transferred to eppendorf tubes and stored at -80" C

2.2.11 Electroporation (Ausubel et al., 1994)

To transform competent cells, 80 pl aliquots were mixed with 3 pl of the transforming DNA in a prechilled 0.2 cm electroporation cuvette. The DNA solutions used for

electroporations contained 0.1 to 0.5 pg of DNA dissolved in distilled water. The cuvette

containing the celVDNA suspension was placed in a BioRad Gene Pulser apparatus f,rtted

with a Pulse Controller device. The cuvette was pulsed at 2.5 kV using a 25 ¡t"F

capacitance setting and a pulse controller setting of 400 Q. After the pulse, the cuvette

was removed from the apparatus and the celVDNA suspension was immediately diluted in

1 ml of SOC medium. The diluted suspension was incubated at 31" C with shaking for 1

hour. Aliquots were then plated onto a selective medium-

2.2.12 Selection for transformants

Transformed bacterial cells were plated onto a selective medium containing the

appropriate antibiotic. When using pUC19 as the cloning vector, recombinant clones

were detected by insertional inactivation of B-galactosidase (Yanisch-Perroî et aI-,1985)- Twenty pglml of the chromogenic indicator, 5-bromo-4-chloro-3-indolyl-P-D- 45 galacropyranoside (X-gal) (Promega) and 20 pglml of isopropylthiogalactoside (IPTG)

(promega) as an inducer of the lacZ gene were added to the plates. Recombinant clones appeared as whiæ colonies while non-recombinant transformants were blue.

2.2.13 Agarose gel electrophoresis (Maniatis et ø1., 1982)

TAE buffer (50x) (g/l)

242 g Tris base (Trizma, Sigma)

57.1 ml Glacial acetic acid

100 ml EDTA (0.5 M, pH 8.0)

Gel loading buffer (6x) (g/10 ml)

0.025 g Bromophenol blue (Ajax Chemicals)

0.025 g Xylene cyanol (Sigma) 3ml Glycerol

Agarose gels (lVo) were prepared by melting 1 g agarose in 100 ml of lx TAE buffer.

The solution was allowed to cool to approximately 60" C and carefully poured into the

appropriate sized gel tray. A comb was placed in position and the gel was allowed to

solidify. The comb was removed and the gel was submerged in lx TAE buffer in a gel gel electrophoresis tank (BioRad). DNA samples were mixed with one sixth volume of

loading buffer and loaded into the wells using aP20 micropipette (Gilson, France). The

gel was run at 9 V/cm and the progress of the electrophoesis was monitored by the

migration of the indicator dyes, bromophenol blue and xylene cyanol' The gels were

usually run until the bromophenol blue was approximately 5 mm from the end of the gel.

The gel was removed from the electrophoresis tank and stained in a 0.5 pglml solution of

ethidium bromide (Sigma), destained in distilted water and examined on a UV- transilluminator. Ethidium bromide-stained gels were photographed under UV

illumination using a Polaroid Land Camera or saved as a digital image on a PC using the

Bio-Rad Gel Doc 1000 gel imaging system and Molecular Analyst. 46

2.2.14 Conjugation (Maniatis ¿f øX., 1982)

Conjugation between E. coli strain 517-1 containing the conjugative plasmid pHCS23CATmob:Tn1732 and P. oxalaticus were carried out on agar plates'

Approximaæly 108 mid log cells of the donor and recipient were mixed on a non-selective

LB plate and incubated at 37" C overnight. The cells were scraped from the plate, resuspended in I ml of L Broth, serially diluted and plated onto an agar medium containing a calcium oxalate precipitate (2.I.5.1.2), kanamycin and chloramphenicol-

Plates were incubated overnight at room temperature. A single halo-forming colony was used ro inoculate 10 ml of liquid medium (2.1.5.1.1) containing 50 pglml kanamycin and incubated overnight at room temperature with shaking. The culture was diluted 1:106 and plated onto an agar medium containing a calcium oxalate preciptate (2.1-5.I-2) and 50

pdml kanamycin and incubated at room temperature until haloes were obvious around

colonies

2.2,15 Southern transfer (Southern, 1975)

20x SSC

3M NaCl

0.3 M sodium citrate

DNA fragments were transferred from agarose to nylon membrane using the Southern

method as described by Maniatis et al. (1932). The gel was soaked for 10 minutes in 0.25

M HCl to partially hydrolyse the DNA. The gel was rinsed in H2O to remove the acid and

soaked twice in 0.5 M NaOH, 1 M NaCl for 7 minutes to denature the DNA. After

rinsing the gel in H2O, the gel was neutralised by soaking twice in 0.5 M Tris-HCl

(pH7.4), 3 M NaCt for 15 minutes. The transfer was set up by soaking a piece of paper

towelling in 20x SSC and wrapping it around an appropriate-sized gel mould. The gel

was laid on the paper towelling, making sure there were no air bubbles. The gel was

surrounded with plastic. A Hybondru-N+ membrane, cut to the same size as the gel, was 47

rinsed in HZO and carefully laid on the gel, making sure there were no air bubbles. A

stack of paper towels approximatety 10 cm high was placed on the membrane and a

weight was placed on the stack. The transfer was allowed to take place overnight, then

dismantled and the membrane was dried. The membrane was exposed to Ultra-violet light

for 6 minutes. The membrane and some mesh were pre-wet in a suitable tray containing

30 ml 2x SSC. Both were rolled up into a tight roll. The roll was transferred to a

hybridisation bottle and 30 ml2x SSC was added. The membrane and mesh were slowly

unwound inside the bottle by gently rocking and rolling the bottle. If bubbles were

present the membranes were removed and re-rolled. The membrane was then ready for

prehybridisation"

2.2.16 Prehybridisation

Prehybridisation Solution

0.1 g skim milk powder (Diploma)

T tf 'lJ 6.9 ml Hzo

2.5 ml 20x SSC

0.5 ml 107o SDS

0.1 ml 10 mg/ml salmon sperm DNA (Sigma)

Salmon Sperm DNA

Salmon sperm DNA was weighed out and dissolved in TE buffer to give a final

concentration of 10 mg/ml. It was sonicated for 15 minutes, then boiled for 15 minutes- It

was stored at -20" C.

TE Buffer

10 mM Tris.HCl (pH 7.5) tI

; 1mM EDTA

! 48

The 2x SSC used to unroll the mesh and membrane was discarded and replaced with 10 ml prehybridisation fluid. The cap was replaced and the bottle was placed in the \ hybridisation oven. The rotisserie was balanced by another bottle. The bottles were

placed in the rotisserie such that the bottles rotated in the rotisserie in the same direction as

the membranes were unrolled. The bottle was incubated for t hour at 65" C'

2.2.17 Oligolabelling

DNA was labelled using the MegaprimerM DNA labetling system RPN 1607. DNA (25-

100 ng) was placed in an eppendorf tube in a volume of 32 pl. Primer solution (5 pl) was

added and the DNA was denatured by boiling for 5 minutes. The mixture was chilled on

ice for 5 minutes, then centrifuged briefly. Keeping the tube at room temperature, 10 pl

of MegaprimerM reaction buffer, 1 pl of cr32pdctp and2 pl of the 'Klenow' fragment

of DNA polymerase I were added. The tube was incubated at 37" C for 30 minutes- The

reaction was stopped and the probe was denatured by boiling for 5 minutes, then placed

on ice for 5 minutes. The probe was then ready for hybridisation. r14

2.2.18 Hybridisation

Hybridisation Solution

o-1 g skim milk powder (Diploma)

6.5 ml Hzo

2.5 ml 20x SSC

1.0 ml 30% PEG 6000

The hybridisation bottle was removed from the hybridisation oven, the cap was removed

and the prehybridisation solution was poured off. The hybridisation solution was poured

into the bottle and the probe was carefully added to the hybridisation solution, being

I careful to avoid injecting the probe directly onto the membrane. The cap was replaced and

the bottle gently agitated to ensure an even distribution of the probe in the hybridisation

! 49

hybridise solution. The bottle was placed back in the hybridisation oven and left to

overnight at 65' C.

2.2.19 Washing

a container The membrane was removed from the hybridisation bottle and submerged in placed a water of wash solution (0.5x SSC, 0.1% SDS) at 42" C. The container was in piece paper bath at 42" C and left for one hour. The membrane was removed to a of placed in towelling to remove excess liquid, then wrapped in plastic. The membrane was and the an autoradiograph cassette, X-ray film was placed on top of the membrane the X-ray cassette was placed in the -80" C freezer. After an appropriate exposure time,

film was developed.

2.2.19 Stripping the membrane

minutes' Used membranes were stripped for reprobing by boiling in O.IVo SSC for 15

the membranes were then prehybridised and hybridised as normal.

2.2.20 Nested deletions

Nested deletions were performed using a kit and protocol supplied by Promega' DNA generating cloned in pUC19 was mapped to determine the appropriate endonuclease for

Exonuclease Ill-resistant 3' overhanging ends and exonuclease Ill-sensitive blunt or 5' reaction was overhanging ends. Approximately 25 to 50 pg of plasmid DNA in a 100 pl

digested with 50 U of the appropriate endonuclease at 37" C. When digestion was 120 pl were added and complete, 12 ¡t"l10x buffer, 50 U Søl I (10 U/pl) and HzO to pellet dried incubate at37" C a further 3 hours. The cut DNA was ethanol precipitated, the

and dissolved in 54 plH2O. Six pl Exo III 10x buffer was added to the tube. Meanwhile, were left 7.5 pl of S1 nuclease mix was added to each of 24 microcentrifuge tubes which at on ice. The DNA tube was warmed to 37"C in a heating block. Digestion proceeded I reaction about 450 bases/minute at 3:." C. There was a 20-30 second lag before the possible. samples began. Two pl Exo III Ggl.2 U/pl) was added, mixing as rapidly as

I 50

(2.5 pl) were removed at 30 second intervals into the S1 tubes on ice, pipetting up and down briefly to mix. After all the samples had been taken, the tubes were moved to room temperature for 30 minutes. Sl stop buffer (1 pl) was added and the tubes were heated at

70" C for 10 minutes to inactivate the 51 nuclease. To determine the extent of digestion, 2 pl samples were removed from each time point digest for analysis on a l7o a$arose !eI-

The samples from each time point digest were transferred to 37" C and 1 pl of Klenow mix was added to each sample. The samples were incubated for t hour at 37" C. The samples were transferred to room temperature and 40 pl of ligase mix was added to each sample. The samples were mixed well and incubated at room temperature for t hour.

Each sample was ethanol precipitated, the pellet dried and dissolved in H2O, ready for electroporation.

2.2.21 DNA sequencing

DNA fragments cloned in pUC19 were sequenced by the Nucleic Acid and Protein

Chemistry Unit, Department of Plant Science, The University of Adelaide, using the M13

universal primers from the Applied Biosystem DNA sequencing ready reaction (Perkin

Elmer) and an automated sequencer.

PCR products were sequenced directly using the primer 5'-GAA TTC GTC GAC .AGA'

GTT TGA TCC TGG CTC AG-3' (3.2 pmole), Terminator Ready Reaction Mix (8.0

pl), template (30-180 ng PCR product) and water to 20 pl. The reaction tubes were

placed in a DNA thermal cycler, held at 96" C for 30 seconds, held at 50" C for 15

seconds, then held at 60" C for 4 minutes. The tubes underwent this sequence of

conditions for 25 cycles then cooled to 4" C and held at that temperature. The products

were then ethanol precipitated and washed twice with707o ethanol. The pellet was dried

and sequencing was performed by the Nucleic Acid and Protein Chemistry Unit,

Department of Plant Science, The University of Adelaide, using an automated sequencer. 51

2.2.22 Dot blots (Ausubel et al., 1994')

A piece of positively charged nylon membrane was cut to the approximate size of the dot blot manifold. Distilted water was poured to a depth of approximatety 0'5 cm in a glass dish, the membrane placed on the surface and allowed to submerge. It was left for 10 minutes. A piece of Whatman 3MM filter paper was cut to the size of the manifold and wetted in distilled water. The Whatman 3MM paper was placed in the manifold and the membrane was laid on top of it. The manifold was assembled according to the rnanufacturer's instructions, ensuring that there were no air leaks in the assembly.

DNA samples were prepared so that each sample contained an equal amount of DNA and

1 M NaOH and 200 mM EDTA, pH 8.2, were added to each sample to give a final concentration of 0.4 M NaOÉV1Q mM EDTA. The samples were heated for 10 minutes in the a water bath or oven at 100' C then spun briefly in a microcentrifuge. The suction to manifold device was turned on, 500 pl of distilled water was applied to each well, and

allowed to filter through,leaving the suction on. The DNA samples were applied to the

wells and allowed to filter through. After applying the samples, each well was rinsed with

500 pl of 0.4 M NaOH and the manifold was dismantled. The membrane was rinsed

briefly in 2x SSC and air dried. The membrane was treated with prehybridisation solution

for t hour at 65' C and probed.

2.2.23 Polymerase chain reaction (Ausubel et al., 1994)

The MgCl2 concentration was optimised by preparing seven microcentrifuge tubes as

follows

Tube H2o (pl) 100mM MgCl2 (Pl) 1 9.0 0.0 2 7.5 1.5 3 6.0 3.0 4 4.5 4.5 5 3.0 6.0 6 1.5 7.5 7 0.0 9.0 52

100 Tubes 1-7 contained MgCl2 concentrations ranging from 0-9 mM in a final volume of pl when 90 pt of a Mg2+-free reaction cocktail and 1 ¡tl Taq DNA polymerase were added. The Mg2+-free reaction cocktail for 8 reactions was prepared by mixing the following:

(B ger 80 pl 1 0x Mg2+-¡t"e amplifrc ation buffer oehrin Mannheim)

80 pl 2 mM 4dNTP mix

8pl 50 pM oligonucleotide 1

8 ttl 50 pM oligonucleotide2 544 ¡tI l5pg/ml template DNA

The cocktail (90 pl) was added to the tubes containing MgCl2 and 1 pl of 2.5 Ul¡tl Taq

DNA polymerase was added to each tube. The reaction mixtures were overlaid with 100

pl mineral oil. The samples were heated for 1 minute at 94" C to denature the DNA, incubated for 2 minutes at 50" C to anneal the primers, and incubated for 2 minutes at72"

C for primer extension by the polymerase reaction. The steps of denaturation, annealing

and extension were repeated for another 39 cycles. Electrophoresis of a 10 pl sample

from each reaction tube in a l7o agarcse gel and staining with ethidium bromide was used

to determine which MgCl2 concentration resulted in the greatest amount of product, and

this was the concentration used in future reactions using the same DNA and primers.

2.2.24 Restriction Fragment Length Polymorphisms (Brunk et ø1., 1996)

Colonies were scraped from agar plates and suspended in 100 pl of sterile water and

boiled for 10 minutes after which 10 pl was used in a PCR reaction. The PCR primers and used were a forward bacterial primer 5'-GC (TC)TA ACA CAT GCA AGT CGA-3'

a universal reverse primer j'-CTG ATT ACC GCG GCT GC-3'. These primers were and designed by Brunk et aI. (1996) from data taken from the ribosomal database project each were are designed to hybridise with bacterial 165 ribosomal DNA and 100 pmol of ml used in each reaction. PCR reactions were carried out in a 20 pl volume in 0'5 PCR Eppendorf tubes. Magnesium chloride concentration was 3 mM, 2 ¡l of 10x buffer' 53

0.5 U of AmpliTøq DNA Polymerase and dNTPs to a concentration of 200 pM were added and the volume brought to 20 pl with sterile distilled water. The PCR was performed for 40 cycles. The resulting fragment was digested with the restriction endonucleases C/o I and Rs¿ I, separated in a I27o polyacrylamide gel, stained with ethidium bromide and vsiualised on a UV transilluminator-

2.2.25 Polyclonal antibody production

Phosphaæ-buffered saline ( 10x) (g/l)

80 g NaCl 29 KCI 11.5 g NazHPO¿ 2 g KH2POa

The reagents were dissolved in sequence in 800 ml distilled water, the pH was adjusted to

7.5 and the volume was increased to 1 l before autoclaving.

Blood was collected from two rabbits before raising antibodies and the serum was used

for controls. The two rabbits were injected at four subcutaneous sites in the rump with a

solution of 0.1 mI of Aspergillus sp. oxalate decarboxylase (Boehringer Mannheim), 0.4

ml of PBS and 0.5 ml of Freund's complete adjuvent (Sigma). Four weeks later, the

rabbits were again injected at four subcutaneous sites in the rump with a solution of 0.1

ml of oxalate decarboxylase, 0.4 ml PBS and 0.5 ml of Freund's incomplete adjuvent

(Sigma). Two weeks after the second set of injections, blood samples were again

collected. Blood samples were refrigerated overnight to allow a clot to form. The samples

were then centifuged at 3000 rpm and the serum was removed and stored at -2O" C until

required. 54

2.2.26 Enzyme-linked immunosorbent assay (ELISA) (Voller et al., 1980)

Carbonate Buffer (g/l)

1.59 g Na2CO3 2.93 g NaHCO3 0.2 e NaN3 The pH was adjusted to 9.8 and made up to 1 I with distilled water

PBS-Tween

0.5 ml of Tween 20 in 1 l of lx PBS

Antibody 1 dilution buffer (per 10 ml)

200 mg PVP

10 ml PBS-Tween

Antibody 2 dilution buffer (per 10 ml)

200 mg PVP 20 mg BSA

10 ml PBS-Tween

Alkaline phosphatase solution (per 10 ml)

10 mg 4-nitrophenyl phosphate (Sigma)

10 ml diethanolamine

The antigen was prepared at a concentration of I2.5 mg/ml in carbonate buffer and serial

dilutions of 6.25,3.125,1.56, 0.75, 0.325 and 0.163 mg/ml were prepared. The coating

anrigen (100 pl) was pipetted into each well of an 8 x 12-we11 ELISA plate in the

following manner: 55

Row Dilution (mg/ml) A r2.5 B 6.25 c 3.125 D 1.56 E 0.75 F 0.325 G 0.163 H nothing added

The plate was wrapped in Glad'WraprM and left in the refrigerator overnight. The liquid was tapped out of the plate and washed once quickly and twice for three minutes with

PBS-Tween. BSA (100 td of 10 mg/ml) in PBS was added to each well and the plate was incubated at room temperature for t hour to block any non-specific binding, The plate was tapped out and the wells were washed three times with PBS-Tween. Dilutions of polyclonal antibody were prepared in antibody 1 dilution buffer and 100 pl of the dilutions were added to the appropriaæ wells: 56

Column Dilution

1 1:2000

2 1:4000

3 1:8000

4 1:16000

5 1:32000

6 1:2000 (control)

7 1:2000

8 1:4000

9 1:8000

10 1:16000

11 1:32000

L2 1:2000 (conrol)

The plate was incubated ovemight in the refrigerator. The plate was washed twice quickly and once for 5 minutes with PBS-Tween and tapped out. Goat anti-rabbit IgG-alkaline phospharase conjugate (100 pl) (Sigma), diluted to 1:1000 in antibody 2 dilution buffer, was added to each well and incubated at room temperature Tor 2 hours. The wells were washed twice quickly and once for 5 minutes with PBS-Tween before adding 100 pl of fresh alkaline phosphatase solution. The plate was incubated at room temperature until the colour developed and the absorbance was measured at 405 nm on a Titretek Multiscan photometer. 57

2.2.27 \ilestern transfer

Transfer buffer (gil)

3.03 g Tris base Çnzma, Sigma) 14.4 g Glycine 200 ml Methanol 800 ml HzO

The pH was adjusted to 8.3 using lN HCl.

Rinse buffer (g/1)

I.I2 g Tris base (Trizma, Sigma) 8.67 g NaCl 0.32 g EDTA

The pH was adjustedto7.4 using lN HCl.

'Western substrate (m g/ml)

0.4 mg Naphthol ASMX phosphate (Sigma)

1 mg Fast Red (Sigma) 24.2 mg Tris base (Trizma, Sigma)

The pH was adjusted to 8.2 using lN HCl.

Protein preparations were separated by SDS-PAGE according to the method of Laemmli

(1970) on I27o polyacrylamide slab gels. Samples were run at 11.6 V/cm until the

bromophenol blue reached the resolving gel, then at 16.4Ylcm until the bromophenol

blue reached the bottom of the gel. Protein transfer to nitrocellulose membranes and

subsequent treatment of the nitrocellulose was performed according to the method of

Towbin et at. (1979). The gel was soaked in transfer buffer for 20 minutes. A sheet of

nitrocellulose and two sheets of Whatman 3MM filter paper were also briefly soaked in

transfer buffer. A scouring pad was submerged in transfer buffer and a sheet of 3MM 58 filter paper was placed on top of it, followed by the sheet of nitrocellulose, the gel, and another sheet of 3MM filter paper. A second scouring pad was placed on top and the assembly was sandwiched between two stiff plastic grids. The assembly was placed in an electrophoretic chamber (Bio-Rad Mini ProteanrM II) containing transfer buffer with the nitrocellulose sheet facing the anode. The transfer was carried out at 100 V for L hour at

4" C.

After electrophoretic transfer of the protein, the nitrocellulose membrane was incubaæd at room temperature for 3 hours in rinse buffer containing 37o skim milk powder (Diploma) to saturate the remaining protein binding sites (O'Connor and Ashman, 1982). The membrane was incubated with rabbit serum diluted 1:1000 in rinse bufferl}.l%o Triton

Xl00lI7o BSA overnight at room temperature. The membrane was washed three times,

for one hour each, in rinse búferl}.IVo Triton X100 with shaking, then incubated with

goar anri-rabbit lgG-alkaline phosphatase conjugate (Sigma) diluted 1:1000 in ELISA

buffer overnight at room temperature. The membrane was again washed three times, for

one hour each, in rinse bufferll%o Triton X100 with shaking. Staining of the membrane

was performed according to the method of Druguet and Pepys (1977), based on the

procedure of Stage and Avrameas (1976). Membranes were incubated in a freshly

prepared and filtered mixture of equal volumes of naphthol ASMX phosphate (Sigma,

0.4 mg/ml in distilled water) and Fast Red TR salt (Sigma, 6 mg/ml inO.2 M Tris'HCl,

pH S.2). After one hour at room temperature, the reaction was terminated by washing the

membrane in water. Reactive bands were identified by deposition of red stain.

2.2.28 RNA preparation (Ausubel et ø1., 1994)

Diethylpyrocarbonate (DEPC) treatment of solutions

DEPC (0.2 ml) (Sigma) was added to 100 ml of the solution to be treated. The mixture

was shaken vigorously to get the DEPC into solution. The solution was autoclaved to

inactivate the remaining DEPC. 59

Protoplasting Buffer

15 mM Tris.HCl, pH 8.0

0.45 M sucrose

8mM EDTA

Store at 4" C.

Gram-negative lysing buffer

10 mM Tris.HCl, pH 8.0

10 mM NaCl lmM sodium citraæ

1.57o (wüvol) SDS

The buffer was stored at room temperature

The cells were collected from a 10 ml gram-negative bacterial culture by centrifuging for

10 minures ar 10, 000 rpm (12, 000 g) at 4" C. The cells were resuspended in 10 ml proroplasting buffer. Lysozyme (80 ¡rt of 50 mg/ml) (Boehringer Mannheim) was added

and cells were incubated for 15 minutes on ice. The protoplasts were collected by

centrifuging for 5 minutes at 7000 rpm (5900 g) at 4" C. The protoplasts were

resuspended in 0.5 ml of gram-negative lysing buffer, 15 pl DEPC was added, mixed

gently and transferred to an Eppendorf tube. The protoplasts were incubated for 5

minutes ît 37" C and chilled on ice. Saturated NaCl (250 pl) was added and mixed by

inversion, forming a substantial precipitate. The tube was incubated for 10 minutes on

ice, then centrifuged in a microcentrifuge for 10 minutes at high speed at 4" C. The

supernatant was removed to two clean Eppendorf tubes, 1 ml of ice-cold 1007o ethanol

was added to each tube and precipitated overnight at -20" C. The precipitate was pelleted

by centrifugation for 15 minutes at high speed at 4" C. The pellet was rinsed in 500 pl

ice-cold 707o ethanol and dried. It was redissolved in 100 pl DEPC-treated water. Ten pl of the RNA solution was diluted in 1 ml of water and the AZOO and 4239 were

determined. The remaining RNA solution was stored at -70' C. 60

2.2.29 Northern transfer (Ausubel et ø1., 1994)

All solutions were prepared with særile deionised water that had been treated with DEPC"

10x MOPS running buffer

0.4 M MOPS (Sigma), pH 7.0 0.1 M sodium acetate

O.O1 M EDTA

The buffer was stored in the dark and discarded if it turned yellow"

RNA sample

11 pl RNA solution

5 pl 10x MOPS running buffer 9 til I2.3M formaldehyde 25 ¡tl formamide The sample was mixed by vortexing, spun briefly (5-10 seconds) in a

microcentrifuge to collect the liquid, and incubated for 15 minutes at 55" C.

