New Insights Into the Function and Development of the Soldier Caste in Termites

Home , Feruloyl esterase, Kladothrips, Pheidole bicarinata, Phragmosis, Synalpheus, Trophallaxis

University of Kentucky UKnowledge

Theses and Dissertations--Entomology Entomology

2015

NEW INSIGHTS INTO THE FUNCTION AND DEVELOPMENT OF THE SOLDIER CASTE IN TERMITES

Li Tian University of Kentucky, [email protected]

Right click to open a feedback form in a new tab to let us know how this document benefits ou.y

Recommended Citation Tian, Li, "NEW INSIGHTS INTO THE FUNCTION AND DEVELOPMENT OF THE SOLDIER CASTE IN TERMITES" (2015). Theses and Dissertations--Entomology. 24. https://uknowledge.uky.edu/entomology_etds/24

This Doctoral Dissertation is brought to you for free and open access by the Entomology at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Entomology by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT:

I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File.

I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known. I agree that the document mentioned above may be made available immediately for worldwide access unless an embargo applies.

I retain all other ownership rights to the copyright of my work. I also retain the right to use in future works (such as articles or books) all or part of my work. I understand that I am free to register the copyright to my work.

REVIEW, APPROVAL AND ACCEPTANCE

The document mentioned above has been reviewed and accepted by the student’s advisor, on behalf of the advisory committee, and by the Director of Graduate Studies (DGS), on behalf of the program; we verify that this is the final, approved version of the student’s thesis including all changes required by the advisory committee. The undersigned agree to abide by the statements above.

Li Tian, Student

Dr. Xuguo Zhou, Major Professor

Dr. Charles W. Fox, Director of Graduate Studies

NEW INSIGHTS INTO THE FUNCTION AND DEVELOPMENT OF THE SOLDIER CASTE IN TERMITES

DISSERTATION

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Entomology in the College of Agriculture, Food and Environment at the University of Kentucky

Li Tian

Lexington, Kentucky

Co-Directors: Dr. Xuguo Zhou, Professor of Entomology and Dr. John J. Obrycki, Professor of Entomology

Lexington, Kentucky

ABSTRACT OF DISSERTATION

NEW INSIGHTS INTO THE FUNCTION AND DEVELOPMENT OF THE SOLDIER CASTE IN TERMITES

The evolution of nonreproductive castes is a defining characteristic of eusociality. The function and developmental regulation of the altruistic worker and soldier caste is the central element contributing to major advantages of eusociality over solitary animals. The soldier caste is the first evolved sterile caste in termites. Their primary function is believed to be colony defense. However, the function and development of termite soldiers remains largely unknown. Because of their apparent morphological adaptation for fighting and their limited behavior repertoire, our understanding of colony defense by termite soldiers is limited to their physical defense. In addition, we know little about the molecular mechanisms mediating soldier development. In Chapters 2 and 3 I discuss the role of the soldier caste under competition risk. By exposing the Eastern subterranean termite Reticulitermes flavipes to cues of a competitor termite species, I found that exposure to competitor cues reduced feeding, compromised growth and survival of R. flavipes workers. The presence of R. flavipes soldiers largely ameliorated these negative impacts. At the transcriptional level, R. flavipes soldiers can counteract the effects of competitor cues on worker head gene expression. This counteracting effect seems to be associated with genes in metabolism and immunity. These studies demonstrate that competition can affect a termite colony’s fitness by either competitors physically invading the colony and causing damage or cues from competitors inducing a stress response in termite colony members. More importantly, soldiers can contribute to colony fitness by physically engaging in combat, but also by enhancing colony members’ survival under competitor-cue exposure. In Chapter 4, I describe the molecular mechanism mediating soldier-caste differentiation. I cloned the full length cDNA sequence of the R. flavipes Methoprene-tolerance (Met) gene, a gene encoding a putative receptor for juvenile hormones. Using RNA interference, I studied the function of Met and found that this gene essentially mediates the JH-dependent soldier-caste differentiation in termites.

KEY WORDS: Eusociality, termites, the soldier caste, competitor cue, stress buffering, Methoprene-tolerance

Li Tian Student’s Signature

December 9th, 2015 Date

NEW INSIGHTS INTO THE FUNCTION AND DEVELOPMENT OF THE SOLDIER CASTE IN TERMITES

Li Tian

Xuguo Zhou Co-Director of Dissertation

John J. Obrycki Co-Director of Dissertation

Charles W. Fox Co-Director of Dissertation

December 9, 2015

DEDICATION

This work is dedicated to Mom, dad and Lian

ACKNOWLEDGEMENT

First of all I would like to thank my advisor Dr. Xuguo Zhou, without whom I would have not been able to complete this project. I would like to thank him for his guidance, kindness and patience. I feel fortunate to join Dr. Zhou’s lab. He gave me the freedom to explore my own interested field of study. He encouraged me to present my research and make connections in all kinds of academic conferences. He also help me to apply fellowships and grants. He taught me the skills of scientific presentations and scientific writing. It is his training that helped me to grow up as an independent researcher.

My appreciation extends to my advisory committee members: Dr.Kenneth F.

Haynes, Dr. Subba R.Palli, Dr John J.Obrycki, Dr.Catherine Linnen, and Dr.Scott

Gleeson for their insightful comments, constructive criticisms and thought-provoking questions at different stages of my research. Here I would like to express my special appreciation to Dr. Kenneth F. Haynes for his help on my research. Dr. Haynes has been deeply involved in my project. He helped me extensively on my experimental design, and provided critical comments on my manuscript. In addition, I would also like to thank Dr.

Evan Preisser from University of Rhode Island for his extensive effort and help on my research manuscript.

I am also grateful to my former and current lab mates: Qian (Karen) Sun,

Xiangrui Li, Zhen Li, Pei Liang, Xiaowei Yang, Hu Li, Huipeng Pan, Dongyan Song,

Tian Yu and Linghua Xu for their comments on research and helps of doing experiments.

I also want to give special thanks to my friend, Jingpeng Liu, who works on bioinformatics analysis at the Markey cancer center at the University of Kentucky, for his

iii

extensive help of analyzing my RNAseq data and for the great fun we’ve have had together.

Finally I would like to thank my parents, and my wife, Lian He, for their love, support and encouragement, which have helped me to go through difficult times. They are always the source of courage and inspiration in my life.

TABLE OF CONTENT

ACKNOWLEDGEMENT ...... iii TABLE OF CONTENT ...... v LIST OF TABLES ...... viii LIST OF FIGURES ...... ix Chapter 1 Introduction ...... 1 1.1 Classification of Eusocial Lineages ...... 1 1.2 Morphology and Functionality of the Soldier Caste ...... 3 1.2.1 What constitutes a soldier? ...... 3 1.2.2 Morphological Distinctions of the Solider Caste ...... 5 1.2.3 Adaptive Functions of the Solider Caste ...... 6 1.3 Regulation of Soldier Caste ...... 8 1.3.1 The Cost of Maintaining the Soldier Caste ...... 8 1.3.2 Environmental Risk ...... 8 1.3.3 Resource Availability and Allocation ...... 10 1.3.4 Colony Size, Reproductive Caste and Genetic Factor ...... 10 1.3.5 Self-Regulation ...... 11 1.3.6 Juvenile Hormone ...... 12 1.3.7 Molecular Basis ...... 13 1.4 The Evolution of the Soldier Caste...... 14 1.4.1 Biological Factors ...... 14 1.4.2 Ecological Factors ...... 16 1.4.3 Genetic Factors ...... 17 1.5 Perspectives and Questions ...... 19 1.5.1 Defining a Soldier Caste ...... 19 1.5.2 Ecological Factors Shape Caste Evolution ...... 20 1.5.3 Soldier-Derived Eusociality ...... 20 Chapter 2 The Stress Buffering Function of the Soldier Caste ...... 24 2.1 Introduction ...... 24 2.2 Materials and Methods ...... 25 2.2.1 Termites ...... 25

2.2.2 Experiment I: Impact of soldiers on worker behavior ...... 26 2.2.3 Experiment II: Acute impact of soldiers on worker survival ...... 28 2.2.4 Experiment III: Chronic impact of soldiers on worker feeding, growth, and survival ...... 28 2.2.5 Statistical analysis ...... 30 2.3 Results ...... 31 2.3.1 Workers behave differently in the presence of competitors and soldiers ...... 31 2.3.2 Soldiers decrease the impact of competing species on worker mortality ...... 31 2.3.3 Soldiers buffer the long-term impact of competitors on workers ...... 32 2.4 Discussion ...... 33 2.4.1 Competitor cue exposure reduced worker fitness ...... 33 2.4.2 Soldier alleviates negative impact of competitor cue on workers ...... 34 2.4.3 Ecological significance of the stress-buffering function of the soldier caste .. 35 2.4.4 Implications of the soldier function to eusocial evolution in termites ...... 36 Chapter 3 Gene Expression Profile Associated with the Soldier- Dependent Stress Buffering ...... 43 3.1 Introduction ...... 43 3.2 Material and Method ...... 44 3.2.1 Termites ...... 44 3.2.2 Competition cue treatment ...... 45 3.2.3 Sample collection ...... 45 3.2.4 RNA isolation, cDNA library construction, and illumina sequencing ...... 46 3.2.5 Screening of differentially expressed genes ...... 47 3.2.6 Gene Expression Validation by qRT-PCR ...... 48 3.3 Results ...... 49 3.3.1 qRT-PCR validation ...... 49 3.3.2 Soldier-moderated transcriptional response of R. flavipes workers to competitor cues ...... 49 3.3.3 Functional categories of the soldier-modulated CRGs ...... 50 3.4 Discussion ...... 50 Chapter 4 The Juvenile Hormone Resistant Gene Methoprene-tolerant Mediates Soldier Caste Differentiation in the Termite Reticulitermes flavipes ...... 62

4.1 Introduction ...... 62 4.2 Material and Methods ...... 64 4.2.1 Termites ...... 64 4.2.2 Molecular characterization of Met ...... 65 4.2.3 Gene expression profiling ...... 66 4.2.4 Functional study of Met ...... 67 4.3 Results ...... 68 4.3.1 Molecular characterization...... 68 4.3.2 Functional characterization of the RfMet ...... 69 4.4 Discussion ...... 70 Chapter 5 Summary and Perspectives...... 86 APPENDIX I: Taxonomic grouping of the 23436 R. flavipes worker head ...... 90 APPENDIX II: Primer sequence for RACE-PCR ...... 91 APPENDIX III: Primer sequence for qRT-PCR ...... 92 APPENDIX IV: Primer sequence for RfMet dsRNA ...... 93 REFERENCES ...... 94 VITA ...... 109

vii

LIST OF TABLES

Table 1.1 The soldier caste in different eusocial lineages ...... 22 Table 2.1 Result of Repeated Measurement ANOVAs testing the effects of treatment (nonleathal presence of conspecific workers, heterospecific workers, or heterospecific workers plus a single conspecific soldier), colony ID and time on R. flavipes paper consumption, change in body weight and mortality...... 37 Table 3.1 Gene-specific primers for qRT-PCR validation ...... 56 Table 3.2 Gene expression validation by qRT-PCR ...... 57 Table 3.3 Annotated DETs modulated by the soldier caste ...... 58 Table 4.1 Results of Repeated Measurement ANOVAs testing the effects dsRNA injection on presoldier differentiation in R. flavipes...... 75

viii

LIST OF FIGURES

Figure 1.1 The worker caste and the soldier caste in eusoical societies...... 23 Figure 2.1 Schematic view of the experimental setup...... 38 Figure 2.2 Mean behavioral responses of 10 R. flavipes workers...... 39 Figure 2.3 Cumulative mortality of R. flavipes workers after 48 hour-exposure to competitor cue...... 40 Figure 2.4 Solder moderate long term effects of competitor cue on worker fitness...... 42 Figure 3.1 Number of competitor regulated genes in R. flavipes worker head...... 59 Figure 3.2 Venn diagram of the number of shared and unique CRGs between soldier- accompanied (W+S) and soldier-deprived (W–S) workers ...... 60 Figure 3.3 Comparison of fold change of CRGs in soldier-accompanied workers (W+S) and soldier-deprived workers (W–S) ...... 61 Figure 4.1 Schematic representation of the structure of R. flavipes Met...... 76 Figure 4.2 Expression pattern of the R. flavipes Met...... 78 Figure 4.3 Expression of Krüppel homolog 1 in response to JHIII treatment ...... 79 Figure 4.4 Effects of RfMet dsRNA injection on worker mortality and gene expression. 81 Figure 4.5 Effects of RfMet dsRNA-injection on presoldier differentiation by workers. . 82 Figure 4.6 Effects of RfMet RNAi and reduced dose of exogenous JHIII on presoldier morphology...... 84 Figure 4.7 Effects of exogenous dose of JHIII on presoldier differentiation by workers. 85

1 Chapter 1 Introduction

1.1 Classification of Eusocial Lineages

The origin of eusociality is one of the major transitions in evolutionary history [1].

Eusocial lineages are characterized by cooperative brood care, overlapping generations and reproductive division of labor [2]. The latter is regarded as the hallmark of eusociality [1, 3]. Eusocality has been documented in phylogenetically distant taxa including insects (Hymenoptera [4], termites [4], aphids [5], thrips [6], and beetles [7]), crustacean (snapping shrimp [8]), and mammals (naked mole rats [9]). Despite the diverse taxonomic distribution, a single characteristic is common to all eusocial lineages: the evolution of a reproductively altruistic caste [4]. It is believed that behavioral and morphological adaptations of these “reproductively selfless” individuals contribute to the major advantages of social living and are essential for the spectacular evolutionary success of eusociality [2, 4].

Independent origins of eusociality result in remarkable variation in adaptive functions of altruistic castes. Two functionally distinct sterile castes, soldier and worker, are the cornerstones of the eusocial societies [4, 10]. Workers and soldiers display many distinct characteristics (Figure 1.1). The worker caste is, typically, the numerically dominant caste in a colony [4], except for the workerless inquiline ant species[11].

Pogonomyrmex colei, an endemic species equipped with a psammophore, a bearded structure for digging and moving sand particles, is often found living commensally with a much larger congeneric species, Pogonomyrmex rugosu. With few exceptions (in ants), worker caste exhibits limited morphological modifications (except for the body size) from the reproductives (Figure 1.1 g-h) [4]. Workers are capable of performing all

housekeeping tasks such as nest construction, foraging, brood care and defense [7, 9, 12].

The physical soldier caste is numerically few in the colony, comprising 2-50% of the population [13-15]. This caste displays morphological and behavioral specializations for defense (Figure 1.1 a-f), which distinguish them from the reproductive caste or ordinary colony members [4, 16, 17].

Eusocial lineages exhibit remarkable differences in the evolution of a sterile caste.

Based on the very first sterile caste evolved in a society, we categorize these lineages into worker-first and soldier-first eusociality, respectively. In worker-first lineages, which include eusocial Hymenoptera (ants, bees and wasps) [10, 18], naked mole rats [9] and possibly eusocial ambrosia beetles [7], workers are the first sterile caste evolved. In the soldier-first lineages, ranging from termites [10, 18], eusocial aphids [17], gall-dwelling thrips [6], to snapping shrimps [8], the sterile soldier caste is the only, or first evolved sterile caste. Both types of eusociality are highly successful in terms of their biomass, social complexity and ecological dominance [4, 19].

Extensive studies of life history, function and caste regulation in eusocial hymenopterans shed light on the ultimate and proximate mechanisms underlying the evolution and maintenance of eusociality [2, 4, 12, 20-22]. Soldier-first lineages, which exhibit substantial differences from the worker-first Hymenoptera [10, 23-25], provide alternative and complementary models for the comprehensive understanding of the evolution of eusociality [6, 26, 27]. In this chapter, I present an up-to-date summary of our current knowledge regarding the soldier caste. I define the soldier caste as individuals that possess no or reduced reproduction and that are both morphologically and behaviorally specialized for defense. This excludes old workers that may defend the nest

(also called temporal soldiers) in bees and wasps [28-30]. In this chapter, I focus on the bona fide soldier caste in soldier-first eusocial lineages, which evolved directly from the reproductive form [17, 31, 32]. I also include the physical soldiers in ants throughout this review because of their morphologically and behaviorally specializations for defense [4].

Although it is still debatable whether ant soldiers evolve from reproductives in a way that parallel to, yet independent from workers ( e.g. most researchers believed that ant soldiers evolved from worker caste) [33-37], ant soldiers apparently represent convergent evolution between ants and termites under similar ecological conditions [4]. To facilitate future research, questions regarding the ecological and evolutionary significance of the soldier-first eusociality are discussed as well.

1.2 Morphology and Functionality of the Soldier Caste

1.2.1 What constitutes a soldier?

Soldier-first eusociality is not uncommon across phylogenetically distant taxa. In termites, the soldier caste represents a final developmental stage (Table 1.1) [38]. They differentiate from juveniles through molting and the final stage is always preceded by a presoldier stage [39]. These soldiers are considered as permanent juveniles because their prothoracic glands do not degenerate during morphogenesis [40]. In eusocial aphids, the soldier caste maybe 1st or 2nd immature instars, depending on the species (Table 1.1) [17].

These aphids either never molt or remain instars for a prolonged time period before developing into adults [41]. Caste determination takes place during embryonic development or at a late 1st instar stage [41-43]. In social thrips, the soldiers are adult male or female offspring of the foundress (Table1.1) [6, 44]. Caste determination seems

to occur in the egg [45]. In the eusocial snapping shrimp of the genus Synalpheus, soldiers are large, mature males with powerful major chelae, which defend the queen and juveniles against hetero/ conspecific intruders (Table 1.1) [8, 46, 47].

Besides soldier-first lineages, physical soldiers have been documented in few

Hymenoptera lineages (Table 1.1). In ants with a polymorphic worker system, a major worker is commonly called “soldier” because of its morphological and behavioral specialization for defense [33, 34]. Most recently, a physical soldier caste was discovered in a neotropic stingless bee, Tetragonisca angustula, [15]. The body size of the soldier bees is larger than foragers and they are specialized for nest defense.

Interestingly, a physical soldier caste is also documented in non-eusocial animals.

A trematode speices (Himasthla sp.), which infects the California horn snail, Cerithidea californica, produces two morphologically distinct forms, a soldier morph and a reproductive morph, within the host [7, 22]. The soldier morph defends the reproductive morph against interspecific competitors within the same host [48, 49]. A physical soldier caste is also documented in a polyembryonic wasp, Copidosoma floridanum

(Encyrtidae), during its larval stage inside the host [50]. In this species, females lay eggs in the host, and the subsequent embryonic proliferation produces about 3000 embryos

[51, 52]. Most embryos develop into larvae that will eventually develop into adults, while a small portion develops into "soldier" larvae [51]. These soldier larvae defend siblings against competitors but are not able to develop beyond the larval stage, and die from desiccation after the host is consumed [53, 54].

1.2.2 Morphological Distinctions of the Solider Caste

Anatomical specialization for defense is a typical trait of a soldier caste (Figure 1.1). In social aphids, a soldier usually possesses an enlarged body, sclerotized tergites and stylets, enlarged forelegs or sharp frontal horns, which are adaptations to attack Dipteran or coleopteran predators (Figure 1.1 d) [41]. In gall-dwelling thrips, the soldier caste possess reduced wings (micropterous) and armed forelegs [6, 55], making them efficient defenders against predators and kleptoparasitic thrips (gall-stealing species of

Koptothrips) [32]. Termite soldiers have various physical modifications for nest defense

[16, 38]. Soldiers in all termite lineages possess heavily sclerotized and pigmented head capsules, which are stronger than those of workers and reproductive (Figure 1.1a,b) [38].

In some lineages, soldiers possess enlarged mandibles that are used to attack intruders by biting, crushing and slashing (Figure 1.1b) [56]. This morphological adaptation enables soldiers to fight and kill equal sized competitors and predators, such as ants. In genus

Nasutitermes, soldiers possess an ampule-shaped head capsule that houses the frontal gland to eject toxic terpenoid chemicals (Figure 1.1a) [56]. In genera Cryptotermes [57] and Reticulitermes [58], the size and shape of soldier head are adapted for phragmosis defense (blocking the nest entrance to prevent invaders from entering the nest) [56].

Snapping shrimp soldiers are larger than nest mates in body size and possess powerful major chelae [8, 46, 47]. When faced with an intruder, the soldier shrimp aggressively snaps at the enemies until they are killed or expelled from the nest.

In comparison to soldier-first lineages, a physical soldier caste is limited in worker-first lineages, which exists predominantly in few ant species with elaborated morphological specializations [4]. In the ant genera Pheidole and Solenopsis, soldiers possess a large body size and a disproportionately enlarged head (Figure 1.1f) [19]. These 5

traits are likely adaptations for fighting or phragmosis defense [59]. Soldiers in the genus

Eciton possess large, fishhook-shaped mandibles, which are believed to be effective weapons against vertebrates [4, 60]. Some species in the genera Pheidole, Solenopsis, and

Camponotus, are trimorphic within the worker caste, such that soldiers can be of multiple sizes and are subdivided into "small" and “super” soldiers [61]. In stingless bee,

Tetragonisca angustula, the soldier caste is bigger, heavier and has larger hind legs in comparison to regular workers, which enable them to carry out effective nest defense

(Figure 1.1e) [15].

The soldier morph of trematode is smaller and possesses much larger mouthparts than the reproductive morphs [48, 49]. The enlarged mouthparts facilitate their fighting with conspecific intruders, while the smaller body size can enhance defensive functionality by facilitating dispersion of soldier morphs through the host tissue [48, 49].