Formaldehyde loading buffer

1mM EDTA, pH 8.0

0.25Vo (w/v) bromophenol blue (Ajax Chemicals)

0.25Vo (w/v) xylene cyanol (Sigma)

507o (vlv) gþerol

20x SSC (g/l)

175 g NaCl 88 g sodium citrate.2H2O

The pH was adjusted to 7.0 with 1 M HCl. 6I

Methylene blue

0.037o (wlv) methylene blue (George T. Gurr Ltd-, London)

0.3 M sodium acetate, pH 5.2

Agarose (1.0 g) (FMC BioProducts) was dissolved n72 ml water and cooled to 60" C in a water bath. When the flask had cooled, it was placed in a fume hood and 10 ml of 10x

MOPS running buffer and 18 ml of I2.3M formaldehyde were added. The molten agarose was poured into a gel tray, the comb was put in place and the agarose was allowed to set. The comb was removed, the gel was placed in the gel tank, and sufficient

lx MOPS running buffer was added to cover the gel to a depth of approximately 1 mm.

The sample was prepared by adding 10 pl of formaldehyde loading buffer, vortexing,

spinning to collect the liquid, and loading the sample onto the gel. RNA (0.5 to 10 ttg)

was loaded per lane. Duplicate samples were loaded on one side of the gel for ethidium

bromide staining. the gel was run at 5 V/cm until the bromophenol blue dye had migrated

one-half to two-thirds the length of the gel. The gel was removed and the lanes that were

to be stained with ethidium bromide were cut off and stained for 10 minutes. The gel was

examined on a UV transilluminator, to visualise the RNA, and photographed with a ruler

laid alongside the gel so that the band positions could later be identified on the membrane.

The unstained portion of gel was placed in an RNase-free glass dish and rinsed with

several changes of sufficient deionised water to cover the gel. A sheet of paper towelling

was soaked in 20x SSC, wrapped around a gel tray and placed upside-down in a glass

dish filled with 20x SSC to half the depth of the gel tray. The gel was placed on the gel

tray and a sheet of HybondrM N+ nylon membrane was cut to the same size as the go1.

Distilled water was poured into an RNase-free glass dish to a depth of approximately 0.5

cm and the membrane was wetted by placing it on the surface of the water. The

membrane was allowed to submerge and left for 5 minutes. The wetted membrane was

carefully placed on the surface of the gel to avoid getting air bubbles under it. Paper

towels were cut to the same size as the membrane and stacked on top to a height of 62 approximafely 4 cm. A weight was placed on top and the structure was left overnight to transfer. The membrane was rinsed in 2x SSC, then place it on a sheet of Whatman 3MM paper and allowed to dry. The dry membrane was placed RNA-side-down on a UV transilluminator and irradiated for 6 minutes. The transfer efficiency was checked by staining the membrane in methylene blue for 45 sec and destaining in water for 2 min.

Prehybridisation and hybridisation was performed as for Southern blots.

2.2.30 Polyacrylamide gel electrophoresis

2.2.30.1 Denaturing (protein) (Laemmli, 1970)

Resolving Gel (I27o)

3.45 ml FIzO 2.5 ml 1.5 M Tris.HCl (PH 8.8) 4 ml 30Vo acrylamide/ 17o N,N'-methylene-bis-acrylamide (Sigma) 0.1 ml l07o SDS

The solution was de-gassed for 1 minuæ.

50 pl fresh lÙVo APS (Sigma)

5 pl TEMED (Sigma)

Stacking Gel (47o)

6.2 ml HzO 2.5 ml 0.5 M Tris.HCl (pH 6.8) 1.3 ml 30Vo acryIamide/ 1% N,N'-methylene-bis-acrylamide (Sigma) 0.1mI 107o SDS

The solution was de-gassed for 1 minute.

50 pl fresh 107o APS (Sigma)

10 pl TEMED (Sigma) 63

Loading Buffer (5x)

6.0 ml Hzo

1.0 ml 0.5 M Tris.HCl (pH 6.8)

0.8 ml gþerol

0.2 ml 0.057o bromophenol blue (Ajax Chemicals)

1.6 ml 10% sDs

0.4 ml p-mercaptoethanol

Gel Running Buffer (1(}x)

1l Hzo

30.3 g Tris

144 g glycine

1og SDS

pH to 8.3

Coomassie Stain (per litre)

2 g Coomassie Brilliant Blue R250 (Sigma) 500 ml 95%oBthanol

100 ml Glacial acetic acid 400 ml HzO

The solution was stirred for 30-40 minutes, filtered through Whatman No. 1 filter

paper and stored at room temperature.

Coomassie destain (mV100 ml)

25 ml 95VoEthanol

10 ml Glacial acetic acid

65 ml H2o 64

BioRad mini-gel glass plates were prepared for pouring the resolving gel. The resolving gel solution was prepared and poured into the gel mould to approxim ately 20 mm from the top, making suro there were no leaks. The resolving gel was overlaid with HZO and allow to set. When the gel had set, the water was poured off and any excess water was blotted off. The stacking gel solution was prepared and poured into the mould, the comb was inserted and the gel was allowed to set. The gel was placed in the gel running apparatus and the internal tank was filled with gel running buffer until the wells were covered. The apparatus was checked for leaks, then the outer tank was filled until the bottom of the gel was submerged. The samples were prepared by boiling for 5 minutes with the appropriate amount of 5x loading buffer and the gel was loaded. The gel was run at 11.6 V/cm until the bromophenol blue reached the resolving gel. The gel was then run at 16.4Vlcm until the bromophenol blue reached the bottom of the resolving gel. The gel was removed from the glass plates, stained with Coomassie Blue, destained and dried in a gel drier.

2.2.30.2 Non-denaturing (protein)

The method for non-denaturing polyacrylamide gels was the same as for denaturing gels

except that the solutions contained no SDS or p-mercaptoethanol and the samples were

not boiled before loading.

2.2.30.3 Denaturing (DNA) (Ausubel et al., 1994)

10x TBE buffer (pH 8.0)

1089 Tris Base (|izma, Sigma) 55g Boric Acid

40 mt 0.5 M EDTA, PH 8.0

Distilled H2O was added to 1 1. 65

2x Formamide loading buffer

l ml 10x TBE buffer

9 ml Deionised Formamide

50 mg Bromophenol Blue (Ajax Chemicals)

The gel casting apparatus was assembled and the gel solution for a l27o polyacrylamide gel was prepared by mixing the following in a side-arm vacuum flask:

42 p urea

1 ml 10x TBE 3ml40voacryl'atrtidet2Zobisacrylamidesolution(Sigma)

Waær to 10 ml

The mixture was degassed under vacuum for 10 minutes before adding 50 pl of l07o

ammonium persulphate (Sigma) and 5 pl TEMED (Sigma). The solution was $ently

mixed, poured into the previously assembled plates and a comb was inserted' The gel

was allowed to polymerise at room temperature. After polymerisation of the gel was

complete, the comb was removed and the plates were attached to the gel electrophoresis

tank. Both the top and bottom troughs were filled with lx TBE buffer and the gel was

prerun for at least an hour. DNA samples were diluted two-fold with 2x formamide

loading buffer and heated to 90" C for 3 minutes prior to loading. The wells were

thoroughly rinsed by pipetting TBE buffer up and down several times immediately prior

to loading. The sample was loaded and the gel was run at approximately 20-40 V/cm

(constant voltage) until the bromophenol blue reached the bottom of the gel. When the gel

had finished running, the glass plates were removed from the tank and laid horizontally.

The top plate was pried off and the gel was gently peeled off into a staining box. The gel

was stained with ethidium bromide and visualised under LIV light. 66

2.2.31 Synthesis of Oxalyl-CoA

Thiocresyl hydrogen oxalate was synthesised by adapting the methods of Stolle (1914).

A solution of oxalyl chloride (15 g, 118 mmoles) (Sigma) was added dropwise over half an hour to a stirred solution of boiling thiocresol (10 g, 80 mmoles) (Sigma) in 150 ml of ether. After 1.5 hours, the reaction mixture was allowed to cool to room temperature.

Thin layer chromatography (1:1 diethyl ether:light petroleum) (Quayle, 1962) showed a difference between the starting material and the product formed. The reaction mixture was rotoevaporated to give a yellow oil with no thiol smell. Water (3 ml) was added to the stirred oil and it was cooled on ice. After 2 hours, yellow crystals of thiocresyl hydrogen oxalate formed. This was recrystalised in petroleum ether, forming 5 g of yellow crystals with a melting point of 100" C, as reported by Stolle (1914). Thiocresyl hydrogen oxalate

(5 mg) was dissolve in 4 ml ether and added to a solution of 10 mg CoA in 4 ml0-5 M NaHCO¡, pH 7.5. The mixture was shaken vigorously for 15 minutes at room temperature. The ether layer was removed and the aqueous layer was adjusted to pH 4.6 with dropwise addition of l\Vo HCl. The aqueous layer was washed four times with 4 ml portions of ether, tested for free coenzyme A (Stadtrnan,1957), then stored at -70" C.

2.2.32 Free thiol test (Stadtman, 1957)

Nitroprusside Reagent

Sodium nitroprusside (1.5 g) (Sigma) was dissolved in 5.0 ml of 2 N HzSO¿ and 95 ml

of absolute methanol and 10 ml of a concentrated NHaOH solution (28Vo ÑH+OH) was

added. The copious white precipitate was filtered off and the clear orange filtrate was

kept. This reagent was stable for weeks if kept stored at 0" C-

Methanolic Sodium Hydroxide

NaOH (2.0 g) was dissolved in 5.0 ml of HZO and 95 ml of absolute methanol was

added. 67

A drop of the test solution was placed on a naffow strip of Whatman No. 3 filter paper

and the paper was dipped into the nitroprusside reagent. The immediate appearance of a ,:|

red spot indicated the presence of free thiol groups. The very faint colours produced with

very small quantities of free thiol groups were made readily detectable by shaking the filter paper strip in analytical grade ethyl ether. If the above test was negative, the

presence of thiol esters could be demonstrated by following the nitroprusside dip with a

dip in the methanolic sodium hydroxide solution. Under these conditions, the thiol esters

were hydrolysed and liberation of a free thiol group produced a red colour as above.

2.2.33 Enzyme assays

2.2.33.1. Oxatyl-CoA decarboxylase (8. C. 4.1.1.2) (Baetz and Allison' 1989)

Oxalyl-CoA decarboxylase activity in cell-free extracts was determined by mixing the

following reagents in a quartz cuvette with a 1 cm path length and measuring the optical

ü density at340 nm for 10 minutes:

100 pl 0.5 M Sodium Phosphate buffer, pH 6.7

5 trl 10 mM Thiamine pyrophosphate (Sigma)

70 pI 100 mM MgClz

80 pl 100 mM Sodium oxalate

35 pt 2.6 mM Oxalyl-CoA

10 pl 100mM NAD (Sigma)

100 pl Cell free extract

600 pl IJzo

The amount of oxalyl-CoA degraded to produce formate was calculated from a standard

curve generated by incubating 0 to 0.5 pmoles of formate with formate dehydrogenase

and NAD+ to completion. The specific activity for oxalyl-CoA decarboxylase was

determined as a function of the pmoles of NADH produced per minute per mg of protein

as determined using the Bradford method. t 68

2.2.33'2 Formate dehydrogenase (E' c' l'2'2'l) (Johnson et al'' 1964)

Formate Dehydrogenase activity in cell-free extracts was determined by mixing the

following reagents in a quartz cuvette with a I cm path length and measuring the optical

density at340 nm for 10 minutes:

100 pl 0.5 M Sodium Phosphate buffer, pH 6.7

l0 pl 0.1 M NAD (Sigma)

50 pt 10mM Sodium formate

100 pl Cell Free Extract

740 ¡tl Ilzo

The amount of formate degraded was calculated from a standard curve generated by

incubating 0 to 0.5 pmoles of formate with formate dehydrogenase and NAD+ to

completion. The specific activity for formate dehydrogenase was determined as a function

of the pmoles of NADH produced per minute per mg of protein as determined using the 1

'',f Bradford method.

',1 2.2.33.3 Glyoxytate dehydrogenase (E. C. l.Z.l.c) (Quayte and Taylor' 1961)

Glyoxylate dehydrogenase activity in cell-free extracts was determined by mixing the

following reagents in a quartz cuvette with a 1 cm path length and measuring the optical

density at340 nm for 10 minutes:

27 ¡rmoles Sodium Pyrophosphate Buffer, pH 8.6

2.5 pmoles Cysteine

5 pmoles Sodium Glyoxylate

0.2 pmoles CoA (Sigma)

I 0.2 ¡rmoles NADP (Sigma)

100 ¡r1 Cell Free Extract

HzO to 1 ml

Ì 69

The amount of glyoxylate converted to oxalyl-CoA was calculated from a standard curve

generated by incubating 0 to 0.5 pmoles of glyoxylate with cell-free extract and NADP+

to completion. The specific activity for glyoxylate dehydrogenase was determined as a

function of the pmoles of NADPH produced per minute per mg of protein as determined

using the Bradford method.

2.2.34 Cotony lifts (Ausubel et ø1., 1994)

Bacterial colonies were grown on the appropriate agar medium. A piece of sterile

HybondrM N+ nylon membrane was placed on the plate, pushed down gently but firmly

with a sterile spreader, then removed. The membrane was placed on a piece of filter

paper, soaked in 0.5 M NaOH, for 5 minutes, transferred to another filter paper, soaked soaked in in 1 M Tris.HCl (pH 7.5), for 5 minutes, then transferred to a final filter paper,

0.5 M Tris.HCl (pH 7.5)/1.25 M NaCl, for a further 5 minutes. The membrane was dried and UV cross-linked by placing face-down on a UV transilluminator. The

membrane was then prehybridised and hybridised in the standard manner. [T

2.2.35 Cell-free extracts

Cultures grown for assays of enzyme activity in cell-free extracts were grown to mid-log

in 10 ml or 1 I volumes. Cells were harvested by centrifugation and resuspended in 1 ml

or 25 ml of 0.05 M phosphate buffer, pH 7.0, respectively. Cells in 1 ml volumes were

ruptured by sonication in an Eppendorf tube for 25 seconds at 36 Watts in an ice bath

using a small sonication probe. Cells in volumes of 25 ml were ruptured by sonication in

an aluminium container for 30 seconds at 75 Watts using a large sonication probe. Care

was taken not to allow the samples to become too warm or to froth as this greatly reduced

enzyme activity. The ruptured cells were centrifuged at high speed (1 ml) or 15,000 rpm

(25 ml) at 4" C and the supernatant was transferred to a fresh tube. Enzyme assays were t I performed on the same day as activity was rapidly lost during storage. ;

* 70

2.2.36 Protein estimation

The method of Bradfo rd (1976) was used to determine protein concentration.

A 0.5 mg/ml solution of Bovine Serum Albumin (BSA) (Sigma) was prepared. The solution concentration of BSA was determined using Azso = 6'6 for a 10 mg/ml

measured in a 1 cm path-length cuvette (ie., a 0.5 mg/ml solution will have an 4280 -

0.33).

Coomassie Brilliant Blue solution

(Sigma) was dissolved In a 1 l volumetric flask, 100 mg Coomassie Brilliant Blue G-250 volume in 50 ml of 95To ethanol. Phosphoric acid (100 ml of 857o) was added and the

was brought to 1 I with water. The solution was filtered through Whatman No- I filter

paper and stored ît 4" C.

Duplicate amounts of 0.5 mg/ml BSA (5, 10, 15 and 20 pl) were aliquoted into 8

microcentrifuge tubes and the volume in each was brought to 100 pl with 0-15 M NaCl'

Into Zmicrocentrifuge tubes, 100 pl of 0.15 M NaCI were aliquoted; these were blank vortexed. tubes. To each tube, 1 ml of Coomassie Brilliant Blue solution was added and

The tubes were allowed to stand for 2 minutes at room temperature. The 4595 of the

BSA standards was determined using a 1 cm path-length microcuvette (1 ml) and a

standard curve was made by plotting absorbance at 595 nm versus protein concentration.

The absorbance for the unknown solution was determined and the standard curve was

used to determine the concentration of protein in the unknown solution'

tI

;

t 7l

2.2.37 Paper chromatography n-ButanoVAcetic Acid (Woiwod, 19 49)

250 ml n-Butanol 250 ml HzO

Shake

Add 60 ml glacial aceúc acid.

The lower layer was withdrawn after separation. The butanol layer was stored in the presence of the aqueous layer in order to reduce esterification.

Ninhydrin (Consden et aL.,1944) (Sigma)

0.I7o ninhydrin was dissolved in water-saturated n-butanol

The method of Block (1952) was used. Drops of the sample to be analysed were placed at intervals of approximately 2 cm, approximately 2.5 cm from the bottom margin of the filter paper. The spots were allowed to dry. The filter paper was placed in the

chromatography chamber with the bottom end in the solvent. The chamber was covered

with a glass plate and left until the solvent front had almost reached the top of the filter

paper. The chromatograms were dried, sprayed with ninhydrin solution and the colour

was developed at room temperature for 24-36 hours (Dent, 1948; Roberts and Frankel,

19s0).

2.2.38 Cosmid Packaging

E. coli, strain DH1, rwas grown overnight in 10 ml of LB broth with 0.4Vo maltose- A

pipette tip, from a Boehringer packaging kit, containing sonic extract was placed in an

Eppendorf tube containing lysate and allowed to thaw slowly. During thawing, the DNA

then (0.1-0.5 Lrg in 3 ¡rl) was added. After thawing, the mixture was mixed carefully, incubated for t hour at room temperature. The DHl cells were centrifuged at 3000 rpm

for 5 minutes and the cell pellet was resuspended in 1 ml of 10 mM MgSO4 in LB + 72

0.4Vo maltose. The cells were incubated with shaking at 32" C for 45 minutes. The packaged DNA was mixed with the cells and incubated for t hour before plating onto LB agar containing the appropriate antibiotic. 73

Chapter 3

Isolation and characterisation of Oxalate-Degrading Bacteria

3.1 Introduction

Only a small number of microorganisms have been found which can grow on oxalate as a sole carbon and energy source. The reason for this is not clear but it may be explained by the low energy potential of oxalate and the insolubility of calcium oxalate.

Oxalate-degrading microorganisms have been isolated from both aerobic and anaerobic environments. Aerobic oxalate-degrading bacteria have been isolated from air, soil and chicken dung where one of their roles would appear to be to break down oxalate.

Many of these belong to the genus Pseudomanas and the others belong to closely related

genera. More recently, oxalate-degrading anaerobes have been isolated from the rumen

and from the large bowel of humans and other animals (Allison et al., 1985) and from

anoxic freshwater sediments (Smith et a1.,1985; Dehning and Schink, 1989). Unlike

their aerobic counterparts, the anaerobic bacteria appear to use only oxalate and acetate in

combination as growth substrates and it would appear that their sole purpose is to degrade

oxalate in these environments.

Oxalobacter formigenes is the only oxalate-degrading bacterium to date to be

isolated from the rumen and also from the large bowel of humans and other animals

where its actions in the destruction of oxalate are of considerable importance to the host

(Allison et a1.,1985). However, when sheep are adapted to grazing soursobs, there is

often persistent low-level absorption of oxalate, resulting in chronic oxalate poisoning

(Bull, 1929). To overcome this, a gene for an eîzyme involved in oxalate metabolism

could be used to transform a more common rumen microorganism. The enzymes in

bacteria responsible for the metabolism of oxalate have been most extensively studied in

Pseudomanas oxalaticas (Quayle and Keech, I959a,1959b, 1960; Quayle et al.,196I;

Quayle and Taylor, 196I; Quayle, I963a,1963b) which was isolated from the intestinal 74 tract of Indian earth worms (Khambata and Bhat, 1953). A similar, if not identical, system has more recently been studie d in Oxalobacter formigenes (Baetz and Allison,

1989; Anantharam et a1.,1989; Lung et aI.,I99I; Abe et a1.,1996: Sidhu et a1.,1997)'

The aim of this chapter is to examine the species diversity of oxalate-degrading bacteria isolated from a soil sample from Adelaide, South Australia, and identify which species are present. Having characterised the species isolated from the soil, they will be compared with Pseudomonas oxalaticus. Any species demonstrating a superior oxalate- degrading capacity would then be studied further to determine whether the genes responsible are suitable candidates for cloning.

3.2 Results

3.2.1 Isolation of oxalate-Degrading Bacteria from the soil

A sample of garden soil carrying a heavy infestation of soursobs rwas collected

from Adelaide. Soil samples were also collecæd from two other locations in the state (a

sheep farm at Lucindale and an orchard at Berri) for comparison. These did not carry

heavy infestations of plants containing high levels of oxalate. A small amount (0-l g) was

shaken in 100 ml of sterile distilled water and 100 pl was spread on agar Bhat and Barker

calcium oxalate medium in a 15 cm petri dish. Thirty four oxalate -degrading colonies

grew on the plate inoculated with the sample from Adelaide, 15 colonies from the

Lucindale sample used oxalate and 4 from colonies from the Berri sample used oxalate.

This equates to 3.4 x 105, 1.5 x 105 and 4 x 104 oxalate-degrading bacteria per gram of

soil from Adelaide, Lucindale and Berri respectively. Twelve of the colonies from the

Adelaide sample demonstrated a good oxalate-degrading capacity and were used for

comparison with P s eudomonas oxalaticus. 75

P. axalatic:tts Oxl)

Figure 3.1 Halo formation by OxD on agar Bhat and Barker medium. 76

3.2.2 Characterisation

3.2.2.1 Biochemical AnalYsis

One of the colonies isolated from the Adelaide garden soil produced large haloes when grown on agar Bhat and Barker oxalate medium (Fig. 3.1) and was referred to as

OxD. This was identified by the Institute of Medical and Veterinary Science (IMVS) using the Analytical Profile Index. The results of the tests performed are shown in Tab1e

3.1. It was found to closely resemble Pseudomonas diminuta which is a soil inhabitant'

Test Result

Gram Stain Gram-negative

Growth Strict aerobe

Oxidase Positive

Catalase Positive

Motility Positive

Haemolysis y on sheep blood agar

Indole Negative

Bile Growth Negative

Esculin Hydrolysis Negative

Nitraæ Negative

VFA'S None

Table 3.1 Characterisation of OxD by the IMVS

3.2.2.2 Genetic Analysis

3.2.2.2.1 Chromosomal DNA Homology

As a preliminary estimate of homology, DNA was extracted from a number of

oxalate-degrading soil isolates and dot blotted onto a nylon membrane according to the 77 merhod of Ausubel et aI. (1994) (Figure 3.2). Total P. oxalaticøs DNA was labelled with

a control and E- [32p]¿Cfp and used as a probe. P. oxalaticøs DNA was used as positive coli strai¡ S17 DNA was used as a negative control. P. oxalaticus DNA hybridised poorly to p. aeruginosa. The intensity of the first dot suggests less than257o homology when compared with the fourth dot of P. oxalaticr¿s. Homology with the soil isolates was also less than2íVo-

3.2.2.2.2 Chromosomal DNA Restriction Profrles

DNA was isolated from oxalate-degrading soil bacteria cultured from Adelaide garden soil and selected on the basis of differing colony morphology. The DNA was digested with the restriction endonucle ase Eco RI and the resulting fragments were separated by electrophoresis \n a l7o agarose gel. Figure 3.3 shows the resulting banding patterns. Oxla, Oxlb and Oxlc appeared to have the same banding pattern, OxB and

OxD appeared to have the same banding pattern, Ox3a and Ox5 appeared to have the same banding pattern and OxLl, OxL3 and OxL4 appeared to have the same banding pattern. Ox2b, Ox3b and OxL2 appeared to have unique banding patterns. None had a

banding pattern matching that of P. oxalaticus.

3.2.2.2.3 Restriction Fragment Length Polymorphisms (RFLP)

The genes for the 165 rRNA subunits of Oxla, Oxlb, Oxlc, OxB, Ox3a, Ox3b,

OxD, Ox5, OxLl,OxL2, OxL3 and OxL4 were amplified by PCR using a forward

bacterial primer 5'GC (TC)TA ACA CAT GCA AGT CGA3', which anneals at base 46,

and a universal reverse primer 5'CGT ATT ACC GCG GCT GC3', which anneals at

base 520, and the resulting fragments were digested with the restriction endonucleases (Figure RsaI and Cfo I. These fragments were separated in a I2Vo polyacrylamide gel

3.4). E- coli, P. aeruginosa and P. oxalaticus were used for comparison. P. aeruginosa

and P. oxalaticus had quite different RFLPs. Oxlc and OxL2 had the same RFLPs.

Although Oxla and Ox3b appeared to have similar RFLPs, Ox3b had a small fragment 78 1234

I!. c:oli

l:>. ueruginosct

P. oxalatict¿s

Oxla

Oxlb

Oxl c

OxB

Ox2b

Ox3a

()x3b

OxD

Ox5

Oxl..l

(Jx\,2

()xL3

Oxl.4

Figure 3.2Dotblot of oxalate-degrading soil isolates. DNA was applied to ttre membrane at four different amounts for each sample. The first dot contained 40 Pg of DNA, the second contained 30 pg, the third contained 20 pgand the four-th contained 10 pg. 79

I 234 5fi7 89101112131415161718

23.13 kb 9.42 kb 6.56 kb 4.36 kb

232t

Figure 3.3 Chromosomal DNA Restriction Profiles. DNA from soil isolates and controls was digested with Eco RI. Lane 1: À DNA digested with Hind Itr (size marker); Iane2:

E. coli; lane 3: P. aeruginosa;Iane 4: P. oxalatícusi lane 5: OxD; lane 6: Oxla; laneT:

Oxlb; lane 8: Oxlc; lane 9: OxB; lane 10: Ox2b; lane l1: Ox3a; lane 12: Ox3b; lane 13:

OxD; lane 14: Ox5; lane 15: OxLl; lane 16: OxL2;lane 17: OxL3; lane 18: OnLA- 80

I 2 3 4 5 6 t 8 9 l0 ll t2 13 14 1516 tl

2.32 kl) 1,93 kb 1.37 kb 1.261*)

0.70 kb

Figure 3.4 Restriction fragment length polymorphisms in the 165 subunit of the rRNA genes of oxalate-degrading soil microorganisms. Lane 1: À digested with Bst EII (size marker); lane2: E. coli;lane 3: P. aeruginosa; lane 4: P. oxalaticus;lane 5: Oxla; lane 6:

Ox3a; laneT: Ox3b; lane 8: Ox[-2;lane 9: OxLl; lane 10: OxL3; lane 11: OxB; lane 12:

Ox5. 81

which was not present in Ox1a. Ox2b and Ox3a appeared to have the same RFLPs- The

34 colonies isolated from Adelaide garden soil could be describedinT unique groups.

3.2.2.2.4 Sequence Analysis of the 165 Subunit of rRNA

A I4g3 bp PCR producr of the 165 rDNA subunit of each of the 7 unique groups was created using the forward primer 5'-GAA TTC GTC GAC AGA GTT TGA TCC

TGG CTC AG-3' and the reverse primer 5'-AAG CTT GGA TCC ACG GCT ACC TTG

TIA CGA CTT-3'. Direct sequencing was performed in the forward direction only using the forward primer. The sequence was deærmined using an automated sequencer and 550 bp of sequence (Appendix 1), representing approximately one third of the gene, were used for comparison with sequences in the GenBank database. Ox1a, Oxlc and Ox3b hadggfto homology withVaríovorax paradoxus. Ox3a had88% homology with Ralstonia eutropha. OxLl hadgSZo homology withThiobacillus sp. OxL2 had967o homology with

Rhizobiumsp. OxB and OxD had977o homology with a number of Paracoccøs species

(P. carortnifuciens and P. m.arcusii)"

3.2.3 Growth Curves

The selected colonies isolated from Adelaide soil were tested for their growth in

Bhat and Barker liquid medium containing 0.37o (wlv) sodium oxalate. Isolates

designated Ox1a, Oxlc, Ox3b and OxLl had lag periods of about 15 hours before

entering the logarithmic growth phase (Figure 3.5). This is similar to the lag period of

Pseudomonas oxalaticus.The isolate designated OxD appeared to have a longer lag

period of approxim ately 29 hours (Figure 3.2). Mid-log growth was reached after 20-25

hours and stationary phase was reached after 30 hours for all species except OxD, which

reached mid-log after 30 hours and stationary phase after 37 hours. During growth, the

medium became alkaline, reaching pH 8.5-9.0 at stationary phase.

It was hypothesised that the low cell density of OxD at stationary phase was a

result of inhibition of growth by high pH of the medium. OxD was grown in a fermenter 82 in which the pH of the medium could be controlled. Initially the pH was not controlled and increased as the OD66g increased. When the pH of the medium reached approximately 8.6, the culture appeared to enter stationary phase (Figure 3'6). The pH was adjusted to 7.0 and controlled at that level for the remainder of the experiment using

1 M HCl. The culture re-entered the logarithmic growth phase and entered stationary phase again at an OD600 of approximately 0.2I. This represents a culture density of approximately 2x 107 celVml, calculated by direct plating.

0.8

.__ä- Variovorax sp.

0.6 ^--"*^+* Ralstonia sp. - . .-* ....,it. .""" - Thiobacillus sp. o ro Rhizobium sp. o -"{t- o 0.4 P. oxalaticus G

0.2

0.0 0 10 20 3 0 40 50 Time (hrs)

Figure 3.5 Growth of Soil isolates in Bhat and Barker oxalate medium.

0.3 11.5

E 10.5 tr 0.2 o O.D. at 600nm (oo # 9.5 pl-l o [-+ 8.5 ci 0.1 o 7.5

0.0 6.5 0 10 20 3 0 40 50 60 Time (hours)

Figure 3.6 Growth of OxD in Bhat and Barker oxalate medium 83

3.2.4 Oxalate Tolerance

Oxalate-degrading soil bacteria isolated from Adelaide garden soil were grown for three days at25" C in Bhat and Barker liquid medium with sodium oxalate concentrations ranging from 07o (w/v) to 5.0% (w/v) (Figure 3-7). Paracoccus sp. tolerated oxalate concentrations up to \-BVo (w/v) which was the optimum concentration for growth,

Ralstonia sp. tolerated oxalate concentrations up to 1.07o (w/v) which was the optimum concentration for growth, Thiobacillus sp. tolerated oxalate concentrations greater than

5.0Vo (wlv) with optimum growth at I.5Vo (ilv), Rhizobium sp. tolerated oxalate concentrations up to 4-0Vo (w/v) with optimum growth at l.5Vo (w/v) and Paracoccus sp. tolerated oxalate concentrations up to 2.5Vo (w/v) with optimum growth atÙ-BVo (ilv).

1.0

0.8 Variovorax sp. -ttl- * Halstonia sp. 0.5 o ..'....-fl_ Thiobacillus sp. (oo ô o Rhizobium sp. 0.4 --**:gf*---- Paracoccus sp

0.2

0.0 0 1 2 345 6 o/o Oxalate (w/v)

Figure 3.7 Oxalate tolerance of oxalate-degrading species isolated from Adelaide garden

soil. 84

3.2.5 Substrate Utilisation

The isolate designaæd OxD was used in this experiment for two reasons. Firstly, halo formation around colonies grown on Bhat and Barker agar medium appeared to be significantly greater than other isolates and therefore this isolate may be a useful candidate for further study of the enzyme systems. The second reason was the differences in classihcation using the Analytical Profile Index and 165 rRNA sequencing. The culture was grown in Bhat and Barker liquid medium in which the oxalate had been replaced by

0.37o (wlv) of another carbon source. Because OxD is a very small micro-organism, optical density measurements were always low. Growth after five days was determined by diluting the cultures 1:103 and 1:106 and spreading 100 pl on Bhat and Barker calcium oxalate plates. The viable cell count was calculated. OxD grew well on galactose, oxalate, pyruvate, fructose, mannose, polygalacturonic acid, cr-ketogluctarate, glyoxylate, yeast extract and arabinose (Table 3.2). There was poor growth on starch' There was no growth on cellobiose, maltose, raffinose, succinate, lactate, fumarate, malate, glycerol, citrate, gluCOSe, SucrOSe, SOrbitol, maleate, formate, ethanol, aletate, lactOSe, glycerophosphate, fucose, tannin or trehalose after five days. After seven days there was good growth on maltose, raffinose, succinate,lactatÊ,fumarate, glucose, sucrose' lactose

and fucose. Verification that the bacteria were, in fact, OxD was based on halo formation

and colony morphology.

3.2.6 Votatite Fatty Acid Analysis

Pseudomonas oxalaticus and the five species isolated from the Adelaide garden

soil were grown in Bhat and Barker oxalate medium and the products were analysed by

gas liquid chromatography. No volatile fatty acids were produced and excreted into the

medium during growth on oxalate. 85

Substraæ OxD P. diminuta P. oxalaticus (Doudoroff and (Khambata and Bhat, Palleroni, 1975) 1es3) Cellobiose ND Maltose ND Galactose ++ ND Raffinose ND ND Oxalate ++ + Succinate ++ ++ Lactate ++ Fumarate + ND Fyruvate ++ ++ ND Malate + ND Glycerol ND Citrate ++ Glucose ++ Fructose ++ ND Sucrose ND Mannose ++ ND Sorbitol ND Maleate ND Formate ND + Ethanol + ++ Acetate *-* ++ Starch + + Lactose ND Polygalacturonic acid ++ ND ND ++ ND cr-Ketoglutarate Glycerophosphate ND ND Fucose ND Glyoxylate ++ ND ND Tannin ND ND Yeast Extract ++ ND ND Trehalose ND Arabinose ++ ND

Table 3.2 OxD substrate utilisation and comparison with P. diminuta and P. oxalaticus.

++ represents good growth, + represents medium growth, - represents no growth, ND

represents Not Determined. 86

3.3 Discussion

Only a small number of oxalate-degrading species have been reported in the literature. However, many of these have been isolated from soil. Oxalate metabolism by

P. oxalaticus has been studied in detait but there could be other soil bacteria that degrade oxalate more rapidly. Soil bacteria capable of degrading oxalate were easily cultured on an agar-based medium containing a calcium oxalate precipitate (Bhat and Barker, 1948) and are present in moderate numbers in soil in three areas of South Australia. The sample from Adelaide was garden soil with a heavy infestation of soursobs and was therefore expected to contain oxalates. It was not surprising, therefore, to find that this sample contained the highest population of oxalate-degrading bacteria. An isolate, designated

OxD, rapidly formed clear haloes around colonies on an agar based medium containing a calcium oxalate precipitaæ and was used for further studies of its enzyme systems.

Classification of OxD by the IMVS using the Analytical Proltle Index showed it to

be closely related to Pseudomonas diminul¿. However, P. diminutahas been reported as

not utilising oxalate as a sole carbon source for growth (Doudoroff and Palleroni, 1975).

OxD was studied for its ability to use a range of carbon sources as sole growth substrates

and differed from P. oxalaticøs and P. diminuta in its ability to use a number of them. No

volatile fatty acids were excreted into the growth medium by either OxD or P. oxalaticus

during growth on oxalate. Doudoroff and Palleroni (1975) describe Pseudomonads as

Gram-negative, straight or curved rods, generally 0.5 to 1.0 pm by 1.5 to 4.0 pm in size

and motile by polar flagella. They are strict aerobes, except for denitrifiers, test positive

for catalase activity and have a G+C content of 58-70Vo. They are common inhabitants of

soil, fresh water and marine environments. Some species cause disease of plants and

exhibit varying degrees of host specificity and some are occasional animal pathogens. As

a group, Pseudomonads are able to metabolise a wide range of organic compounds. The

Analytical Profile Index would suggest that OxD is related to P. diminuta. However,

sequencing of the 165 rRNA determined that OxD was closely related to a number of

Paracoccus species. 87

Hybridisation of P. oxalaticr¿s DNA with the DNA of oxalate-degrading soil

bacteria was poor. The value of DNA hybridisati on in vitro for the examination of

taxonomic relationships has been proven on several different groups of organisms

(McCarthy and Bolton, 1963; Hoyer et aI., 1964; Brenner et aI., 1967; Kingsbury,

I¡67).DNA-DNA hybridisation is effective in revealing relatively close relationships and

the information can be correlated effectively with the general phenotypic differences of the

strains. DNA-DNA hybridisation ceases to be of much value when members of different

species within the genus are compared (Bendich and McCarthy, 1967). Therefore, due to

the marked degree of heterogeneity in Pseudomonads, it is unlikely to be of much

comparative value.

The results of rRNA-DNA hybridisation experiments carried out in Pseudomonas

allowed the grouping of the species of the genus into at least five sharply defined "RNA

homology groups" (Bendich and McCarthy, 1967). RNA-DNA competition values obtained among members of different RNA homology groups are as low, and .'Ì rlf any member of a group and E coli, thus .fl occasionally lower, than those obtained with

providing further evidence of the marked heterogeneity of the genus Pseudomon¿s- This

explains the poor hybidisation between P. oxalaticøs DNA and P. aeruginosa DNA, even

though they belong to the same genus and suggests that this is not a reliable method of

determinin g relatedness.

The analysis of chromosomal restriction profiles to compare isolates was very

effective. When digested with Eco RI and separated in a t%o agarose gel, the DNA

exhibited a clear and unique banding pattern. Nili (1996) used this technique to

demonstrate that two variants of Bacteroides fibrisolvens strain El4, S and L, which had quite different colony morphologies, were indeed the same species and strain. However

they were quite different from B. fibrisolv¿ns strain IJl7c. This technique for comparing

isolates had the advantage of being rapid, requiring only the time to grow the culture,

purify the DNA, digest it with the enzyme and separate the fragments in an agarose gel.

Ning (1992) used DNA fingerprinting to demonstrate genetic diversity among stains of r 88

Selenom.onas ruminantiumbúDNA banding profiles in agarose gels were not published

so comparisons could not be made.

The comparison of restriction fragment length polymorphisms in the 165 subunit

of the rRNA proved useful in verifying the results obtained from the restriction profiles.

It was, in fact, a much less time-consuming method of distinguishing different species as

a PCR reaction could be performed on a boiled cell suspension and the separation of

bands was more distinct than the restriction profiles of the chromosomal DNA. However,

to classify the bacteria, it is of more value to sequence the DNA between the two primers

and compare that to sequences in the GenBank database.

Sequencing of the 165 subunit of rRNA showed that the 14 isolates examined

represented five different species from five different genera. All of the type strains of

other species ofthe represented genera have been isolated from soil. Three ofthe genera

were earlier classified in the genus Hydrogenomonas (Davis et aI., 1970). However,

'i taxanomic studies on the genus Hydrogenomonas by Davis et aI- (1970) showed that iil

I none of the strains tested could use oxalate. The nutritional data was based on methods

described by Stanier et al. (1966) and it was suggested that some of the utilisable

substrates may be toxic at the concentrations used, or strains were tested which were

unable to utilise those substrates. Stanier et at. (1966) generally used organic carbon

sources at concentrations of 0.I7o (w/v) which was the concentration of oxalate used in

this srudy. Therefore, it is most likely that Davis et al. (1970) did not test strains which

were able to utilise oxalate.

Davis et at. (1970) proposed that the genus Hydrogenomonas be abandoned and

that the various species of the "hydrogen bacteria" should be assigned to other genera, ie.

pseudomonas, Alcaligenes and Paracoccus. Some members of the genus, Alcaligenes,

have since been assigned to the genera Variovorax and Ralstonia. Bergey's Manual of

grounds, it seems likely that the I Determinative Bacteriology (I974) states that on many

genera Paracoccus, Pseudom.onas and Alcalígenes are very closely related to each other

and that at least the facultatively organotrophic species of the genus Thiobacillus belong in ! 89

the same generic cluster. This would suggest that the oxalate-degrading soil bacteria are

closely related.

In most cases, homology with published 165 rDNA sequences was in the range

of 967o to 997o. This would suggest that the isolated species belong to the same genus as

the published species. However, it would require a more detailed taxanomic study to

determine whether they belonged to the same species. In previous 165 rDNA

comparisons, Thiobacillus versutus was shown to be 99.I7o similar to Paracoccus

denitrificans and was renamed Paracoccus yersutus (Katayama et a1.,1995). Homology

of Paracoccus rrcffcustt 165 rDNA with other species of Paracoccus tanged ftom 96.37o

to 93.37o (Harker et aI., 1998) while homology with Paracoccus carotínifaciens (Tsubokura et al., 1999) i.s 1007o. P. marcusii was isolated in Israel and P.

carotinifaci¿ns was isolated in Japan. They could well be the same species. The closest

homology of the isolate designated as Ox3a was to Ralstonia eutropha (88Vo). This would

suggest that it belongs to a genus which has not had its 165 rDNA sequenced, or it

1 '4 belongs to a new genus and species.

The growth curves in liquid medium containing oxalate as sole carbon source

(Bhat and Barker, 1948) of the five different species from Adelaide garden soil were

plotted. Variovoraxsp. and Thiobacittus sp. had lag periods of 15 hours. The growth of

P. oxalaticus in liquid medium has not been reported but was also found to have a lag

period of 15 hours- Paracocc¡ls sp. had a lag period of 29 hours. These results compare

with a lag period reported for Pseudomonas ODl of 18 hours (Jayasuriya, 1955), 8

hours for O. vibrioþrmis and C. oxalicum (Dehning and Schink,1989), 13 hours for

Sox-4 (closely related to O. formigenes) and almost 3 days for Ox-8 (Smith et a1.,1985)

and 16 hours for O- formigenes (Allison et a1.,1985). Variovorax sp., Ralstonia sp.,

Thiobacilfuis sp., Rhizobium sp. and Paracoccus sp. reached stationary phase after 32,

I 29,33,31 and 37 hours respectively. P. oxalaticus reached stationary phase after 38

hours. This compares with 33 hours for Pseudom.onas ODl (Jayasuriya, 1955),24 hours

for O. vibrioformis and C. oxalicurn (Dehning and Schink, 1989), 24 hours for Sox-4 l 90

and 8.5 days for Ox-8 (Smith et a1.,1985) and22 hours for O. formigenes (Allison er

aI., 1985). This would suggest that althou gh Paracoccus sp. appears to degrade oxalate

more rapidly due to its large halo size relative to the colony size on Bhat and Barker agar

medium, it may be more convenient to work with P. oxalaticus for cloning of the genes

involved in oxalate degradation.

Growth of Paracocc¿rs sp. in liquid medium containing oxalate resulted in an

increase in the pH of the medium. The culture reached stationary phase when the pH of

the medium was 8.6. Smith et al. (1985) reported a similar phenomenon with Sox-4 and

Ox-8 reaching stationary phase when the pH reached 8.0 and 7.8 respectively. Jayasuriya

(1955) reported the pH of the medium to be 9.0 when the culture reached the stationary

growth phase and this increased to 9.5. No-one has reported the effect of controlting pH

on the growth of a culture. It would appear that the pH of the culture medium is a growth-

limiting factor when cells are grown in media containing oxalate.

Paracoccu.r sp. grew well in media in which the oxalate concentration ranged from ti

I,i 0.8Vo (wlv) (60 mM) to 2.0Vo (ilv) (150 mM). At higher concentrations, growth was i inhibited. Dawson et al. (I980a) reported an optimum oxalate concentration of 111 mM

for O. formigenes, 50 mM and 60 mM were reported for O. vibrioformi.ç and C. oxalicum respectively, although both could tolerate 100 mM (Dehning and Schink,

1989), 50 mM was reported for Sox-4 and Ox-8 (Smith et aI., 1985), 60 mM was

reported for Pseudomonas OD1 (Jayasuriya, 1955) and 20 mM was reported for P.

oxalaticus, although it was able to tolerate 150 mM (Khambata and Bhat, 1953).

Paracoccur sp. was able to grow well in much higher concentrations of oxalate than any

previously described isolates and therefore warranted further investigation of the enzpe

system.

I

I 9l

Chapter 4

Enzyme Systems in the Metabolism of Oxalate

4.1 Introduction

Chapter 3 described the isolation and characterisation of some oxalate-degrading bacteria from Adelaide garden soil. One of these, characterised as Paracoccus sp. by comparing the 165 rDNA sequence with sequences in the Genbank database, appeared to degrade oxalate more rapidly than other species, based on halo formation on Bhat and

Barker agar medium. Therefore, it was decided to use this isolate for comparison of the enzymes involved in oxalate degradation with oxalate-degrading bacteria reported in the literature, in particular P. oxalaticus and O. formigenes.

Following transport into P. oxalaticus cells, oxalate is converted to the active form by the action of formyl-CoA transferase (EC 2.8.3.2). It is then used in either the synthesis of cell constituents or the production of energy for growth. Synthesis of cell constituents from oxalate has been shown to involve reduction of oxalate to glyoxylate

(Quayle et a1.,1961; Quayle and Taylor,196l; Quayle, 1963a,b). This occurs via the

following two reactions, the first of which is catalysed by formyl-CoA transferase:

(1) + Formate AG'= 0 kJ/mol Oxalaæ + Formyl-CoA -> Oxalyl-CoA

The second reaction is catalysed by the eîzyme, oxalyl-CoA reductase (glyoxylic

dehydrogenase) (EC I.2.l.c):

+10.6 kJ/mol (2) Oxalyl-CoA + NADPH + H+ -> Glyoxylate + NADP+ + CoASH ÂG' =

The glyoxylate is then converted into glycerate, and then into other cell constituents, via

the glycerate pathway, discovered in glycolate-grown Escherichia coli and species of

P s eudomonas (Kornberg, 1966). 92

The necessary energy for growth of P. oxalaticus on oxalate is derived from the following series of catabolic reactions. The f,rrst is catalysed by the enzyme, oxalyl-CoA decarboxylase (EC 4.1.I.2) (Quayle, 1963b):

(3) + ÂG'= -25.8 kJ/mol Oxalyl-CoA + H+ -> HCOO-CoA CØ

The second reaction is catalysed by the enzyme, formyl-CoA transferase:

0 kJ/mol (4) HCOO-CoA + Oxalate -> HCOO- + Oxalyl-CoA ÂG' =

The third is catalysed by the enzyme, formate dehydrogenase (EC 1.2.2.I) (Johnson er

ø1.,1964):

(5) ÂG'= -43.3 kJ/mol HCOO- + NAD+ -> COz+ NADH

Oxalobacter formigenes contains an oxalyl-CoA decarboxylase, but oxalate metabolism by O. formigenes differs from that of P. oxalaticus in that formate is an end product (Allison et a1.,1985). It has not been tested for the presence of an oxalyl-CoA

reductase. During growth on oxalate, the pink-pigmented organisms, Pseudomonas AMl, Pseudomonas AM2, Pseudomonas extorquens and Protaminobacter ruber,

produce oxalyl-CoA decarboxylase, formate dehydrogenase and oxalyl-CoA reductase

(Blackmore and Quayle, 1970).

As formate is beneficial in the rumen, it was decided to concentrate on studying

oxalate degradation via oxalyl-CoA decarboxylase in P. oxalaticus and Paracoccus sp.

4.2 Results

4.2.1 Determination of Assay Conditions for Paracoccus sp. Oxalyl-CoA Decarboxylase

Before any enzyme kinetics could be determined for the oxalyl-CoA

decarboxylase of Paracoccu.s sp., the optimum conditions for the enzyme assay had to be

established. 93

4.2.1.1 Assay Requirements

The crude supernatant fraction from cell-free extracts of Paracocc¡1.ç sp. cataþsed a rapid decarboxylation of oxalate in the presence of ATP, acetate, CoA, TPP and magnesium ions. The omission of ATP, CoA, or acetate from the assay cockøil resulted in a six- to eight-fold reduction in activity (Table 4.1). Omission of magnesium ions or

TPP from the assay cocktail did not appear to affect activity. There was no activity when oxalate alone was used. When acetate was replaced by succinate, as for P. oxalaticus

(Quayle et a1.,1961) and O. formigenes (Allison et a1.,1985), the relative activity of the enz)rme was ISJVo of the activity when acetzte was used as the CoA donor. Acetate, CoA and ATP could be replaced by catalytic amounts of oxalyl-CoA.

Omissions Relative Activity

None I00Vo

ATP I4Vo

Coenzyme A 177o

Acetate l77o

TPP I00Vo

Table 4.1. Cofactors for the decarboxylation of oxalate by oxalyl-CoA decarboxylase

derived from soil isolate Paracoccus sp. Relative activity is expressed as a percentage of

specific activity (3.25 ¡rmoles oxalyl-CoA/min./mg protein) in the complete assay of cell-

free extracts.

4.2.L.2 pH Optimum

The optimum pH for the decarboxylation of oxalyl-CoA to formyl-CoA by oxalyl-

CoA decarboxylase ln Paracoccils sp. was 6.8 (Figure 4.1). 94

0.

N o gu, o E E 0.

0. 5 6 7 I 9 pH

Figure 4.1. Optimum pH for Paracocclts sp. oxalyl-CoA decarboxylase activity.

4.2.2 Comparison of Enzyme Systems in Parøcoccus sp. and Pseudomonas oxalatícus.

Cell-free extracts of. Paracoccus sp. and P. oxalaticus were produced by ultrasonic

disruption of the cells and centrifugation to remove the cell debris. The extracts contained

1.62 and 6.4I mglml protein respectively.

4.2.2.1 Oxalyl-CoA Decarboxylase

Oxalyt-CoA decarboxylase was found to be active in crude cell-free extracts of

both P. oxalaticus and Paracocc¿¿r sp. The sperific activities of the cell-free extracts were

found to be 1.03 and3.25 pmoles oxalyl-CoA/min./mg protein respectively (Figure 4.2). 95

o z +t- P. oxalaticus

at, .-----.c- Paracoccussp. Io E 1

0 2 4 68 10 12 Time (min.)

Figure 4.2- OxalyI-CoA decarboxylase activity in crude cell-free extracts of Pseudom.onas oxalaticus and Paracoccus sp. The initial rates of reaction were 0.66 and 0.53 pmoles

oxalyl-CoA/min respectively and reaction mixtures (section 2.2.33.1) contained 641 ¡:"g

and 162 pg of protein respectively.

4.2.2.2 Formate Dehydrogenase

Formate dehydrogenase was found to be active in crude cell-free extracts of P.

oxalaticus and Paracoccus sp. with specific activities of 0.61 and 4.84 pmoles

formate/min./m g protein respectively (Figure 4. 3).