In polyembryonic wasp C.floridanum, soldier larvae possess elongate body and are equipped with specialized fighting mandibles, which enable them to fight with inter- clonal competitors [53].

1.2.3 Adaptive Functions of the Solider Caste

Besides nest defense, the soldier caste in many eusocial lineages has evolved various adaptive functions (Table 1.1). In many ant species, soldiers may participate in seed milling, food storage and even brood care, in addition to nest defense [2, 59, 62]. Soldiers from social aphids are actively involved in gall cleaning and repair [17, 63, 64]. These individuals eliminate defecated honeydew, shed skins and carcasses, and also repair gall openings that are damaged by predators [63]. Soldiers within gall-dwelling thrips could lay eggs and produce dispersers [45, 65]. Hence they contribute to colony reproduction, 6

despite that they have reduced fecundity when compared to the foundress [45]. A recent study found that soldiers of the social thrip, Kladothrips intermedius, perform an antifungal function by secreting specific compounds to control the fungal pathogen

Cordyceps bassiana [66]. In termites, soldiers of Nasutitermes costalis may control the growth of a nest microbe by releasing terpenoid secretions from their frontal gland [67].

Termite soldiers, sometimes, also serve as foraging scouts [68-71]. This task is considered an adaptation of the soldier caste to reduce predation risk in the early phase of foraging activities, during which nest members are more likely to be exposed to other predators [68]. Soldiers of Prorhinotermes simplex participate in the transportation of eggs after the colony is disturbed [72]. Moreover, the soldier caste in some termite species also contributes to colony reproduction. High numbers of soldiers have been observed to accompany and protect alates, thereby assisting the swarm [73]. The presence of soldiers also appears to stimulate the production of supplementary reproductives [38, 73], a process which is associated with the juvenile hormone (JH) [38,

74]. According to Henderson [38], termite soldiers act as a “JH sink” that uptakes JH from nest mates during the caste transition process to decrease the JH level of the reproductively competent immature workers [38]. In some basal termite families (e.g.,

Termopsidae), there is a fertile soldier caste in addition to the regular soldiers [75]. This soldier caste, by itself, is a reproductive caste. Fertile soldiers possess defensive morphology and, in the meantime, they also have well-developed gonads and are capable of egg-laying [75].

1.3 Regulation of Soldier Caste

1.3.1 The Cost of Maintaining the Soldier Caste

In most eusocial lineages, the physical soldier caste is costly to produce and maintain [4,

38, 43]. Termite soldiers are unable to collect food and must depend on the assistance of workers for food [38, 76]. Overloading of soldier caste, i.e., maintaining a higher than normal soldier percentage in a colony, adversely impacted the survivorship of the termite colony [14]. In ants, production of soldiers requires a high level of nutrition to be received by the brood [4, 77]. In social aphids, the production of soldiers can slow down the intrinsic growth rate of the colony [56]. In comparison to a temporal based caste system, the morphology-based caste is less flexible in modulating caste compositions in response to environmental cues [4, 78]. This may be one of the reasons why most hymenopterans employ temporal-based nest defense (age-dependent polyethism) as opposed to a physical soldier caste [78]. To maximize colony fitness in face of a trade-off between enhanced defense and soldier maintenance, eusocial lineages must regulate soldier production in response to various environmental cues to ensure adequate defensive capability while minimizing fitness costs [13, 48, 79].

1.3.2 Environmental Risk

Various environmental cues have been documented to affect the regulation of soldier caste in soldier-first lineages. These cues can influence colonial decisions in soldier production and allocation by affecting both the necessity of defensive investment and the level of available resources for defensive investment. Predation and competition risk could increase the colonial demand for soldier investment. Shibao [80] hypothesized that production of soldiers should be responsive to the level of predation or competition risk to optimize colony fitness. Consistent with this “optimized defense” hypothesis, studies

in diverse lineages show that soldier production and allocation could be affected by environmental factors. Direct risk of predation and competition, which is caused by the presence of predators and competitors, can prolong the soldier instar in social aphids

[81], and increase the production of the soldier caste in ants [79] and polyembryonic wasps, C. floridanum [82]. Indirect risk which is represented by the likelihood of encourtering predation or competition, can also affect soldier production. The aphid

Pseudoregma sundanica, attract ant by secreting honey drew for their protection against predators such as lady beetle. Therefore, tending by ants may be perceived as a signal of

“being protected”, and can inhibit the production of sterile soldiers [83]. Excluding ants from a P. sundanica colony, causes a loss of protection agaist predators and represents a higher predation risk, thereby resulting in increased soldier production [83]. Similarly, the social trematode (Philophthalmus sp.) produces fewer soldiers when the trematode parasitizes larger host snails, which are less likely to be co-infected with other competing trematodes [48]. Seasonal or temperature changes, which could affect predator abundance, may affect soldier production in termites and aphids. In a subterrenan termite, Reticulitermes flavipes, the percentage of soldiers reaches its peak in the spring when temperatures are increasing, which is advantageous for the protection of emerging alates [14, 38]. In the bamboo aphid, P. bambucicola, soldier percentage in a colony started to increase in late summer, reached a peak in autumn, and then abruptly decreased in early winter [84].

The abundance and/or spatial distribution of predators and competitors can also affect the distribution of soldiers within a colony. Social societies allocate their soldier caste to regions in which predation and competition risks are high [68, 69, 80]. In P.

bambucicola , soldier distribution was biased toward peripheries that are exposed to predators [80]. In termites, soldier density was substantially greater during the exploratory phase of foraging in unknown territories where a higher risk of intra- or interspecific confrontations was present [68, 69, 85]. Interestingly, when the Eastern subterranean termite, R. flavipes, encountered corpses from a congeneric competitor, R. virginicus, significant more R. flavipes soldiers were recruited to the burial site in comparison to the treatment with R. flavipes corpses [86].

1.3.3 Resource Availability and Allocation

The abundance and quality of food resources are closely associated with soldier abundance. Since development and maintenance of this caste are energetically costly, soldier investment is favored when a colony is nutritionally sound [87, 88]. In a subterranean termite, Coptotermes formosanus, soldier production took place when workers received a high-nutritional food (e.g. pine wood) instead of a low-nutritional food [88, 89]. A mathematical model [90] showed that food availability and allocation can affect soldier production in lower termites. Based on the model, soldiers are produced from young workers when food is abundant, and are produced from older workers when food is scarce [90]. Resource availability can also affect soldier production in ants, in which high quality food (a high protein diet) is believed to be essential for the development of soldiers from larval ants [77, 91-94].

1.3.4 Colony Size, Reproductive Caste and Genetic Factor

Other epigenetic factors, including colony size and population density, can also affect the soldier production [95, 96]. In two social aphid species, Tuberaphis styraci and

Pseudoregma bambucicola, increased colony size is consistently associated with higher soldier ratio [96, 97]. A similar correlation has been documented in carpenter ant species

Camponotus novaeboracensis [98]. In T. styraci, soldier production can be affected by the population density in a colony [43]. In addition, under specific environmental conditions, the soldier ratio seems to be consistently different among genetically unrelated laboratory R. flavipes colonies, suggesting that genetic factors may also play a role in the soldier production [99]. Recently, several studies have focused on how reproductives affect the soldier production in the soldier-first lineages. In the worker-first

Hymenoptera and naked mole rats, the presence of the queen could suppress the production of new queens or inhibit worker reproduction, through physical aggression or queen pheromone [100-105]. Similar queen effects on soldier caste regulation have been documented in the soldier-first lineages. In termites, the presence of primary or secondary queens has been shown to inhibit the differentiation of new reproductive [106-108] , but facilitate soldier differentiation in some species [109-111]. Interestingly, the soldier caste in lower termites seems to regulate queen production by controlling JH level of nestmates through an unknown mechanism [38]. Future study is needed to explore queen-soldier interactions in the soldier-first lineages.

1.3.5 Self-Regulation

Besides JH, soldier caste differentiation appears to be self-regulated through positive and negative feed-back mechanisms in termites [38, 112], aphids [43] and ants [93]. In termites, soldiers dictate its own percentage by inhibiting worker-soldier caste differentiation through down-regulating of JH titer in workers [38, 112, 113]. In addition, pheromones might also play a role in the self-regulation process. Lefeuve [112] suggested that soldier differentiation in a higher termite, Nasutitermes lujae, might be inhibited by a contact pheromone secreted from the frontal glands of soldiers. Consistent 11

with this hypothesis, two soldier-produced terpenes, γ-cadinene (CAD) and γ-cadinenal

(ALD) have recently been extracted from the soldier head of R. flavipes. These soldier head extracts, serving as primer pheromones modulating the JH response threshold in workers, clearly exhibited regulatory effects on soldier differentiation [114, 115].

Similarly, ant soldiers may also regulate the JH level of their nestmates. Modulation occurs during the larval stage, possibly through an inhibitory soldier pheromone, which can be transferred though brood feeding [93]. In the aphid Tuberaphis styraci, physical contact seems to be important in self-regulation [42]. Frequent physical contact among non-soldier nymphs due to crowding can trigger soldier differentiation [42]. On the other hand, the "coexisting" soldiers can suppress the soldier differentiation [42, 43].

1.3.6 Juvenile Hormone

Juvenile hormone (JH), an important growth hormone in insects, has been implicated in caste determination and division of labor [116-118]. In termites, JH is essential for soldier caste differentiation and is responsive to environmental cues, including nutrition, temperature and seasonality [88, 119]. It has been demonstrated in many different species that JH induces worker-soldier transition [120-123], in which externally applied JHIII or a JH analog (JHA) stimulated presoldier formation in termites [113, 117, 124, 125]. A similar association between JH and soldier production has been found in eusocial

Hymenoptera. Topical application of JH or methoprene (a JH analog) on larval ants at a critical period result in the development of the soldier morph in several ant species [78,

126, 127].

1.3.7 Molecular Basis

The molecular basis underlying the soldier caste differentiation has been investigated in termites, and several genes and regulatory pathways have been implicated in the worker- soldier transition in termites. SOL1, a soldier specific gene in the Japanese damp-wood termite , Hodotermopsis japonica, is expressed exclusively in terminally differentiated soldiers but not in presoldiers [39]. It is believed that SOL1 is one of the most downstream genes in the cascade because the expression of SOL1 begins after caste differentiation is completed [39]. A recent study identified another soldier specific gene,

HsjCib, in the Japanese rotten-wood termite Hodotermopsis sjostedti [128]. This gene, categorized as a β-thymosin, encodes an actin binding protein. It is considered as a potential downstream effector in the soldier morphogenesis and is likely involved in cephalic morphogenesis and neural reorganization. Hexamerins, a family of storage proteins, have been shown to play an essential role in the regulation of soldier differentiation in termites. Downstream pleiotropic effects caused by hexamerins silencing significantly affect the expression of soldier morphogenesis-associated genes

[121] and eventually induce JH-dependent presoldier formation [129]. These mechanistic studies indicate that hexamerins possess JH-sequestering capabilities and can regulate worker-soldier transition by modulating the availability of JH [129]. As a negative regulator, hexamerins are also responsive to environmental stimuli, including epigenetic factors such as temperature and nutrition [121] as well as predation and competition stress (Li and Zhou, unpublished data), which, in turn, influence the downstream soldier formation. These combined findings suggest that the hexamerins are one of the environmentally responsive factors that exert a regulatory function by connecting upstream epigenetic factors to downstream caste differentiation responses [121]. 13

Recently, it has been demonstrated that soldier morphogenesis is associated with the insulin/insulin-like growth factor signaling (IIS) pathway in the termite H. sjostedti [130].

Termite orthologs of the IIS pathway, including HsjInR, HsjPKB/Akt, were up-regulated during soldier morphogenesis [130]. It is believed that insulin signaling could interact with JH and may play an important role in mandible elongation during soldier formation

[130]. Most recently, Methoprene tolerant, a gene encoding a putative JH receptor, has been demonstrated to regulate soldier specific morphogenesis[131].

1.4 The Evolution of the Soldier Caste

Distinctively different caste distributions have been observed in worker-first and soldier- first lineages. A physical soldier caste is not common in worker-first lineages, and have only been documented in a few ant species, and recently in a stingless bee T. angustula

[4, 78]. Likewise, the presence of a true worker caste is not common in soldier-first lineages, and has only been documented in several termite families [40]. The difference on sterile caste function (e.g. improved brood care for worker first lineages and enhanced colony defense for soldier-first lineages) between worker-first and soldier-first lineages strongly suggests eusocial evolution in these two groups may have been driven by distinct biological, ecological, and genetic factors [10, 18, 26, 132].

1.4.1 Biological Factors

Metamorphosis: Caste determination is inevitably affected by the distinctively different developmental pathways. For instance, worker-first lineages, primarily comprises of holometabolous hymenopterans, while solder-first lineages like termites, aphids, thrips

are hemimetabolous insects. Metamorphosis can affect the evolution of the worker caste via immature dependency. The holometabolous development in Hymenoptera produces dependent, vulnerable immatures that are morphologically distinct from adults. Since they larvae do not possess adult morphology (e.g wings, compound eyes), they can’t work. In the meantime, it provide adults with an ecological opportunity for parental care.

The dependency of immature hymenopteran is believed to promote the evolution of workers [25]. The extensive brood care required by highly dependent larvae may encourage the evolution of alloparenting. For example, social Hymentoptera are evolved from solitary lineages exhibiting extensive brood provision for helpless young [10]. By contrast, the hemimetabolous termites produce relatively independent immature instars, whose body ground plan resembles miniature adults [25, 133]. These immatures are, by themselves, capable laborers to carry out various tasks for the colony. In comparison to the holometabolous hymenopterans, evolving specialized workers for brood care might not be the top priority in the hemimetabolous termites. Indeed, true workers are, generally, absent in the primitive termites [24, 133].

Morphological Peculiarity: Evolution of a distinct physical soldier caste is not common in the Hymenoptera. One possibility is that adult hymenopterans are usually anatomically well-equipped with stings and sclerotized body, and therefore they might not need a highly specialized soldier caste [4, 18]. The sting, in particular, might be an adequate defense mechanism to replace a bona fide soldier caste [4, 18]. Indeed, all workers in a honeybee colony are able to sting and their age-dependent functional transition from forager to soldier requires little morphological change. In contrast, termites and aphids are both soft-bodied insects that possess few, if any, defensive structures. Therefore, the

evolution of a well-equipped defensive caste would greatly improve the overall colony fitness. Interestingly, the association between morphological peculiarity and caste evolution has also been suggested in a study on a stingless bee, Tetragonisca angustula.

This species has reduced stinger that cannot be used for defense, and they seems to have an anatomically distinct defensive caste known as guard bees [15].

1.4.2 Ecological Factors

Ecological factors, such as nesting structure/habitat can have profound influence on the evolution of castes. By dwelling and feeding inside their nest, foraging is not necessarily required for the soldier-producing lineages like termites and gall-making aphids.

Therefore specialized foragers might not be essential in these lineages [25]. In some basal termite species, which nest in a single piece of wood log for their lifetime, true workers are absent [25]. By contrast, true worker caste do evolve in termite species nesting in separate locations, in which foraging outside the nest is mandatory [40]. In addition, saturated nesting site, limited resource, and high predation and competition pressure demand effective defensive strategies [134-136], which can lead to the evolution of distinct soldier caste [10]. In social aphids, predation risk seems to be the primary driving force for the evolution of soldier caste [97, 137]. Intraspecific competition likely drives soldier evolution in termites [75], snapping shrimps [138],and social trematodes [49].

Similarly, interspecific parasitism is thought to be the main driving forces for the evolution of the soldier caste in social thrips [32].

In contrast, most social hymenopterans have strong flight capability and have the tendency to explore new territories [10, 25]. This would free the Hymenoptera lineages from strong local competition for nest sites. In addition, nesting site of social 16

hymenotpera is usually distant from food source. Thus evolution of foragers may be needed for efficient foraging [10]. The convergent evolution between ants and termites reflects the ecological influences on caste evolution [4, 25]. With a subterranean nesting structure similar to termites, ants face strong predation and completion stress. These may have driven the evolution of distinct soldier castes in some ant species [79, 139, 140]. In agree with the statement, a study by abouheif et al [127], suggest that high possibility of confrontation with the predatory army ants is associated the tendency to produce super soldier castes in some pheidole ants species..

1.4.3 Genetic Factors

Debate over the contribution of genetic relatedness to the evolution of altruistic caste have been ongoing for many years [21, 23, 141-144]. Currently, the controversy seems to lie in whether close kinship is a driving factor or merely a consequence of the evolution eusociality [145, 146] and whether ecological factors or genetic factors contribute more in shaping eusociality [147-152]. In Hymenoptera, the haplodiploid genetic system results in higher genetic relatedness of workers to females (siblings) than to males

(brothers and sons) [21, 22]. Supporting kin selection theory [21], workers seem to favor raising the most related full siblings than less related males, leading to a female-biased sex ratio in a colony [22, 153, 154].

Most soldier-first lineages are diploid animals. The sex ratio theory based on asymmetric relatedness does not seem to apply to these lineages [18, 143, 155].

Nevertheless, a high level of genetic relatedness has been assumed in many soldier-first lineages, because of their reproductive strategies and lifestyle [10, 18, 155]. For example, in social aphids, colony members can be genetically identical due to clonal reproduction. 17

In termites, high genetic relatedness is achieved through monogamy [156], inbreeding

[157] and chromosomal translocations [158]. In addition, high genetic relatedness via inbreeding has also been documented in social thrips [159, 160]. Recently, Kobayashi et al [148] documented a mother-son inbreeding system in two Reticulitermes species, R. virginicus and R. speratus. This asymmetric genetic system indicates that colony members are more related to the queen (female) than they are to the king (male). In agreement with kin selection theory, reproductive alate populations were found to be strongly female biased in colonies with mother-son inbreeding, suggesting that colony members favor the sex to which they are more related [148].

While genetic factors may have generally driven the evolution of altruistic behavior, and later the sterile castes, it seems difficult to associate genetic factors with the caste evolution. Both workers and soldiers exhibit reproductive altruism to their close related colony members albeit the difference between their function. Yamamura [18] developed a model of genetic correlation with caste distribution. Comparative study of social aphids, termites and Hymenoptera suggested that genetic identity based on clonal reproduction could favor the evolution of a soldier caste [18]. Diploid system could allow the evolution of both workers and soldiers. Haplodiploidy could favor the evolution of only workers [18]. However, this model seems to be based on an over-simplified analysis that did not incorporate other factors that may be important for caste evolution.

In addition, the suggested genetic correlations of caste distribution failed to explain caste system in more recently discovered eusocial lineages such as social thrips (haplodiploid, with only soldiers) [32], eusocial beetles (diploid, with only workers) [7], naked mole rats

(diploid, with only workers) [9] and snapping shrimps (diploid, with only soldiers)

1.5 Perspectives and Questions

1.5.1 Defining a Soldier Caste

The term “soldier caste” implicates the primary adaptation of this caste as nest defense.

However, soldier castes in some lineages can perform other adaptive functions [17, 63,

66, 72]. In some cases, soldiers do not carry out defense at all. A soldier caste that carry out no defense is known in many ants species [2, 161, 162], where they may be adapted for other function [4]. Although controversial [151, 163], Myles [164] suggested that the morphology of termite soldiers might originally be adaptations for neotentic competition for nest inheritance and breeding position. Recent discovery of anti-fungal function in the gall-dwelling thrips K. intermedius [66] suggests that fugal pathogens might be major selective factors for soldier evolution in social thrips [66]. These findings suggest that ecological factors other than defense might be involved in shaping the evolution of the soldier caste. It is also possible, that soldier castes in some lineages is primarily adapted for other function with nest defense being subsequently formed. Therefore, future efforts should focus on exploring the function of the soldier caste in each lineages, since such information would undoubtedly lead to deeper insights into the evolution of soldier caste and eusociality.

In addition, questions may arise when the term “soldier” is used to describe the sterile caste in some lineages without knowing whether the caste is truly specialized for nest defense. In ants, the term “soldier” is used to describe wingless caste that are neither workers nor reproductives and that possess limited task repertoire, regardless whether the individual carry out nest defense [162, 165]. However, we suggest precautions in the use of “soldier” in the soldier-first lineages [4]. Since the “soldier” is the first specialized sterile caste in these lineages, functions of this sterile caste, which is directly reflected by 19

its name, may directly indicate ecological implications in eusocial evolution of these lineages [4]. Therefore, use of “soldier” to define these sterile castes without comprehensive understating of their adaptive functions would mislead our understanding of eusocial evolution in these lineages.

1.5.2 Ecological Factors Shape Caste Evolution

Despite the fact that both soldiers and workers exhibit reproductive altruism, the two castes are distinct in their adaptive functions. Current debates regarding how genetics and ecological factors contribute to the development of eusociality primarily focus on how these factors contribute to the evolution of altruistic helping(why to help), whereas the remarkable functional differences (how to help) between the two castes are not sufficiently considered. Although it has been demonstrated in many lineages that genetic relatedness might contribute to evolution of altruism in both worker-first and soldier-first lineages, little genetic correlation has been found to explain distinct caste evolution in worker-first and soldier-first lineages. However, a comparison between worker-first and soldier-first lineages suggests the presence of strong ecological and biological correlations for such differences. Therefore, while eusocial evolution could be attributed to both genetic and ecological factors, the function and distribution of altruistic castes are primarily shaped by the latter.

1.5.3 Soldier-Derived Eusociality

Classical theories on eusocial evolution and maintenance, such as kin selection, primarily focus on the sterile worker caste in the social Hymenoptera [2, 21]. However, the discovery of soldier-first lineages suggests that social evolution could take place under very different genetic and ecological conditions and can take different forms (soldier first eusociality versus worker first eusociality). Furthermore, the discovery of a physical

soldier caste in trematodes and parasitic wasps indicates that a distinct altruistic caste can also be present in non-eusocial systems, as long as biological and ecological factors essential for caste evolution are met. Therefore, study on the soldier caste and soldier- first lineages have led to new insights into the evolution of caste and eusociality. More importantly, the soldier-first lineages provide important complementary additions to comparative models available for study social evolution, because of their distinct biological and ecological traits Despite a growing interest in the study of soldier castes

[66, 130, 148, 162, 166], the evolution and regulation of soldier caste in eusocial lineages remains unclear. For instance, it is still unknown how JH and/or pheromone regulate soldier caste differentiation in snapping shrimps, gall-dwelling thrips or eusocial aphids.

Although few studies have focused on the molecular mechanisms of caste differentiation in termites [39, 121, 128, 129], the ultimate and proximate factors contributing to the soldier differentiation are far from clear [18, 75, 151, 167]. Empirical study is, therefore, warranted to explore the function, evolution and regulation of the soldier caste.

Table 1.1 The soldier caste in different eusocial lineages

Lineage Origiona Stageb Sexc Function Representative References Shrimp R A M Defense Synalpheus [8] Species Aphid R J F Defense regalisTuberaphis [168] Colony styraciPemphigus [63] hygieneNest repair spyrothecaePemphigus [64] Thrip R A M&F Defense spyrothecaeOncothrips [32] Antifungal tepperiKladothrips [66] Termite R J M&F agentDefense intermediusCoptotermes [169] Antifungal formosanusNasutitermes [170] agentScout costalisNasutitermes [68] Egg costalisProrhinotermes [72] transferringCaste simplexReticulitermes [115] regulationReproducti on flavipesZootermopsis [75] d e Hymenoptera W A F Defense nevadensisPheidole [171] Nurse bicarinataPheidole [172] Seed milling megacephalaSolenopsis [173] Food storage Colobopsis [62] megacephalageminata Tropical egg Crematogaster [162] nipponicus “a”: evolutionary origin of the soldier caste.laying smithi “b”: the developmental stage of the soldier caste. “c”: sex of the soldier caste “d”: only include the physical soldier caste in ants here “e”: Ant soldier is origined from either reproductives or worker. R: Reproductive form, W: Worker caste, A: Adult, J: Juvenile, M: Male, F: Female.

Figure 1.1 The worker caste and the soldier caste in eusoical societies. a. Soldiers (upper right) and workers in a termite genus Nasutitermes (Photo by Alex Wild). b. The soldier caste (left) and the worker caste in a termite Zootermopsis nevadensis (Photo by Li Tian). c. The soldier caste (upper right in the left picture) in trematode Himasthla spp., and its appearance in close-up (right picture) (From Hechinger et al [173]). d. The soldier caste of a eusocial aphid, Tuberaphis styraci, attacking a lacewing larvar (predator) (From Shibao et al [13]). e. The soldier caste (right) and the worker caste in the stingless bee, Tetragonisca angustula (From Gruter et al [15]). f. A soldier (left) and an ordinary worker of ant Pheidole barbata (Photo by Alex Wild). g. Workers surrounding a queen in an Apis merllifera colony. h. Workers of Heterocephalus glaber (Photo by Edward Russell)

2 Chapter 2 The Stress Buffering Function of the Soldier Caste

2.1 Introduction

The presence of a reproductively altruistic caste is a hallmark of eusocial insects [2].

Because the altruist caste is specialized for certain social tasks at the cost of self- reproduction, functions of these castes have strong implications to trade-offs between reproduction and ecological pressures that have promoted the origin of eusociality [174].

The origin of eusociality in termites is hallmarked by the evolution of the sterile soldier caste [75]. However, our understanding of this caste is far from comprehensive in terms of its function and regulation [75, 151]. Termite soldiers are best known for their morphological specialization for defense [174]. For instance, soldiers in the genus

Nasutitermes have an ampule-shaped head housing a frontal gland from which viscous secretions composed primarily of terpenoids are ejected (Moore, 1964, 1968) [174].

Soldiers of the genus Reticulitermes possess powerful mandibles and disproportionately enlarged heads [174]. The morphology of the soldiers is clearly modified either for fighting or for defense of the colony by blocking the nest entrances [56]. On the other hand, the morphological modifications of their mouthparts make them unable to carry out other social tasks, and they must depend on the assistance of workers to feed [38, 76]. For this reason, the behavioral repertory of the soldiers is very limited in comparison with that of the workers, giving strength to the conclusion that they perform the exclusive role of physical defense [31, 56].

However, recent studies suggest that soldiers may also play an important role in social regulation [175]. In particular, an increasing amount of work indicates that the ratio and behavior of termite soldiers can greatly influence the behavior and physiology

of colony members [113, 114, 175-177]. For instance, soldiers of the dry-wood termites moderate the aggressive response of workers toward predatory ants [177]. This would be adaptive given that excessively aggressive behavior by workers would compromise foraging efficiency because workers are the primary foraging force. Soldiers also inhibit differentiation of new soldiers by workers, possibly using a negative feedback mechanism mediated by pheromone release by soldiers [178]. This prevents unnecessary burden to the colony due to production of excess soldiers. In addition, soldiers also seem to regulate colony reproduction [151] and affect efficiency of foraging by workers [179].

The role of soldiers in social regulation is further supported by the recent discovery and isolation of soldier-specific primer pheromones [175]. These findings suggest that in addition to defense, soldier termites are also able to contribute to colony fitness by influencing the development and behavior of colony members. The purpose of this study is to demonstrate that in at least one species, R. flavipes, the soldier caste can modulate the response of colony members to competitor cues, and serve to alleviate stress induced by competitor cues.

2.2 Materials and Methods

2.2.1 Termites

Workers and soldiers from three field-collected R. flavipes colonies (A1–A6, R1, and R2) were used in this study. Workers from one field-collected R. virginicus colony (A7) were used as the competitor. The distribution of these congeneric species overlaps throughout

North America, and each is agonistic toward the other [180]. “A”-prefix colonies were collected from the University of Kentucky Arboretum (Lexington, KY), while “R”-prefix

colonies were collected from Daniel Boone National Forest (Winchester, KY). R. flavipes colonies were collected within one week of use to minimize the impact of isolation from their original colony, maintained in growth chambers (complete darkness at 27 ± 1 C, 80

± 1% RH), and provisioned with pine wood mulch and fine pine wood logs. Termite species were identified by a combination of soldier morphology and 16s mitochondrial ribosomal gene sequencing.

2.2.2 Experiment I: Impact of soldiers on worker behavior

This experiment assessed whether the presence of soldiers altered the behavioral responses of R. flavipes workers to the nonlethal presence of R. virginicus. Prior to this experiment, R. flavipes workers from colony A1 were marked with individually identifiable color codes. Unmarked R. flavipes workers were transferred from their colony into a 55 mm Petri dish containing a filter paper disk; the disk was kept moist to prevent worker dehydration. As the workers walked on the disk, the dorsal side of individual workers was gently marked on the head, thorax, or abdomen with two different colors of permanent marker. To reduce the potential for injury, each body part on a given individual was only marked once. After being marked, workers were transferred to another Petri dish; several workers that sustained injury during the marking process were discarded.

Color-coded R. flavipes workers were added to a 35 mm Petri dish (“testing”) placed at the center of a 55 mm Petri dish (“periphery”; Figure 2.1). Prior to the addition of the workers, I cut 16 evenly spaced 1 mm slits in the wall of the 35 mm dish that transmitted chemical cues and allowed antennal contacts, but were too narrow for damaging/lethal interactions to occur. The experiment began when we added R. flavipes, 26

either 20 workers or 19 workers and one R. flavipes soldier, to a testing area provisioned with moistened paper disks. After a 24-h acclimation period, I stocked the periphery with

40 R. virginicus workers. This created two treatments: R. flavipes with competitors without soldiers and with soldiers. To confirm that workers in the testing area were responding to competitors rather than simply termite density per se, I added another treatment in which 40 R. flavipes nest-mate workers were placed in the periphery. Each

55 mm Petri dish was covered and sealed to decrease the risk of dehydration.

After the dish was sealed, I used a Canon VIXIA HF G20 video camera to record the behavior of all R. flavipes workers in each dish over the next 24 h. All three treatments were held under standard laboratory conditions (Light, 25 ± 1 C, 70 ± 1%

RH). At the end of the 24-h sampling period, the recorded footage was analyzed using

Observer (Noldus, Wageningen, The Netherlands), a behavior analysis program. At the beginning of the experiment and every four hours thereafter (i.e., 0, 4, 8, 12, 16, 20, and

24 h), I analyzed a three-minute section of video for the time spent on a series of commonly observed behaviors of every marked worker in every colony. Although I observed all workers in each colony, I only analyzed data from workers carrying clearly identifiable marks throughout the 24-h observational period.

I recorded the following behaviors for each worker: locomotion, resting, feeding, grooming (both itself and another individual), and vibration (rapid back-and-forward bodily movement). I also observed other behaviors that were too infrequent to analyze.

These included stomodeal/proctodeal trophallaxis (nutrient transfer from the mouth/anus of one individual to the mouth of another), defecation, and moving the corpses of dead nest mates. Please refer to the work by Korb and Schmidinge [181].

2.2.3 Experiment II: Acute impact of soldiers on worker survival

This experiment assessed whether the presence of soldiers over a short time period (two days) altered the survival of R. flavipes workers exposed to the nonlethal presence of R. virginicus. As in experiment I (Figure 2.1), the testing area contained either 20 R. flavipes workers or 19 workers and one nest-mate soldier. None of the workers were color coded.

Immediately after placing R. flavipes in the testing area of each arena, I placed either 20

(1:1 ratio) or 40 (2:1 ratio) R. virginicus workers in the periphery area. Termites in both the testing and periphery areas were provisioned with a moistened paper disk for food.

All Petri dishes were kept in an incubator (27 ± 1 C, 80 ± 1% RH) in total darkness for two days. At the end of the experiment, the Petri dishes were removed from the incubator and worker survival was assessed. The experiment was carried out using R. flavipes colonies A2, A4, and A5; for each colony, there were five replicates per treatment for each of the four treatments (1:1 competitor – soldier, 1:1 competitor + soldier , 2:1 competitor – soldier, 2:1 competitor cue + soldier ) for a total of 60 replicates (three colonies  four treatments  five replicates).

2.2.4 Experiment III: Chronic impact of soldiers on worker feeding, growth, and survival

This experiment assessed whether the presence of soldiers over a longer time period (15 days) altered the fitness (feeding rate, growth rate, and survival) of R. flavipes workers exposed to the nonlethal presence of the competitor R. virginicus. As in experiments I and II, the testing area contained either 20 R. flavipes workers or 19 workers and one nest-mate soldier; none of the workers were color coded. Immediately after placing R. flavipes in the testing area of each arena, I placed five competitor R. virginicus workers in

the periphery area for a total of two treatments: competitor-cue exposure without soldier

(competitor – S) or competitor-cue exposure with soldier presence (competitor + S). As in experiments I and II, I added another treatment in which five conspecific R. flavipes nest-mate workers were placed in the periphery as a control treatment (nest mate).

Termites in both the testing and periphery areas were provisioned with a moistened paper disk that was replaced with a fresh disk every three days. All Petri dishes were kept in an incubator (27 ± 1 C, 80 ± 1% RH) in total darkness except during measurement periods; the experiment ran for 15 days.

The experiment was carried out using three R. flavipes colonies. For colony A3, there were five replicates per treatment for each of the three treatments (nest mate, competitor – S, competitor + S) for a total of 20 replicates (four treatments  five replicates). For colony R1, there were seven replicates per treatment, for a total of 28 replicates; for colony R2, there were nine replicates per treatment, for a total of 36 replicates.

Worker mortality per replicate was scored daily, and dead workers were removed.

While dead R. flavipes workers were not replaced, dead R. flavipes soldiers and dead R. virginicus workers were replaced to maintain constant conditions. At the start of the experiment and every third day thereafter, all workers were removed from each replicate and weighed as a group. Average worker weight was determined by dividing the group weight by the number of surviving workers, and percentage weight change was determined by subtracting the day 0 weight from the measurement on that day, dividing by the initial weight, and multiplying by 100.

At the start of each experiment, R. flavipes workers were provisioned with a single paper disk that had been oven-dried at 100 C for one hour and weighed before being moistened with 100 µl deionized water and placed in the testing area. Every third day, the partially consumed old disk was replaced by a similarly treated new disk. The old disk was brushed to remove extraneous material, dried, and reweighed; paper consumption was calculated using the initial and final disk weights. Paper consumption rate (“PCR”; mg paper/mg termite/day) was calculated for each three-day period as follows: ((paper consumed, mg)/(total worker weight, mg))/(3 days).

2.2.5 Statistical analysis

The behavioral data from experiment I was taken on a single replicate (= Petri dish) per treatment, so no statistical analysis was possible. In experiment II, I used a three-way analysis of variance (ANOVA) to test for the effect of R. virginicus:R. flavipes ratio, colony, treatment nested within colony, and all two-way interactions; nonsignificant interactions were removed and the analysis was re-run. While the data met the assumption of equal variances, it was not normally distributed; ANOVA is, however, highly robust to departures from normality when per-treatment sample sizes are large

[182]. In experiment III, I used rm-ANOVA to assess the effect of colony and treatment nested within colony on cumulative mortality, percentage weight change, and paper consumption rate over time. The data on paper weight consumed contained a small number of anomalously high (i.e., >0.05 mg paper/mg worker/day) and low (i.e., negative) values. I addressed these by plotting the distribution and removing the highest and lowest 2.5% of values from the dataset. The removal of these data points narrowed the data range considerably, from –0.05, 0.077 to –0.001, 0.044. Because the Mauchly 30

Criterion test showed that the rm-ANOVA results violated the assumption of sphericity, we report Greenhouse–Geisser corrected results. All data were analyzed using JMP 9.0.0

(SAS Institute, Cary NC USA).

2.3 Results

2.3.1 Workers behave differently in the presence of competitors and soldiers

Our behavioral survey (Figure 2.2) showed that workers in the presence of nest mates spent a substantial amount of time resting and feeding, and virtually no time in vibration

(a typical stress response). In contrast, the nonlethal presence of R. virginicus workers led

R. flavipes to cease feeding, increase activity levels, and spend a large amount of time in vibration. The presence of R. flavipes soldiers decreased, but did not eliminate, the impact of R. virginicus on worker behavior; R. flavipes workers resumed feeding but still spent time in vibration.

2.3.2 Soldiers decrease the impact of competing species on worker mortality

The mortality rate of R. flavipes workers increased as a function of the R. virginicus:R. flavipes ratio (Figure 2.3; 1:1 ratio = 10.1 + 3.48 [SE]; 2:1 ratio = 21.9 + 3.56; F1,52 =

5.12, p = 0.030). The presence of a single R. flavipes soldier virtually eliminated the negative impact of R. virginicus, decreasing worker mortality in the 1:1 and 2:1 ratio treatments by 83% and 80%, respectively (F3,52 = 7.07, p < 0.001). All three R. flavipes colonies responded similarly to the treatments (F2,52 = 1.11, p = 0.34), and there were no significant two-way interactions (p > 0.05).

2.3.3 Soldiers buffer the long-term impact of competitors on workers

Workers exposed to competitor workers consumed 37% less paper over the course of the experiment than did workers with nest mates (13.8 versus 22.0 mg/g worker/day, respectively; Figure 2.4A; Table 2.1). The presence of a single R. flavipes soldier sharply reduced the negative impact of R. virginicus workers. Feeding in the competitor + S treatment (21.0 mg/g worker/day) was only 4.6% lower than in the nest-mate treatment, a statistically indistinguishable difference (Figure 2.4A).

Despite similar feeding rates, workers in the competitor + S treatment lost weight over the course of the experiment, while workers in the nest-mate treatment gained weight (Figure 2.4B; Table 2.1). The competitor + S treatment differed statistically from both the competitor and nest-mate treatments on days 3–9 of the experiment, but was similar to the competitor treatment on days 12–15 (Table 2.1, significant time  treatment interaction). This convergence appears to reflect the fact that higher mortality rates in the competitor + S treatment (Figure 2.4 C) removed all but the healthiest workers.

Worker mortality in the nonlethal presence of nest mates was minimal: 6% over the 15-day experiment (Figure 2.3C). While the nonlethal presence of even a small number of R. virginicus workers (1:4 ratio of R. virginicus:R. flavipes), increased mortality 10-fold, the presence of an R. flavipes soldier reduced competitor-induced mortality from 65% to 33%. Mortality rates in both competitor treatments increased more over time than in the nest-mate treatment, yielding a significant time  treatment interaction (Table 2.1).

2.4 Discussion

2.4.1 Competitor cue exposure reduced worker fitness

Exposure to competitor cues altered R. flavipes worker behavior, decreased growth, and increased mortality. Our study demonstrates that exposure to competitor cues can be lethal to termite workers. The fact that higher competitor:worker ratios (Figure 2.3) increased the lethal impact also suggests that worker responses were proportional to the magnitude of the threat [183]. The results are consistent with multiple studies showing that chronic risk exposure can have lethal impacts in invertebrates [e.g., 184, 185, 186].

Previous experiments addressing interspecies competition in termites virtually always allowed direct contact between the opposing groups [e.g., 180]. Clearly, in these experiments the primary cause of worker mortality is agonistic interactions [187].

However, the causes of nonagonistic workers’ mortality in our experiments are difficult to ascertain. It is possible that the combined impact of competitor-induced stress increased energy expenditure (i.e., behavioral/physiological responses) and decreased energy intake (i.e., reduced feeding) may have rapidly depleted worker resources to lethal levels. This interpretation is consistent with data from the behavioral survey, where workers exposed to nest mates spent approximately equal amounts of time in energetically costly and beneficial activities. The presence of competitors increased the ratio of costly to beneficial activities to 6.3:1 and decreased the fraction of time spent feeding by >99% (from 9.1% to 0.03% in the nest-mate and competitor treatments, respectively). Similar cue-induced cessation of feeding has also been documented in the grasshopper Melanoplus femurrubrum, where it increases starvation risk [186]. More broadly, risk-mediated changes in energy consumption, oxidative stress, and immune function have been documented in many invertebrate species [188, 189], where they can 33

compromise growth, reproduction, and survival. Thus, I suspect, but cannot confirm, that some combination of factors acts in concert to cause nonagonistic worker mortality.

Clearly, future studies are needed to understand the exact mechanisms generating the nonagonistic worker mortality.

2.4.2 Soldier alleviates negative impact of competitor cue on workers

The ability of a single soldier to buffer the lethal effects of chronic stress on the rest of the 19 nest-mate workers suggests a previously unrecognized function of the soldier caste. In addition to their role in colony defense, soldiers can also serve as a social buffer by reducing the impact of chronic stressors. The termite soldier caste is well equipped for physical defense. Because its presence denotes improved protection, it is reasonable for the nest mate to reduce the energy-costly stress response to risk cues in the presence of protective soldiers. Reduction of stress by the presence of a protective caste has not been documented in other social species. Nevertheless, it has been demonstrated that accompanying nest mates have been shown to reduce stress associated with fear and anxiety [190]. In addition, a negative correlation between the level of defense and level of vulnerability to risk is common in solitary animals [e.g., 191]. A large body of literature has demonstrated that animals with improved defense (living in a group, processing defensive morphology, or large body size) show reduced vigilance and defensive response to cues released by predators. The specialized caste structure found in termites and other eusocial insects may allow this trade-off to occur at the colony level [174].

Previous studies on the soldier function have been focused on physical defense.

While soldiers are able to benefit the colony by physical defense with their specialized morphology, they are only 2–5% of the individuals in R. flavipes colonies and spend 34

much of their time resting in the tunnel network [192, 193]. In addition, they are costly to maintain because they need to be fed by workers. Therefore, during the absence of nest intruders, soldiers would be a burden to the colony if physical defense is their exclusive function. This study provides a previously unknown mechanism by which termite soldiers can enhance colony fitness constantly and more efficiently.

The mechanisms by which soldiers alleviate worker stress are unknown. However, previous studies suggest that soldiers can influence colony members through chemical or acoustic cues. Future experimental testing of the function of soldier-specific cues, such as pheromones or cuticular hydrocarbons may help to address the question.

2.4.3 Ecological significance of the stress-buffering function of the soldier caste

The stress-buffering function of the soldier caste may be critical to the ecological success of a colony. Termites have limited dispersal capability because they are wingless insects.

Therefore, local competition for resources can be strong. Field studies have shown that competing colonies from different or the same species often nest near each other and forage at the same food/habitat sources [194-197] and interference competition, which involves fierce aggression between competing colonies, can commonly occur [198].

Inter- and intraspecies competition not only influences the spatial and temporal distribution of a colony [198], but may also compromise survival, and even leads to elimination of the entire colony [199, 200]. A previous study has shown that foraging workers may detect wood-chewing sound release by nearby competitors [194]. Therefore, it is likely that termite workers are constantly exposed to a certain level of threat from nearby competitors and suffer stress.

Like bees and ants, the termite worker caste is the primary housekeeping force that carries out foraging, nest building, and brood care [31]. Therefore, maximizing this 35

work force is beneficial to the overall fitness of the colony. By protecting vulnerable workers from environmental stressors, soldiers ensure high colony efficiency under a hostile environment. Our study also explains a phenomenon previously observed in the field: soldiers are always required during nest exploration, or recruited to the trail of foraging workers [175]. It is likely that in these situations, the primary function of soldiers is to increase working efficiency by protecting the workers from the impacts of environmental stressors. Future experiments including quantifying the level of environmental risk in the field may help to test this hypothesis.