2

o z .+t- P. oxalaticus t, 1 + Paracoccus sp. Io E

0 12 o 2 * rfr" (m1n.) 1o

Figure 4.3. Formate dehydrogenase activity in crude cell-free extracts of Pseudomanas

oxalaticus and Paracoccus sp. The initial rates of reaction were 0.39 and 0.78 pmoles

oxalyl-CoA/min respectively and reaction mixtures (section 2.2.33.2) contained 641¡t"g

and 162 pg of protein respectively" 96

4.2.3 Induction of P. oxalatícus and Paracoccus sp. Oxalyl'CoA Decarboxylase

P. oxalaticrr,r was cultured in oxalate-free medium and subcultured several times in oxalate-free medium before harvesting at mid-log growth by centrifugation at 5000 rpm. the cell pellet was then resuspended in a medium containing oxalate as the sole carbon source. An aliquot was removed every hour and a crude cell-free extract was produced.

The specific activities of oxalyl-CoA decarboxylase in the cell-free extracts were determined and plotted against time (Figure 4.4). Induction of oxalyl-CoA decarboxylase was evident after 5 hours and the specific activity increased until it reached a maximum after 10 hours"

.= o 4 o CL

cn 3 E ì --.....rt- P. oxalaticus .= E 2 * Paracoccus sp. o o E E ¿ I < 0 U, 0 10 20 Time (hrs)

Figure 4.4. Induction of oxalyl-CoA decarboxylase activity in Pseudomonas oxalaticus

and Paracoccus sp.

4.2.4 Determination of K- andY*o,

Using the optimum assay conditions, the Kln and Y,n¿¡ for oxalyl-CoA

decarboxylase produced by Paracoccus sp. were determined using the following

procedure. The relationship between substrate concentration and initial rate of reaction

was determined and results showed that the initial rate of reaction increased with 97 increasing substrate concentration. The reciprocal of the initial rate of reaction (liV) was plotted against the reciprocal of the substrate concentration (1/S) in a Lineweaver-Burk plot (Figure 4.5). The K21and Yqas.were calculated from this plot as follows:

y=9.4971 + 11.699x R^2= 0.985 14

12

10 x G E I 6

4 EI

0 2 4 6 8 10 12 1/S

Figure 4.5. Lineweaver-Burk plot for the oxalyl-CoA decarboxylase of Paracoccil.r sp.

Lineweaver-Burk plot has equation y = 9.497I + 11.699x

Ym*=1 y intercept

= 0.105 ¡rmoles/min.

andK*=Ymnxx slope

-- 0.105 x 11.699

= 1.23 mM (c.f. 1.0 mM for P. oxalaticøs (Quayle, 1963) and

0.24 mM f.or O. formigenes (Baetz and Allison, 1989))

4.3 Discussion

The oxalyl-CoA decarboxylase produced by Paracoccøs sp. has the same requirements for activity as the enzymes produced by P. oxalaacus (Quayle et a1.,1961) 98

and Oxalobacter formigenes (Allison et al., 1985). When ATP, CoA and acetate or succinate were omitted from the assay cocktail, enzyme activity was considerably reduced. Replacement of these components of the assay by catalytic quantities of oxalyl-

CoA resulted in comparable oxalyl-CoA decarboxylase activity for both Paracoccus sp. and P. oxalaticus cell-free extracts. Jakoby et aI. (1956) described a partially purified enzyme preparation, obtained from an organism grown in the presence of oxalate, which catalysed an anaerobic decarboxylation of oxalate. The system required substrate quantities of ATP and catalytic quantities of acetate, CoA, TPP and magnesium ions.

These authors suggested that the function of the ATP, acetate and CoA in the overall reaction was to synthesise acetyl-CoA by the action of acetyl-CoA synthetase. Quayle er at. (1961) prepared an enzyme fraction in a similar fashion from oxalate-grown P. oxalaticus. The decarboxylation was dependent on the presence of acetate, ATP and CoA.

The omission of any of these cofactors resulted in a six- to eight-fold reduction in

activity. When acetate was replaced by succinate, the rate of decarboxylation of oxalate

was increased. It was suggested that the function of the ATP, CoA and succinate was to

generate succinyl-CoA. This was found to be the case when the three cofactors were

replaced by succinyt-CoA in the reaction cocktail" Oxalate degradation by cell-free

extracts prepared from the anaerobic rumen microorganism, O. formigenes, was

dependent upon the presence of ATP, CoA and succinate in the reaction mixture (Allison

et al., 1985). Omission of any of these cofactors resulted in a ten- to twenty-fold

reduction in activity. The requirement for ATP, CoA and succinate could be replaced by

succinyl-CoA. The function of succinyl-CoA in the crude system appeared to be catalytic. 'When the enzyme was purified (Baetz and Allison, 1989), TPP was a necessary cofactor

for activity and acyl-CoA transferase was necessary only because of the assay system

used. The use of acyl-CoA transferase in the assay allowed oxalyl-CoA to be used in

catalytic quantities while oxalate was used in substrate quantities. These results suggest

that the mechanisms of oxalate decarboxylation in Paracocc¡rs sp. are the same as for

other bacterial species reported in the literature. 99

The pH optimum of 6.8 for oxalyl-CoA decarboxylase activity in cell-free extracts of Paracocczs sp. was very close to those reported for P. oxalaticus and O. formigenes.

Quayle (1963b) reported a pH optimum of 6.6 for P. oxalaticus while Baetz and Allison

(1989) reported a pH optimum of 6.7 for O. formigenes.

The pathways of oxalate metabolism in P. oxalaticus have been studied in detail

(Quayle et al., 1961). Enzyme assays of crude cell-free extracts of Paracoccus sp. revealed that oxalyl-CoA decarboxylase/formate dehydrogenase pathway was present in this organism" The specific activities of oxalyl-CoA decarboxylase and formate dehydrogenase in the cell-free extracts of Paracoccøs sp. were three- to eight-fold higher than in those of P. oxalaticøs and the reason for this is unknown.

The Km value of 1.23 mM for the oxalyl-CoA decarboxylase of Paracoccus sp. is similar to that reported for P. oxalaticus (1.0 mM) (Quayle, 1963b) and O. formigenes

(0.24 mM) (Baetzand Allison, 1989). The molecular weight of the P. oxalaticus eîzpe

has not been reported but Baetz and Allison (1989) determined that the O. formigenes

enzyme has a molecular weight of 260,000 and is made up of four identical subunits,

each with a molecular weight of 65,000. Rogers (1991) reported a protein with a

molecular weight of 65,000 afær partial purif,rcation and SDS-PAGE of a cell-free extract

from Paracoccus sp. However, probing a Western transfer of the SDS-PAGE with

antibodies raised against purified oxalyl-CoA decarboxylase from Paracoccus sp. would

be required to confirm whether the band resulted from the subunits of oxalyl-CoA

decarboxylase. Zymogram assays after PAGE were attempted but were unsuccessful.

The assay method for detecting the enzyme after PAGE may not be suitable as it relied on

the disappearance of soluble, diffusible oxalyl-CoA rather than the production of formyl-

CoA.

The oxalyl-CoA decarboxylases of P. oxalaticus, O. formigenes and Paracoccus

sp. have the same cofactor requirements and very similar pH optima and Km values.

However, it is not known how closely these enzymes are related at the amino acid level.

Presumably, the active sites are highly conserved but there is no data on these as the gene 100 has only been cloned from O. formigenes and no comparative studies have been made with other species. Cloning and sequencing of the genes may determine this. Chapter 5

Ctoning of the Genes for Oxalate Decarboxylation

5.1 Introduction

In the previous chapter, the enzyme kinetics of the oxalyl-CoA decarboxylase produced by Paracocc¡rs sp. were studied and compared with the enzymes produced by

P" oxalaticus and O. formigenes.They were found to have the same assay requirements,

similar pH optima and similar Km and Vmax values. Cloning and sequencing of the gene for oxalyl-CoA decarboxylase would give information as to how closely the enzymes in

different species are related. To this end, four different methods of selection for cloned

genes wilt be explored in an attempt to clone the gene for oxalyl-CoA decarboxylase.

The first, and simplest, method to be used is selection by plate assays. Cosmid

tribraries could be created in E. coli and grown on Bhat and Barker agar medium. If the

oxalyl-CoA decarboxylase is successfully expressed, clear haloes should appear around

colonies containing the cloned gene. Plate assays have been used successfully for

selecting for E coli canying the cloned genes for a-amylase (Clarke et a1.,1992; Cotta

and Whitehead, 1993; Satoh et al-,1993), endoglucanase (Teather and Wood, 1982) and

B-glucosidase (Armentrout and Brown, 1981; Love and Streiff, 1987), for example,

from various organisms (reviewed by Glick and Pasternak, 1989). However, as two

enzymes and a transport protein are involved in the conversion of oxalate to formate tn

vivo, a simple plate assay may not suff,rce. Therefore, cosmid libraries could be subjected

to antibody selection (Erlich et al., 1978; Helfman et aI., 1983; Kemp and Cowman,

1981; Young and Davies, 1983; Huynh et a1.,1984).

The second method to be used is the use of mutant hosts which have lost the

ability to degrade oxalate (ox-) for the production of complementation libraries. The

mutant hosts could be created by ultra-violet mutagenesis and transformed with DNA t02 from the wild-type cloned in a suitable vector. This would overcome the problem of the gene not being expressed rn E coli, should it arise.

The third method to be used is the development of DNA probes for the selection of colonies carrying the oxalyl-CoA decarboxylase gene. Transposon mutagenesis has been used previously to facilitate the cloning of genes from a number of bacterial species

(Purucker et al., 1982; Kuner and Kaiser, 1981; Shimkets et a1.,1983; Gantotti et al.,

1981; Engebrecht et a1.,1983; Belas et a1.,1982;Bricker et a1.,1983; læong et a1.,1982:

Schell, 1983; Purcell and Clegg, 1983; Shaw et a1.,1980; Morona and Reeves, 1982).

TnI732 (Ubben and Schmitt, 1986) could be used to generate ox- mutants. The KnR

gene from Tnl732 in the mutants could then be cloned in such a way that the clone carries

some genomic DNA which could be used as a probe for the oxalyl-CoA decarboxylase

gene in plasmid libraries.

The fourth method to be used is to create DNA probes by PCR amplification of

the oxalyl-CoA decarboxylase gene cloned from another species. The gene for oxalyl-

CoA decarboxylase in O. formigenes has been cloned and sequenced (Lung et al., L994).

The DNA sequence revealed a single open reading frame of 7,704 bp capable of encoding

a 568-amino-acid protein with a molecular weight of 60,691. The identification of a

presumed promoter region and a rho-independent termination sequence indicated that the

gene was not part of a polycistronic operon. Primers created using this sequence data

could be used to amplify a region of the oxalyl-CoA decarboxylase gene by PCR and the

amplif,red DNA could be used as a probe to screen plasmid libraries.

P. oxalaticzs will be used initially to clone the gene for oxalyl-CoA decarboxylase

because it is well characterised and the enzyme has been studied in detail (Quayle and

Keech, 1959a; Quayle and Keech, 1959b; Quayle and Keech, 1960; Quayle et al.,196I:

Quayle and Taylor, 1961; Quayle, L963a Quayle, 1963b)' If time permits, the

experiment will be repeated f.or Paracocc¡rr sp. Currently, the only information available

concerning the gene for oxalyl-CoA decarboxylase is derived from the gene cloned from

A. formigenes.Inthis bacterium, oxalate is the sole source of energy for cell growth and 103 formate is an end product. Therefore, oxalyl-CoA decarboxylase is expressed constitutively. However, in P. oxalaticus,the enzyme is induced only when oxalate is the sole carbon source. Sequencing of the gene for oxalyl-CoA decarboxylase in P. oxalaticus, and regions upstream and downstream of the coding sequence, will help to determine the relationship of the gene with those for formyl-CoA transferase and the oxalate transport protein, ie. are they part of an operon or afe they expressed independently? The presence of an in-frame TAA stop codon followed by multiple in- frame stop codons and a putative rho-independent termination sequence, together with the observation that no additional open reading frames were found either upstream or downstream of the coding sequence indicate that the oxalyl-CoA decarboxylase gene is not part of a polycistronic operon in O. formígenes. Comparison of TPP binding motifs

and general amino acid sequence data will determine how well the sequence is conserved.

5.2 Results

5.2.1 Plate Assays

P. oxalaticøs DNA was partially digested with the restriction endonuclease Bam

FII (Figure 5.1) and ligated into the BamHI restriction site of the cosmid pHC79. The

resulting cosmids, each containing 30-45 kb of P. oxalaticøs DNA, were package using

the Boehringer DNA packaging kit (Cat. No. 1 758799) and used to transfectE. coli

strain DHl. The cells were spread on Bhat and Barker agar medium containingTÍ ttglml ampicillin and grown at 37" C. The transformation efficiency was 4.6 x l}a

transformants/pg chromosomal DNA and more than a thousand colonies were screened

for clear halo formation around the colonies as an indication of oxalate utilisation. Based

on the E. coli chromosome containin g 4.2 x t06 bp (Brock and Madigan, 1988), the

library should represent more than 5 copies of the entire P. oxalaticøs chromosome.

However, no colonies producing clear haloes were found. The cosmids from 40 colonies

were purified, digested with the restriction endonuclease Bam HI and separated in a IVo

agarose gel (Figure 5.2). The cosmids contained large random fragments of P. oxalaticus

DNA and24 appeared to be unique. In Figure 5.2, (a)2, (b)2, (c)6 and (d)9 appear to be r04

12345 6 7

23.13 kb

9.42kb

6.s6 kb

4.36 kb

2.32kb 2.03 ktl

Figure 5.1 P. oxalaticus DNA partially digested with Bam HI. Lane 1: undigested;lane2:

2 minute digest; lane 3: 5 minute digest; lane 4: 10 minute digest; lane 5: 30 minute digest; lane 6: 60 minute digest. 105 r234567891011 1234567891011 ¿þÉ

l¿ 23.r 3 kb h,l ¡.¿ 9.42kb ., 23.13 kb 6.56 kb ¡¡ L.i 9.42kb 6.s6 kb 4.36kb 2.32kb ': 2.03 kb Ìl

ìi.t l4l t:j 2.32kb 2.03 kb

a (a) ;!]j (b)

1 2 3 4 5 6 7 8 9 l0 11 1 2 3 4 5 6 7 8 9 10 l1

23.13 kb 23.13 kb du* b t iú., 9.42kb 9.42kb \r du 6.56 kb 6.56 kb t-,.a^út.

(c) (d) Figure 5.2 Randomly picked cosmids from a library of P. oxalaricøs DNA cloned in

pHC79.

A. Lane 1: l" x Hind III marker; lanes 2-11: cosmids digested with Bam HI.

B. Lane 1: ì, x Hind III marker; lanes 2-11: cosmids digested with Bam HI.

C. Lane 1: )" x Hind III marker;lanes 2-11: cosmids digested with Bam HI.

D. Lane 1: l, x Hind III marker;lanes 2-11: cosmids digested with Bam HI. 106

the same, (a)3 and (c)4 appear to be the same, (a)8 and (b)3 appear to be the same and

(c)5, (c)9, (c)10 and (d)3 appear to be the same.

5.2.2 Antibody Probes

Two rabbits were inoculated with a commercial preparation of Aspergillus sp. oxalate decarboxylase (Boehringer Mannheim) to produce polyclonal antibodies (see

2.2.25). Cells from P. oxalaticøs and Paracoccu,r sp. were sonicated and the proteins in the cell-free extract were separated in a l2Vo denaturing polyacrylamide gel, transferred to a nylon membrane and probed with the polyclonal antibodies. Tlte Aspergillus sp. oxalate decarboxylase ìwas used as a positive control. The polyclonal antibodies only bound to the control protein (Figure 5.3).

5.2.3 Generation of Ox' Mutants

Selection using plate assays or antibodies to detect transformants containing the oxalyl-CoA decarboxylase gene was dependent upon expression of P. oxalaficøs genes in

E. coli. To be sure of the genes being expressed, it would be far better to clone them in

ox- P. oxalaticus and select for reversion to ox+.

P. oxalaticøs cells were spread on agar calcium oxalate medium (Bhat and Barker,

1948) containing 0.0IVo succinate during logarithmic growth and exposed to ultra-violet

irradiation. A survival curve was plotted (Figure 5.4) and used to estimate the length of

time to irradiate the cells to gain 10% survival. This was found to be approximately 15

seconds. However, after screening over 30,000 irradiated colonies, no ox- mutants were

discovered. t07

,J

1234s67

il ,,Û rl

Figure 5.3 V/estern immunoblot of bacterial cell-free extracts. Lane 1: Control

(Aspergiltus niger oxalate decarboxylase); lane 2: P. oxalaticus;lane 3: VariovorØc sp.; '7: lane 4: Ralstonia sp.; lane 5: Thiobacillus sp.; lane 6: Rhizobium sp.; lane Paracoccus

sp

I 108

1

* r .= J U' 2

0 20 40 60 Time (sec.)

Figure 5.4 Survival of P. oxalaticus after exposure to ultra violet radiation

5.2.4 Generation of DNA Probes from P. oxalaticus

5.2.4.1 Transposon Mutagenesis 't ,,f P. oxalaticør was transformed with the plasmid pHC23 by conjugation from E"

coli.Tltts plasmid carried a chloramphenicol resistance gene on the plasmid element and a

kanamycin resistance gene on the transposon element. The aim was to create ox- mutants

of P. oxalaticus, clone the kanamycin resistance gene with flanking DNA from the P.

oxalaticus chromosome and use the flanking DNA as a probe for a library of the native P.

omlaticus DNA"

It was found that chromosomal integration occuned at a high rate in P. oxalaticus

and by the time a single transformed colony could be isolated on agar medium containing

chloramphenicol and kanamycin, the transposon had already integrated into the

chromosome. Therefore, the cells were transformed by electroporation and selected on

Bhat and Barker agar medium containing kanamycin only. It is estimated that over

I 100,000 colonies were screened. The average bacterial chromosome contains

approximately 2000 genes and three genes are involved in oxalate decarboxylation.

Therefore, it is expected that 150 of the colonies screened should be ox-. Using Southern

k 109

hybridisation with TnI732 as a probe, it was found that the transposon integrated

randomly into the chromosome (Figure 5.5). However, no ox- mutants were recovered. ,J To determine whether this method was effective for creating mutants, 100 colonies were

screened for amino acid auxotrophs. Four colonies were found to require casamino acids

in the medium on which they were gro\'/n but these were not investigated further as they

were not relevent to the project.

5.2,4.2 Polymerase Chain Reaction

Forward and reverse primers approximately 1 kb apart were made using sequence

data from the oxalyl-CoA decarboxylase gene of O. formigerzes (Lung et aI., 1994).

These were used to generate a PCR product using P. oxalaticøs DNA as the template. The

optimum MrgZ+ concentration was found to be 3.0 mM. PCR amplification of P.

oxalaticus DNA resulted in f,rve fragments, one being approximately I kb long (Figure

5.6). The other four were approximately 2.1kb,560 bp, 400 bp and 300 bp. As it was

T close to the expected size, the 1 kb PCR product was used as a probe for a southern rrf transfer of P. oxalaticus DNA digested with a range of restriction endonucleases to

determine which would produce a fragment suitable for cloning (Figure 5.7). It was

found that a HindlII digest of P. oxalalicus DNA produced a fragment of approximaæly

2.8 kb which hybridised with the 1 kb probe.

The 2.8 kb Hind III fragment that hybridised to the PCR product was isolated by

cutting out the gel slice containing it and extracting it from the gel by the freeze/squeeze

method. The purified DNA was then tigated into the HindIII restriction site of pUC19

and used to transform E. coli stain XL-Blue. Resulting white colonies were transferred to

a fresh plate and grown overnight for a colony lift. Overnight growth of the colonies

proved a large number to be false positives. However, upon hybridisation with the PCR

product, one colony carried a recombinant plasmid containing the 2.8 kb Hind III tÌ the opposite ; fragment of interest (Figure 5.8). This fragment was then cloned in

orientation and both orientations were mapped and sequenced so that the sequence data

from one orientation could be confirmed by the data from the other. * 110

r 2 3 4 5 6 7 8 9 l0 11 12 13 t4

6.24kb

4.20 kb

2.00 kb

Figure 5.5 Southern blot of the integration of transposonTnlT32 into the chromosome of

P. oxahrtc¿rs. The DNA was digested with Pvun and [32p1-1abe11ed TnI732 was used as

a probe. Lane 1: pHC23;Iane2 P. oxalaticus;Iane3: P. oxalaticus canying pHC23;

lanes 3-14: P. oxalatic¡¿s after integration of Tn7732.

I

I t2 3 4 111

lrl 23.13 kb 9.42kb 6.56 kb 4.36 kb 2.32kb 2.03 kb

\/

=t

Figure 5.6 PCR of P. oxalaticus DNA using primers derived from the oxalyl-CoA

decarboxylaso sequence of O. formigenes. Lane 1: both primers; lane2: forward primer only: lane 3: reverse primer only; lane 4:ÌuxHind III marker. The arrow indicates the

band that was taken and used as a probe. rt2

1234567891011121314

lkb

Figure 5.7 Southern transfer of P. oxalalicøs DNA digested with a range of restriction endonucleases and probed with the 1 kb PCR fragment labelled with ¡32p1¿CTP. Lane 1:

1 kb PCR fragment; lane2 EcoRldigest; lane 3: Søc I digest; lane 4: Kpn I digest; lane

5: AvaI digest; lane 6: SmnI digest; laneT: XmaI digest; lane 8: BamHI digest; lane 9:

Xbaldigest; lane 10: Accldigest; lane 1l: Hind II digest; lane 12; Sal I digest; lane 13:

Ps/ I digest; lane 14: Hind Itr digest. 113

Figure 5.8 Colony lift of E coli colonies carrying recombìnant plasmids probed with the

1kb PCR product genorated from P. oxaløticu.s. rt4

5.2.5 Sequencing

5.2.5.1 Mapping

The Hind III fragment of P. oxnlatícus cloned in pUCl9 was mapped to deærmine the position of restriction sites and which enzymes would be suitable for digesting the

DNA to create nested deletions for sequencing. The restriction map of the Hind III fragment is shown in figure 5.9"

H ESSa P Sm P H I ilt I I I I ) ) ) -(4) ---(s) (6)

Figure 5.9 Restriction map of the Hind III DNA fragment of P. oxalaticus which hybridised with the PCR product. H = HindIII, E = Eco RI, S = Sall,Sa =.S¿c I, P =

PstI, Sm =,Sn¿ I. The solid lines (-) of (1), (2) and (3) show the fragments left after deletions using Eco RI, Sac I and Pst I respectively. The dotted lines (---) of (4), (5) and

(6) show the fragments left after deletions using Eco RI,,Søc I and Psr I respectively of the fragment cloned in the opposiæ orientation.

Nested deletions for the purposes of sequencing this DNA fragment could not be created using Exonuclease III because restriction sites for Sac I and Sal I were present in the fragment. Therefore, deletions of the fragment were created by digestions with Eco

RI, Sac I, and Psr I. The fragment between the two Psr I restriction sites was subcloned in pUC19 and nested deletions were performed on this fragment.

5.2.5.2 Nested Deletions

The Psr I fragment was subcloned in both orientations. When subcloned in one

orientation, the recombinant plasmids formed light blue colonies, suggesting that the 115 fragment contained a P. oxalaticar promoter sequence which exhibiæd low-level activity in E. coli. The resulting plasmids were digested with Sac I and Sal I, then nested deletions were created using a kit from Promega. A range of deletions were created

(Figure 5.10) and used for sequencing.

5.2.5.3 Sequence Data

Sequencing was performed in the forward direction only using the M13 universal forward primer from the Applied Biosystem DNA sequencing ready reaction (Perkin

Elmer) and an automated sequencer. The Hind III and Psr I restriction sites of pUC19 are at the end of the multiple cloning site and this only allowed deletions to be performed from the forward end. However, sequence data was obtained in both directions by cloning the fragments in both orient¿tions. Appendix 2 shows the combined results of the sequence data.

The cloned P. oxalaticøs DNA contained a gene 2.1 kb in length. A proposed ribosome binding site, GAGGA, was found 6 bp upstream of the GTG start codon. The proposed TATA box promoter sequence, CAAATA, was found adjacent to the ribosome binding site and 6 bp upstream of the proposed ribosome binding site. The proposed

Pribnow box promoter sequence was found 23 bp upstream of the proposed TATA box promoter sequence. Stop codons occur in all three reading frames just upstream from the putative translational initiation codon. Comparison of the amino acid sequence with published amino acid sequences entered in the Non-redundant Genbank CDS database using BLAST (Altschul et a1.,1990) showed 807o homology with Elongation Factor G from Haemophilus influenzae (Appendix 3). Homology with Elongation Factor G from a number of other bacteria was less than 80Vo. There was no homology with the O. formigenes oxalyl-CoA decarboxylase gene. 116

123 4 5 6 7I 9l0tl12t3t4l5t6l7t8192ù212223217526272829

23.1:i kb 23. r3 kb 9.42kb 9.421ú 6.56 kb 6.s6 kb

Figure 5.10 Nested deletions of the Psr I fragment subcloned in pUC19. Lane 1: l, x

plasmid digested and SaI I but not Exo III; lanes 3-28: Hindltlmarker; lane2 with ^Sac I nested deletions taken from an Exo trI digest at 30 second intervals for 13 minutes; lane

29: À marker- It7

5.2.6 Generation of DNA probes from O- formígenes

Since the 1 kb PCR product from P. oxalaticus appeared to be part of elongation factor G, the 2.1 kb, 560 bp, 400 bp and 300 bp PCR products were used to probe a dot blot of DNA extracted from the oxalate-degrading soil isolates (Figure 5.11). The PCR products either hybridised to all the DNA samples, including negative controls, or they hybridised to only a few of the oxalate-degrading species but not all of them. Therefore,

PCR was performed using O. formigen¿s DNA as the template and using the same primers used for PCR amplification of P. oxalaricøs DNA as they were derived from the

produced a O. formigenes oxalyl-CoA decarboxylase gene sequence data. This also prominent band of approximately I kb. This PCR product was used to probe a dot blot of

DNA from a number of soil isolates and P. oxalaticus using O- formigen¿s DNA as a positive control and P. aeruginosa and E coli DNA as negative controls (Figure 5.I2).