2.4.4 Implications of the soldier function to eusocial evolution in termites

The evolution of the sterile soldier caste signifies reproductive division of labor, therefore it is a milestone in termite eusocial evolution [75]. Therefore, understanding the functionality of this caste has strong implications for understanding ecological factors driving termite eusocial evolution. It has been previously believed that direct predation and inter/intraspecies competition, which lead to the need for improved physical defense, are primary factors driving the evolution of the soldier caste [75]. Our results illustrate that the need to survive environmental risk is another important ecological pressure to termites, and offers insight into how evolution of the soldier caste might contribute to this process. Therefore, the need to survive environmental risk may be another key factor that has promoted the evolution of the soldier caste and eusociality in termites.

Table 2.1 Result of Repeated Measurement ANOVAs testing the effects of treatment (nonleathal presence of conspecific workers, heterospecific workers, or heterospecific workers plus a single conspecific soldier), colony ID and time on R. flavipes paper consumption, change in body weight and mortality.

Term Paper consumpt. rate % change in weight Mortality

F df p F df p F df p

Treatment 4.5 6,42 0.001 13.3 6,47 <0.001 16.3 9,72 <0.001

Colony 7.2 2,42 0.002 4.5 2,47 0.016 32.9 2,72 <0.001

Time 7.2 3,142 <0.001 6.5 3,146 <0.001 146 2,143 <0.001

Time*Treatment 1.7 20,142 0.035 3.7 19,146 <0.001 8.6 18,143 <0.001

Time*Colony 7.6 7,142 <0.001 3.5 6,146 <0.001 11.1 4,143 <0.001

R. flavipes worker

R. flavipes Soldier

Slits R. virginicus 3.5 cm worker 5.5 cm Figure 2.1 Schematic view of the experimental setup.

This setup was used to evaluate the impact of competitor cue on R. flavipes workers’ survival, body mass, and food consumption.

100 Walk Rest Allogrooming 80 Selfgrooming Vibration Feeding 60 Others

% Time Spend in Behavior in Spend Time % 20

0 Nestmate Control Competitor, S- Competitor, S+

Treatment

Figure 2.2 Mean behavioral responses of 10 R. flavipes workers.

Behavioral performance was surveyed every four hours over a 24-hr period, when exposed to the non-lethal presence of nestmate workers (left bar), competitor (R. virginicus) workers without accompany by soldiers (middle bar), and competitor workers with accompany by a single soldier (right bar).

Figure 2.3 Cumulative mortality of R. flavipes workers after 48 hour-exposure to competitor cue.

R. flavipes workers were exposed to competitor (R. virginicus) workers in the absence (soldier-) and presence (soldier+) of a single R. flavipes nest-mate soldier. Left pair of bars: 1:1 competitor worker: R. flavipes worker ratio; right pair of bars: 2:1 competitor worker: R. flavipes worker ratio. * p < 0.001 One-way ANOVA followed by LSD post- hoc test

0.030 Nestmate Control A Competitor, Soldier- Competitor, Soldier+ 0.025

0.020

0.015

(mg/mg worker/day) (mg/mg

Paper Consumption Rate Consumption Paper 0.010

0.005 10 B 5

-5

-10

-15

Change in Worker Weight (%) Weight Worker in Change -20

-25 80 C

Cumulative Mortality (%) Mortality Cumulative 20

0 0 3 6 9 12 15 Experimental Days 41

Figure 2.4 Solder moderate long term effects of competitor cue on worker fitness.

Figure shows worker feeding rate (A), percent weight change (B), and mortality (C) over a 15-day experimental period in the non-lethal presence of nest mate workers (black circles) or a competitors with (soldier +) or without (soldier-) accompany of a single R. flavipes nest-mate soldier (black triangles and white circles, respectively).

3 Chapter 3 Gene Expression Profile Associated with the Soldier- Dependent

Stress Buffering

3.1 Introduction

The evolution of the soldier caste is the hallmark of the origin of eusociality in termites.

[75, 151]. While soldiers are known to have evolved for improved colony defense, how it functions to contribute efficiently to colony fitness in the context of defense is not well understood.

Previously, our understanding of the function of the soldier caste has been limited to physical defense [31, 56]. However, my recent study demonstrated that soldiers of the

R. flavipes can serve as a “social buffer” to alleviate stress of colony members in an adverse environment. In particular, soldiers can moderate the behavior response of workers to the presence of competitors, and improve worker survival under sustained exposure to competitor cues (Chapter 1). Because termite colonies live in a highly competitive environment [198, 201-203], and workers are the primary workforce for a colony [31], stress buffering by soldiers may greatly improve colony fitness in a hostile environment by maximizing colony work forces. Despite the importance of this finding to our understanding of the soldiers’ function, mechanisms mediating the soldier- dependent stress buffering remain unknown. In particular, we know little about whether and how soldiers affect gene expression in workers to moderate their stress.

The potential of social regulation on gene expression has been described in other social lineages. For instance, both queen and larvae of the honey bee can modulate gene expression in the worker brain to regulate their behavior [204, 205]. In addition, social influence on gene expression in colony members in termites has also been described by

previous work [175, 206]. These lines of evidence suggest that, under competitor-cue exposure, the soldier caste might moderate worker stress by modulating worker gene expression. To test this possibility, I first challenged workers of R. flavipes with nonlethal exposure to a competitor species and examined the global change in head gene expression in response to competitor-cue exposure using RNAseq. Then, I compared the magnitude of competitor-cue induced gene expression change between workers with or without being accompanied by soldiers. I predicted that exposure to competitor cues can cause changes in the gene expression profile in workers, and that soldiers will moderate the magnitude of competitor-cue induced change in gene expression to mitigate the negative impact of competitor cues on workers.

3.2 Material and Method

3.2.1 Termites

Three 3-year old incipient colonies of R. flavipes, containing ~2000 workers and including royal pairs, were used in this study. Primary royal pairs of these colonies were collected from the University of Kentucky campus (Lexington, KY) in April, 2010. They were paired immediately following collection, maintained in a 5 cm diameter round container, and provisioned with moistened filter paper and fine wood mulch. Distilled water and new mulch were added to the container every three months. Colonies were transferred to a larger container once per year to accommodate for increase in colony size. All colonies were held in an incubator environment (darkness at 28 °C and 70 ± 5%

RH). A colony of R. virginicus, collected from the University of Kentucky Arboretum was used as the source of competition cues.

3.2.2 Competition cue treatment

The experimental setup was the same as in Chapter 2 (Figure 2.1). Briefly, R. flavipes workers were lured out from their natal nest into a moistened cardboard roll. Workers were added to a 35 mm Petri dish (“core testing”) placed at the center of a 55 mm Petri dish (“periphery”; Figure 2.1). Prior to the addition of the workers, 16 evenly spaced 1 mm slits were cut into the wall of the 35 mm dish, which transmitted chemical cues and allowed antennal contacts, but were too narrow for damaging/lethal interactions to occur.

Twenty R. flavipes workers, or 19 workers and one soldier, were added to the 35 mm dish provisioned with moistened paper disks. This created two social environments for workers: soldier-accompanied and soldier-deprived environments. For convenience, workers in the soldier-accompanied and soldier-deprived environments will be hereafter called W+S and W–S, respectively. Workers were allowed to acclimatize to the environment for 24 h. After the 24-h acclimatizing period, 40 workers of a competitor species, R. virginicus, serving as a source of competitor cues, were added to the periphery. The control treatment included 20 workers surrounded with 40 nest-mate workers in the periphery. The Petri dish was covered and sealed to decrease the risk of dehydration. Treatments were held in an incubator environment (darkness at 28 °C and

80 ± 5% RH). For each colony, three technical replicates were carried out for each treatment at each exposure duration.

3.2.3 Sample collection

Workers were exposed to either competitor or nest mate for 24 h. Then, worker heads were removed and flash-frozen in liquid nitrogen. For each colony, three technical

replicates were performed. Samples from the three technical replicates were pooled before RNA extraction.

3.2.4 RNA isolation, cDNA library construction, and illumina sequencing

Total RNA was extracted using the SV total RNA isolation kit (Promega). RNA purity and degradation were checked on 0.8% agarose gels and spectrophotometrically

(NanoDrop). RNA samples were shipped to BGI institute in dry ice (Guangzhou,

Shenzhen) for sequencing. Before library construction, RNA integrity was further analyzed at BGI using the 2100 Bioanalyzer (Agilent Technologies) with a minimum

RNA integrated number (RIN) value of 6.5. Samples with RIN < 6.5 were not used. After quality control, total RNA samples were treated with DNase I to degrade any possible

DNA contamination of the RNA. Seq libraries were prepared and sequenced on a HiSeq

2000 (Illumina) at BGI. Briefly, the mRNA was fragmented into small pieces (200 bp) using sonification. The cleaved RNA fragments were used for first strand cDNA synthesis using reverse transcriptase and random primers. These cDNA fragments were subjected to the end repair process and ligation of adapters. These products were purified and enriched using the polymerase chain reaction (PCR) to create the final cDNA library.

Nine cDNA libraries were sequenced. These include three treatments: 1. Nest mate- treated control, 2. competitor-treated, W–S, and 3. competitor treated, W+S, for three colonies. The sequencer was able to generate over 200 million, 50 bp-end reads with every biological replicate from each treatment. Data quality for raw reads was determined using SolexaQA. The raw reads were filtered by removing adapter sequences, reads in which the percentage of unknown bases (N) is greater than 10%, and reads with >50% low-quality base (base with quality value ≤ 5 based on SolexaQA). Clean reads were

mapped to a reference R. flavipes head transcriptome previously established by our group using SOAPaligner/SOAP2 [1].

3.2.5 Screening of differentially expressed genes

The expression level for each gene was determined by the number of reads uniquely mapped to the specific gene and the total number of uniquely mapped reads in the sample. The gene expression level was calculated using the reads per kb per million reads

(RPKM) [207]. The equation is shown below:

106퐶 푅푃퐾푀 = 푁퐿 ⁄103

Here RPKM is the expression level of a gene, C is number of reads that uniquely aligned to a gene A, N is total number of reads that uniquely aligned to all genes, and L is number of bases of the gene. The RPKM method is able to eliminate the influence of different gene length and sequencing discrepancy on the calculation of gene expression level. Therefore, the RPKM values can be directly used for comparing the difference of gene expression among samples. If there is more than one transcript for a gene, the longest one was used to calculate its expression level and coverage.

The gene expression levels in both W+S and W–S in the competitor-cue treatment were compared with nest mate-exposed control workers to identify competitor-cue regulated genes (CRGs, hereafter). Gene expression fold change in W+S and W–S relative to the control was calculated. For individual replicates of comparison, genes were considered as differentially expressed when the expression Log2 (Foldchange) > 1 or < –

1, with false discovery rate (FDR) < 0.00. To calculate genes significantly expressed between two treatment groups (average of the three replicates), differentially expressed 47

genes between the two treatments were screened using the NOISeq method Genome

Research 2011 [6]. The NOISeq method shows a good performance to screen differentially expressed genes between two groups, when comparing it with other differential expression methods. Genes were considered as differentially expressed when the expression Log2(foldchange) > 1 or < –1, with a possibility > 0.8. Genes differentially expressed between competitor-cue and control treatment groups were considered as

CRGs.

3.2.6 Gene Expression Validation by qRT-PCR

To validate the RNAseq results, I analyzed the expression pattern of the 12 genes with the highest-fold change in the competitor-exposed W–S sample using qRT-PCR. cDNA was synthesized from the same RNA samples used for RNA sequencing. About 1 μg of total RNA was used as a template to synthesize the first-strand cDNA using an M-MLV reverse transcriptase kit (Invitrogen) following the manufacturer’s protocols. The resultant cDNA was diluted to 0.1 μg/μl for further analysis in the qRT-PCR (BioRad

MyiQ™ Single-Color Real-Time PCR Detection System) using a SYBR Green Realtime

PCR Master Mix (BioRad). Table 3.1 lists gene specific primers used in the gene expression analysis. Relative gene expression was calculated by the 2−ΔΔCt method using the housekeeping gene glutathione-S-transferase (GST) as the reference to eliminate sample-to-sample variations in the initial cDNA samples.

3.3 Results

3.3.1 qRT-PCR validation

To validate the RNAseq results, I analyzed the expression pattern of the 12 genes with the highest-fold change in the competitor-exposed W–S sample using qRT-PCR. Fold change and directionality of regulation from qRT-PCR were similar to results from

RNAseq analysis in all of the 12 transcripts (Table 3.2).

3.3.2 Soldier-moderated transcriptional response of R. flavipes workers to competitor cues

If the soldier caste can moderate the magnitude of the transcriptional response of workers to competitor-cue exposure, we would expect to see a smaller gene expression fold change in CRGs in W+S compared with CRGs in W–S. There were 321 and 339 CRGs in W–S and W+S, respectively (Figure 3.1). First, I found a significant overlap of CRGs between the W–S and the W+S (Figure 3.2). There were 187 CRGs shared by the two groups. These CRGs might be robustly regulated by exposure to competitor cues, regardless of the absence/presence of the soldier caste. Overall, the direction of regulation of these shared CRGs was the same between W–S and W+S (Figure 3.3). Of the 187

CRGs, 134 were upregulated transcripts in both W–S and W+S, 53 were downregulated in both groups. However, when I compared the magnitude of gene expression fold changes of these CRGs between W–S and W+S, we found that 75% (140 out of 187) of the CRGs showed relatively smaller fold change in W+S. Overall the magnitude of expression of the CRGs is significantly smaller in W+S group than the W-S group

(p<0.05, n=187, paired t-test). I examined the gene expression fold change of the 187

CRGs as a function of soldier availability (soldier-accompanied vs soldier-deprived) using regression analysis; the regression model predicts that the magnitude change of

competitor-regulated transcripts was smaller in soldier-accompanied workers than for the soldier-deprived workers (Figure 3.3). Here, I consider the 140 CRGs showing smaller fold change in the W+S group as “soldier-moderated CRGs.”

3.3.3 Functional categories of the soldier-modulated CRGs

What CRGs can soldiers modulate to alleviate competitor-induced stress in workers? As mentioned previously, there were 140 CRGs that might be moderated by the soldier caste. However, only 24 of 140 CRGs were annotated with Nr and GO Terms (Table

3.3). Twelve out of the 24 (50%) transcripts were assigned to terms related to metabolic processes. These include metabolic processes for carbohydrates, lipids, biogenic amines, and amino acids. These proportions were high compared with other GO terms. In addition to metabolic processes, 4, 3, 3, and 1 CRGs were assigned to the immune process, neuropeptide signaling, cuticle development, and transcription regulation, respectively.

3.4 Discussion

Nonlethal exposure to competitor cues changed the expression of many genes in the head of R. flavipes workers. The presence of the soldier caste reduced the magnitude of expression change for most of the competitor-regulated genes. Taken together, the study demonstrates that the soldier caste can moderate the transcriptional response of workers to competitor cues.

I initially predicted that the number of CRGs is smaller in soldier-accompanied workers. However, the results suggest that W+S workers have slightly more CRGs than

W–S workers. In addition, both W+S and W–S display a considerable number of unique

CRGs. A possible explanation is that some of the CRGs in the W+S group might be regulated by soldier cues but not competitor cues. Previous studies indicate that the soldier caste alone can be strong social stimuli to influence behavior and development of workers [208]. In addition, soldiers can profoundly influence the gene expression profile in workers [206]. Because our experiment did not include a nest mate-treated, W+S control, I cannot distinguish soldier-regulated genes from the CRGs in the W+S group

There were 140 CRGs shared by W–S and W+S. The direction of regulation of the 140 CRGs is the same for W–S and W+S, suggesting that these genes may be robustly regulated by competitor-cue exposure. Interestingly, 75% of the shared CRGs show smaller fold change in the W+S group. This indicates that soldiers can moderate the effects of competitor-cue exposure on genes. Meanwhile, significant regulation of these genes in both W–S and W+S indicates that soldiers can only alleviate, but not eliminate, the effects of competitor cues. This is consistent with the bioassay results from our previous study (Chapter 1), in which soldiers reduced, but not completely eliminated the deleterious impacts of competitor cues on worker survival and behavior. In addition, most soldier-moderated CRGs showed only subtle differences in expression fold change between W+S and W–S. The subtle effects on a large proportion of CRGs suggest that soldiers might affect the global transcriptional response of workers, instead of modulating some specific major genes.

What functional category of CRGs is associated with stress buffering by soldiers?

The results showed that 50% of the soldier-moderated CRGs were involved in the metabolic process. These include metabolism for lipids, carbohydrates, and proteins. An accelerated metabolism under the fight-or-flight response to predator cue exposure has

been demonstrated in many animal species [209-211]. These works demonstrated that animals exposed to a fight-or-flight stressor, such as predator cue, may show increased energy expenditure, as indicated by increased respiratory rates and increased oxygen consumption [210, 211]. It is possible that competitor-cue exposure also accelerated metabolic rate and energy consumption in workers, which eventually caused worker death due to energy depletion. Therefore, the large proportion of metabolic genes among the soldier-modulated CRGs indicates that the rescuing effects of soldiers on workers’ survival under competitor-cue exposure may be caused by soldiers moderating the effects of competitor cue on worker metabolism. It is also possible that the observed modulating effects of soldiers on metabolism-related genes are a result of soldier modulation on worker behavior during competitor-cue exposure. In the previous chapter, I demonstrated that competitor cue-exposed W–S workers spent more time than the W+S workers on energy costly behavior such as vibration and grooming, but less time on energy gain behavior like feeding. Therefore, the difference between W+S and W–S on metabolic gene expression may just be caused by different activity the workers engage in. Some of the soldier-modulated CRGs are associated with immune response, neuropeptide signaling, and cuticle development. All of the four immune-related genes were upregulated by competitor-cue exposure, with the gene encoding prolixicin antimicrobial protein being upregulated by more than 60 fold. Activation of the immune response by environmental stressors has been previously described in a large body of work on both vertebrates and invertebrates [184, 212-215]. In vertebrates, an innate immune gene pathway can be activated by the central nerve system via stress hormones and neurotransmitters during fight-or-flight response [214]. Nonlethal exposure to stressful

predator cues also activates an immune response in dragon fly larvae [213]. Although why the immune system can be activated during fight-or-flight response remains hypothetical [214, 215], activating and maintaining immune response can be energetically costly [214] and depletes the energy resource in workers. In vertebrates, chronic activation of the immune response may cause inflammation-associated diseases such as atherosclerosis, diabetes, and neurodegeneration [214]. Therefore, suppressing activation of worker immunity by competitor cues may be another factor contributing to stress-buffering by soldiers. Moreover, three CRGs, encoding the Neuromedin B receptor

(also known as the bombesin receptor) were downregulated by competitor-cue exposure, but moderated by the soldier caste. In vertebrates, bombesin and its receptors are involved in a variety of physiological processes such as muscle contraction and endocrine secretion in the gut, and they play a key role in food intake and energy homeostasis [216,

217]. In insects, the function of the bombesin receptor remains poorly understood.

However, a gene functional study in cockroaches suggested that the bombesin receptor also acts to regulate feeding activity in insects [218]. Interestingly, a previous behavior study showed that competitor-cue soldiers can moderate the inhibition effects of competitor cue on worker feeding behavior. It is therefore likely that the dynamic changes of these genes are associated with stress buffering by soldiers. At the least, some of the soldier-moderated CRGs encode laccase and cuticle proteins, which are all related to insect cuticle development. In insects, laccase is a phenoloxidase required in cuticle tanning [219, 220]. However, many phenoloxidases related to cuticle melanization and tanning also play an important role in insects’ immunity [221, 222]. Therefore, it is likely that laccase might be part of the immune response activated by competitor cues but

moderated by the soldier caste, as previously discussed. The expression of cuticle protein can be affected by many environmental stressors, such as insecticide or a dry environment [223]. Under these conditions, insects modulate the expression of cuticle protein to tune their exoskeleton structure to prevent water loss or penetration of a toxic compound into the body [223]. Why competitor-cue exposure downregulates cuticle protein expression is unclear. However, based on the previous study, the change in cuticle gene expression might be associated with physiological stress suffered by workers.

Overall, our result is consistent with many previous studies showing that exposure to fight-or-flight stressors may interfere with important biological functions such as metabolism, immunity, and energy homeostasis [224-226].

It is worth mentioning that a large proportion of the CRGs were not annotated. I can only discuss the effects of competitor cue and soldier-caste functional group of genes based on a relatively small subset of transcripts. This prevents me from comprehensively understanding the function. The lack of annotation information in a relatively large proportion of CRGs might be due to early stage of genomic study on termites. Although transcriptomic studies have been done on several termite species [39, 227-231], complete genome information is only available for one species to date [232]. At the time when our library was sequenced, no genome information was available for any termite species.

This explains why only a small subset (2%) of our head transcripts have significant hits on termite and cockroach transcripts (Figure A1, Appendix). The lack of annotation might be a common phenomenon to studies on nonmodel systems without comprehensive genome information. Alternatively, the lack of annotation information might be because our libraries contain a large number of novel genes. Although a large amount of work has

been done to investigate the effects of predator/competitor cues on the life history and physiology of animals, only a few studies have addressed transcriptomic response to these environmental stressors [224, 233, 234]. These works primarily focus on vertebrates. Future studies on genome sequencing of termites, as well as transcriptomic studies on predator/competitor-induced stress in insects may facilitate the analysis of our transcriptome data. Overall, our study suggests that the soldier caste can counteract the effects of competitor cues on gene expression, and that genes related to metabolic processes and immune response are primary targets for soldier regulation. However, how this transcriptional-level stress buffering correlates with the downstream fitness impacts of the stress buffering (e.g., reduced worker mortality, reduced worker body weight loss, and enhanced worker feeding activity) remains unclear. Because metabolic processes and immune response profoundly influence energy income/expenditure of an individual, soldier’s modulation of these physiological processes might serve to regulate energy homeostasis in competitor cue-exposed workers, preventing them from suffering energy depletion. Future studies on functional validation of these soldier-modulated genes using

RNAi, combining physiological study quantifying energy consumption (oxygen consumption, respiratory rate) in workers should lead to new insights into how soldiers function to improve colony member fitness under environmental stress.

Table 3.1 Gene-specific primers for qRT-PCR validation

Gene Identity Forward primer (5’-3’) Reverse primer (5’-3’)

CL4393.Contig1 GCAGCACATACAGCAAATATGG CAGTCTGGAGTGAGAAGTGAAG Unigene15359 ACGGCCGCAAGGTTAAA CGTGGATGTCAAGAGTAGGTAAG Unigene23530 CCCTACCCAACAACACATAGT GTAATAGCTCACTGGTCGAGTC Unigene39362 AGTCCTGTGCTCCAATGTATAG CTGCTGTTTCCACCTGTTTG Unigene51327 GCGCCTGCACAAACAAATA GCACGGATTTGGTCTCTGATA Unigene7778 CAGAAACGGAGAGTCTAGCATAA GTGGCAGTAATTTGGGCATAAG Unigene37551 CGCTTCCTTCCACATACTTCTC TACACACACGCGTTGGAATAG CL241.Contig1 GAGCAGGTTGATGTGGGTAATA CAGCATGCCCTTCTTGTAGTA CL560.Contig1 TCACAAAGTGCGTCGTAGTC CGTATTCACCGTGGCATTCT Unigene27117 TACAAGCTCTGGCTGCATATAG GTAACAGAGTCAGCCCTTTCA CL3436.Contig1 CGAGGAATGGGACTTGAATGAG TGGGAGTTGCGTTCGATTAC Unigene23529 GGATCGGAGTGAAAGGCTAATC CTAGCCGAAACAGTGCTCTAC Glutathione-S- transferase * TTGGGGTCCTTTGGATACAG AAGATGAACCCGCAGCATAC

* Glutathione-S-transferase (GST) gene was used for normalization of the qRT-PCR results.

Table 3.2 Gene expression validation by qRT-PCR

RNAseq qRT-PCR Gene ID a c log2FC Log2FC P-Value CL560.Contig1 7.48 5.30 0.03 Unigene23529 7.41 5.20 0.01 Unigene23530 6.92 3.81 0.11 Unigene37551 6.37 6.46 <0.01 Unigene15359 5.47 6.19 <0.01 Unigene7778 5.34 5.26 <0.01 Unigene27117 4.84 5.89 <0.01 Unigene39362 4.84 3.40 0.03 Unigene51327 3.41 1.96 0.03 CL4393.Contig1 2.22 1.88 0.11 CL3436.Contig1 -3.52 -2.74 0.02 CL241.Contig1 -3.78 -2.84 0.02 a Transcripts were selected from the top 20 up/down regulated transcripts in soldier- deprived workers in 24-h treatment.

b Data represents fold change of gene expression (log transformed) between competitor vs nest mate-treated workers.

c Fold change in qRT-PCR represents differences between expression level (2–ΔΔCt) of competitor-exposed vs nest mate-exposed workers.

Table 3.3 Annotated DETs modulated by the soldier caste

Log (FC) Gene ID 2 Nr annotation GO-Biologic process W–S W+S CL2646 1.2 1 endogenous cellulase carbohydrate metabolism Uni27117* 4.8 3.5 aspartate 1-decarboxylase Amino acid metabolism Uni30448 1.9 1.3 beta-alanyl conjugating enzyme dopamine metabolism Uni24417 –1.4 –1.3 fatty acid desaturase lipid metabolic process Uni1014 –1.7 –1.2 fatty acid desaturase lipid metabolic process Uni31314 1.8 1.7 fatty acid desaturase lipid metabolic process Uni21681 –1.9 –1.8 fatty acid desaturase lipid metabolic process Uni10272 1.7 1.4 feruloyl esterase metabolic process Uni32249 –1.9 –1.8 cytochrome P450 metabolic process Uni32248 –2 –1.8 cytochrome P450 metabolic process Uni13547 –1.5 –1 arylsulfatase B precursor metabolic process CL20 1.4 1.3 alpha-amylase metabolic process Uni37726 1.9 1.8 bacteria binding protein Immune process Uni37727 2 1.2 bacteria binding protein Immune process Uni37551* 6.4 5.3 prolixicin antimicrobial protein Immune process Uni34741 2.3 1.6 peptidoglycan recognition protein Immune process Uni23550 –2.4 –2 bombesin receptor neuropeptide signaling Uni28413 –2.2 –1.7 Phe13-bombesin receptor neuropeptide signaling Uni44730 –2.3 –1.6 neuromedin-B receptor-like neuropeptide signaling Uni12313 –2.4 –1.6 cuticle protein Cuticle development Uni34232* –3.6 –1.6 cuticle protein Cuticle development Uni37073 2.3 1.9 laccase Cuticle development Uni13019 2.2 1.8 laccase Cuticle development Uni28954 –1.8 –1.4 Kruppel homolog-1 Transcription regulation *DETs with >2 fold difference in expression fold change between W+S and W–S sample

400

300

200 Number of DETS Number of

Number of DETs of Number

100

0 W-S W+S SocialSocial Environment Environment

Figure 3.1 Number of competitor regulated genes in R. flavipes worker head.

Soldier-accompanied (W+S) and soldier-deprived (W–S) workers were exposed to the competitor cues. Number of CRGs between the competitor-exposed worker and the nest mate-exposed control workers are shown.

W-S W+S

134 187 152

Figure 3.2 Venn diagram of the number of shared and unique CRGs between soldier-accompanied (W+S) and soldier-deprived (W–S) workers

8 y=0.78x+0.1 y R=2=0.94 0.78x + 0.1 2 6 R =0.94

0 -10 -8 -6 -4 -2 0 2 4 6 8 10

(Foldchange) W+S (Foldchange) -2 (Foldchange) W+S (Foldchange)

2 Log Log -4

-6

-8

LogLog(Foldchange)2(Foldchange) W W-S-S 2 Figure 3.3 Comparison of fold change of CRGs in soldier-accompanied workers (W+S) and soldier-deprived workers (W–S)

The 187 CRGs shared by the two groups are shown. Expression fold changes (log- transformed) of these CRGs in these two groups are plotted, and the regression line is shown. In general, these shared CRGs show the same direction of regulation between W+S and W–S. However, fold changes of these CRGs were generally smaller in W+S.

4 Chapter 4 The Juvenile Hormone Resistant Gene Methoprene-tolerant Mediates

Soldier Caste Differentiation in the Termite Reticulitermes flavipes

4.1 Introduction

Caste polyphenism, the ability to produce morphologically distinct castes in response to environmental cues, is a defining character in eusocial insects [235]. Polyphenic caste differentiation is an essential means of division of labor [2]. For example, both ants and termites produce wingless workers for foraging and brood care, and winged forms

(known as alates) for dispersal [2]. Some species produce soldiers with an enlarged head or mandibles suitable for defense [2]. Therefore, the study of caste polyphenism has strong implications for understanding mechanisms underlying regulation and evolution of eusociality. Caste polyphenism is primarily regulated by juvenile hormone (JH) [236-

240]. However, the molecular mode of JH action mediating caste differentiation remains unknown. Specifically, key factors mediating JH signaling in caste differentiation have not been identified. Methoprene-tolerance (Met), a gene encoding a transcriptional regulator of the basic helix–loop–helix (bHLH)-Per–Arnt–Sim (PAS) domain family, is known to mediate JH signaling in insects [241]. For instance, Met mediates the antimetamorphic function of JH [241]. Interrupting Met gene expression through RNA interference resulted in precocious metamorphosis in larvae of holometabolous insects

[241]. In addition, Met also mediates JH-dependent ovarian development. Silencing Met repressed ovarian development in the cockroach Diploptera punctata [242]. Despite these advances, whether Met mediates caste polyphenism in social insects remains unclear.

Soldier-caste differentiation in termites is a classic model of caste polyphenism

[240]. In primitive termite lineages, soldiers are differentiated from workers (also known

as pseudergates), a group of developmentally totipotent immature insects, who perform social tasks, while retaining the capability of molting and developing into other physical castes upon colony need [243]. During soldier-caste differentiation, workers first molt into a presoldier stage, then into a soldier [243]. Both molts result in dramatic modification of head capsule and mandibles, eventually creating soldier-specific morphology. Presoldiers show a similar head morphology to soldiers, such as large head and elongated mandibles, but are much less sclerotized than mature soldiers [31]. Soldier differentiation is induced by high circulating levels of JH in workers in response to various environmental cues [244, 245]. In the laboratory, presoldier differentiation by workers can be artificially induced by exogenous JHIII [246], thus providing an ideal model for studying the JH signaling pathway mediating caste polyphenism.

Here, I hypothesize that Met, a putative JH receptor, is involved in the JH- mediated worker–soldier transition. To test this hypothesis, I first cloned and profiled a

Met gene in the eastern subterranean termite, R. flavipes [247]. Then, I functionally analyzed the Met, especially under the influence of JH.

4.2 Material and Methods

4.2.1 Termites

Reticulitermes flavipes field colonies used in the cloning and molecular characterization of the Met gene were collected during the spring and summer of 2015 using termite trapping stations filled with cardboard rolls at the University of Kentucky Arboretum, the

State Botanical Garden located on campus, Lexington, KY (GPS coordinates: 38.0333°

N, 84.5° W). Once trapped termites were extracted from the cardboard rolls, they were placed in Petri dishes (14.5 cm × 2.0 cm) covered with moistened unbleached paper towels (Wausau Paper, Wausau, Wisconsin) at the bottom as their food source for one to two weeks. After becoming acclimatized to the laboratory environment, termites were transferred to round plastic containers (15.0 cm in diameter, 6.5 cm in height) to establish the field colonies. These queenless R. flavipes colonies were provisioned with moistened wood mulch and pinewood blocks, and maintained in environmental chambers (VWR,

West Chester, Pennsylvania) in complete darkness (L:D = 0:24), at 27 ± 1 C, 80–99%

RH. Field colonies used in this study were within six months of the collection time.

In addition, a 5-year old R. flavipes incipient colony, which contains a royal pair and ~4000 workers, was used for the functional characterization (RNAi) of Met. Alates were collected from a residential area in the vicinity of the University of Kentucky

Arboretum when R. flavipes started to swarm in April, 2010. The founding kings and queens of these incipient colonies were randomly paired 24 h after their nuptial flights

(swarming). Initially, the newly established royal pair was maintained in a 5 cm diameter round container, and provisioned with two layers of moistened filter papers and fine wood mulch. Distilled water and new mulch were added to the container every three

months. Incipient colonies were transferred to larger containers once per year to accommodate their colony growth. All colonies were held in environmental chambers

(VWR, West Chester, Pennsylvania) in complete darkness (L:D = 0:24), at 27 ± 1 C,

80–99% RH)

4.2.2 Molecular characterization of Met

A 334 bp partial transcript, spanning a conserved region (PAS domains) of Met protein was identified in a R. flavipes worker brain EST previously established by our group by using BLASTx search within the Nucleotide collection database. Total RNA was extracted from the whole body of workers using the SV total RNA isolation kit

(Promega, Madison, WI) following the manufacturer’s protocol. RNA purity and degradation were checked on 0.8% agarose gels and spectrophotometrically (NanoDrop,

Thermo Fisher Scientific, Waltham, MA). About 1 μg of total RNA was used as a template to synthesize the first-strand cDNA using an M-MLV reverse transcriptase kit

(Invitrogen, Carlsbad, CA) following the manufacturer’s protocols. The full length cDNA sequence of the Met gene was obtained using a Rapid Amplification of cDNA Ends kit

(Invitrogen, Carlsbad, CA) from worker RNAs with gene-specific primers (Appendix I).

To sequence it, the Met gene was subsequently cloned with the TOPO TA-Cloning Kit

(Invitrogen, Carlsbad, CA). Similar searches with the resulting nucleotide sequences were conducted using BLASTx in Genbank (www.ncbi.nlm.nih.gov) under default settings. In BLAST searches, E-values for significance of identity were 1 × 10−10 and smaller. PI and molecular weight of the Met protein were identified using the expasy database. The protein sequence was blasted against the PFAM database to identify functional domains.

4.2.3 Gene expression profiling

Termite dissection and tissue collection: Different termite tissues were dissected from the worker caste. Termite workers were anesthetized on ice and dissected under a microscope. Seven tissues, including brain, head + antennae, salivary gland, foregut, midgut, hindgut, and the remaining carcass were removed, washed in 1 phosphate buffered saline (Sigma) buffer and flash-frozen in liquid nitrogen. Workers from three field colonies were used in the dissections. Fifty workers were dissected for each colony.

Individual tissues of the same type from the same colony were pooled for subsequent analysis.

Caste collection: Different termite castes were collected from field colonies and were flash-frozen in liquid nitrogen. Seven castes, worker, soldier, larvae, long-wing nymphs, short-wing nymphs, nymphoid neotenic reproductives, and ergatoid neotenic reproductives were collected from four field colonies. For the definition of termite castes, please refer to [248]. qRT-PCR: The Met gene expression level was determined using qRT-PCR. qRT-PCR was performed with a BioRad MyiQ™ Single-Color Real-Time PCR Detection System using a SYBR Green Realtime PCR Master Mix (BioRad). Relative gene expression was calculated by the 2−ΔΔCt method using housekeeping genes as the reference to eliminate sample-to-sample variations in the initial cDNA samples. The gene Hsp-70 was used as a housekeeping gene in both caste and tissue studies (Appendix II). Significant differences between caste and tissue on mean expression level of RfMet were analyzed by One-way

ANOVA followed by LSD post hoc test.

4.2.4 Functional study of Met

RNA Interference: RfMet and GFP dsRNAs, at lengths 532 and 248 bp, respectively, were synthesized using a MEGAscript® RNAi Kit (Thermo Fisher Scientific, Waltham,

MA). The template cDNAs were amplified by PCR primers that had T7 RNA polymerase sequences (TAATACGACTCACTATAG) appended to their 5 and 3 ends. The dsRNA- template PCR primers are shown in (Appendix III). After synthesis, dsRNA was diluted individually in nuclease-free water to 10 µg/µl for injection into worker termites. 500 ng dsRNA were injected into the side of the thorax using a microinjector fitted with a custom-pulled borosilicate glass needle, and with the assistance of a custom vacuum manifold that facilitated termite immobilization. Controls were injected with an equivalent volume of nanopure water alone. I examined RfMet expression on workers at

1, 3, 5, and 7 days after injection using qRT-PCR to test whether RfMet dsRNA injection efficiently suppressed RfMet expression. β-actin was used as a housekeeping gene.

Significant differences among injection treatments on mean expression level of RfMet within each day were analyzed using One-way ANOVA followed by LSD post hoc test.

JH Bioassay: After dsRNA injection, replicated groups of 20 termite workers were subjected to model JH bioassays as described previously [129], with minor modifications.

Briefly, 54 µg of JHIII, dissolved in acetone (Sigma) were applied to 3 cm paper discs.

Treated discs were allowed to dry and then moistened with 80 µl deionized water. The paper discs were placed in a 3.5 cm Petri dish, serving as source of JHIII and food for termite workers. Injected workers were then placed in the Petri dish. It is customary that presoldier emergence begins on bioassay day 8 and plateaus by day 13; thus, assays are

typically run for 15 days. Termites were checked every day and dead workers were removed immediately. Presoldiers were scored every day from day 8 to day 15. Data were summarized as cumulative percentage of presoldier formation between days 8 and

15. The number of living termites was scored at the 15th day to document cumulative mortality. Eight injection replicates (n = 20 workers per replicate) were performed per treatment. One incipient colony was used. I used rm-ANOVA to assess the effect of effects of injection treatments on rate of presoldier differentiation. Because the Mauchly

Criterion test showed that the rm-ANOVA results violated the assumption of sphericity, we report Greenhouse–Geisser corrected results.

4.3 Results

4.3.1 Molecular characterization

I have isolated a presumably full-length copy of a transcript that encodes 1030 amino acids with molecular weight of 112.85 kDa. The 3791 bp complete cDNA consists of a

3093 open reading frame (ORF), a 240 bp 5 untranslated region (UTR) and a 458 bp 3

UTR. Our ORF starts with the Kozak translation start site consensus AATAUGG. The protein contains the bHLH domain, two PAS domains (A and B), and a PAS C-terminal motif PAC (Figure 4.1) that are all conserved with Met protein from cockroach

Diploptera punctata (DpMet), the red flour beetle Tribolium castaneum (TcMet), and the fruit fly Drosophila melanogaster (DmMet) (Figure 4.1). Phylogenetic analysis showed that the R. flavipes gene I isolated forms a monophyletic group with the Met in the cockroach Diploptera punctata (Appendix III). This gene will be referred as RfMet hereafter.

To determine RfMet expression across tissues and castes, I employed qRT-PCR

(Figure 4.2). RfMet is expressed in all tissues, but the expression is highest in the brain, and lowest in midgut and hindgut. Among castes, RfMet expression is significantly lower in neotenic reproductive castes than in other castes. No significant difference in RfMet expression was detected among worker, larvae, and nymphs.

4.3.2 Functional characterization of the RfMet

Validation of JH uptaken by workers: To confirm that JHIII can be taken up by workers through our approach, I first examined the expression of Krüppel homolog 1, which has been demonstrated to be upregulated by topical application of JHIII or its analog [249,

250] The results showed that Krüppel homolog 1 expression was constantly elevated from 4 to 48 h after JHIII application (Figure 4.3). This indicates that I can successfully deliver JHIII to workers through the described approach.

Effects of RNAi on RfMet expression and worker survival: To determine the effectiveness of dsRNA in knock-down of RfMet, I examined the expression level of RfMet using qRT-

PCR in workers injected with RfMet dsRNA. Relative to control injection with GFP dsRNA or water, RfMet dsRNA injection significantly suppressed RfMet expression in workers at day 5 after injection (Figure 4.4A). In addition, the injection did not cause significant worker mortality (Figure 4.4B).

Effects of RfMet knockdown on presoldier differentiation: Presoldiers began to form from day 8 after JH application, and reached a plateau at day 13 (Figure 4.5). Ninety percent of workers in the control treatment differentiated into presoldiers 15 days after JH application. There was a significant effects of treatment and treatment x time (Table 4.1)

There were no significant differences on cumulative presoldier formation with GFP dsRNA and water injection (Figure 4.5). A considerable proportion of RfMet dsRNA- injected workers also differentiated into presoldiers. However, the percentage is significantly lower than for the control treatments (Figure 4.5) on day 12 to day 15. In addition, some presoldiers formed by RfMet dsRNA-injected workers showed less magnitude of mandibles and head capsule development (Figures 4.6G, I).

Effects of reduced JH dose on presoldier formation: To confirm that the effects of RfMet

RNAi are due to suppressed JH signaling, I topically applied various doses of exogenous

JHIII on uninjected workers and observed presoldier differentiation. The results show that the rate of presoldier formation is positively associated with JH dose, worker groups receiving a lower dose of exogenous JHIII showed low percentage presoldier formation

(Figure 4.7). In addition, workers receiving JHIII but with a reduced dose differentiated into presoldiers with similar phenotypes to the presoldiers formed by the RfMet dsRNA- injected workers (Figure 4.6H).

4.4 Discussion

While the role of JH in caste polyphenism has been well established [249], molecular mechanisms by which JH is transduced to regulate polyphenic caste differentiation remains unclear. Specifically, key factors mediating the JH action in polyphenic development have not been identified. Although Met has been established as a JH receptor mediating the anti-metamorphic function of JH [241], whether it mediates the JH function in polyphenic caste differentiation in social insects remains unknown.

This study characterized the molecular character of Met in the termite R. flavipes and demonstrated that RfMet essentially regulates the polyphenic soldier-caste differentiation in termites. The close phylogenetic relationship between RfMet and cockroach Met was consistent with the close phylogenetic relationship between the two lineages [251]. RfMet RNAi moderately, yet significantly, reduced the percentage of workers molting into presoldiers in the presence of exogenous JHIII, whereas in control groups 90% of workers molted into presoldiers. This means that silencing RfMet can cause resistance to JHIII and completely suppress the presoldier development. In

Drosophila melanogaster, JH signaling may be mediated by more than one factor [241].

For instance, both Met and germ cell expressed (GCE) genes may serve to mediate JH signaling [252]. Our study suggests that RfMet is the single key factor required for JH induction of initiation of presoldier differentiation. A considerable proportion of dsRfMet-injected workers successfully molted into presoldiers with normal morphology.