The probe hybridised to DNA from all oxalate-utilising species but not with P. aeruginosa

or E. coli. The PCR product was also used to probe a southern transfer of P. oxalaticus

DNA digesred with a number of restriction endonucleases (Figure 5.13). The probe

hybridised poorly to the P. oxalaticøs DNA and attempts to repeat this failed to show any

hybridisation.

5.3 Discussion

Selection of E. coli colonies carrying the cloned oxalyl-CoA decarboxylase gene

using plate assays was unsuccessful. A number of genes from Pseudomorzas species

have been cloned in E. coli.Examples include naphthalene oxidation genes (Ensley et al-,

1983; Schell, 1983) and protocatechuate 4,5-dioxygenase (Noda et aI., 1990). The

naphthalene oxidation genes are located on the plasmid NAH7, making cloning

particularly easy. The enzymes involved in naphthalene oxidation were expressed

constitutively in E coli whereas the same genes are inducible in Pseudomonas (Ensley ø/

at., 1983). However, P. putida oxidised naphthalene at a much higher rate than did E

coti (37o of the levels produced by P. putida) containing the cloned genes (Schell, 1983). 118

(a) (b) (c) (d) (e)

P. lxulutir:us

E. col.i

P. aeruginosa

Variovorcr.r sp.

Rulstonia sp

Rhizobium sp.

Thiobacillus sp.

Paracoccus sp

Figure 5.11 Testing of PCR probes from P. oxalaticus. Dot blots of DNA from a number of soil isolates were probed using the PCR products generated from P. oxalaticus using (c) product. (d) 400 O. formigenes primers. (a) 2.1 kb product. (b) I kb product. 560 bp bp product. (e) 300 bp product. 119

{.}, .fcsrnrigetws

l:i. r:o!Ì

lt. æcrxgitzt>s,s

!:). t.s"v*lalírn*'

l,?vi

lIalsttxtiu r;1s

*hir.ohiunt sp.

7'kioltrzt: ilÌ'us t;çt.

Par*t:oc<:t.ts sp.

Figure 5.12 Testing of PCR probes from O. formigenes.Dot blots of DNA from a number of soil isolates and P. oxalaticus were probed using the PCR product generated from O. formigenes. DNA from O. formigenes was used as a positive control and P. aerugínosa and E. coli were used as negative controls. r20

7 2 3 4 s.6 7

I I

I i j ¡

Figure 5.13 Southern transfer of P. oxalaticus DNA digested with a range of restriction endonucleases and probed with the 1 kb t32Pl-labelled PCR product fron O. formigenes-

Lane 1: 1 kb PCR product from O. formigenes; lane 2: Bam HI digest; lane 3: Eco RI digest; lane 4: Kpnldigest; lane 5: PsrI digest; lane 6: Smn I digest; laneT: EcoRIJPstI digest. t2t

It was suggested that the genes in E. coli are poorly expressed from a Pseudomonas promoter sequence. Noda et at. (1990) found that protocatechuate 4,5-dioxygenase of P. paucim.obilis was efficiently expressed in E. coli only with the aid of the /ac promoter of

E. coli. This would suggest that promoters from Pseudomonas species work poorly in E. coli and substantially higher activity would be required to detect positive clones with oxalyl-CoA decarboxylase activity as detection is dependent on the disappearance of the substrate rather than the appearance of the product, as in the case of the naphthalene oxidation genes.

Another challenge to be overcome in the cloning of genes involved in the metabolism of oxalate is the number of genes involved in the reaction. Many of the genes cloned by selection on plates require only one gene for expression. Howevef, three steps are involved in oxalate decarboxylation; first there is transport of oxalaæ into the cell, then activation of the oxalate molecule with coenzyme A, followed by decarboxylation to produce formyl-CoA and carbon dioxide. The genes for the proteins and enzymes involved in each step have been cloned from O. formigenes. Abe et al. (1996) cloned the

oxalate:formate antiport protein gene (418 amino acids, 1254bp), Sidhu et al. (1997)

cloned the formyl-CoA transferase gene (428 amino acids, 128a bp) and Lung et aI.

(1991) cloned the oxalyl-CoA decarboxylase gene (568 amino acids, 170a bp). None of

these genes were cloned by plate selection and expression of the oxalyl-CoA

decarboxylase gene in E- coli was achieved by cloning it directly downstream of the tac

promoter in the expression vector, pDR540 (Lung et a1.,1994).

The polyclonal antibodies raised against a commercial preparation of oxalate

decarboxylase from a fungus, Aspergillus sp., did not react with cell-free extracts of P.

oxalaticus. Oxalate decarboxylase is produced by a number of fungi, including Collybia

velutipes (Shimazono and Hayaishi, 7957), Myrotheciumvercucaria (Lillehoj and Smith,

1965) and Aspergillus niger (Emiliani and Bekes, 1964). The fungal oxalate

decarboxylase has no requirement for the cofactors required by the oxalyl-CoA

decarboxylase produced by P. oxalaticus and O. formigenes. However, it has a r22 requirement for catalytic quantities of oxygen which makes it unsuitable for use in an anaerobic environment. The differing cofactor requirements and the lack of any cross- reaction with the polyclonal antibodies suggest that the enzymes are quite different and that oxalyl-CoA decarboxylase should be purified from P. oxalaticus and polyclonal antibodies raised against it if this method were to be used to select E. coli expressing the protein. Lung et at. (1994) used antibodies raised against oxalyl-CoA decarboxylase produced by O- formigenes to show that a PCR product cloned in E. coli directly downstream of a tac promoter produced a protein with the same molecular weight as oxalyl-CoA decarboxylase. However, the poor expression of othet Pseudomonas genes in E. coli, using Pseudomor?dJ promoters, would suggest that another approach should be taken.

Mutagenesis to create mutant P. oxalatic¡¿s which had lost the ability to utilise oxalate (ox- mutants) failed to produce any such mutants. This is surprising as both the transport protein and the formyl-CoA transferase enzyme are required for the cell to utilise oxalate. However, coenzyme A is able to be transferred from both succinyl-CoA and

acetyl-CoA (Quayle et a1.,1961), suggesting that either formyl-CoA transferase is not

specific for formyl-CoA or other acyl transferases are active in P- oxalaticus so that

coenzyme A can be transferred to oxalate from other sources. Once oxalate has been

converted to oxalyl-CoA, it can be converted to either formyl-CoA by the action of

oxalyl-CoA decarboxylase (Quayle, 1963b) or glyoxylate by the action of glyoxylic

dehydrogenase (Quayle and Taylor, 1961). Therefore, two point mutations would be

required to generate ox- mutants suitable for cloning the oxalyl-CoA decarboxylase gene.

The results suggest that the creation of point mutations may not be of any value in cloning

the genes involved in oxalate metabolism.

Experiments using reconstitution assays to study the movements of oxalate and to

characterise the exchange of oxalate with formate in O. formigenes demonstrated that both

[l4C]oxalare and ¡l4C1formate were taken up by proteoliposomes loaded with unlabelled

oxalate, but not by similarly loaded liposomes (Anantharam et aI-,1989). The results r23 reflected the presence of an antiporter that requires an appropriate alternative substrate before net movement across the membrane is possible. There was no movement across the membrane as a result of diffusion. However, formate is converted to COz and NADH in p. oxalaticus so some alternate substrate would be required for net movement of generate oxalate across the membrane. The conversion of oxalate to formate would also an internal alkalinity and Anantharam et al. (1989) suggest that this may promote an additional oxalate2-:OH- antiport by a mass action effect in O. formiSenes. The exchange with hydroxyl ions would have the same thermodynamic impact as the antiport of oxalate and formate. It is therefore quite possible that an oxalate2-:OH- antiport is responsible for transport across the cell membrane ln P. oxalaticus as the culture medium becomes alkaline when P. oxalaticrzs is grown on most carbon sources. In a limited number of trials, Anantharam et aI. (1989) demonstrated that malonate, succinate, or oxaloacetate, but not malate, partially released labelled oxalate afær completion of oxalate self-exchange high and concluded that among the dicarboxylates the exchange reaction had a relatively specificity for oxalate. Glyoxylate also failed to be transported across the membrane. The simple monocarboxylic acids, formate, acetate and propionate, were also tested. Each preparation took up oxalate, but comparison of initial rates indicated that formaæ was the

most successful countersubstrate. P. oxalatic¡ts cells exposed to UV irradiation, or which

had undergone transposon mutagenesis, wefe grorwn on agar calcium oxalate medium

(Bhat and Barker, 1948) containing 0.1% succinate. This gave enough of an alternate

carbon source for colonies to grow but not enough to suppress expression of the enzymes

involved in oxalate degradation . As P.oxalaticus is able to utilise other dicarboxylic acids (Dawson et aI., while O. formigenes is only able to utilise oxalate as a carbon source

1980a) it is possible that oxalate is able to enter the cells of P. oxalaticus via other

antiports. If this were the case, haloes around colonies containing inactivating mutations

in the oxalate antiport would be expected to be smaller than those around normal colonies.

However, there was considerable variation in haloes around colonies which had not been

exposed to mutagens so selection on this basis was not viable. 124

Once oxalate is in the cell and has been converted to oxalyl-CoA, it can take either of two pathways. It can be converted to formyl-CoA via oxalyl-CoA decarboxylase, or it can be converted to glyoxylate via glyoxylic dehydrogenase (Quayle et aI', 196l)'

Therefore, mutagenic deactivation of both these enzymes would be required to create ox- mutants at this step of oxalate degradation. It would be possible to create a double mutation using chemical or UV mutagenesis but transposon mutagenesis at this point would not work as the transposon appeared to integrate stably in the chromosome at a single random point. The plasmid carrying the transposon was extremely unstable in P. oxnlaticus and the most effecúve way of transforming the cells was by electroporation-

Lung et at. (fr99Ð sequenced the oxalyl-CoA gene from O. formigenes' As no other oxalyl-CoA genes had been sequenced, it could not be compared with any others to determine conserved regions. Therefore, G+C-rich regions approximately lkb apart were selected and primers for these regions were synthesised. PCR of P. oxalatic¿¿s DNA using these primers resulted in a product, among others, of approximately 1 kb which

was used in the cloning process. The cloned sequence contained regions very similar to

previously confirmed promoter regions and ribosome binding sites. It was somewhat

unusual in that it had a GTG start codon, which occurs occasionally. However, the

sequence cloned showed very strong homology to the elongation factor G of a wide range

of species . Other PCR products generated from P. oxalaticus using the primers derived not suitable from the O. formigenes oxalyl-CoA decarboxylase gene sequence were

probes either. It was concluded from this that the regions chosen for the primers were not

conserved between P. oxalaticus and O. formigenes.

Once again, this O. formigen¿s DNA was used as the template for the PCR. resulted in the synthesis of a I kb fragment which was used as a probe. The probe

hybridised with DNA from oxalate-degrading bacteria in a dot blot and an initial southern

transfer of p. oxalaricus DNA but there ,was poor hybridisation to subsequent southern

transfers, suggesting that there is poor homology between the O. formigenes oxalyl-CoA t25 decarboxylase and that of P. oxalaticøs. Attempts to clone the fragment that hybridised to the PCR fragment in the initial southern transfer were unsuccessful. 126

Chapter 6

General Discussion and Future Studies

Oxalate-degrading soil bacteria are found in a wide range of soils in South

Australia, from the red sands of the Riverland to the non-wetting sands of the South East to the clay soils of the Adelaide plains. Populations of oxalate-degrading bacteria in these soils appears to be related to the types of plants associated with the soils. Soils supporting the growth of plants containing high concentrations of oxalate had higher populations of oxalate degrading bacteria than soils supporting the growth of plants containing low concentrations of oxalate. A strong population of plants containing high concentrations of oxalate would inevitably lead to high concentrations of oxalate in the soil. One of the roles

of the soil bacteria may be to remove the oxalate from the soil. Oxalate is an end product of metabolism in plants and serves no other purpose other than a possible defence

mechanism against insects and herbivores (James, 1972). The determination of the

population of oxalate-degrading bacæria in the soil is easily achieved using agar Bhat and

Barker medium and counting the number of halo-producing colonies from a known

amount of soil.

Sequencing of the 165 subunit of rDNA proved to be a rapid and effective method

of classifying the bacteria to genus. To classify the bacteria to species using this method

would require 1007o homology. This requirement can be illustrated by the example of

Paracoccus denitrificans and Thiobacitlus versutus being shown to have 99-l7o

homology, resulting in T. versurøs being reclassified as P. versutus (Katayama et al.,

1995). When classifying large numbers of bacteria, it was useful to study restriction

fragment length polymorphisms prior to 165 rDNA sequencing. This markedly reduced

the number of isolates that needed to be classified. Species belonging to the same genus

have quite different RFLP's, as in the case of P. aeruginosa and P. oxalartcus- The use of

RFLP's eliminated the need for DNA restriction profiles which are more time-consuming

to prepare and more difficult to compare. Dot blots were of no comparative value due to t27

marked heterogeneity, even between species of the same genus. Dot blots are only

effective in revealing relatively close relationships (Bendich and McCarthy, 1967)-

Classical biochemical methods are useful for further classification beyond the information

gained by sequencing of the 165 subunit of rDNA. However, in the case of the soil

isolate designated Ox3a, biochemical and microscopic examination will be required for

classification. At best, the Ox3a 165 rDNA was most closely related to that of Ralstonia

eutropha with 887o homology. This is not high enough to classify it as Ralstonia sp.

suggesting that it belongs to a new genus and species.

A study of the enzyme system for oxalate degradation in Paracoccus sp.

demonstrated that the oxalyl-CoA decarboxylase had similar properties to those of P.

oxalaticus (Quayle et a1.,1961) and O. form.ígenes (Allison et a1.,1985). As the enzymes

all appeared to be similar, P. oxalatic¿rs was chosen for initial cloning of the gene for

oxalyl-CoA decarboxylase because the species was well characterised and the enzyme

system was well defined (Quayte and Keech,I959a; Quayle and Keech, 1959b; Quayle

T rt and Keech, 1960; Quayle et aI.,196l; Quayle and Taylor, 196I; Quayle, 1963a; Quayle,

1963b). Since the other isolates belong to the same generic cluster as P. oxalaticus and

Paracoccu.r sp., it is probable that the same mechanisms for oxalate metabolism exist in

these species. However, this would need to be confirmed. Also, nothing is known about

the mechanism of induction of oxalyl-CoA decarboxylase in P. oxalaticus, ot any other

oxalate-degrading bacteria in which it is induced. The enzyme is produced constitutively

in O. formigenes (Allison et a1.,1985)"

Cloning of the gene for oxalyl-CoA decarboxylase from P. oxalatictzs proved

difficult. A number of approaches were tried without success. Selection of E. coli

colonies carrying the cloned oxalyl-CoA decarboxylase gene using plate assays was

unsuccessful because three genes are required for the formation of clear haloes around

colonies grown on an agar medium containing a calcium oxalate precipitate (Quayle et aI.,

1961; Allison et a1.,1985) and therefore all three genes would need to be cloned to

produce haloes around transforme d E. colí colonies. Genes from other species of

v t28

Pseudom.onas which have been cloned in E. coli were found to be poorly expressed from

a Pseudomonas pÍomoter sequence (Ensley et aI., 1983; Schell, 1983; Noda et al-,

1990), suggesting that even if all three genes were successfully cloned, they would be

poorly expressed in E- coli and halo formation may not be evident. This would also make

probing with polyclonal antibodies raised against oxalyl-CoA decarboxylase difficult.

This approach was not attempted with P. oxalaticzs because antibodies raised against

Aspergillus niger oxalate decarboxylase showed no cross-reaction with the P. oxalaticus

protein. This could be expected as the reaction requirements of the two enzymes are

different. Lung et at. (L994) raised antibodies against the oxalyl-CoA decarboxylase

produced by O. formigenes and showed by'Western immunoblotting that the oxalyl-CoA

decarboxylase gene cloned in E. coli produced a protein of the same molecular weight as

the native protein. However, the gene was preceded by an E. colí tac ptomoter, resulting

in the production of large amounts of the eîzyme ín E. coli. Lung et al. (1,994)

constructed the clone in this way so that the gene would be expressed in E. coli.

I Presumably O- formigen¿s promoters are not active in E. coli. U .i I Mutagenesis to form ox- mutants of P. oxalatícus should have been successful.

Inactivation of either the transport protein or formyl-CoA transferase would result in the

production of ox- mutants. However, P. oxalaticas is able to grow on other dicarboxylic

acids and oxalate may be able to enter the cell via other antiports. Oxalyl-CoA

decarboxylase assays using cell-free extracts of P. oxalaricøs (Quayle et a1.,1961) and O.

formigenes (Altison et a1.,1935) showed that acetyl-CoA and succinyl-CoA could be used as CoA donors in the activation of oxalate, suggesting that other acyl-CoA

transferases may be able to replace formyl-CoA transferase. Oxalyl-CoA is then either

decarboxylated by the action of oxalyl-CoA decarboxylase or converted to glyoxylate via

glyoxylic dehydrogenase (Quayle et al., 196l). Therefore, a myriad of mutations are

required to generate ox- mutants of P. oxalaticus and the use of point mutations to

generate mutants may not be of any value. I ox- t r29

Producing a PCR product from P. oxalaticus using primers from the O. a PCR product formigenes oxalyl-CoA decarboxylase gene sequence did not result in specific for oxalate-degrading bacteria. This would suggest that the regions selected for

the primers were not conserved in the oxalyl-CoA decarboxylase gene. Lung et al. Q99a)

sequenced the gene from O. formigenes and this is the only reported sequence for oxalyl- CoA decarboxylase from any species so there is no information available concerning

conserved regions which could be used for PCR primers. Therefore, the most promising

approach appeared to be the use of a PCR product from O. formigenes as a probe- This

probe hybridised to P. oxalaricøs DNA in an initial Southern transfer but attempts to

repeat the experiment failed when the probe only hybridised to itself on membranes- This

would suggest that there is poor homology between the O. formigenes oxalyl-CoA

decarboxylase and that of P. oxalaticzs. The inability to produce a PCR product from P.

oxalaticus,using primers from O. formigenes, which was specific for oxalate-degrading

species supports this theory.

'j ll An approach that was not attempted in this study which could be attempted in the :\ future is N-terminal sequencing of the purified P. oxalaticøs oxalyl-CoA decarboxylase

and the synthesis of a degenerate primer based on the amino acid sequence- Internal

amino acid sequence could be determined by proteolysis of the enzyme with

endoproteinase Lys-C, separation of the resulting fragments by high performance liquid

chromatography, Edman degradation and amino acid sequencing of a suitable fragment.

Another degenerate primer could be synthesised from the amino acid sequence data and

both primers could be used for PCR amplification of the P. oxalaticus oxalyl-CoA

decarboxylase gene. Comparison of the amino acid sequences with that derived for O.

formigenes oxalyl-CoA decarboxylase may indicate the size of the expected fragment.

Direct sequencing of the fragments resulting from PCR and comparison of the data with

the published sequence of the O. formigenes oxalyl-CoA decarboxylase gene sequence

determine which fragment may be suitable for probing a library of P. oxalaticus i would DNA inB. coli to obtain the full length gene.

t 130

poisoning of animals by consumption of oxalate-containing plants is a widespread

phenomenon which is recognised internationally. In most cases, this can be alleviated by

adapting the animals before allowing them to grrze pastures dominated by oxalate-rich

plants. However, adaptation is a time-consuming process. The oxalyl-CoA decarboxylase

gene, when linked with the formyl-CoA transferase gene and the oxalate antiport protein

gene and all preceded by a suitable promoter, could be used to genetically modify a

common rumen bacterium which is always present in high numbers so that the process of

adaptation could be avoided. An extensive study of the genetics of a suitable host would

need to be performed to find a suitable promoter and develop efficient transformation

techniques.

Another area in which the oxalyl-CoA decarboxylase gene could be used is gene

therapy to control calcium oxalate kidney stone formation (Lung et aI-,1994). Oxalic acid

is a product of metabolism in virnrally all life forms and its high rate of synthesis, coupled

with a general inability to catabolise oxalic acid can lead to a rapid accumulation. Gene

therapy using the oxalyl-CoA decarboxylase gene could be developed to alleviate this j1 problem. This applies to both humans and animals.

t I

l I

Ì 131

Appendix 1

165 rDNA sequence data.

Oxla AAGGTG CCTGGCCGTC CCAAGTCGAA Oxlc GCCTTACACA TGCAAGTCGA Ox3a GGATAAGATA AGANGNGANN NGGGGCCGGC CCNA'UU\GN\ Ox3b TTACAGGTC CCGACTCGAA OxLl TCAGCCGTGG OxL2 TCCCA TTAGAAGCCA OxB AATAGA TAAGAAGAGA NGCTTGGGCC OxD CT CCCTAGGCAG AAGCCTGATA

Oxla CGGTAGCTTC GGGAGCAATC CTGGCGGCGA GTGGCGAACG Oxlc ACGGCAGCGC GGGAGCAATC CTGGCGGCGA GTGGCGAACG Ox3a AGNTTTTTTT GGGCTTCGGA CTGGCGGTGA GCGGCGAACG Ox3b CGGAAGCTTT GGGAGCAATC CTGGCGGCGA GTGGCGAACG OxLl ACCGTCCCTA ACNU\CGATT CTTTAGGGGA GCGGCAGACG OxL2 ATAGATCCGC CCN\TA]\'UU\ ATTAAGGGGA GCGGCAGACG OxB GTCCCAAAAA NUU\GATACC TTCGGGGATA GCGGCGGACG t(D GGGCCCACCC A;UUVUU\'\CC TTCGGGGATA GCGGCGGACG

Oxla GGTGAGTAAT ACATCGGAAC GTGCCCAATC GTGGGGGATA Oxlc GGTGAGTA.AT ACATCGGAAC GTGCCCAATC GTGGGGGATA Ox3a GGTGAGTAAT ACATCGGAAC GTGCCCTGTT GTGGGGGATA Ox3b GGTGAGTAAT ACATCGGAAC GTGCCCAÄTC GTGGGGGATA OxLl GGTGAGTAAC GCGTGGGAAT CTACCCAGCT CTACGGAÀTA OxLz GGTGAGTAAC AATTGGGAAT CTACCTAGCT CTACGGAATA OxB GGTGAGTAAC GCGTGGGAAC GTGCCCTTTT CTACGGAATA ol(D GGTGAGTAAC GCGTGGGAAC GTGCCCTTTT CTACGGAATA

Oxla ACGCAGCGAA AGCTGTGCTA ATACCGCATA CGATCTACGG Oxlc ACGCAGCGAA AGCTGTGCTA ATACCGCATA CGATCTACGG Ox3a ACTAGTCGAA AGATTAGCTA ATACCGCATA GGACCTGAGG Ox3b ACGCAGCGAA AGCTGTGCTA ATACCGCATA CGATCTACGG OxLl ACCCAGGGAA ACTTGGACTA ATACCGTATA CGTCCTTCGG Oxl-z ACCCAGGGAA ACTTGGACTA ATACCGTATA CGTCCTTCGG OxB GCCCAGGGAA ACTTGGATTA ATACCGTATA CGCCCTTTTG OxD GCCCAGGGAA ACTTGGATTA ATACCGTATA CGCCCTTTTG r32

Oxla ATGA'U\GCAG GGGATCGCAA GACCTTGCGC GAATGGAGCG Oxlc ATGNU\GCAG GGGACCGCAA GGCCTTGCGC GAATGGAGCG Ox3a GTGNU\GGGG GGGACCGGTA ACGGCCTCGG CAATAGGACG Ox3b ATGAAAGCAG GGGATCGCAA GACCTTGCGC GAATGGAGCG OxLl GAGAAAG AT TT ATCGGAG TT GGAT GAGCC OxLz GAGAAAG AT TT ATCGAÀG TT GGAT GAGCC OxB GGGNU\G AT TT ATCGGAG AA GGAT CGGCC CI(D GGGA;U\G AT TT ATCGGAG AA GGAT CGGCC

Oxla GCCGATGGCA GATTAGGTAG TTGGTGAGGT NU\GGCTCAC Oxlc GCCGATGGCA GATTAGGTAG TTGGTGGGGT AÀAGGCTCAC Ox3a GCCGATGTGT GATTAGGTAG TTGGTGGGGT AAGAGGGTGG Ox3b GCCGATGGCA GATTAGGTAG TTGGTGAGGT AAAGGCTCAC OxLl CGCGTTG GATTAGCTAG TTGGTGGGGT AAAGGCCTAC OxL2 CGCGTTG GATTAGCTAC TTGGTGGGGT NU\GGCCTAC OxB CGCGTTG GATTAGGTAG TTGGTGGGGT AATGGCCTAC OxD CGCGTTG GATTAGGTAG TTGGTGGGGT AATGGCCTAC

Oxla CAAGCCTTCG ATCTGTAGCT GGTCTGAGAG GACGACCAGC Oxlc CAAGCCTTCG ATCTGTAGCT GGTCTGAGAG GACGACCAGC Ox3a CGAGGTGAGG ATTGGTATGT GGTCTGATAG GACGATCAGC Ox3b CAÄ,GCCTTCG ATCTGTAGCT GGTCTGAGAG GACGACCAGC OxLl CAAGGCGACG ATCCATAGCT GGTCTGAGAG GATGATCAGC OxL2 CTTTGTACAT TATATTTATT CTTTCTGACA TGTATCTACG OxB GAAGCCGACG ATCCATAGCT GGTTTGAGAG GATGATCAGC CIÐ CAAGCCGACG ATCCATAGCT GGTTTGAGAG GATGATCAGC

Oxla CACACTGGGA CTGAGACACG GCCCAGACTC CTACGGGAGG Oxlc CACACTGGGA CTGAGACACG GCCCAGACTC CTACGGGAGG Ox3a CACACTGGGA CTGAGACACG GCCCAGACTC CTACGGGAGG Ox3b CACACTGGGA CTGAGACACG GCCCAGACTC CTACGGGAGG OxLl CACACTGGGA CTGAGACACG GCCCAGACTC CTACGGGAGG OxL2 ATCTTTAATT TGTGCATTTC AATAAATCGA TCCCTATTAT OxB CACACTGGGA CTGATACACG GCCCAGACTC CTACGGGAGG ùÐ CACACTGGGA CTGAGACACG GCCCAGACTC CTACGGGAGG

Oxla CAGCAGTGGG GAATTTTGGA CAATGGGCGA AAGCCTGATC Oxlc CAGCAGTGGG GAATTTTGGA CAATGGGCGC AÀGCCTGATC Ox3a AAGCATTGGG GAATTTTGGA CAATGGGGGC AACCGTGATC Ox3b CAGCAGTGGG GAATTTTGGA CAATGGGCGA AAGCCTGATC OxLl CAGCAGTGGG GAATATTGGA CAATGGGCGC AAGCCTGATC OxL2 CTCCAACACC GGGTTTTTTT TTTTTTTTTT TTGGGGACAC OxB CAGCAGTGGG GAATCTTAGA CAATGGGGGC AACCCTGATC OxD CAGCAGTGGG GAATCTTAGA CAATGGGGGC AACCCTGATC 133

Oxla CAGCCATGCC GCGTGCAGGA TGAAGGCCTT CGGGTTGTAA Oxlc CAGCCATGCC GCGTGCAGGA TGAAGGCCTT CGGGTTGTAA Ox3a TAGCAATGCC GCGTGTGTGA AGAAGGCCTT CGGGTTGTAA Ox3b CAGCCATGCC GCGTGCAGGA TGAAGGCCTT CGGGTTGTAA OxLl CAGCCATGCC GCGTGAGTGA TGAAGGCCCT AGGGTTGTAA AxI,z TA.ATANTCGN ACCACAATTG GTGTTCTTCT ATATTTATAT OxB TAGCCATGCC GCGTGAGTGA TGAAGGCCTT AGGGTTGTAA ûxD TAGCCATGCC GCGTGAGTGA TGAAGGCCTT AGGGTTGTAA

Oxla ACTGCTTTTG TACGGAACGA AACGGCTCTT TCTAATAAAG Oxlc ACTGCTTTTG TACGGAACGA AACGGCTCTT TCTN\TA'U\G Ox3a AGCACTTTTG TCCGGA;\'\GA AATCGCGGTG GCTAATACCT Ox3b ACTGCTTTTG TACGGAACGA AACGGCCTTT TCTÆ\TNU\G OxLl AGCTCTTT C AACGGTGAAG ¡l. OxL2 TGCAÀTTCTT CATTCTTTAT OxB AGCTCTTT C AGCTGGGAAG A OxD ÀGCTCTTT C AGCTGGGAAG å

Oxla AGGGCTAATG ACGGTACCGT AAGAATAAGC ACCGGCTAAC Oxlc AGGGCTAATG ACGGTACCGT AAGAÀTAAGC ACCGGCTAAC Ox3a GGCGTGGATG ACGGTACCGG AAGAÀTAAGC ACCGGCTAAC Ox3b AGGGCTAATG ACGGTACCGT AAGAATAAGC ACCGGCTAAC OxLl TAATG ACGGTAACCG TAGAAGAAGC CCCGGCTAAC OxLZ OxB TAATG ACGGTACCAG CAGAAGAAGC CCCGGCTAAC ùÐ TAATG ACGGTACCAG CAGAAGAÀGC CCCGGCTAAC

Oxla TACGTGCCAG CAGCCGCGGT AATACGTAGG GTGCAAGCGT Oxlc TACGTGCCAG CAGCCGCGGT AATACGTAGG GTGCAAGCGT Ox3a TACGTGCCAG CAGCCGCGGT AATACGTAGG TGCGAGCGT Ox3b TACGTGCCAG CAGCCGCGGT AATACGTAGG GTGCAAGCGT OxLl TTCGTGCCAG CAGCCGCGGT AATACGAAGG GGGCTAGCGT OxL2 OxB TCCGTGCCAG CAGCCGCGGT AATACGGAGG GGGCTAGCGT CIÐ TCCGTGCCAG CAGCCGCGGT AATACGGAGG GGGCTAGCGT

Oxla TAATCGGAAT TACTGGGCGT A'U\GCGTGCG CCAGGCGGGT Oxlc TAATCGGAAT TACTGGGCGT NU\GCGTTGC CCAGGCGGTA Ox3a TAATCGGAÄT TACTGGGCGT NU\GCGTG Ox3b TAATCGGAAT TACTGGGCGT NU\GCGTTGC GCAAGGGGTA OxLl TGTTCGGAAT TACTGGGCGT A;U\GCGCACG T AGGCGGAT OxL2 OxB TGTTCGGAAT TACTGGGCGT NV\GCGCACG T AGGCGGAT OxD TGTTCGGAAT TACTGGGCGT NU\GCGCACG T AGGCGGAT t34

Oxla AAT Oxlc ATGTTAA Ox3a Ox3b ATGTAAAACA G Orú1 CGATCAGTTA GGGGTGAAAT CCCAGGGCTC AACCTGGAAC OxL2 OxB TGGAAAGTCG GGGGTGA;U\T CCCGGGGCTC AACCCGGAAT CI(D TGGAAAGTTG GGGGTGAAAT CCCGGGGCTC AACCCCGGAA

Oxla Orlc Ox3a Oßb OxLl TGCTCTAATA CTGTCGACTG OrrLz O)ù GCTC O(D CTGCCT 135

Appendix 2

P. oxalaticus sequence data.

5' -C TGCAGAAGGCCGTGGTGGCGCGATGÀAGAAGCGCGACGAAGTGCACCGCATGGCCGAAGC

C AACAAGGCGTTCTCGCATTTCCGCTTCTAÀGGCGCGCG NUU\'\CGCTGTTGGTTGCCGGGCGG

GCTGTGTTTTCACACATCTCGCCCGTTTGTGTTAÀGGGCGCACGCAGTGAGÀATCC TGCGCC TC -35

AC GGAEAAATAç.AçGATTÀÀAG TGGC TCGTAAGAC TCC CATTGAGCGC TACC GCAATATC GGTA -1-O RBS M A R K T P I E R Y R N I G

TTTCGGCTCACATTGACGCGGGTNUU\CCACCACGACCGAGCGGATCC TGTTCTACAC CGGTGT I S AH I DAG KTTTT E R I L F Y TGV

GAACCACAÀGATCGGTGAAGTGCATGATGGCGC GGC CAC CATGGAC TGGATGGAGCAGGAGCAG NHKIGEVHDGAATMDWMEOEO

GAGCGTGGCATCACGATCACC TCCGC TGCCACC ACGGCC TTC TGGAAGGGCATGGGCGGCAAC T ERGTTITSAATTAFWKGMGGN

ACCCCGAGCACCGC TTCAACATCATCGACACCC CGGGCCAC GTGGAC TTCACCATCGAGGTGGA YPEHRFNIIDTPGHVDFTIEVE

GCGTTCCATGCGCGTGC TGGAC GGCGC GTGCATGGTGTAC TGCGCAGTGGGTGGCGTGCAGCCG RSMRVLDGACMVYCAVGGVOP

CAGTCGG A;U\CTGTC TGGCGCCAGGCC AAC AAGTACGGCGTGCCGCGTCTGGCATTCGTCAACA O S E TVWR O AN K Y G V P R L A F VN

AGATGGACC GTACCGGCGCGAACTTC TTCAAGGTTTACGACCAGC TGAAGAC CCGCC TGAAGGC KMD R T G AN F F KVY D O L K T RL KA

CAACCCGGTGCCCGTCGTGGTGCCGATCGGCGC TGAAGACGGC TTC CAGGGC GTCGTCGATC TG N PV PVVV P I GA E D G F O GVVD L

C TGGAAATGAAGGCGATCATC TGGGAC GAÀGCC AGCCAGC TGAGGTTCGAATACCAGGACATCC L EMKA T I WD EA S O L R F E YOD I 136

CGGCAGAAC TGCAAGCCACCGC TGACGAATGGC GCGAGAÀGATGGTCGAGTC CGCCGCCGAAGC P A E L O ATAD EWR E KMV E S AA E A

CAGCGAAGAGCTGATGG NUU\GTACC TGGGCGGCGAAGAGC TGACC CGCGCC GAGATC GTCAAG SEELMEKYLGGEELTRAEIVK

GCGC ÎGCGTGACCGTACCATC GCC TGC GAAATCCAGCCGATGC TGTGCGGCACCGCGTTCAAGA AL RDR T I AC E I Q PML C G TAF K

ACAAGGGCGTGCAGC GTATGC TCGACGCCGTGATCGAC TTCC TGCC GTCGCC GGTCGATATTCC NKGVO RMLDAV I D F L P S PVD I P

GCC GGTCAAGGGCGTGGAC GAAAGCGACGACGAGAAGAAGC TCGAGCGCAAGGCCGAC GACAAC PVKGVDESDDEKKLERKADDN

GAGAAGTTC TCGGCGC TGGCGTTCAAGATCATGAC CGAC CC GTTCGTCGGCC AGC TGATC TTC T EKFSALAFKIMTDPFVGOLIF

TCC GCGTC TAC TCGGGCAAGATCAATTCGGGCGACACCG TGTACAACCCGGTGAAGCAGAAGAA F RVY S G K T N S G D TVYN PV KO K K

GGAGCGTCTGGGCCGTATTC TGCAGATGCACGC CAACCGGCGCGAGG NU\TC AAGGAAGTGC TG E R L G R T L OMHANR R E E I K E VL

GCCGGCGACATCGCC GCTGCGGTGGGC C TGAAGGATGCC AC CACGGGCGATACGC TGTGCGATC AG D I AAAVG L K DA T T G D TL C D

CGGC TGCCC CGATCGTGCTCGAGCGCATGGTGTTCCCGGAGCC GGTGATC TC GCAGGC TGTCGA P AA P I VL E RMVF P E PV I S OAVE

GCCGAAGACCAAGGC TGACCAGGNUU\GATGGGCATCGC CCTGAACCGCCTGGCCGCTGAAGAT P K T KAD O E KMG I A L NR L AA E D

CCGTCGTTCCGTGTGCGTACCGATGAAGAATCGGGCCAGACCATCATTTCGGGCATGGGCGAGC P S F RVRTDE E S GO T I I S GMGE

TCCACCTCG AJU\TTC TGGTCGACCGCATGAAGC GCGAATTCGGCGTGG AAGC C AACATCGGCGC LHLEILVDRMKREFGVEANIGA

GCC GCAGGTGGCC TACCGCG N\'\CCATTC GCAAGAAGGC CGAGGAC GTCGAGGGCAAGTTCGTC POVAYRETIRKKAEDVEGKFV

AAGCAGTCGGGCGGC CGTGGC CAGTAC GGTCAC GCCGTGATCACGC TGG AAC CGC AAGAACCGG K O S G G R G O Y G H AV I T L E P A E P 137

GCAAGGGC TTCGAATTCATCGACGCCATCA.A,GGGCGGTGTGATTCC TCGCGAATACATCCCGGC G KG F E F T DA T KGGV I PRE Y T PA

GGTCGAGAAGGGTATCGTCGACACGCTGCCGGC CGGTATCC TGGCTGGC TTC CCGGTGGTAGAC V E K G I VD T I, P A G I L A G F PVV D

GTGAAGGTCACGC TGAC GTTC GGTTCG TACCAC GACGTGGAC TCGAACG A;UU\CGCGTTCCGCA V KV T L T F G S YH DVD S NE NAF R

TGGCCGGC TCGATGGC TTTCAAGGAAGCCATGC GCAAGGCCAGCCC GGTTC TGC TCGAGCCGAT MAG S MAF K E AMR K A S PV L L E PM

GATGGCCGTGGAAGTGGAAAC GCCGGAAGAC TACACGGGTAC CGTGATGGGC GAC TTGTCGTCC MAV EV E T P E DY TG TVMG D L S S

CGC CGCGGC ATCGTGCAGGGCATGGACGACATGGTGGGC GGCGGCAAGATCATCAAGGCCGAAG R RG I VOG MD DMVG G G K I I KA E

TCC CGCTGTCGG NU\TGTTCGGTTATTCCACGC TGCGC TCGGC CAC GCAAGGCCGCGC TACGTA V P L S EMF GY S T L R S ATOG RATY

CAC CATGGAATTCAAGCAC TACGCAGAGGCACC GAAGAACATCGCCGAAGCC GTGATGACGGCC TME F K H Y AE A P KN I A E AVM TA

AAGGGC AAGCAGTA'\'V\GCTT- 3' KGKO

Nucleotide sequence 5' to 3' and corresponding amino acid sequence of the gene cloned

using the PCR product from P. oxalaticus DNA as a probe. The proposed ribosome

binding site (RBS) is underlined with a dotted line (...) and the proposed -35 and -10

promoter sequences are underlined with a solid line (-). Stop codons in all three

reading frames, just upstream from the putative translational initiation codon are in bold

text. 138

AppendÍx 3

Comparison of the P. oxalatícus elongation factor G with that from .E[. influenzøe using the Basic Local Alignment Search Tool (Altschul et al., 1990). >spl P43925 IEFG-HAEIN ELONGATION FACTOR G (EF-G) . rpirl lF64078 elongation factor G (fusA) homolog Haemophílus influenzae (strain Rd xw20) >gilL2O4829 (U0OO14) elongation factor G IHaemophilus influenzael >gi11-22251'l (U32848) translation elongation facLor G IHaemophilus inf luenzae] Length = 700 Score = 744 (340.8 bits), Expect = 5.3e-130, Sum P(2) = 5 .3e-13 0 Identities Query: 82 DEKKLERKADDNEKF SALAFK IMTD PFVGQL I FFRVY SG KINSGDT\TYNPVKQKKERLGR 1- 4 1. DE + ER A D E FS+LAFKI TDPFVG L FFRVYSG TNSGDTV N V+QK+ER GR DETEGERHASDEE PF S S LAFK I ATDPFVGNLTF FRVY SGVTNSGDWLNSVRQKRERFGR 3 6 O Sbjct: 301 Query: L42 I LQMHANRREE T KEVLAGD T NUryGLKDATTGDTLCD PAAP IVL ERMVF PE PVI SQAVE P 2 O 1- I+QMHAN+REEIKEV AGDTN\j\+GLKD TTGDTLC API+LERM FPEPVIS AVEP IVQMHANKREE I KEVRAGDI A'U\T GLKDVTTGDTLCAI DAP I I LERMEF PE PVI SVAVEP 42 O Sbjct: 361 Query: 202 KTKADQEKMG IALNRLAAED P S FRVRTDEE S GQTI I SGMGE LHLE I LVDRMKREFGVEAN 2 6 1 KTKADQEKMG+AL RLA EDPSFRV TDEESG+TITSGMGELHL+T+VDRMKREF VEAN KTKADQEKMGLALGRLAQED P S FRVHTDEE SGE TT I S GMGELHLD I IVDRMKRE FI{VEAN 4 8 O Sbj ct. : 421- Query: 262 IGAPQ 266 IG PQ sbjcr: 481 IGKPQ 485 Score = 235 (107.6 bits), Expect = 5.3e-130, Sum P(2) = 5.3e- r-3 0 (69fà) rdentities = 45/83 (542) , positives = 58/83 Query: 1 MVE SAAEAS E ELMEKYLGGEE LTRÀE IVKALRDRTI AC E I Q PMLCGTAFKNKGVQRMLDA 6 O +VE+AAEASEELMEKYLGGE+LT EI ALR R +A EI + CG+AFKNKGVQ MLDA LVE NU\EAS EELME KYLGGEDLTEEE I KSALRQRVLANE I I LVTCG SAFKNKGVQA}4LDA 2 8 1 Sbjct: 222 Query: 6]. VIDFLPSPVDTPPVKGVDESDDE 83 V+++LP+P DIP +KG++ + E Sbj ct : 282 WEYLPAPTDIPAIKGTNPDETE 3 04 139

References

Abe, K., Z. Ruan and P. C" Maloney (1996) "Cloning, Sequencing and Expression in

Escherichia coli of OxlT, the Oxalate:Formate Exchange Protein of Oxalobacter

formigenes." J. Biol. Chem., 271, p. 6789-6793.

Achen, M. G., B. E. Davidson and A. J. Hillier (1986) "Construction of Plasmid

Vectors for the Detection of Streptococcal Promoters." Gene, 45,p.45-49"

Allison, M. J., E. T. Littledike and L. F. James (1977) "Changes in Ruminal Oxalate

Degradation Rates Associated with Adaptation to Oxalate Ingestion." J. Anim.

Sci., 45, p. 1173-1179.

Allison, M. J., H. M. Cook and K. A. Dawson (1931) "selection of Oxalate-Degrading

Rumen Bacteria in Continuous Cultures." J. Anim. Sci.,53., p. 810-816'

Allison, M. J., K. A. Dawson, W. R. Mayberry and J. G. Foss (1985) "Oxalobacter

formigenes gen. nov., sp. nov.: Oxalate-Degrading Anaerobes that Inhabit the

Gastrointestinal Tract." Arch. Microbiol., l4l, p. l-7 .

Altschul, S. F., W. Gish, W. Miller, E. W. Myer and D. J. Lipman (1990) "Basic Local

Alignment Search Tool." J. Mol. Biol., 215, p. 403-410-

Amann, R. I., W. Ludwig and K. H. Schleifer (1995) "Phylogenetic Identification and in

si¿a Detection of Individual Microbial Cells Without Cultivation." Microbiol.

Rev., 51, p. 143-169"

Anantharam, V., M. J. Allison and P. C. Maloney (1989) "Oxalate:Formate Exchange:

The Basis for Energy Coupling in Oxalobacter." J. Biol. Chem., 264, p.7244-

7250.

Andrews, E. J. (1971) "Oxalate Nephropathy in a Horse." J. Amer. Vet. Med. Assoc.,

159. o. 49-52. t40

Annison, E. F. (1954) "studies on the Volatile Fatty Acids of Sheep Blood with Special

Reference to Formic Acid." Biochem. J.,58, p. 670-680'

Anon. (1962) "A New Look at Soursob." Sth' Aust. J. Agric., é5., p' 414-418'

Anon. (1965) "Two-Pronged Attack on Soursob." Rural Research in C.S.I'R.O', No. 2, p.30-33.

Anthony, C., and L. I. Zatman (1964) "The Microbial Oxidation of Methanol. I.

Isolation and Properties of Pseudomonas sp.M27." Biochem. 1.,92, p. 609-

6r4.

Armentrout, R. W., and R. D. Brown (1981) "Molecular Cloning of Genes for

Cellobiose Utilisation and their Expression in Escherichia coli-" Appl.Environ'

Microbiol., 4I, p. 1355-1362.

Atlas, R. M. (1993) Handbook of Microbiological Media (L. C. Parks, ed) (CRC Press) p.492,523.

Attwood, G. T., R. A. Lockington, G. P. Xue and J. D. Brooker (1988) "Use of

Unique Gene Sequence as a Probe to Enumerate a Strain of Bacteroides

ruminicolalntroduced into the Rumen." Appl. Environ. Microbiol., fl,p.534-

539.

Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith

and K. Struhl (1994) Current Protocols in Molecular Biology (John Wiley and

Sons, Inc.).

Avaniss-Aghajani, E., K. Jones, A. Holtzman, T. Aronson, N. Glover, M. Boian, S.

Froman and C. F. Brunk (1996) "Molecular Technique for Rapid Identification

of Mycobacteria." J. Clin. Microbiol. , U, p.98- 102. t4t

Avaniss-Aghajani, E., K. Jones, D" Chapman and C. Brunk (1994) "A Molecular

Technique for Identification of Bacteria Using Small Subunit Ribosomal RNA

Sequences." BioTechniques, l'7 , p. 144-149.

Baetz, A. L. and M. J. Allison (1989) "Purification and Characterisation of Oxalyl-

Coenzyme A Decarboxylase from Oxalobacter formigenes." J. Bacteriol.,lTl,

p. 2605-2608.

Baetz, A. L., and M. J. Allison (1990) "Purification and Characterisation of Formyl-CoA

Transferase from Oxalobacter formi g e ne s." ! . B acteriol., 11 2, p. 3537 -3540.

Bagdasarian, M., and K. N. Timmis (1981) "Host:Vector Systems for Gene Cloning in

Pseudomonas." In: Current Topics in Microbiology and Immunology (P. H.

Hofschneider and W. Goebel, eds.) (Springer Verlag, Berlin) p.47-67 -

Bagdasarian, M., R. Lurz, B. Ruckert, F. C. H. Franklin, M. M. Bagdasarian, J. Frey

and K. N. Timmis (1981) "specific-purpose Plasmid Cloning Vectors. II"

Broad Host Range, High Copy Number, RSF 1010-derived Vectors and a

Host-vector System for Gene Cloning in Pseudomonas." Gene, 16, p. 237-247.

Balcke, P. (1985) "Oxalic Acid in Chronic Renal Insufficiency." Wiener Klinische 'Wochenschrift, Pl, p. 15.

Balcke, P., P. Schmidt, J. Zazgornik, H. Kopsa and A. Haubenstock (198a) "Ascorbic Acid Aggravates Secondary Hyperoxalemia in Patients on Chronic

Hemodialysis." Annals of Internal Medicine, 101, p.344-345.

Barker, J. (1960) "soursob Poisoning." Dept. Agric., Sth. Aust., Leaflet No. 3595

Bassalik, K. (1913) "Über die Verarbeitung der Oxalsäure durch Bacillus extorquens n.

sp." Jahrbüecher für'Wissenschaftliche Botanik, 53, p. 255-302-

Beijer, W. H. (1952) "Methane Fermentation in the Rumen of Cattle." Nature, 170, p.

57 6-577 . r42

Belas, R., A. Mileham, D. Cohn, M. Hilmer, M. Simon and M. Silverman (1982)

"Isolation and Expression of the Luciferase Genes from Vibríon harveyi."

Science, 2I8, p. 791-793.

Bendich, A. J., and B. J. McCarthy (1970) "Ribosomal RNA Homologies among

Distantly Related Organisms." Proc. Natl. Acad. Sci. USA,6, p. 349-356.

Bhat, J. V. (1966) "Enrichment Culture Technique." J. Sci. Ind. Res. New Delhi ,23, p.

450-454.

Bhat, J. V. and H. A. Barker (1943) "studies on a New Oxalate-Decomposing

Bacterium, Vibrio oxaliticus." J" Bact.,55., p. 359-368'

Biek, D. E., and J. R. Roth (1980) "Regulation of Tn5 Transposition in Salmonella

typhimurium." Proc. Natl. Acad. Sci. USA,L,p.6047-605t-

Black, J. M. (1986) Flora of South Australia (Second edition) (J. P. Jessop and H. R.

Toelken, eds.) (South Australian Government Printing Division).

Blackmore, M. 4., and J. R. Quayte (1968) "Choice Between Autotrophy and Heterotrophy in Pseudom.onas oxalaticus-" Biochem . 1., !U, p- 705-713-

Blakemore, M. A., and J. R. Quayle (1970) "Microbial Growth on Oxalate by a Route

not Involving Glyoxylate Carboligase." Biochem. J., 118, p. 53-59.

Block, B. J. (1952) Paper Chromatography: A Laboratory Manual (R. LeStrange and G"

Zweig, eds) (Academic Press Inc.) p. 20.