There are several explanations. First, there might be variations among individuals on

RNAi efficiency. In this study, RNAi resulted in a 30% inhibition of RfMet expression at day 5. This is not a high efficiency compared with those observed in other species [253,

254]. Unlike those studies in which RNAi efficiency was tested on individuals, I tested

RNAi efficiency on pooled individuals. Pooling individuals might have homogenized individual differences. Therefore, the observed inhibition of 30% RfMet expression may reflect a mix of individuals with higher and lower RNAi efficiency. Individual variation in RNAi efficiency has been previously described for the pea aphid Acyrthosiphon pisum

[255] and the apple moth Epiphyas postvittana [256]. Although we tried to match individual workers on their body size and age by using workers of the same size with the

same number of antennal segments [248], it is almost impossible to tell the exact age and sex of a worker from external morphology, which might affect RNAi efficiency.

Alternatively, some workers we used might have already initiated presoldier development before treatment and were therefore not affected by RNAi. In our experiment, I minimized such a possibility by avoiding workers in the gut-purging period (workers with a yellowish-white abdomen), a stage ~6 days preceding presoldier molt [257, 258].

However, molting workers are not distinguishable from regular workers before they enter the gut-purging period. Therefore, it is possible that some workers at the early stage of presoldier development might have been accidentally used in our experiment and later became presoldiers. Interestingly, some workers were able to molt into a presoldier with an underdeveloped head and mandibles. This indicates that some individuals were able to initiate presoldier development but failed to complete presoldier-specific morphogenesis.

In addition, presoldiers with underdeveloped phenotypes were never observed in the control group. Workers that received reduced exogenous JHIII also differentiated presoldiers with head morphology similar to the dsRfMet-injected individuals. These results together suggest that the RfMet is critical for not only initiating presoldier differentiation, but also regulating presoldier specific morphogenesis during the process of differentiation.

Masuoka et al. (2015) [131] demonstrated that Met plays a key role in soldier- specific morphogenesis during the presoldier-to-soldier transition in the damp-wood termite, Zootermopsis nevadensis. By injecting dsRNA into workers at the gut-purged period (a stage immediately before presoldier molt), the study found that silencing Met gene interrupted soldier morphogenesis and resulted in soldiers with shorter mandibles

[131]. However, their study found no effects of Met gene silencing on presoldier differentiation by workers [131]. In this study, I silenced the RfMet gene in workers at an earlier stage (before JH application) and found that Met also regulates worker-to- presoldier differentiation and may mediate presoldier-specific morphogenesis.

Combining with the finding from Masuoka et al. (2015) [131], the two studies suggest that Met is an essential requirement throughout the process of soldier-caste development, including both presoldier and soldier development, and may be involved in mediating both presoldier- and soldier-specific morphogenesis. This is consistent with previous studies showing that JH is required for both worker-to-presoldier and presoldier-to- soldier transitions [176, 259].

Termites display a highly plastic caste-determination system [31, 248]. Starting from a hatching larva, an individual can have more than one developmental possibility before reaching its developmental endpoint. For instance, in termites of the genus

Reticulitermes, a second instar larva can molt into either nymphs with wing-bud, or wingless workers [248]. Nymphs, at their sixth instar, can further develop into either winged alates, who will leave the nest to found their own colony, or neotenic reproductive caste with wing-buds (nymphoids), who will stay in their natal nest and reproduce like the primary king and queen [248]. Workers can have stationary molts to remain as a worker, or progressively molt into soldiers or neotentic reproductives without wing-buds (ergatoids) [248]. Intercastes with morphology intermediate between two castes can also occur [117, 243]. The developmental regulation of these castes is the foundation to termite sociality and is profoundly influenced by circulating JH titers [176,

259]. In general, it is suggested that a high JH titer is associated with soldier-destined

development, a low JH titer is associated with stationary molt or development toward a reproductive caste [259]. How might Met transduce signals denoting different JH titers to influence downstream expression of caste-specific genes? Clearly, there must be changes in the Met signaling pathway that contribute to shifting the Met function from maintaining the status quo in juvenile insects [236] to regulating polyphenic caste development in termites. These changes in gene networks might have contributed to evolution of caste and eusociality in termites, and possibly in other social insect lineages.

Our finding that RfMet is the key factor mediating the JH-dependent soldier-caste differentiation has set a foundation for future study on the Met signaling networks that mediate polyphenic caste differentiation in social insects. With findings from this study, I am now investigating factors downstream of Met for a comprehensive understanding of the Met signaling involved in the soldier-caste differentiation. I hope that a future study on the JH signaling pathway in caste differentiation will bring new insights into genetic changes mediating the evolution of sociality in termites and other social insects.

Table 4.1 Results of Repeated Measurement ANOVAs testing the effects dsRNA injection on presoldier differentiation in R. flavipes.

Presoldier formation Term F df p

Injection 16 167, 2 0.0001

Time 602.8 167, 7 <0.0001

Time*Injection 7.02 167,14 <0.0001

0 66 126 154 206 361 400 458 1030 RfMet

0 23 75 101 161 304 365 421 950 DpMet

0 26 86 112 207 253 315 355 516 TcMet

0 38 87 137 186 403 443 501 716 200 DmMet amino acids

bHLH PAS-A PAS-B PAS-C

Figure 4.1 Schematic representation of the structure of R. flavipes Met.

The R. flavipes Met predicted protein sequence was compared with orthologous proteins from Diploptera punctata (DpMet), Tribolium castaneum (TcMet), and Drosophila melanogaster (DmMet). Numbers indicate amino acid identities within the conserved domains.

2.0 A A

1.5 A RfMet A AB AB 1.0

Expression Level of of Level Expression 0.5 BC

(Relative to the soldier caste) soldier the to (Relative C

0.0 lwbn swbn worker larvae nymphoid ergatoid Caste 2.0 A B B

1.5

Gene Gene

Met

B B 1.0 B B

(Relative to whole body) whole to (Relative C 0.5 C

Expression Level of of Level Expression

0.0 SG FG MG HG Brain H&A Carcass Tissue Types

Figure 4.2 Expression pattern of the R. flavipes Met.

A. Expression among tissues. Results are expressed as the percentage of gene expression relative to whole body. H&A: head capsule + antennae; SG: salivary gland; FG: foregut; MG: midgut; HG: hindgut. B. Expression pattern among castes. Results are expressed as the percentage of gene expression relative to the soldier caste. lwbn: long wing-budded nymph; swbn: short wing-budded nymph; Nymphoid: neotentic reproductive developed from nymphs; Ergatoid: neotenic reproductive developed from workers. Numbers in parentheses indicate number of individuals used per colony. Means labeled with the same letter (A, B, or C) are not significantly different ( p < 0.05, One-Way ANOVA followed by LSD post hoc test). Error bar indicates the standard error of the mean.

10 JHIII

Acetone 8 *

6 * *

Kruppelhomolog-1 * * * 4 *

(Relative to 0 hour control) hour 0 to (Relative 2

Expression of the the of Expression

0 4 8 12 16 20 24 48

Hours after Treatment

Figure 4.3 Expression of Krüppel homolog 1 in response to JHIII treatment

Twenty workers were placed in a 3.5 cm Petri dish above a 3.0 cm paper disc treated with 54 l JHIII (Sigma) dissolved in acetone. The control was treated with acetone. For each sample, the RfMet expression level was normalized against Hsp-70. The normalized gene expression was expressed as the proportion of the expression recorded in the 0-h control. JH-treated workers show significantly elevated expression of Krüppel homolog 1 compared with the acetone-treated control at all time points from 4 h to 48 h after topical application of JHIII. * p < 0.05 by two-sample t-test, one tailed, equal variance. Error bars represent the standard error of the mean.

Figure 4.4 Effects of RfMet dsRNA injection on worker mortality and gene expression.

A. Expression level of RfMet. For each sample, the RfMet expression level was normalized against β-actin. The normalized RfMet expression was expressed as the proportion of the expression recorded in the uninjected control. A significant difference between RfMet dsRNA injection and control treatments was seen at day 5 postinjection (* p < 0.05 by One-Way ANOVA followed by LSD post hoc test). B. Cumulative worker mortality at day 15 postinjection. NS: No significant mortality was observed between Met dsRNA-injection treatment and controls (p < 0.05 by One-Way ANOVA followed by LSD post hoc test). Error bars represent the standard error of the mean.

Figure 4.5 Effects of RfMet dsRNA-injection on presoldier differentiation by workers.

The results represent the cumulative percentage of injected workers molting into presoldiers from day 8 to day 15 after topical application of JHIII. A significant difference between RfMet dsRNA injection and control treatments was seen at days 12, 13, 14, and 15 (*p < 0.05, Repeated-Measurement-ANOVA followed by Tukey HSD post hoc test). Error bars represent the standard error of the mean.

WildWild type-Type ControlControl TreatmentTreatment A D G

B E H

C F I

Figure 4.6 Effects of RfMet RNAi and reduced dose of exogenous JHIII on presoldier morphology.

Wild-type presoldiers (A) are developed from workers (B), with elongation of mandibles and change of head shape from roundish to rectangular. In addition, the mandibles of wild-type presoldiers (F) are less tanned at the apical teeth (arrow in F) and have a greater distance between second and third marginal teeth (distance between arrow heads in F) than do worker mandibles (arrow and distance between arrow heads in C). Topical application of 54 g JHIII on RfMet dsRNA-injected workers induced presoldiers with a phenotype that was intermediate between wild-type worker and presoldier (G), as indicated by roundish head (G), shorter mandibles (G and I), darker apical teeth of the left mandible (arrow in I) and a shorter distance between the second and third marginal teeth (arrow heads in I). Topical application of JHIII on uninjected workers with a two- fold reduction in dose (from 54 g to 27 g) induced presoldiers with a phenotype similar to those from the RfMet dsRNA injection. Topical application of 54 g JHIII on GFP dsRNA-injected or uninjected workers induced presoldiers similar to the wild-type phenotype (D, presoldier by GFP dsRNA-injected worker, E, presoldier by uninjected worker.)

100 A

A 80

AB 60

at Day 15 (%) 15 Day at BC

20 CD

Cumulative Presoldier Formation Formation Presoldier Cumulative CD D D 0 54 27 13.5 6.25 3.125 1.5625 0.78125 Acetone JH Dose ( g)

Figure 4.7 Effects of exogenous dose of JHIII on presoldier differentiation by workers.

Results represent mean cumulative percentage of workers molting into presoldiers from day 8 to day 15 after topical application of JHIII. Means were calculated by averaging six colonies. Means labeled with the same letter are not significantly different (p < 0.05 by One-Way ANOVA followed by LSD test). Error bars represent the standard error of the mean.

5 Chapter 5 Summary and Perspectives

The presence of reproductively altruistic castes is one of the primary traits of the eusocial societies [2]. Understanding the function and regulation of the sterile caste is the key to understanding the evolution of eusociality. Termites represent a major eusocial lineage distinct from the extensively studied social hymenopterans (bees, ants, and wasps) in many aspects including social structure, development, and habitat. However, compared with Hymenoptera, much less is known about regulation and evolution of sociality in termites. We do know, however, that the soldier caste was the first sterile caste that evolved in termites, thus a hallmark of termite eusocial evolution [31, 75, 151].

Therefore, understanding the function and development of this caste have strong implications to understanding termite social evolution.

This dissertation studies the function and development of the termite soldier caste at the ecological and molecular level. The first chapter classified eusocial lineages into worker-first lineages and soldier-first lineages, based on the function of the first evolved sterile caste in the lineage. Then I provided a general introduction to the current status of knowledge on the function, regulatory mechanism, development, and theories regarding evolution of the soldier caste in the soldier-first lineages. I showed that the function and development of the soldier caste are poorly understood. For example, soldiers in many lineages, including termites, have broad, nondefensive functions, which have been largely ignored in previous studies on social evolution in these lineages. Ignoring these functions would prevent us from comprehensively understanding ecological factors driving its evolution and may lead to wrong conclusions. In addition, I showed that compared with social hymenoptera like ants and honeybees, in which the developmental mechanism of

worker/queen caste differentiation has been extensively studied, much less is known about molecular mechanisms underlying soldier-caste development. Because the emergence of the soldier caste is the hallmark of eusocial evolution in these lineages [75,

151], the lack of knowledge in this field may have greatly hindered our understanding of social evolution in these lineages.

Based on the first chapter, the second chapter focused on the function of the termite soldier caste. Previously, termite soldiers were known to play an exclusive role of physical defense. However, the low percentage of soldier caste in a colony and the costly nature of maintaining a soldier caste, suggest that this caste might serve more functions than fighting. Interestingly, previous literature suggests that soldiers can influence colony members in their behavior and development [175, 177]. In particular, the presence of soldiers can repress aggression by workers in the presence of a predator [177]. In many species, soldiers are recruited to the foraging group, even in the absence of predators or competitors [175]. Based on these findings, I hypothesized that soldiers may moderate nest-mate response to environmental risk. This function should be important given that termite colonies can live close to ants and competing colonies and even share the same foraging and nesting resources [194-197]. Using a bioassay and behavioral analysis approach, I found that soldiers are able to protect workers from deleterious impacts of competitor-cue exposure, and a low percentage of soldiers is enough to protect the rest of the group members. This finding expands our understanding of the ecological function of the soldier caste. It suggests that, in a competitive environment, the soldier caste can contribute to colony fitness in two ways: 1. Physically protecting the nest from intruders and 2. Alleviating colony-member stress caused by exposure to competition cues. The

latter is important because it protects workers, the primary foraging forces for the colony, from being affected by environmental risk, thus maximizing the colony foraging force in a hostile environment. Overall, this study demonstrates how the soldier caste can efficiently contribute to colony fitness, even at a low percentage. An issue that has not been addressed in our study is how soldiers communicate with workers to alleviate their stress. In colonies of many social insects, nest mates mutually influence colony members in their development and behavior through pheromones [204, 260]. Previous studies suggest that termite soldiers can release a primer pheromone from a frontal gland, which affects workers’ development [175]. Therefore, it is likely that soldiers alleviate worker stress through soldier-specific chemical or other types of signals. Future research including a competition test using soldier-head extraction, and cuticular hydrocarbon may address these questions.

Based on the findings in Chapter 2, Chapter 3 investigated molecular mechanisms mediating the stress-buffering function of the soldier caste. Previous literature suggests that in social insects, social communication (e.g., pheromone signaling) can influence colony members’ development and behavior via regulating an individual’s gene expression [204]. This leads to an interesting hypothesis that the soldier caste can alleviate worker stress by moderating transcriptional response of workers to competitor- cue exposure. To test the hypothesis, I exposed workers to competitor cues under soldier- accompanied and soldier-deprived conditions, then I compared worker gene expression change in response to competitor-cue exposure between these two conditions. I found that competitor cues altered expression of hundreds of genes, but expression change of a large proportion of the competitor cue-regulated genes was smaller when workers were

accompanied by soldiers. I also found that a large proportion of the soldier-modulated genes were involved in metabolic, immune, and neurotransmitter processes. These results suggest that soldiers can moderate the effects of competitor cues on head gene expression in workers, and genes involved in metabolism, immune, and neural signaling might be the primary targets for soldier buffering. To correlate these genes with the downstream phenotypic impacts of soldier stress buffering I observed in Chapter 2, I have started to establish RNA interference (RNAi) to investigate possible functions of some soldier- moderated genes.

Chapter 3 focused on molecular and functional characterization of the Met gene, a gene encoding a JH receptor. Because JH is the key regulator for polyphenic caste differentiation in termites [31], the study of the Met gene aims to set a foundation for future study on JH signaling networks mediating caste differentiation in termites.

Because the soldier-caste differentiation can be induced by exogenous JHIII [31], it provides a good model to study the function of Met in caste differentiation. In general, I demonstrated that RfMet is the key factor mediating the JH-dependent soldier-caste differentiation in termites. However, how Met interferes with downstream factors regulating molting and morphogenesis remains unclear. Future study on factors downstream of RfMet would provide new insight into these issues.

Overall, the dissertation presents novel insights into the function and developmental mechanism of the soldier caste in termites. It contributes to the understanding of regulation and evolution of a nonreproductive caste in termites and possibly other social insects.

6 APPENDIX I: Taxonomic grouping of the 23436 R. flavipes worker head

Non-insects Other insect order Phthiraptera Coleoptera Diptera Hemiptera Hymenoptera Lepidoptera Cockroaches Termites

38%

1% 5% 4% 7% 2%

15% 1% 15%

13% 1%

Transcripts with hits to the NCBI NR database (E value≤10e-5). Bar chart indicates hits to cockroaches and termites. Note that only a very small proportion of reads were mapped to termites and cockroaches (the order Blattodea)

7 APPENDIX II: Primer sequence for RACE-PCR

Primer name Primer sequence (5’-3’) RfMet 3’ RACE ACTCGACACCTTCTTGATGGCCGTATCA RfMet 3’ RACE nested CAATACCCTTGTATCGGAGGAAGAAGGTTTAC RfMet 5’ RACE AGTCTTGGACAGCAGCCTGTAGCAACTA RfMet 5’ RACE nested TTCCCAAAGCTCTGCTTACC

8 APPENDIX III: Primer sequence for qRT-PCR

Primer name Primer sequence (5’-3’) RfMet-realtime-forward GGATCAGGGAATGACATCGATAC RfMet-realtime reverse AACAGCGAGCGTGAAGATAC Rf-krh-1 forward CACTACGCGAGAGCTTCATAAT Rf-krh-1 reverse TTTCCTGCTAGCCACAAGATAG Rf-β-actin forward CACAGGGCCAGAAGCTAAATA Rf-β-actin reverse CATCCTTGCTTGCAGCTATTG Rf-HSP70 forward CCTCATAAAGCGCAACACAA Rf-HSP70 reverse CACCTGGATCAACACACCAG

9 APPENDIX IV: Primer sequence for RfMet dsRNA

Primer name Primer sequence (5’-3’) T7-RfMet-foward GTAATACGACTACTATAGGGTCGTCGGGACAAGATGAATG T7-RfMet-reverse GTAATACGACTACTATAGGGTAACTGACCAGAACCATCATGG

10 REFERENCES

1. Szathmary, E. and J.M. Smith, The major evolutionary transitions, in Shaking the Tree: Readings from nature in the history of life, H. Gee, Editor. 2000, University of Chicago Press. p. 32-47. 2. Wilson, E.O., The insect societies. 1971, Cambridge, Mass: Harvard University Press. 3. Crozier, R.H. and P. Pamilo, Evolution of social insect colonies: sex allocation and kin selection. 1996, Oxford: Oxford University Press. 4. Oster, G.F. and E.O. Wilson, Caste and ecology in the social insects. 1978, Princeton, NJ: Princeton University Press. 5. Stern, D.L. and W.A. Foster, The evolution of sociality in aphids: a clone's-eye view, in The evolution of social behavior in insects and arachnids. , J.C. Choe and B.J. Crespi, Editors. 1997, University Press, Cambridge: Cambridge p. 150-165. 6. Crespi, B.J., Eusociality in Australian gall thrips. Nature, 1992. 359(6397): p. 724-726. 7. Kent, D.S. and J.A. Simpson, Eusociality in the beetle Austroplatypus incompertus (Coleoptera: Curculionidae). Naturwissenschaften, 1992. 79(2): p. 86-87. 8. Duffy, J.E., Eusociality in a coral-reef shrimp. Nature, 1996. 381(6582): p. 512- 514. 9. Jarvis, J., Eusociality in a mammal: cooperative breeding in naked mole-rat colonies. Science, 1981. 212(4494): p. 571-573. 10. Queller, D.C. and J.E. Strassmann, Kin selection and social insects. Bioscience, 1998. 48(3): p. 165-175. 11. Bourke, A.F.G. and N.R. Franks, Alternative adaptations, sympatric speciation and the evolution of parasitic, inquiline ants. Biol. J. Linn. Soc., 1991. 43(3): p. 157-178. 12. Smith, C.R., et al., Genetic and genomic analyses of the division of labour in insect societies. Nat. Rev. Genet., 2008. 9(10): p. 735-48. 13. Shibao, H., et al., Mechanisms regulating caste differentiation in an aphid social system. Commun Integr Biol, 2010. 3(1): p. 1-5. 14. Haverty, M. and R. Howard, Production of soldiers and maintenance of soldier proportions by laboratory experimental groups of Reticulitermes flavipes (Kollar) and Reticulitermes virginicus (Banks)(Isoptera: Rhinotermitidae). Insect Soc., 1981. 28(1): p. 32-39. 15. Gruter, C., et al., A morphologically specialized soldier caste improves colony defense in a neotropical eusocial bee. Proc Natl Acad Sci U S A, 2012. 109(4): p. 1182-6. 16. Prestwich, G.D., Chemical defense by termite soldiers. J. Chem. Ecol., 1979. 5: p. 459-480. 17. Stern, D.L. and W.A. Foster, The evolution of soldiers in aphids. Biol. Rev. Camb. Philos. Soc., 1996. 71(1): p. 27-79. 18. Yamamura, N., Different evolutionary conditions for worker and soldier castes: genetic systems explaining caste distribution among eusocial insects. J. Theor. Biol., 1993. 161(1): p. 111-117.