Borden, T. 4., and C. D. Bidwell (1968) "Treatment of Acute Ethylene Glycol

Poisoning in Rats." Invest. Urol., Q, p.205-210.

Bove, K. E. (1966) "Ethylene Glycol Toxicity." Amer. J. Clin' Path.,45, p. 46-50. r43

Bradford, M. M. (1976) "4 Rapid and Sensitive Method for the Quantification of

Microgram Quantities of Proæin Utilising the Principle of Protein-Dye Binding." Anal. Biochem., 2, p.248-254.

Brenner, D. J., M. A. Martin and B. H. Hoyer (1932) "Deoxyribonucleic Acid

Homologies among some Bacteria-" J. Bacteriol., 2!,p. 486-487.

Bricker, J., M. H. Mulks, A. G. Plaut, E. R. Moxon and A. Wright (1983) "IgA1 Proteases íf Haemophilus influenzae: Cloning and Characterisation in

Escherichia coliK-Lz." Proc. Natl. Acad. Sci. USA, 80, p. 2681-2685-

Brock, T. D., and M. T. Madigan (1988) "Biology of Microorganisms." (5th edition)

(Prentice-Hall Internaional) p. 104.

Brunk, C. F., E. Avaniss-Aghajani and C. A. Brunk (1996) "A Computer Analysis of

Primer and Probe Hybridisation Potential with Bacterial Small-Subunit rRNA

Sequences." Appl. Environ. Microbiol. , Q, p- 812-879.

Bull, L. B. (1929) "Poisoning of Sheep by Soursobs (Oxalis cernua): Chronic Oxalic

Acid Poisoning." Aust. Vet. J.,5, p. 60-69.

Carroll, E. J., and R. E. Hungate (1955) "Formate Dissimilation and Methane Production

in Bovine Rumen Contents." Arch. Biochem. Biophys., 5é, p. 525-536.

Catt, M. J. (1972) "Soursob Control." Sth. Aust. Dept. Agric. Spec. Bull., No. 5.72.

Chandra, T. S., and Y. I. Shethna (9175) "Isolation and Characterisation of some New

Oxalate-decomposing Bacteria." Ant. Leeuw. J. Micrbiol. Serol., 41, p. 101- il1

Church, D. C. (1919) "Digestive Physiology and Nutrition of Ruminants." (Oxford

Press) p.374-376. t44 clarke, R. G., Y.-J. Hu, M. F. Salmon and K.-J. Cheng (1992) "Cloning and

Expression of an Amylase Gene from Streptococcus bovis in Escherichia coli."

Arch. Microbiol., I57, p. 20I-204.

Consden, R., A. H. Gordon and A. J. P. Martin (1944) "Qualitative Analysis of

Proteins: Partition Chromatography Method Using Paper." Biochem. J',38, p.

224.

Cook, D. A. and L. M. Henderson (1969) "The Formation of Oxalic Acid from the Side

Chain of Aromatic Amino Acids in the Rat." Biochim. Biophys. Acta, !&1, p.404-41r.

Cotta, M. A., and T. R. Whitehead (1993) "Regulation and Cloning of the Gene

Encoding Amylase Activity of the Ruminal Bacterium, Streptococcus bovis."

Appl. Environ. Microbiol., 59., p. 189-196.

Crawhall, J. C., R. R. de Mowbray, E. F. Scowen and R. W. E. Watts (1959)

"Conversion of Glycine to Oxalate in a Normal Subject." The Lancet, 2, p. 810.

Cronin, E. H. (1965) "Ecological and Physiological Factors Influencing Chemical

Control of Halogeton glomerat¿¿s." U.S. Dept. Agric. Tech. Bull., 1325.

Daniel, S. L., P. A. Hartman and M. J. Allison (1937) "Microbial Degradation of Oxalate

in the Gastrointestinal Tracts of Rats." Appl. Environ. Microbiol., 53., p. 1793-

1797.

Datta, P. K., and B. J. D. Meeuse (1955) "Moss Oxalic Acid Oxidase. A Flavoprotein."

Biochim. Biophys. Acta,lZ, p. 602-603.

Davis, D. H., R. Y. Stanier, M. Doudoroff and M. Mandel (1970) "Taxanomic Studies

on some Gram-negative Polarly Flagellated 'Hydrogen Bacteria' and Related

Species." Arch. Mikrobiol., @, p. 1-13. t45

Davison, J., M. Heusterspreute, N. Chevalier, V. Ha-Thi and F. Brunel (1987) "Vectors

with Restriction Site Banks. V. pJRD215, a Wide-Host-Range Cosmid Vector

with Multiple Cloning Sites." Gene, 51, p. 275-280-

Dawson, K. 4., M. J. Allison and P. A. Hartman (1980a) "Isolation and Some

Characteristics of Anaerobic Oxalate-Degrading Bacteria from the Rumen."

Appl. Environ. Microbiol.,4,, p. 833-839.

Dawson, K. 4., M. J. Altison and P. A. Hartman (1980b) "Characteristics of Anaerobic

Oxalate-Degrading Enrichment Cultures from the Rumen"" Appl. Environ-

Microbiol., 40, p. 840-846.

Dehning, I. and B. Schink (1939) "Two New Species of Anaerobic Oxalate-Fermenting

Bacteria, Oxalobacter vibrioformis sp. nov. and Clostridium oxalicum sp.

nov., from Sediment Samples." Arch. Microbiol., -153, p-79-84.

Deichmann, 'W. B., and H. W. Gerarde (1964) "symptomatology and Therapy of

Toxicological Emergencies." (Academic Press) p. 303.

Delong, F. E. (1992) "Archaea in Coastal Marine Environments." Proc. Natl. Acad. Sci

USA,89, p. 5685-5689.

Delong, F. E., K. Y. Wu, B. B. Prezelin and R. V. M. Jovine (1994) "High Abundance

of Archaea in Antarctic Marine Picoplankton." Nature, fl, p. 695-697 -

Dent, C. E. (1948) "A Study of the Behaviour of Some Sixty Amino Acids and Other Ninhydrin-Reacting Substances on Phenol-'Collidine' Filter-Paper

Chromatogr¿uns, with Notes as to the Occurrence of Some of Them in Biological

Fluids." Biochem. 1.,43, p. 169.

Dijkhuizen, L., B. van der Werf and W. Harder (1980) "Metabolic Regulation in

Pseudomonas oxalaticus OX1. Diauxic Growth on Mixtures of Oxalate and

Formate or Acetate." Arch. Microbiol., 124, p.261-268. 146

Dodson, M. E. (1959) "Oxalate Ingestion Studies in the Sheep." Aust. Vet. J., 35,

p.225-233.

Doetsch, R. N., R. Q. Robinson and J. C. Shaw (1953) "Catabolic Reactions of Mixed

Suspensions of Bovine Rumen Bacteria." J" Dairy Sci., S, p. 825-831'

Doudoroff, M., and N. J. Palleroni (1975) "Description of Pseudomonas." In: Bergey's

Manual of Determinative Bacteriology (8th edition) (R. E. Buchanan and N. E.

Gibbons, eds.) (The V/illiams and Wilkins Company, Baltimore) p.2I7-238.

Dougall, H. W., and F. H. Birch (1967) "Further Experimants on the Acid Grass Setaria

sphacelata." Plant and Soil, 26, p.85-98.

Druguet, M. and M. B. Pepys (1977) "Enumeration of Lymphocyte Populations in

Whole Peripheral Blood with Alkaline Phosphatase-Labelled Reagents." Clin. Exp. Immunol., P, p. 162-161.

Elder, T. D. and J. B. V/yngaarden (1960) "The Biosynthesis and Turnover of Oxalate in

Normal and Hyperoxaluric Subjects." J. Clin. Invest., 39, p. 1337-1344-

Emerson, P. M., J. H. Wilkinson and W. A. Withycombe (1964) "Effect of Oxalate on

the Activity of Lactate Dehydrogenase Isozymes." Nature ,2Q., p. 1337-1338.

Emiliani, E. and P. Bekes (1964) "Enzymatic Oxalate Decarboxylation in Aspergillus

niger." Arch. Biochem. Biophys., 105, p. 488-493.

Engebrecht, J., K. Nealson and M. Silverman (1983) "Bacterial Bioluminescence:

Isolation and Genetic Analysis of Functions from Vibrio fischeri." Cell, p, p.

773-78r.

Ensley, B. D., B. J. Ratzkin, T. D. Osslund, M. J. Simon, L. P. Wackett and D. T.

Gibson (1983) "Expression of Naphthalene Oxidation Genes in Escherichia coli

Results in the Biosynthesis of Indigo." Science,222,p- 167-169- r47

Erden, F., A. Hacisalihoglu,Z. Kocer, B. Simsek and S' Nebiogtu (1985) "Effects of

Vitamin C Intake on V/hole Blood Plasma, Leukocyte and Urine Ascorbic Acid

and Urine Oxalic Acid Levels." Acta Vitam. Enzym-,1,p.I23-I30.

Erlich, H. 4., S. N. Cohen and H. O. McDevitt (1973) "A Sensitive Radioimmunoassay

for Detecting Products Translated from Cloned DNA Fragments." Cell, .1.?., p.

681-689.

Erwin, E. S., G. J. Marco and E. M. Emery (1961) "Volatile Fatty Acid Analysis of

Blood and Rumen Fluid by Gas Chromatography." J. Dairy Sci., ![, p. 1768-

1770.

Espejo, E. and E. Agosin (1991) "Production and Degradation of Oxalic Acid by Brown

Rot Fungi." Appl. Environ. Microbiol., 57, p. 1980-1986.

Ewart, A. J. (1909) "The'Weeds, Poison Plants, and Naturalized Aliens of Victoria."

I (Government Printer) p. 17. Lf

'1i Farinelli, M. P., and K. E. Richardson (1983) "Oxalate Synthesis from[l4Ct]Glycolate

and llaCt]Glyoxylate in the Hepatectomised Rat." Biochim. Biophys. Acta,

7 57 , p. 8-14.

Fellstrom,8., B. G. Danielson, B. Karlstrom, H. Lithell, S. Ljunghall, B. Vessby and

L. V/ide (1984) "Effects of High Intake of Dietary Animal Protein on Mineral

Metabolism and Urinary Supersaturation of Calcium Oxalate in Renal Stone

Formers." Br. J. Urol.,5é, p. 263-269.

Fiedler, S., A. Friesenegger and R. Wirth (1989) "Electroporation: A General Method

for Transformation of Gram-negative Bacteria." In: Genetic Transformation and

Expression (L. O. Butler, C. Harwood and B. E. B. Moseley, eds.) (Intercept

Ltd., England) p. 205-219. 148

Fiedler, S., and R. Wirth (198S) "Transformation of Bacteria with Plasmid DNA by

Electroporation." Anal. Biochem., 170, p.38-44-

Finegold, S. M., W. J. Martin and E. G. Scott (1978) In: Diagnostic Microbiology: A

Textbook for the Isolation and Identification of Pathogenic Microorganisms (C.

V. Mosby, ed.) (C. V. Mosby Co., Saint Louis).

Fleming, C. E., M. R. Millar and L. R. Vawter (1923) "The Greasewood as a Range

Plant Poisonous to Sheep." University of Nevada Expt. Sta. Bull., 115, p. 1-

22.

Fuhrmann, J. 4., K. McCallum and A. A. Davis (1993) "Phylogenetic Diversity of

Subsurface Marine Microbial Communities from Atlantic and Pacif,rc Oceans."

Appl.Environ. Microbiol., Ð,, p. 1294-1302"

Gambardella, R. L. and K. E. Richardson (1978) "The Formation of Oxalate from

'i Hydroxypyruvate, Serine, Glycolate and Glyoxylate in the Rat." Biochim' tf ì: Biophys. Acta, !!!, p. 315-328.

Gantotti, V. 8., K. L. Kindle and S. V. Beer (1981) "Transfer of the Drug-Resistance

Transposon Tn5 to Erwinia herbicola and the Induction of Insertion Mutations."

Curr. Microbiol., 6, p.377-38I.

Gardiner, M. R. (1963) "The Effect of Oxalate-Containing Plants on Ruminants." West.

Aust. J. Dept. Agric.,4, p. 153-156"

Gardner, C. 4., and H. W. Bennetts (1956) "The Oxalis Family." In: The Toxic Plants 'Wesæm of Australia. (West Australian Newspapers Ltd') p. 116-119.

Gessner, P. K., D. V. Parke and R. T. Williams (1961) "studies in Detoxication 86. The

Merabolism of l4c-labelled Ethylene Glycol." Biochem. 1., 7 9, p. 482-489.

I Giovannoni, S. J., T. B. Britschgi, C. L. Moyer and K. G. Field (1990) "Genetic

Diversity in Sargasso Sea Bacterioplankton." Nature, 345,p.60-63. I r49

Glick, B. R., and J. J. Pasternak (1939) "Isolation, Characterization and Manipulation of

Cellulase Genes." Biotech. Adv., 7, p.361-386. ì:l

Grund, 4.D., and I. C. and Gunsalus (1983) "Cloning of Genes for Naphthalene

Metabolism in Pseudomnnas putida." J. Bacteriol., 156, p. 89-94.

Grunstein, M., and D. Hogness (1975) "Colony Hybridisation: A Method for the

Isolating of Cloned DNA's that Contain a Specific Gene." Proc. Natl. Acad.

Sci. USA, 72, p.3961.

Hacker, J. B., and R. J. Jones (1969) "The Setaria sphacelata Complex - A Review."

Tropical Grasslands,3, p. 13-34.

Hanahan, D. (1985) "Techniques for Transformation of E. coli." In: DNA Cloning. I

(D. M.Glover, ed.) (IRL Press, Oxford, England) p- 109-135.

Harder, W. (1973) "Microbial Metabolism of Organic Cl and C2 Compounds." Antonie

T ü van Leeuwenhoek,39, p. 650-652"

Harker, M., J. Hirschberg and A. Oren (1998) "Paracoccus marcusii sp. nov., an Orange

Gram-negative Coccus." fnl J. Sys. Bacteriol., 48, p. 543-548-

Heffron, F. (1933) "Tn3 and Its Relatives." In: Mobile Genetic Elements (J. A. Shapiro,

ed.) (Academic Press Inc., New York) p.223-260.

Helfman, D. M., J. R. Feramisco, J. C. Fiddes, G. P. Thomas and S. H. Hughes

(1983) "Identification of Clones that Encode Chicken Tropomyosin by Direct

Immunological Screening of a cDNA Library." Proc. Natl. Acad. Sci. USA,80,

p. 31-35.

Hickinbotham, A. R., and W. G. Bennett (1931) "soursob Troubles." Sth. Aust. J. Ì Agric., 34, p. t255-I259.

r 150

Hodgkinson, A. (1977) "Oxalic Acid in Biology and Medicine." Academic Press,

London/l'{ew York.

Hodgkinson, A. (1978) "Oxalic Acid Metabolism in the Rat." J. Nutr., 108, p. 1155-

1 161.

Hohn, 8., and J. Collins (1980) "A Small Cosmid for Efficient Cloning of Large DN.A.

Fragments." Gene, 11, p. 291-298.

Hoyer, B. H., B. J. McCarthy, and E. T. Bolton (1964) "A Molecular Approach in the

Systematics of Higher Organisms." Science, 144, p. 959-967 -

Hudman, J. F. and K. Gregg (1989) "Genetic Diversity among Strains of Bacteria from

the Rumen." Current Microbiol., 19, P. 313-318.

Hungate, R. 8., W. Smith, T. Bauchop, I. Yu and J.-C. Rabinowitz (1970) "Formate as

an Intermediate in the Bovine Rumen Fermentation." J. Bacteriol., 102, p. 389-

ùf 397. ','' I

Huntington, G. 8., and R. J. Emerick (1984) "Oxalate Urinary Calculi in Beef Steers."

Amer. J. Vet. Res., i15, p. 180-182.

Hurst, E (1942) "The Poison Plants of N.S.V/." (The Snelling Printing Works Pty. Ltd.)

p. 201.

Huynh, T. V., R. A. Young and R.'W. Davies (1984) "Construction and Screening

cDNA Libraries in Àgt10 and Àgtl1." In: DNA Cloning: A Practical Approach,

Vol. 1. (D.M. Glover, ed.) (IRL Press, Oxford) p.49-78.

Jaeger, P., L. Portmann, A. F. Jacquet and P. Burckhardt (1986) "Pyridoxine can Restore Oxaluria to Normal in Idiopathic Kidney Stone Formation."

1 16, p. 1783-1786. I Schweizerische Medizinische'Wochenschrift,

r 151

Jakoby, W. B. and J. V. Bhat (1953) "Microbial Metabolism of Oxalic Acid." Bacteriol"

Rev., 22, p.75-80.

Jakoby, W. B., E. Ohmura and O. Hayaishi (1956) "Enzymatic Decarboxylation of

Oxalic Acid." J. Biol. Chem., 222, p. 435-446.

James, H. M., R. Bais, J. B. Edwards, A. M. Rofe and R. A. J. Conyers (1982)

"Models for the Metabolic Production of Oxalate from Xylitol in Humans: A

Role for Fructokinase and Aldolase." Aust. J. Exp. Biol. Med. Sci., fQ, p. 117-

t22.

James, L. F. (1972) "Oxalate Toxicosis." Clin. Tox., t, p. 23I-243'

James, L. F. (1978) "Oxalate Poisoning in Livestock." In: Effects of Poisonous Plants on Livestock. (Eds. R. F. Keeler, K. R. Van Kampen and L. F. James)

(Academic Press) p. 139-145.

James, L. F., and E. H. Cronin (I974) "Management Practices to Minimize Death Losses

of Sheep Grazing Halogeton-Infested Range." J. Range Managemefit,U-,P"

424-426.

James, L. F., and J. E. Butcher (1972) "Halogeton Poisoning of Sheep: Effect of High

Level Oxalate Intake." J. Anim. Sci., $, p' 1233-1238-

James, L. F., J. C. Street and J. E. Butcher (1967) "In vitro Degradation of Oxalate and

of Cellulose by Rumen Ingesta from Sheep Fed Halogeton glomeratu.t. "J.

Anim. Sci., b, P. 1438-t444.

James, M. P., A. A. Seawright and D. P. Steele (1971) "Experimental Acute Ammonium

Oxalate Poisoning of Sheep'" Aust. Vet. J., 47 , p- 9-17 "

Jayasuriya, G. C. N. (1955) "The Isolation and Characteristics of an Oxalate-

decomposing Organism." J. Gen. Microbiol., 12, p.419-428' 152

Johnson, I.L. (L973) "Use of Nucleic Acid Homologies in the Taxonomy of Anaerobic

Bacteria." Int. J. Syst. Bactenol.,23, p. 308-315.

Johnson, P. A., M. C. Jones-Mortimer and J. R. Quayle (1964) "Use of a Purified Bacterial Formate Dehydrogenase for the Micro-Estimation of Formate."

Biochim. Biophys. Acta, 89, p. 351-353.

Jones, R. J., A. A. Seawright and D. A. Little (1970) "Oxalate Poisoning in Animals

Grazingthe Tropical Grass Setaria sphacelata." J. Aust. Inst. Agric. Sci., 3é, p.

4t-43"

Jubb, K. V. F., and P. C. Kennedy (1963) "Pathology of Domestic Animals Yol.2."

(Academic Press) p. 258.

Katayama, Y., A. Hiraishi and H. Kuraishi (1995) "Pûracoccus thiocyanatus sp. nov., a

new species of thiocyanate-utilizing facultative chemolithotroph, and transfer of

Thiobacillus versutus to the genus Paracocctts as Paracoccus versutus comb.

nov. with emendation of the genus." Microbiol. , 14, p. 1469-77 -

Kemp, D. J., and A. F. Cowman (1981) "Direct Immunoassay for Detecting Escherichia

coli Colonies that Contain Polypeptides Encoded by Cloned DNA Segments."

Proc. Natl. Acad. Sci. USA,78, p. 4520-4524.

Khambata, S. R., and J. V. Bhat (1953) "studies on a New Oxalate-Decomposing

B acterium, P s eudomonas oxalaticus." J . Bacteriol., 66, p. 505-507.

Kingsbury, D. T. (1967) "Deoxyribonucleic Acid Homologies among Species of the

Genus Neisseria." J. Bacteriol.,%, p. 870-874.

Knight, M., L. Dijkhuizen and W. Harder (1978) "Metabolic Regulation in

Pseudomonas oxalaticus OXl. Enzyme and Coenzyme Concentration Changes

during Substrate Transition Experiments." Arch. Microbiol., 116, p. 85-90. 153

Koch, J., and L. Jaenicke (1962) "Über S-Oxalyl-Thiole." Liebigs Ann. Chem., 6jp, p" t29-r39

Kornberg, H. L. (1966) "Anaplerotic Sequences and Their Role in Metabolism." In:

Essays in Biochemistry, Vol. 2.(P. N" Campbell and G. D. Greville, eds.)

(Academic Press, London and New York), p. 1-31.

Kuner, K. M., and D. Kaiser (1981) "Introduction of Transposon Tn5 into Myxococcus

for Analysis of Developmental and Other Nonselectable Mutants." Proc. Natl.

Acad. Sci. USA, ZE, p. 425-429.

Laemmli, U. K. (1970) "Cleavage of Structural Proteins during the Assembly of the

Head of BacteriophageT{." Nature, 221 , p.680-685.

Lanyi, B. (1987) "Classical and Rapid Identification Methods for Medically Important

Bacteria." In: Methods in Microbiology, Volume 19 (R. R. Colwell and R"

Grigorova, eds) (Academic Press, London, New york) p. 6.

Larsen, N., J. G. Olsen, L. B. Maidak, J. M. McCaughey, R' Overbeek, J- T. Mack, L.

T. Marsh and C. R. Woese (1993) "The Ribosomal Database Project." Nucleic

Acids Res., 21, p.3021-3023.

Leong, S. A., G. S. Ditta and D. Helinski (1982) "Heme Biosynthesis in Rhizobium:

Identification of a Cloned Gene Coding for õ-Amino Levulinic Acid Synthetase

from Rhizobium meliloti." I. Biol. Chem.,25J, p.8724-8730.

Lewis, D. (1951) "The Metabolism of Nitrate and Nitrite in the Sheep. 2. Hydrogen

Donators in Nitrate Reduction by Rumen Microorganisms in vitro." Biochem.

J.. 49. o. 149-153.

Liao, L. L. and K. E. Richardson (1972) "The Metabolism of Oxalate in Isolated

Perfused Rat Livers." Arch. Biochem. Biophys., 153, p. 438-448. r54

Liao, L. L. and K. E. Richardson (1978) "The Synthesis of Oxalate from Hydroxypyruvate by Isolated Perfused Rat Liver. The Mechanism of

Hyperoxaluria in I--Glyceric Aciduria." Biochim. Biophys. Acta,538, p. 76-86.

Lillehoj, E. B. and F. G. Smith (1965) "An Oxalic Acid Decarboxylase of Myrothecíum

verrucaria." Arch. Biochem. Biophys., 109, p. 216-220.

Love, D. R., and M. B. Streiff (1987) "Molecular Cloning of a ß-glucosidase Gene from an Extremely Thermophilic Anaerobe in E. coli and B. subtilis."

BioÆechnology, 5, p. 384-387.

Lovley, D. R., R. C. Greening and J. G. Ferry (1984) "Rapidly Growing Rumen

Methanogenic Organism that Synthesizes Coenzyme M and has a High Affinity

for Formate." Appl. Environ. Microbiol., 48, p. 81-87.

Lung, H.-Y., J. Cornelius and A. B. Peck (1991) "Cloning and Expression of the

Oxalyl-CoA Decarboxylase Gene from the Bacterium, Oxalobacter formigenes:

Prospects for Gene Therapy to Control Ca-oxalate Kidney Stone Formation"" Am. J. Kidney Dis., !2, p. 381-385.

Lung, H.-Y., A. L. Baetz and A. B. Peck (1994) "Molecular Cloning, DNA Sequence,

and Gene Expression of the Oxalyl-Coenzyme A Decarboxylase Gene, oxc,

from the Bacterium Oxalobacterformigenes." J. Bacteriol., I76,p.2468-2472.

Maniatis, T., A. Jeffrey and H. van desande (1975) "Chain Length Determination of

Small Double- and Single-stranded DNA Molecules by Polyacrylamide Gel

Electrophoresis." Biochem., 14, p. 37 87 -3794.

Maniatis, T., E. F. Fritsch and J. Sambrook (1982) "Molecular Cloning." (Cold Spring

Harbor Laboratory, Cold Spring Harbor, New York). 155

Marshall, R. J., P. J. Winter and K. A. Bettelheim (1985) "A Study of Enterotoxigenic

E. coli, Serogroup 0126, by Bacterial Restriction Endonuclease DNA Analysis

(BRENDA)." J. Hyg. (Camb.), 94, p.263-285.

Marshall, V. L., W. B. Buck and G. L. Bell (1967) "Pigweed (Amnranthus retroflexus):

An Oxalate-containing Plant." Amer. J. Vet. Res., 28, p. 888-889.

Martz, F. 4., M. F. Weiss and R. L. Belyea (1990) "Determination of Oxalate in Forage

by Reverse-Phase High Pressure Liquid Chromatography." J. Dairy Sci., f,f,

p.474-479.