19. Hölldobler, B. and E.O. Wilson, The superorganism: the beauty, elegance, and strangeness of insect societies. 2009, New York: WW Norton & Company. 20. Beshers, S.N. and J.H. Fewell, Models of division of labor in social insects. Annu Rev Entomol, 2001. 46(1): p. 413-440. 21. Hamilton, W.D., The genetical evolution of social behaviour, I & II. J. Theor. Biol., 1964. 7: p. 1-52. 22. Trivers, R.L. and H. Hare, Haploidploidy and the evolution of the social insect. Science, 1976. 191(4224): p. 249-263. 23. Nowak, M.A., C.E. Tarnita, and E.O. Wilson, The evolution of eusociality. Nature, 2010. 466(7310): p. 1057-62. 24. Korb, J., et al., Brood care and social evolution in termites. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2012. 279(1738): p. 2662-2671. 25. Korb, J., Termites, hemimetabolous diploid white ants? Front Zool, 2008. 5: p. 15. 26. Shellman-Reeve, J.S., The spectrum of eusociality in termites, in The evolution of social behavior in insects and arachnids, J.C.C. Choe, Bernard J, Editor. 1997, Cambridge University Press: Cambridge. p. 52-93. 27. Perry, S., et al., Proclivity and effectiveness in gall defence by soldiers in five species of gall-inducing thrips: benefits of morphological caste dimorphism in two species (Kladothrips intermedius and K. habrus). Behav. Ecol. Sociobiol., 2004. 56(6): p. 602-610. 28. Breed, M.D., G.E. Robinson, and R.E. Page, Division of labor during honey bee colony defense. Behav Ecol Sociobiol, 1990. 27(6): p. 395-401. 29. Robinson, G.E., Modulation of alarm pheromone perception in the honey bee: evidence for division of labor based on hormonally regulated response thresholds. J. Comp. Physiol., A, 1987. 160(5): p. 613-619. 30. Giray, T., M. Giovanetti, and M.J. West-Eberhard, Juvenile hormone, reproduction, and worker behavior in the neotropical social wasp Polistes canadensis. Proc Natl Acad Sci U S A, 2005. 102(9): p. 3330-3335. 31. Bignell, D.E., Y. Roisin, and N. Lo, Biology of termites: a modern synthesis. 2011, London: Springer. 32. Crespi, B.J., D.A. Carmean, and T.W. Chapman, Ecology and evolution of galling thrips and their allies. Annu Rev Entomol, 1997. 42(1): p. 51-71. 33. Wheeler, D.E., The developmental basis of worker caste polymorphism in ants. Am Nat, 1991. 138(5): p. 1218-1238. 34. Wilson, E.O., The origin and evolution of polymorphism in ants. Q. Rev. Biol., 1953. 28(2): p. 136-156. 35. Baroni Urbani, C. and L. Passera, Origin of ant soldiers. Nature, 1996. 383(6597): p. 223. 36. Baroni Urbani, C., The number of castes in ants, where major is smaller than minor and queens wear the shield of the soldiers. Insect Soc., 1998. 45(3): p. 315- 333. 37. Ward, P.S., Ant soldiers are not modified queens. Nature, 1997. 385: p. 494-495. 38. Henderson, G., Primer pheromones and possible soldier caste influence on the evolution of sociality in lower termites, in Pheromone communication in social insects, R.K. Vander Meer, et al., Editors. 1998, Westview Press: Boulder, Colo. p. 314-330.

39. Miura, T., Morphogenesis and gene expression in the soldier-caste differentiation of termites. Insect Soc., 2001. 48: p. 216-223. 40. Noirot, C. and J. Pasteels, Ontogenetic development and evolution of the worker caste in termites. Cell. Mol. Life Sci., 1987. 43(8): p. 851-860. 41. Ijichi, N., et al., Soldier differentiation during embryogenesis of a social aphid, Pseudoregma bambucicola. Entomol. Sci., 2004. 7(2): p. 143-155. 42. Shibao, H., M. Kutsukake, and T. Fukatsu, The proximate cue of density- dependent soldier production in a social aphid. J Insect Physiol, 2004. 50(2): p. 143-147. 43. Shibao, H., M. Kutsukake, and T. Fukatsu, Density-dependent induction and suppression of soldier differentiation in an aphid social system. J Insect Physiol, 2004. 50(11): p. 995-1000. 44. Mound, L.A. and B.J. Crespi, Biosystematics of two new gall-inducing thrips with soldiers (Insecta: Thysanoptera) from Acacia trees in Australia. J. Nat. Hist., 1995. 29(1): p. 147-157. 45. Kranz, B.D., Egg size and reproductive allocation in eusocial thrips. Behav. Ecol., 2005. 16(4): p. 779-787. 46. TÓTh, E. and J.E. Duffy, Influence of sociality on allometric growth and morphological differentiation in sponge-dwelling alpheid shrimp. Biol. J. Linn. Soc., 2008. 94(3): p. 527-540. 47. Duffy, E., C. Morrison, and K. Macdonald, Colony defense and behavioral differentiation in the eusocial shrimp Synalpheus regalis. Behav Ecol Sociobiol, 2002. 51(5): p. 488-495. 48. Leung, T.L.F. and R. Poulin, Small worms, big appetites: ratios of different functional morphs in relation to interspecific competition in trematode parasites. Int. J. Parasitol., 2011. 41(10): p. 1063-1068. 49. Newey, P. and L. Keller, Social evolution: war of the worms. Curr. Biol., 2010. 20(22): p. R985-R987. 50. Giron, D., K.G. Ross, and M.R. Strand, Presence of soldier larvae determines the outcome of competition in a polyembryonic wasp. J. Evol. Biol., 2007. 20(1): p. 165-172. 51. Gordon, S.D. and M.R. Strand, The polyembryonic wasp Copidosoma floridanum produces two castes by differentially parceling the germ line to daughter embryos during embryo proliferation. Dev. Genes Evol., 2009. 219(9-10): p. 445-454. 52. Smith, M.S., I. Milton, and M.R. Strand, Phenotypically plastic traits regulate caste formation and soldier function in polyembryonic wasps. J. Evol. Biol., 2010. 23(12): p. 2677-2684. 53. Giron, D., et al., Male soldier caste larvae are non-aggressive in the polyembryonic wasp Copidosoma floridanum. Biol Lett, 2007. 3(4): p. 431-434. 54. Grbic, M., P.J. Ode, and M.R. Strand, Sibling rivalry and brood sex ratios in polyembryonic wasps. Nature, 1992. 360: p. 254-256. 55. Crespi, B.J., et al., Phylogenetics of social behavior in Australian gall-forming thrips: evidence from mitochondrial DNA sequence, adult morphology and behavior, and gall morphology. Mol. Phylogen. Evol., 1998. 9(1): p. 163-180. 56. Prestwich, G.D., Defense mechanisms of termites. Annu Rev Entomol, 1984. 29(1): p. 201-232.

57. Scheffrahn, R.H., et al., Extreme mandible alteration and cephalic phragmosis in a drywood termite soldier (Isoptera: Kalotermitidae: Cryptotermes) from Jamaica. Fla Entomol., 1998. 81(2): p. 238-240. 58. Matsuura, K., Colony-level stabilization of soldier head width for head-plug defense in the termite Reticulitermes speratus (Isoptera: Rhinotermitidae). Behav. Ecol. Sociobiol., 2002. 51(2): p. 172-179. 59. Wilson, E.O., The soldier of the ant, Camponotus (Colobopsis) fraxinicola, as a trophic caste. Psyche, 1974. 81(1): p. 182-188. 60. Weber, N.A. and T.C. Schneirla, A new Panama Eciton (Hymenoptera, Formicidae). Am. Mus. Novit., 1949. 1441: p. 1-8. 61. Huang, M. and D. Wheeler, Colony demographics of rare soldier-polymorphic worker caste systems in Pheidole ants (Hymenoptera, Formicidae). Insect Soc., 2011. 58(4): p. 539-549. 62. Hasegawa, E., Caste specialization in food storage in the dimorphic ant Colobopsis nipponicus (Wheeler). Insect Soc., 1993. 40(3): p. 261-271. 63. Benton, T.G. and W.A. Foster, Altruistic housekeeping in a social aphid. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 1992. 247(1320): p. 199-202. 64. Pike, N. and W. Foster, Fortress repair in the social aphid species Pemphigus spyrothecae. Anim. Behav., 2004. 67(5): p. 909-914. 65. Kranz, B., et al., A fully reproductive fighting morph in a soldier clade of gall- inducing thrips (Oncothrips morrisi). Behav Ecol Sociobiol, 2001. 50(2): p. 151- 161. 66. Turnbull, C., et al., Antifungal activity in thrips soldiers suggests a dual role for this caste. Biol Lett, 2012. 8(4): p. 526-529. 67. Rosengaus, R.B., M.L. Lefebvre, and J.F. Traniello, Inhibition of fungal spore germination by Nasutitermes: evidence for a possible antiseptic role of soldier defensive secretions. J. Chem. Ecol., 2000. 26: p. 21-39. 68. Traniello, J.F., Enemy deterrence in the recruitment strategy of a termite: soldier- organized foraging in Nasutitermes costalis. Proc Natl Acad Sci U S A, 1981. 78: p. 1976-1979. 69. Traniello, J.F. and R.H. Leuthold, Behavior and ecology of foraging termites, in Termites: evolution, sociality, symbioses, ecology, T. Abe, D.E. Bignell, and M. Higashi, Editors. 2000, Kluwer Academic: Dordrecht. p. 141-168. 70. Casarin, F.E., A.M. Costa-Leonardo, and A. Arab, Soldier initiate foraging activities in the subterranean termite, Heterotermes tenuis. J. Insect Sci., 2008. 8: p. 2-5. 71. Olugbemi, B.O., Exploratory and recruitment phases in soldier-mediated foraging activities in the termite, Coptotermes intermedius Silvestri (Rhinotermitidae: Coptotermitinae). Bull Entomol Res, 2011. 101(4): p. 423-7. 72. Hanus, R., J. Šobotník, and L. Cizek, Egg care by termite soldiers. Insect Soc., 2005. 52(4): p. 357-359. 73. Bordereau, C., The role of pheromones in termite caste differentiation, in Caste differentiation in social Insects, J.A.L. Watson, B.M. Okot-Kotber, and C. Noirot, Editors. 1985, Pergamon Press: Oxford. p. 221-226.

74. Lüscher, M., Evidence for an endocrine control of caste determination in higher termites, in Phase and caste determination in Insects: endocrine aspects, M. Lüscher, Editor. 1976, Pergamon Press: Oxford p. 91–103. 75. Thorne, B.L., N.L. Breisch, and M.L. Muscedere, Evolution of eusociality and the soldier caste in termites: influence of intraspecific competition and accelerated inheritance. Proc Natl Acad Sci U S A, 2003. 100(22): p. 12808-13. 76. Haverty, M.I., The proportion of soldiers in termite colonies: a list and a bibliography (Isoptera). Sociobiology, 1977. 2: p. 199-216 77. Smith, C.R., et al., Caste determination in a polymorphic social insect: nutritional, social, and genetic factors. Am.Nat, 2008. 172(4): p. 497-507. 78. Wheeler, D.E., The developmental basis of worker polymorphism in fire ants. J Insect Physiol, 1990. 36(5): p. 315-322. 79. Passera, L., et al., Increased soldier production in ant colonies exposed to intraspecific competition. Nature, 1996. 379(6566): p. 630-631. 80. Shibao, H., Social structure and the defensive role of soldiers in a eusocial bamboo aphid, Pseudoregma bambucicola (Homoptera: Aphididae): a test of the defence-optimization hypothesis. Res. Popul. Ecol., 1998. 40(3): p. 325-333. 81. Akimoto, S., Ecological factors promoting the evolution of colony defense in aphids: computer simulations. Insect Soc., 1996. 43(1): p. 1-15. 82. Harvey, J.A., L.S. Corley, and M.R. Strand, Competition induces adaptive shifts in caste ratios of a polyembryonic wasp. Nature, 2000. 406(6792): p. 183-186. 83. Shingleton, A.W. and W.A. Foster, Ant tending influences soldier production in a social aphid. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2000. 267(1455): p. 1863- 1868. 84. Sunose, T., et al., What do the soldiers of Pseudoregma bambucicola (Homoptera, Aphidoidea) defend? 昆蟲, 1991. 59(1): p. 141-148. 85. Binder, B.F., Intercolonial aggression in the subterranean termite Heterotermes aureus (Isoptera: Rhinotermitidae). Psyche, 1988. 95(1-2): p. 123-137. 86. Sun, Q. and X. Zhou, Corpse management in social insects. Int. J. Biol. Sci., 2013. 9(3): p. 313. 87. Waller, D. and J. La Fage, Environmental influence on soldier differentiation in Coptotermes formosanus Shiraki (Rhinotermitidae). Insect Soc., 1988. 35(2): p. 144-152. 88. Liu, Y., et al., Effects of temperature and nutrition on juvenile hormone titers of Coptotermes formosanus (Isoptera: Rhinotermitidae). Ann. Entomol. Soc. Am., 2005. 98(5): p. 732-737. 89. Park, Y.I. and A. Raina, Factors regulating caste differentiation in the Formosan subterraneantermite with emphasis on soldier formation. Sociobiology, 2003. 41(1A): p. 49-60. 90. Horiuchi, S., N. Yamamura, and T. Abe, Soldier production strategy in lower termite: from young instars or old instars? J. Theor. Biol., 2002. 218(2): p. 195- 205. 91. Wheeler, D.E., A neglected factor in evolution. Science 1902. 15: p. 766. 92. McGlynn, T.P. and J. Owen, Food supplementation alters caste allocation in a natural population of Pheidole flavens, a dimorphic leaf-litter dwelling ant. Insect Soc., 2002. 49(1): p. 8-14.

93. Wheeler, D.E. and F.H. Nijhout, Soldier determination in Pheidole bicarinata: inhibition by adult soldiers. J Insect Physiol, 1984. 30(2): p. 127-135. 94. Passera, L., Differentiation of the soldiers in the ant Pheidole pallidula Nyl. (Formicidae: Myrmicinae). Insect Soc., 1974. 21(1): p. 71-86. 95. Shibao, H., M. Kutsukake, and T. Fukatsu, Density triggers soldier production in a social aphid. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2004. 271(Suppl 3): p. S71- S74. 96. Itô, Y., et al., Factors affecting the proportion of soldiers in eusocial bamboo aphid, Pseudoregma bambucicola, colonies. Ethol. Ecol. Evol., 1995. 7(4): p. 335-345. 97. Shibao, H., Reproductive schedule and factors affecting soldier production in the eusocial bamboo aphid Pseudoregma bambucicola (Homoptera, Aphididae). Insect Soc., 1999. 46(4): p. 378-386. 98. Gibson, R., Soldier production in Camponotus novaeboracensis during colony growth. Insect Soc., 1989. 36(1): p. 28-41. 99. Long, C., B. Thorne, and N. Breisch, Termite colony ontogeny: a long-term assessment of reproductive lifespan, caste ratios and colony size in Reticulitermes flavipes (Isoptera: Rhinotermitidae). Bull. Entomol. Res., 2003. 93(5): p. 439- 445. 100. Fletcher, D.J. and K.G. Ross, Regulation of reproduction in eusocial Hymenoptera. Annu. Rev. Entomol., 1985. 30(1): p. 319-343. 101. Holman, L., et al., Identification of an ant queen pheromone regulating worker sterility. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2010. 277(1701): p. 3793-3800. 102. Hoover, S.R., et al., The effect of queen pheromones on worker honey bee ovary development. Naturwissenschaften, 2003. 90(10): p. 477-480. 103. Vander Meer, R.K., et al., Pheromone communication in social insects. 1998, Colorado: Westview Press 104. Butler, C., R. Callow, and N.C. Johnston, Extraction and purification of ‘queen substance’from queen bees. Nature, 1959. 184(4702): p. 1871. 105. Clarke, F. and C. Faulkes, Dominance and queen succession in captive colonies of the eusocial naked mole–rat, Heterocephalus glaber. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 1997. 264(1384): p. 993-1000. 106. Light, S.F., Experimental studies on ectohormonal control of the development of supplementary reproductives in the termite genus Zootermopsis (formerly Termopsis). Univ Calif Publ Zool, 1944. 43: p. 413–454. 107. Lüscher, M., Social control of polymorphism in termites, in Insect polymorphism, J.S. Kennedy, Editor. 1961, Royal entomological society: London. p. 57-65. 108. Matsuura, K., et al., Identification of a pheromone regulating caste differentiation in termites. Proc. Natl. Acad. Sci. USA, 2010. 107(29): p. 12963-12968. 109. Maekawa, K., S. Nakamura, and D. Watanabe, Termite soldier differentiation in incipient colonies is related to parental proctodeal trophallactic behavior. Zool. Sci., 2012. 29(4): p. 213-217. 110. Bordereau, C. and S.H. Han, Stimulatory influence of the queen and king on soldier differentiation in the higher termites Nasutitermes lujae and Cubitermes fungifaber. Insect Soc., 1986. 33(3): p. 296-305.

111. Springhetti, A., Influence of the king and queen on the differentiation of soldiers in Kalotermes flavicollis Fabr.(Isoptera). Monitore. Zool. Ital, 1970. 4(3): p. 99- 105. 112. Lefeuve, P. and C. Bordereau, Soldier formation regulated by a primer pheromone from the soldier frontal gland in a higher termite, Nasutitermes lujae. Proc Natl Acad Sci U S A, 1984. 81(23): p. 7665-7668. 113. Mao, L., et al., Formosan subterranean termite (Isoptera: Rhinotermitidae) soldiers regulate juvenile hormone levels and caste differentiation in workers. Ann. Entomol. Soc. Am., 2005. 98(3): p. 340-345. 114. Tarver, M.R., et al., Effects of soldier-derived terpenes on soldier caste differentiation in the termite Reticulitermes flavipes. J. Chem. Ecol., 2009. 35(2): p. 256-64. 115. Tarver, M.R., E.A. Schmelz, and M.E. Scharf, Soldier caste influences on candidate primer pheromone levels and juvenile hormone-dependent caste differentiation in workers of the termite Reticulitermes flavipes. J Insect Physiol, 2011. 57(6): p. 771-7. 116. Rachinsky, A., et al., Caste and metamorphosis: hemolymph titers of juvenile hormone and ecdysteroids in last instar honeybee larvae. Gen. Comp. Endocrinol., 1990. 79(1): p. 31-38. 117. Scharf, M.E., et al., Caste differentiation responses of two sympatric Reticulitermes termite species to juvenile hormone homologs and synthetic juvenoids in two laboratory assays. Insect Soc., 2003. 50(4): p. 346-354. 118. Schulz, D.J., J.P. Sullivan, and G.E. Robinson, Juvenile hormone and octopamine in the regulation of division of labor in honey bee colonies. Horm. Behav., 2002. 42(2): p. 222-231. 119. Liu, Y., et al., Seasonal variation of juvenile hormone titers of the Formosan subterranean termite, Coptotermes formosanus (Rhinotermitidae). Environ. Entomol., 2005. 34(3): p. 557-562. 120. Lenz, M., The dependence of hormone effects in termite caste determination on external factors, in Phase and caste determination in insects., M. Luscher, Editor. 1976, Pergamon Press: Oxford. p. 73-89. 121. Scharf, M.E., et al., Regulation of polyphenic caste differentiation in the termite Reticulitermes flavipes by interaction of intrinsic and extrinsic factors. J. Exp. Biol., 2007. 210(24): p. 4390-4398. 122. Scharf, M.E., et al., Effects of juvenile hormone III on Reticulitermes flavipes: changes in hemolymph protein composition and gene expression. Insect Biochem Mol Biol, 2005. 35(3): p. 207-15. 123. Howard, R.W. and M.I. Haverty, Termites and juvenile hormone analogues: a review of methodology and observed effects. Sociobiology, 1979. 4(2): p. 269- 278. 124. Cornette, R., et al., Juvenile hormone titers and caste differentiation in the damp- wood termite Hodotermopsis sjostedti (Isoptera, Termopsidae). J. Insect Physiol., 2008. 54(6): p. 922-30. 125. Korb, J., E.A. Roux, and M. Lenz, Proximate factors influencing soldier development in the basal termite Cryptotermes secundus (Hill). Insect Soc., 2003. 50(4): p. 299-303.

100

126. Wheeler, D.E. and H.F. Nijhout, Soldier determination in ants: new role for juvenile hormone. Science, 1981. 213(4505): p. 361-363. 127. Rajakumar, R., et al., Ancestral developmental potential facilitates parallel evolution in ants. Science, 2012. 335(6064): p. 79-82. 128. Koshikawa, S., et al., The homolog of Ciboulot in the termite (Hodotermopsis sjostedti): a multimeric beta-thymosin involved in soldier-specific morphogenesis. BMC Dev Biol, 2010. 10(1): p. 63. 129. Zhou, X., F.M. Oi, and M.E. Scharf, Social exploitation of hexamerin: RNAi reveals a major caste-regulatory factor in termites. Proc Natl Acad Sci U S A, 2006. 103(12): p. 4499-504. 130. Hattori, A., et al., Soldier morphogenesis in the damp-wood termite is regulated by the insulin signaling pathway. J. Exp. Zool. B Mol. Dev. Evol., 2013. 320(5): p. 295-306. 131. Masuoka, Y., et al., Knockdown of the juvenile hormone receptor gene inhibits soldier-specific morphogenesis in the damp-wood termite Zootermopsis nevadensis (Isoptera: Archotermopsidae). Insect Biochem. Mol. Biol., 2015. 64: p. 25-31. 132. Thorne, B.L., Evolution of eusociality in termites. Annu Rev Ecol Syst, 1997. 28: p. 27-54. 133. Korb, J., Workers of a drywood termite do not work. Front Zool, 2007. 4: p. 7. 134. Nutting, W., Flight and colony foundation, in Biology of termites, K. Krishna and F.M. Weesner, Editors. 1969, Academic Press Inc: New York. p. 233-282. 135. Mikus, S., R. Brandl, and M. Kaib, Tree-use by Schedorhinotermes lamanianus (Isoptera: Rhinotermitidae). Mitt. Dtsch. Ges. Allg. Angew. Ent., 1997. 11: p. 193-197. 136. Husseneder, C., et al., Small scale population structure of the termite Schedorhinotermes lamanianus: aggression modulated by genetic and environmental factors. Mitt. Dtsch. Gesell. Allg. Angew. Ent, 1997. 11: p. 183- 187. 137. Moran, N., Defenders in the North American aphid Pemphigus obesinymphae. Insect Soc., 1993. 40(4): p. 391-402. 138. Duffy, J.E. and C.L. Morrison, Multiple origins of eusociality among sponge- dwelling shrimps (synalpheus). Evolution, 2000. 54(2): p. 503-516. 139. Yang, A.S., C.H. Martin, and H.F. Nijhout, Geographic variation of caste structure among ant populations. Curr. Biol., 2004. 14(6): p. 514-519. 140. Mertl, A. and J.A. Traniello, Behavioral evolution in the major worker subcaste of twig-nesting Pheidole (Hymenoptera: Formicidae): does morphological specialization influence task plasticity? Behav. Ecol. Sociobiol., 2009. 63(10): p. 1411-1426. 141. Wilson, E.O. and B. Hölldobler, Eusociality: Origin and consequences. Proc Natl Acad Sci U S A, 2005. 102(38): p. 13367-13371. 142. Hughes, W.O., et al., Ancestral monogamy shows kin selection is key to the evolution of eusociality. Science, 2008. 320(5880): p. 1213-1216. 143. Herrera, E.A., Ecological and genetic distribution of eusociality: the case for kin selection. Behav. Ecol., 2013. 24(2): p. 331-333.