Matsumoto, T. (1961) "The Influence of Feed and Feeding Upon the Ruminal Gas

Formation. 9. Formate Dissimilation and Gas Production in the Rumen of the

Goat." Tohoku J. Agric. Sci., 12, p.2L3-220.

McBarron, E. J. (1977) "Oxalates and Oxalic Acid." In: Medical and Veterinary Aspects

of Plant poisons in New South Wales. (Department of Agriculture, N.S.W.)

p.99-103.

McCarthy, B. J., and E. T. Bolton (1963) "An Approach to the Measurement of Genetic

Relatedness among Organisms." Proc. Natl. Acad. Sci. USA, 50, p.156-164.

Mclntosh, G. H. (1972) "Chronic Oxalate Poisoning in Sheep." Aust. Vet. J., 48, p.

53s.

McKenzie, R. A. (1985) "Poisoning of Horses by Oxalate in Plants." Plant Toxicology.

Proceedings of the Australia-USA Poisonous Plants Symposium, Brisbane,

Aust., May 14-18,1984. p. 150-154.

McKenzie, R. 4., and K. Schultz (1983) "Confirmation of the Presence of Calcium

Oxalate Crystals in some Tropical Grasses." J. Agric. Sci., !@, p.249-250"

Mehta, R. J. (1973) "studies on Methanol-oxidising Bacteria. I. Isolation and Growth

Studies." Ant. [,eeuw. J. Micrbiol. Serol., 39, p. 295-302. 156

Michael, P. W. (1959) "Oxalate Ingestion Studies in the Sheep." Aust. Vet. J.,35, p.

43r-432.

Miller, J. G., W. J. Dower and L. S. Tompkins (1988) "High Voltage Electroporation of

Bacteria: Genetic Transformation of Campylobacter jejuní with Plasmid DNA."

Proc. Natl. Acad. Sci. USA, 85, p. 856-860.

MontgomeÍy,L., B. Flesher and D. Stahl (1988) "Transfer of Bacteroídes succinoSenes

(Hungate) to Fibrobacter Een. nov. as Fibrobacter succinogenes comb" nov. and

description of Fibrobacter intestínal.is sp. nov." Int. J. Syst. Bacteriol., f,$, p"

430-435"

Morona, R., and P. Reeves (1981) "Molecular Cloning of the /olC Locus of Escherichia

coli K-12 with the Use of Transposon Tn10." Mol. Gen. Genet., 184, p. 430-

434.

Morris, M. P. and J. Garcia-Rivera (1955) "The Destruction of Oxalates by the Rumen

Contents of cows." J. Dairy Sci.,38, p. 1169.

Moyer, C. L., F. C. Dobbs and D. M. Karl (1994) "Estimation of Diversity and Community Structure through Restriction Fragment Length Polymorphism

Distribution Analysis of Bacterial 165 rRNA Genes from a Microbial Mat at an

Active, Hydrothermal Vent System, Loihi Seamount, Hawaii." Appl. Environ.

Microbiol., 6!, p. 87 I-879.

Mukhamedyanov, M. M. (1933) "sodium Formate in Diets for Lactating Cows."

Khimiya v Sel'skom Khozyaistva,2J-, p. 44-47 .

Mukhamedyanov, M. M., and I. P. Dukhin (1984) "sodium Formate in Diets for

Finishing Young Bulls." Khimiya v Sel'skom Khozyaistvc,2., p. 51-53.

Mukhamedyanov, M. M., and M. E. Koromyslova (1984) "Use of Sodium Formate in

Feeding Young Rams." Ovtsevodstvo, Z, p.22-23. t57

Muller, H. M. (1950) "Oxalsäüre als Kohlenstoffquelle fur Mikrooganimen." Archiv. fur

Mikrobiologie, 15, p. 137 -I48.

Nakamura, Y., J. Yoshida and R. Nakamura (1985) "Effects of Hydrogen Donors on

Nitrate Metabolism in the Rumen and Methemoglobin Formation in the Blood." Jap. J. Zootech. Sci., lf, p. 379-383.

Nguyen, N. U., G. Dumoulin, J. P. wolf, D. Bourderont and S. Berthelay (1986)

"Urinary Oxalate and Calcium Excretion in Response to Oral Glucose Load in

Man." Hormone and Metabolic Res., 18, p. 869-870.

Nili, N. (1996) "Limitations to Amino Acid Biosynthesis de novo in Ruminal Strains of

Prevotella and Butyrivibrio." Ph.D.Thesis, Department of Animal Sciences,

Waite Agricultural Research Institute, University of Adelaide,p-2O7 -

Ning, Z (1992) "Molecular Characterisation of the Ruminal Bacterial Species

Selenomonas ruminantium." Ph.D. Thesis, Department of Animal Sciences,

Waite Agricultural Research Institute, University of Adelaide, p- 54.

Noda, Y., S. Nishikawa, K. Shiozuka, H. Kadokura, H' Nakajima, K. Yoda, Y.

Katayama, N. Morohoshi, T. Haraguchi and M. Yamasaki (1990) "Molecular

Cloning of the Protocatechuate 4,5-Dioxygenase Genes of Pseudomonas

p au c imo bili s ." I . B acteriol., I'7 2, p. 27 04-27 09 .

Norrander, J., T. Kempe and J. Messing (19S3) "Construction of Improved M13

Vectors using Oligonucleotide-Directed Mutagenesis." Gene, 26, p. 101- 106.

Novoa, W. 8., A. D. Winer, A. J. Glaid and G. W. Schwert (1959) "Lactic

Dehydrogenase. V. Inhibition by Oxalate and Oxamate." J. Biol. Chem.,234,

p. 1143-1148. 158

O'Conner, C. G., and L. K. Ashman (1982) "Application of the Nitrocellulose Transfer

Technique and Alkaline Phosphatase Conjugated Anti-immunoglobulin for

Determination of the Specificity of Monoclonal Antibodies to Protein Mixtures."

J. Immunol. Methods, 54, p. 267 -27 I.

Olsvik, O., H. Sorum and K. Birkness (1985) "Plasmid Characterisation of Salmonella

typhimuriuræ Transmitted from Animals to Humans." J. Clin. Microbiol. ,2, p.

336-338.

Ono, K. (1986) "secondary Hyperoxalemia Caused by Vitamin C Supplementation in

Regular Hemodialysis Patients." Clin. Nephrol., 26, p. 239-243.

Osweiler, G. D., W. B. Buck and E. J. Bicknell (1969) "Production of Perirenal Edema

in Swine withAmnranthus retroflexus." Amer. J. Vet. Res., f,Q, p. 557-566.

Pace, N. R., D. A. Stahl, D. J. Lane and G. J. Olsen (1986) "The Analysis of Natural

Microbial Populations by Ribosomal RNA Sequences." Adv. Microbiol. Ecol., !, p. 1-55.

Peterson, D. I., J. E. Peterson, M. G. Hardinge and W. E. C. Wacker (1963)

"Experimental Treatment of Ethylene Glycol Poisoning." J. Amer. Med. Assoc.,

186. o. 955-957.

Pfennig, N and K. D. Lippert (1966) "Über das Vitamin B12-Bedürfnis Phototropher

Schwefelbakterien." Arch. Mikrobiol., 55, p. 245-256.

Picard, C., C. Ponsonnet, E. Paget, X. Nesme and P. Simonex (1992) "Detection and

Enumeration of Bacteria in Soil by Direct DNA Extraction and Polymerase Chain

Reaction." Appl. Environ. Microbiol., 58, p. 27 l7 -2722.

Purcell, B. K., and S. Clegg (1983) "Construction and Expression of Recombinant Plasmids Encoding Type I Fimbriae of a Urinary Klebsiella pneumoniae Isolate." Infect. Immun., 39, p. lI22-Il2l. 159

Purucker, M., R. Bryan, K. Amemiya, B. Ely and L. Shapiro (1982) "Isolation of a

Caulobacter Gene Cluster Specifying Flagellum Production by Using Nonmotile

Tn5 Insertion Mutants." Proc. Natl. Acad. Sci. USA,D,p.6797-6801.

Quayle, J. R. (1962) "Chemical Synthesis of Oxalyl-Coenzyme A and its Enzymic

Reduction to Glyoxylate." Biochim. Biophys. Acta, 57,p.398-399.

Quayle, J. R. (1963a) "Carbon Assimilation by Pseudomonas oxalaricus (Oxl). 6. Reactions of Oxalyl-Coenzyme 4." Biochem. J., 87, p. 368-373.

Quayle, J. R. (1963b) "Carbon Assimilation by Pseudomonas oxalaticus (Oxl). 7. Decarboxylation of Oxalyl-Coenzyme A to Formyl-Coenzyme 4." Biochem. J.,

D., p. 492-503.

Quayle, J. R. (1966) "Formate Dehydrogenase." In: Methods in Enzymology,IX (S. P. Colowick and N. O. Kaplan, eds) (Academic Press Inc., New York) p. 360-

364.

Quayle, J. R., and D. B. Keech (1959a) "Carbon Assimilation by Pseudomonas

oxalaticus (Oxl). 1. Formate and Carbon Dioxide Utilisation During Growth on

Formate." Biochem. J.,f.2, p. 623-630.

Quayle, J. R., and D. B. Keech (1959b) "CaLbon Assimilation by Pseudomonas oxalaticus (Oxl). 2. Formate and Carbon Dioxide Utilisation by Cell-Free

Extracts of the Oganism Grown on Formate." Biochem . 1.,2., p. 631-637 .

Quayle, J. R., and D. B. Keech (1960) "Carbon Assimilation by Pseudomonas

oxalaticus (Oxl). 3. Oxalate Utilisation During Growth on Oxalate." Biochem.

J., É-, p. 515-523.

Quayle, J. R., and G. A. Taylor (1961) "Carbon Assimilation by Pseudomonas

oxalatictts (Ox1). 5. Purification and Properties of Glyoxylic Dehydrogenase."

Biochem. J., 7Å, p. 61 1-615. 160

Quayle, J" R., D. B. Keech and G. A. Taylor (1961) "Carbon Assimilation by

Pseudom.onds oxalaticøs (Ox1). 4. Metabolism of Oxalate in Cell-Free Extracts

of the Organism Grown on Oxalate." Biochem. J., 78, p.225-236.

Rabinowitz, I. C., and W. E. Pricer, Jr. (1957) "An Enzymatic Method for the

Determination of Formic Acid." J. Biol. Chem.,229,p.32I-328-

Rao, P. N., V. Prendiville, A. Buxton, D. G. Moss and N. J. Blacklock (1982) "Dietary

Management of Urinary Risk Factors in Renal Stone Formers." Br. J. Urol.,

54, p. 578-583.

Raskin, L., J. M. Stromley, B. E. Rittman and D. Stahl (1994) "Group-Specific 165

rRNA Hybridisation Probes to Describe Natural Communities of Methanogens."

Appl.Environ. Microbiol., @,, p. 1232-1240.

Ribaya, J. D., and S. N. Gershoff (1981) "Effects of Hydroxyproline and Vitamin B6

on Oxalate Synthesis in Rats." J, Nutr., 111, p. I23l-I239.

Ribaya, J. D., and S. N. Gershoff (1982) "Factors Affecting Endogenous Oxalate

Synthesis and its Excretion in Feces and Urine in Rats." J, Nutr., ll2, p.216I-

2169.

Ribaya-Mercado, J. D., and S. N. Gershoff (1984) "Effects of Sugars and Vitamin B6

Deficiency on Oxalate Synthesis in Rats." J. Nutr., 114,p.1447-1453.

Robbel, 4., and H. J. Kutzner (1973) "streptomyces Taxonomy: Utilisation of Organic

Acids as an Aid in the Identification of Species." Die Naturwissenschaften, f, p.

35r-352.

Roberts, E. and S. Frankel (1950) "y-Aminobutyric Acid in Brain: Its Formation from

Glutamic Acid." J. Biol. Chem., 187, p.55. 161

Rofe, 4.M., A. H. Chalmers and J. B. Edwards (1976) "[14C]Oxalate Synthesis from ¡g-t+ClGlyoxylate and [1-t+ç]Glycollate in Isolated Rat Hepatocytes." Biochem. Med.,lé, p. 277-283.

Rofe, A. M., D. W. Thomas, R. G. Edwards and J. B. Edwards (1977) "[14C]Oxalate

Synthesis from IU-14C]Xylitol: in vivo and in vítro Studies." Biochem. Med.,

18. o. 440-451.

Rofe, A. M., H. M. James, R. Bais and R. A. J. Conyers (1986) "Hepatic Oxalate

Production: The Role of Hydroxypyruvate." Biochem. Med. Metab. Biol., 3é,

p. 141-150.

Rofe, A. M., H. M. James, R. Bais, J. B. Edwards and R. A. J. Conyers (1980) "The

Production of ¡t+61O*alate During the Metabolism of [t+çl"urbohydrates in

Isolated Rat Hepatocytes." Aust. J. Exp. Biol. Med. Sci.,58, p. 103-116.

Rofe, A. M., R. A. J. Conyers and D.'W. Thomas (1981) "Renal Stone Disease in South

Australia." Med. J. Aust., 2, p. 158.

Rofe, A. M., S. M. Pholenz, R. Bais and R. A. J. Conyers (1985) "Inhibitory Effect of

Ascorbic Acid in Assays Involving Oxalate Decarboxylase." Clin. Chem.,3.l, p.

t57 4-157 5.

Rogers, M.-L. (1991) "Comparative Enzymology of Oxalyl-CoA Decarboxylase in

Oxalate-Degrading Organisms." Honours Thesis, Department of Animal

Sciences, Waite Agricultural Research Institute, University of Adelaide, p. 53.

Rouglan, P. G., and C. R. Slack (1973) "Simple Methods for Routine Screening and

Quantitative Estimation of Oxalate Content of Tropical Grasses." J. Sci. Food

Agr., 24, p. 803-811. t62

Runyan, T. J., and S. N. Gershoff (1965) "The Effects of Vitamin B6 Deficiency in Rats

on the Metabolism of Oxalic Acid Precursors." J. Biol. Chem., 240, p. 1859-

1892.

Rushton, H. G., and M. Spector (1982) "Effects of Magnesium Defieciency on

Intratubular Calcium Oxalate Formation in Hyperoxaluric Rats." J. UroI., 127 ,

p. 598-604.

Saiki, R. K. (1989) "The Design and Optimisation of the PCR." In: PCR Technology:

Principles and Applications for DNA Amplification (H. A. Erlich, ed.) (Stockton

Press, New York) p.7-16.

Salamitro, J. P., and P. A. Muirhead, (1975) "Quantitative Method for the Gas

Chromatographic Analysis of Short-Chain Monocarboxylic and Dicarboxylic

Acids in Fermentation Media." Appl. Microbiol., 29,p.374-38I.

Satoh, E., Y. Niimura, T. Uchimura, M. Kozaki and K. Komagata (1993) "Molecular

Cloning and Expression of Two cr-Amylase Genes from Streptococcus bovis

148 in Escherichia coli." Appl. Environ. Microbiol., Ð, p. 3669-3673.

Schell, M. A. (1983) "Cloning and Expression in Escherichia coli of the Naphthalene

Degradation Genes from Plasmid NAH 7." J.Bacteriol., 153, p. 822-828.

Schmidt, T. M., E. F. Delong and N. R. Pace (1991) "Analysis of a Marine

Picoplankton Community by 165 rRNA Gene Cloning and Sequencing." J.

Bacteriol., l7 3, p. 437 l-437 8.

Seawright, A. A. (1982) "Oxalates." In: Animal Health in Australia, Vol. 2. Chemical

and Plant Poisons. (Australian Government Printing Service) p.74-75.

Seawright, A. A., S. Groenendyk and K. I. N. G. Silva (1970) "An Outbreak of Oxalate

Poisoning in Cattle Grazing Setaria sphacelata." Aust. Vet. J., 46,p.293-296. 163

Sharpe, G. S. (1984) "Broad Host Range Vectors for Gram-negative Bacteria." Gene,

29. o.93-102.

Shaw, K. J., C. M. Berg and T. Sobol (1980) Salm.onella typhimurium Mutants

Defective in Acetohydroxy Acid Synthetase I and II." J. Bacteriol.l4l, p. 1258-

1263.

Shimazono, H. (1955) "Oxalic Acid Decarboxylase, a New Enzyme from the Mycelium

of Wood-destroying Fungi." J. Biochem ., 42, p. 321-340"

Shimazono, H. and O. Hayaishi (1957) "Enzymatic Decarboxylation of Oxalic Acid." J.

Biol. Chem.,?.2-, p. 151-159.

Shimkets, L. J., R. E. Gill and D. Kaiser (1983) "Developmental Cell Interactions in

Myxococcus xanthus and the spoC Locus." Proc. Natl. Acad. Sci. USA,80, p.

1406-14r0.

Shirley, E. K., and K. Schmidt-Nielson (1967) "Oxalate Metabolism in the Pack Rat,

Sand Rat, Hamster, and White Rat." J. Nutr., [, p.496-502.

Sidhu, H., S. D. Ogden, H.-Y. Lung, B. G. Luttge, A. L. Baetz and A. B. Peck (1997)

"DNA Sequencing and Expression of the Formyl Coenzyme A Transferase

Gene, frc, from Oxalobacter formig ene s." J . B acteriol., l7 9, p. 3378-338 l.

Smith, R. L., F. E. Strohmaier and R. S. Oremland (1985) "Isolation of Anaerobic Oxalate-Degrading Bacteria from Freshwater Lake Sediments." Arch. Microbiol., W, p. 8-13.

Smith, W. S. (1950-51) "Soursob Poisoning of Sheep." Sth. Aust. J. Agric., fi, p.377- 378.

Southern E. M- (1975) "Detection of Specific Sequences among DNA Fragments

Separated by Gel Electrophoresis." J. Mol. Biol., 98, p. 503-517. t64

Stadtman, E. R. (1957) "Preparation and Assay of Acyl-Coenzyme A and other Thiol

Esters; Use of Hydroxylamine." In: Methods in Enzymology, III (S. P.

Colowick and N. O. Kaplan, eds) (Academic Press Inc., New York) p.938

Stadtman, E. R., and H. A. Barker (1950) " Fatty Acid Synthesis by Enzyme

Preparations of Clostridium kluyveri. VL Reactions by Acyl Phosphates." J.

Biol. Chem., -1-&[, p.769"

Stage, D. E., and S. Avrameas (1976) "Detection of Anti-TNP Antibody-Forming Cells

(AFC) with TNP-Enzyme and TNP-Fab Anti-Enzyme Conjugates." J.

Immunol. Methods, 10, p. 105-118.

Srahl, D. A., B. Flesher, H. R. Mansfield and L. Montgomery (1988) "Use of

Phylogenically Based Hybridisation Probes for Studies of Ruminal Microbial

Ecology." Appl. Environ. Microbiol., 54, p. 1079-1084.

Stahl, D. 4., D. J. Lane, G. J. Olsen and N. R. Pace (1985) "Characterisation of a

Yellowstone Hot Spring Community by 55 rRNA Sequences." Appl.Environ.

Microbiol., 49, p. 1379-1384.

Stanier, R. Y., N. J. Palleroni and M. Doudoroff (1966) "The Aerobic Pseudomonads: A

Taxanomic Study." J. Gen. Micribiol., 43, p. 159-27I.

Stocks, P. K., and C. S. McCleskey (1964) "Identity of the Pink-pigmented Methanol-

oxidising Bacteria as Víbrio extorquens." J. Bacteriol.,88, p. 1065-1070.

Stolle, R. (1914) "Ober Methyl-thionaphenchion." Berichte del Deutschen Chemischen

Gesellschaft, 4'7 , I 131.

Tagaev, O. 4., Y. A. Pazderskii, B. D. Popovich, F. I. Vrydnyk and I. I" Moiseev

(1985) "Formic Acid - A Preservative for Green Feeds." Khimiya v Sel'skom Khozyaistve, 8, p. 58-59. 165

Talapatra, S. K., S. C. Ray and K. C. Sen (1948) "Calcium Assimilation in Ruminants

on Oxalate-Rich Diets." J. Agric. Sci., $, p.163-t73.

Talwar, H. S., V. S. Madiraju, S. R. Murthy, R. Nath and S. K. Thind (1985) "Normalization of Urinary Oxalate by Taurine in Glycolate-fed Rats." Metabolism, A, p. 97- 100.

Teather, R. M., and P. J. Wood (1932) "Use of Congo Red-Polysaccharide Interactions

in Enumeration and Characterisation of Cellulolytic Bacteria from Bovine

Rumen." Appl. Environ. Microbiol., 43, p. 777 -l 80.

Thauer, R. K., K. Jungermann and K. Decker (1971) "Energy Conservation of

Chemotrophic Anaerobic Bacteria." Bacteriol. Rev., 4I, p. 100-I80.

Tideman, A. F. (1966) "Weeds Worth Watching...The Soursobs." Sth. Aust. J. Agric.,

70. o.102-105.

Towbin, H., T. Straehelin and J. Gordon (1979) "Electrophoretic Transfer of Proteins from Polyacrylamide Gels to Nitrocellulose Sheets: Procedure and Some

Applications." Proc. Natl. Acad. Sci., USA, 76, p. 4350-4354.

Tsao, C. S., and S. L. Salimi (1984) "Effect of Large Intake of Ascorbic Acid on

Urinary and Plasma Oxalic Acid Levels." Int. J. Vitam. Nutr. Res., fl, p.245- 250.

Tsubokura, 4., H.Yoneda and H. Mizuta (1999) "Paracoccus carotinifaciens sp. nov.,

A New Aerobic Gram-negative Astaxanthin-Producing Bacterium." Int. J. Sys.

Bacteriol., L2, p. 277 -282.

Ubben, D., and R. Schmitt (1986) "Tnl72l Derivatives fbr Transposon Mutagenesis,

Restriction Mapping and Nucleotide Sequence Analysis." Gene, 41, p. 145-

t52. 166

Van Kampen, K. R., and L. F. James (1969) "Acute Halogeton Poisoning of Sheep:

Pathogenesis of Lesions." Amer. J. Vet. Res., S, p. 1779-1783.

Varalakshmi, P., and K. E. Richardson (1983) "The Effects of Vitamin 8-6 Deficiency

and Hepatectomy on the Synthesis of Oxalate from Glycolate in the Rat."

Biochim. Biophys. Acta, f5|, p. l-l .

Vercoe, J.8., and K. L. Blaxter (1965) "The Metabolism of Formic Acid in Sheep." Br.

J. Nutr., 19, 523-530.

Voller, 4., D. Bidwell and A. Bartlett (1980) "Enzyme-Linked Immunosorbent Assay."

In: Manual of Clinical Immunology (N. R. Rose and H. Friedman, eds.) (Am.

Soc. Microbiol., Washington D.C.) 2nd ed., p.359-371.

Von Wartberg, J. P., J. L. Bethune and B. L. Vallee (1964) "Human Liver Alcohol

Dehydrogenase. Kinetic and Physicochemical Properties." Biochem., 3, p.

1775-1782.

Walthall, J. C., and R. A. McKenzie (1976) "Osteodystrophia fibrosa in Horses at

Pasture in Queensland: Field and Laboratory Observations." Aust. Vet. J.,52,

p. 11-16.

Ward, D. M., R. Weller and M. M. Bateson (1990) "165 rRNA Sequences Reveal

Numerous Uncultured Microorganisms in a Natural Community." Nature,W,

p. 63-65.

Watts, P. S. (1957) "Decomposition of Oxalic Acid in vitro by Rumen Contents." Aust.

J. Agric. Res., 8, p.266-270.

Watts, P. S. (1959a) "Effects of Oxalic Acid Ingestion by Sheep. I. Small Doses to

Chaff Fed Sheep." J. Agric. Sci., 52, p.244-249.

Watts, P. S. (1959b) "Effects of Oxalic Acid Ingestion by Sheep. II. Large Doses to

Sheep on Different Diets." J. Agric. Sci., 52, p.250-255. t67

Watts, R. V/. E., N.Veall, P. Purkiss, M. A. Mansell and E. F. Haywood (1985) "The

Effect of Pyridoxine on Oxalate Dynamics in 3 Cases of Primary Hyperoxaluria

(with Glycolic Aciduria)." Clin. Sci., 69, p. 87-90.

Wilson, B. J., and C. H. lVilson (1961) "Oxalate Formation in Moldy Feedstuffs as a Possible Factor in Livestock Toxic Disease." Amer. J. Vet. Res., 2, p. 961- 969"

W'oiwod, A. J. (1949) "A Method for the Estimation of Micro Amounts of Amino

Nitrogen and Its Application to Paper Chromatography." Biochem. 1., Æ'p.

412.

Yanisch-Penon, C., J. Vieira and J. Messing (1985) "Improved M13 Phage Cloning and

Host Strains: Nucleotide Sequences of the M13mpl8 and pUC19 Vectors."

Gene,33, p. 103-119.

Young, R. 4., and R. W. Davies (1983) "Efficient Isolation of Genes by Using

Antibody Probes." Proc. Natl. Acad. Sci. USA,80,p. 1194-1198.

Zarembski, P. M., and A. Hodgkinson (1961) "Plasma Oxalic Acid and Calcium Levels

in Oxalate Poisoning." J. Clin. Path., N., p.283-285.