101

144. Crozier, R.H., Advanced eusociality, kin selection and male haploidy. Aust. J. Entomol., 2008. 47(1): p. 2-8. 145. Abbot, P., et al., Inclusive fitness theory and eusociality. Nature, 2011. 471(7339): p. E1-E4. 146. Strassmann, J.E., et al., Kin selection and eusociality. Nature, 2011. 471(7339): p. E5-E6. 147. Howard, K.J. and B.L. Thorne, Eusocial evolution in termites and Hymenoptera, in Biology of termites: a modern synthesis, D.E. Bignell, Roisin, Yves., Lo Nathan, Editor. 2011, Springer. p. 97-132. 148. Kobayashi, K., et al., Sex ratio biases in termites provide evidence for kin selection. Nat. Commun, 2013. 4. 149. Shibao, H., Lack of kin discrimination in the eusocial aphid Pseudoregma bambucicola (Homoptera: Aphididae). J. Ethol., 1999. 17(1): p. 17-24. 150. Abbot, P., J.H. Withgott, and N.A. Moran, Genetic conflict and conditional altruism in social aphid colonies. Proc Natl Acad Sci U S A, 2001. 98(21): p. 12068-12071. 151. Roux, E.A. and J. Korb, Evolution of eusociality and the soldier caste in termites: a validation of the intrinsic benefit hypothesis. J. Evol. Biol., 2004. 17(4): p. 869- 75. 152. Husseneder, C., et al., Within-colony relateness in a termite species: genetic roads to eusociality? Behaviour, 1999. 136: p. 1045-1063. 153. Bourke, A.F., Social evolution in ants. 1995: Princeton University Press. 154. Boomsma, J. and A. Grafen, Colony‐level sex ratio selection in the eusocial Hymenoptera. J. Evol. Biol., 1991. 4(3): p. 383-407. 155. Duffy, J.E. and K.S. Macdonald, Kin structure, ecology and the evolution of social organization in shrimp: a comparative analysis. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2010. 277(1681): p. 575-584. 156. Boomsma, J.J., Lifetime monogamy and the evolution of eusociality. Phil. Trans. R. Soc. Lond. B, 2009. 364(1533): p. 3191-207. 157. Bartz, S.H., Evolution of eusociality in termites. Proc Natl Acad Sci U S A, 1979. 76(11): p. 5764-5768. 158. Lacy, R.C., The evolution of eusociality in termites: a haplodiploid analogy? Am Nat, 1980. 116(3): p. 449-451. 159. McLeish, M., T. Chapman, and B. Crespi, Inbreeding ancestors: the role of sibmating in the social evolution of gall thrips. J. Hered., 2006. 97(1): p. 31-38. 160. Chapman, T.W., et al., High relatedness and inbreeding at the origin of eusociality in gall-inducing thrips. Proc Natl Acad Sci U S A, 2000. 97(4): p. 1648-50. 161. Gobin, B. and F. Ito, Queens and major workers of Acanthomyrmex ferox redistribute nutrients with trophic eggs. Naturwissenschaften, 2000. 87(7): p. 323-326. 162. Peeters, C., et al., Evolution of a soldier caste specialized to lay unfertilized eggs in the ant genus Crematogaster ( subgenus: Orthocrema). Arthropod Struct. Dev., 2013. 42: p. 257-264. 163. Roisin, Y., Philopatric reproduction, a prime mover in the evolution of termite sociality? Insect Soc., 1999. 46(4): p. 297-305.

102

164. Myles, T.G., Reproductive soldiers in the Termopsidae (Isoptera). Pan-Pac Entomol, 1986. 62: p. 293-299. 165. Wheeler, W.M., Ants: their structure, development and behavior. Vol. 9. 1910: Columbia University Press. 166. Kamiya, T., et al., What determines the growth of individual castes in social trematodes? Evol. Ecol., 2013. 27: p. 1235-1247. 167. Myles, T.G., Evidence of parental and/or sibling manipulation in three species of Termites in Hawaii (Isoptera). Proc Hawaiian Entomol Soc, 1986. 27: p. 129-136. 168. Kutsukake, M., et al., Venomous protease of aphid soldier for colony defense. Proc Natl Acad Sci U S A, 2004. 101(31): p. 11338-11343. 169. Sobotnik, J., A. Jirosova, and R. Hanus, Chemical warfare in termites. J Insect Physiol, 2010. 56(9): p. 1012-21. 170. Fuller, C.A., Fungistatic activity of freshly killed termite, Nasutitermes acajutlae, soldiers in the Caribbean. J. Insect Sci., 2007. 7. 171. Huang, M.H., Multi-phase defense by the big-headed ant, Pheidole obtusospinosa, against raiding army ants. J Insect Sci, 2010. 10: p. 1. 172. Wilson, E., The relation between caste ratios and division of labor in the ant genus Pheidole (Hymenoptera: Formicidae). Behav. Ecol. Sociobiol., 1984. 16(1): p. 89-98. 173. Wilson, E.O., Division of labor in fire ants based on physical castes (Hymenoptera: Formicidae: Solenopsis). J. Kans. Entomol. Soc., 1978. 51(4): p. 615-636. 174. Tian, L. and X. Zhou, The Soldiers in Societies: Defense, Regulation, and Evolution. Int. J. Biol. Sci., 2014. 10(3): p. 296. 175. Bagnères, A.-G. and R. Hanus, Communication and Social Regulation in Termites, in Social Recognition in Invertebrates. 2015, Springer. p. 193-248. 176. Park, Y.I. and A.K. Raina, Juvenile hormone III titers and regulation of soldier caste in Coptotermes formosanus (Isoptera: Rhinotermitidae). J. Insect Physiol., 2004. 50(6): p. 561-566. 177. Ishikawa, Y. and T. Miura, Hidden aggression in termite workers: plastic defensive behaviour dependent upon social context. Anim. Behav., 2012. 83(3): p. 737-745. 178. Watanabe, D., et al., Soldier presence suppresses presoldier differentiation through a rapid decrease of JH in the termite Reticulitermes speratus. J Insect Physiol, 2011. 57(6): p. 791-5. 179. Cornelius, M.L. and J.K. Grace, Effect of termite soldiers on the foraging behavior of Coptotermes formosanus (Isoptera: Rhinotermitidae) in the presence of predatory ants. Sociobiology, 1997. 29(3): p. 247-253. 180. Polizzi, J. and B. Forschler, Intra-and interspecific agonism in Reticulitermes flavipes (Kollar) and R. virginicus (Banks) and effects of arena and group size in laboratory assays. Insect Soc., 1998. 45(1): p. 43-49. 181. Korb, J. and S. Schmidinger, Help or Disperse? Cooperation in Termites Influenced by Food Conditions. Behav. Ecol. Sociobiol., 2004. 56(1): p. 89-95. 182. Underwood, A., Experiments in Ecology. 1997, New York NY: Cambridge University Press.

103

183. Van Buskirk, J., et al., Prey risk assessment depends on conspecific density. Oikos, 2011. 120(8): p. 1235-1239. 184. McCauley, S.J., L. Rowe, and M.-J. Fortin, The deadly effects of “nonlethal” predators. Ecology, 2011. 92(11): p. 2043-2048. 185. Siepielski, A.M., J. Wang, and G. Prince, Nonconsumptive predator-driven mortality causes natural selection on prey. Evolution, 2014. 68(3): p. 696-704. 186. Schmitz, O., A. Beckerman, and K. O'Brien, Behaviorally-mediated trophic cascades: effects of predation risk on food web interactions. Ecology, 1997. 78(5): p. 1388-1399. 187. Shelton, T.G. and J.K. Grace, Review of agonistic behaviors in the Isoptera. Sociobiology, 1996. 28(2): p. 155-176. 188. Janssens, L. and R. Stoks, Predation risk causes oxidative damage in prey. Biol. Lett., 2013. 9(4): p. 20130350. 189. Adamo, S.A., The effects of the stress response on immune function in invertebrates: an evolutionary perspective on an ancient connection. Horm. Behav., 2012. 62(3): p. 324-30. 190. Kikusui, T., J.T. Winslow, and Y. Mori, Social buffering: relief from stress and anxiety. Philos. Trans. R. Soc. Lond., Ser. B: Biol. Sci., 2006. 361(1476): p. 2215- 2228. 191. DeWitt, T., A. Sih, and D. Wilson, Costs and limits of phenotypic plasticity. Trends Ecol Evol, 1998. 13(2): p. 77-81. 192. Howard, R. and M.I. Haverty, Seasonal variation in caste proportions of field colonies of Reticulitermes flavipes (Kollar). Environ Entomol, 1981. 10(4): p. 546-549. 193. Reinhard, J. and J.-L. Clément, Alarm reaction of European Reticulitermes termites to soldier head capsule volatiles (Isoptera, Rhinotermitidae). J Insect Behav, 2002. 15(1): p. 95-107. 194. Evans, T.A., et al., Termites eavesdrop to avoid competitors. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2009. 276(1675): p. 4035-4041. 195. Hill, G.F., Termites (Isoptera) from the Australian region. Termites (Isoptera) from the Australian region., 1942. Melbourne, Australia: CSIR Publishing. 196. Roisin, Y., et al., Vertical stratification of the termite assemblage in a neotropical rainforest. Oecologia, 2006. 149(2): p. 301-311. 197. Schuurman, G., Foraging and distribution patterns in a termite assemblage dominated by fungus-growing species in semi-arid northern Botswana. J. Trop. Ecol., 2006. 22(03): p. 277-287. 198. Jones, S.C. and M.W. Trosset, Interference competition in desert subterranean termites. Entomologia Experimentalis et Applicata, 1991. 61(1): p. 83-90. 199. Levings, S.C. and E.S. Adams, Intra-and interspecific territoriality in Nasutitermes (Isoptera: Termitidae) in a Panamanian mangrove forest. J.Anim.Ecol., 1984: p. 705-714. 200. Leponce, M., Y. Roisin, and J.M. Pasteels, Intraspecific interactions in a community of arboreal nesting termites (Isoptera: Termitidae). J insect behav, 1996. 9(5): p. 799-817. 201. Shellman-Reeve, J.S., Limited nutrients in a dampwood termite: nest preference, competition and cooperative nest defence. J. Anim. Ecol., 1994: p. 921-932.

104

202. Su, N.-Y. and R.H. Scheffrahn, Intra-and interspecific competition of the Formosan and the eastern subterranean termite: Evidence from field observations (Isoptera: Rhinotermitidae). Sociobiology (USA), 1988. 203. Wood, T. and K. Lee, Abundance of mounts and competition among colonies of some Australian termite species. Pedobiologia, 1971. 204. Grozinger, C.M., et al., Pheromone-mediated gene expression in the honey bee brain. Proc Natl Acad Sci U S A, 2003. 100(suppl 2): p. 14519-14525. 205. Alaux, C., et al., Regulation of brain gene expression in honey bees by brood pheromone. Genes, Brain and Behav., 2009. 8(3): p. 309-319. 206. Tarver, M., X. Zhou, and M. Scharf, Socio-environmental and endocrine influences on developmental and caste-regulatory gene expression in the eusocial termite Reticulitermes flavipes. BMC Mol. Biol., 2010. 11(1): p. 28. 207. Mortazavi, A., et al., Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat. Methods, 2008. 5(7): p. 621-628. 208. Roisin, Y., et al., Caste-dependent reactions to soldier defensive secretion and chiral alarm/recruitment pheromone inNasutitermes princeps. J. Chem. Ecol., 1990. 16(10): p. 2865-2875. 209. Slos, S. and R. Stoks, Predation risk induces stress proteins and reduces antioxidant defense. Funct. Ecol., 2008. 22(4): p. 637-642. 210. Beckerman, A.P., K. Wieski, and D.J. Baird, Behavioural versus physiological mediation of life history under predation risk. Oecologia, 2007. 152(2): p. 335- 343. 211. Woodley, C.M. and M.S. Peterson, Measuring responses to simulated predation threat using behavioral and physiological metrics: the role of aquatic vegetation. Oecologia, 2003. 136(1): p. 155-160. 212. Tung, J., et al., Social environment is associated with gene regulatory variation in the rhesus macaque immune system. Proc Natl Acad Sci U S A, 2012. 109(17): p. 6490-6495. 213. Slos, S., L. De Meester, and R. Stoks, Food level and sex shape predator-induced physiological stress: immune defence and antioxidant defence. Oecologia, 2009. 161(3): p. 461-467. 214. Irwin, M.R. and S.W. Cole, Reciprocal regulation of the neural and innate immune systems. Nat. Rev. Immunol., 2011. 11(9): p. 625-632. 215. Martin, L.B., Stress and immunity in wild vertebrates: timing is everything. Gen. Comp. Endocrinol., 2009. 163(1): p. 70-76. 216. Gonzalez, N., et al., Bombesin-related peptides and their receptors: recent advances in their role in physiology and disease states. Curr Opin Endocrinol Diabetes Obes, 2008. 15(1): p. 58. 217. Sano, H., et al., Characterization of the bombesin-like peptide receptor family in primates. Genomics, 2004. 84(1): p. 139-146. 218. Audsley, N. and R. Weaver, Neuropeptides associated with the regulation of feeding in insects. Gen. Comp. Endocrinol., 2009. 162(1): p. 93-104. 219. Arakane, Y., et al., Laccase 2 is the phenoloxidase gene required for beetle cuticle tanning. Proc Natl Acad Sci U S A, 2005. 102(32): p. 11337-11342. 220. Hopkins, T.L. and K.J. Kramer, Insect cuticle sclerotization. Annu. Rev. Entomol., 1992. 37(1): p. 273-302.

105

221. Marmaras, V.J., N.D. Charalambidis, and C.G. Zervas, Immune response in insects: The role of phenoloxidase in defense reactions in relation to melanization and sclerotization. Arch. Insect Biochem. Physiol., 1996. 31(2): p. 119-133. 222. Shao, Q., et al., Hindgut innate immunity and regulation of fecal microbiota through melanization in insects. J. Biol. Chem., 2012. 287(17): p. 14270-14279. 223. Zhang, J., C. Goyer, and Y. Pelletier, Environmental stresses induce the expression of putative glycine-rich insect cuticular protein genes in adult Leptinotarsa decemlineata (Say). Insect Mol. Biol., 2008. 17(3): p. 209-216. 224. Sanogo, Y.O., et al., Transcriptional regulation of brain gene expression in response to a territorial intrusion. Proc. R. Soc. Lond., Ser. B: Biol. Sci., 2012. 279(1749): p. 4929-4938. 225. Gesquiere, L.R., et al., Life at the top: rank and stress in wild male baboons. Science, 2011. 333(6040): p. 357-360. 226. Huntingford, F.A., Animal conflict. 2013: Springer Science & Business Media. 227. Scharf, M., et al., Caste- and development-associated gene expression in a lower termite. Genome Biol, 2003. 4(10): p. R62. 228. Scharf, M., et al., Gene expression profiles among immature and adult reproductive castes of the termite Reticulitermes flavipes. Insect Mol. Biol., 2005. 14(1): p. 31-44. 229. Miura, T., Developmental regualtion of caste-specific characters in social-insect polyphenism. Evol. Dev., 2005. 7: p. 122-129. 230. Weil, T., M. Rehli, and J. Korb, Molecular basis for the reproductive division of labour in a lower termite. BMC genomics, 2007. 8(1): p. 198. 231. Weil, T., J. Korb, and M. Rehli, Comparison of queen-specific gene expression in related lower termite species. Mol. Biol. Evol., 2009. 26(8): p. 1841-1850. 232. Terrapon, N., et al., Molecular traces of alternative social organization in a termite genome. Nat. Commun, 2014. 5. 233. Sanogo, Y.O., et al., Brain Transcriptomic Response of Threespine Sticklebacks to Cues of a Predator. Brain Behav. Evol., 2011. 77(4): p. 270-285. 234. Wong, R., S. Oxendine, and J. Godwin, Behavioral and neurogenomic transcriptome changes in wild-derived zebrafish with fluoxetine treatment. BMC genomics, 2013. 14(1): p. 348. 235. Simpson, S.J., G.A. Sword, and N. Lo, Polyphenism in insects. Curr. Biol., 2011. 21(18): p. R738-R749. 236. Nijhout, H.F., Insect hormones. 1998: Princeton University Press. 237. Riddiford, L.M., Juvenile hormone action: a 2007 perspective. J. Insect Physiol., 2008. 54(6): p. 895-901. 238. Palli, S.R., Recent advances in the mode of action of juvenile hormones and their analogs, in Biorational Control of Arthropod Pests. 2009, Springer. p. 111-129. 239. Wheeler, D.E. and F.H. Nijhout, Soldier determination in Pheidole bicarinata: effect of methoprene on caste and size within castes. J Insect Physiol, 1983. 29(11): p. 847-854. 240. Nijhout, H.F. and D.E. Wheeler, Juvenile Hormone and the Physiological Basis of Insect Polymorphisms. Q. Rev. Biol., 1982. 57(2): p. 109-133.

106

241. Konopova, B. and M. Jindra, Juvenile hormone resistance gene Methoprene- tolerant controls entry into metamorphosis in the beetle Tribolium castaneum. Proc Natl Acad Sci U S A, 2007. 104(25): p. 10488-10493. 242. Marchal, E., et al., Methoprene-tolerant (Met) knockdown in the adult female cockroach, Diploptera punctata completely inhibits ovarian development. 2014. 243. Miller, E.M., Caste differentiation in the lower termites. Biology of termites, 1969. 1: p. 283-310. 244. Lüscher, M., Hormonal control of caste differentiation in termites. Ann. N. Y. Acad. Sci., 1960. 89(3): p. 549-563. 245. Lüscher, M., Environmental control of juvenile hormone (JH) secretion and caste differentiation in termites. Gen. Comp. Endocrinol., 1972. 3: p. 509-514. 246. Toga, K., et al., Presoldier induction by a juvenile hormone analog in the nasute termite Nasutitermes takasagoensis (Isoptera: Termitidae). Zool. Sci., 2009. 26(6): p. 382-388. 247. Austin, J.W., et al., Genetic variation of Reticulitermes flavipes (Isoptera: Rhinotermitidae) in North America applying the mitochondrial rRNA 16S gene. Ann. Entomol. Soc. Am., 2005. 98(6): p. 980-988. 248. Lainé, L. and D. Wright, The life cycle of Reticulitermes spp.(Isoptera: Rhinotermitidae): what do we know? Bull. Entomol. Res., 2003. 93(04): p. 267- 278. 249. Jindra, M., S.R. Palli, and L.M. Riddiford, The juvenile hormone signaling pathway in insect development. Annu. Rev. Entomol., 2013. 58: p. 181-204. 250. Shpigler, H., et al., The transcription factor Krüppel homolog 1 is linked to hormone mediated social organization in bees. BMC Evol. Biol., 2010. 10(1): p. 120. 251. Inward, D., G. Beccaloni, and P. Eggleton, Death of an order: a comprehensive molecular phylogenetic study confirms that termites are eusocial cockroaches. Biol. Lett., 2007. 3(3): p. 331-335. 252. Moore, A.W., et al., A genomewide survey of basic helix–loop–helix factors in Drosophila. Proc Natl Acad Sci U S A, 2000. 97(19): p. 10436-10441. 253. Rajagopal, R., et al., Silencing of Midgut Aminopeptidase N of Spodoptera litura by Double-stranded RNA Establishes Its Role asBacillus thuringiensis Toxin Receptor. J. Biol. Chem., 2002. 277(49): p. 46849-46851. 254. Goto, A., et al., Silencing of Toll pathway components by direct injection of double‐stranded RNA into Drosophila adult flies. Nucleic Acids Res., 2003. 31(22): p. 6619-6623. 255. Jaubert-Possamai, S., et al., Gene knockdown by RNAi in the pea aphid Acyrthosiphon pisum. BMC Biotechnol., 2007. 7(1): p. 63. 256. Turner, C., et al., RNA interference in the light brown apple moth, Epiphyas postvittana (Walker) induced by double‐stranded RNA feeding. Insect Mol. Biol., 2006. 15(3): p. 383-391. 257. Raina, A., Y.I. Park, and D. Gelman, Molting in workers of the Formosan subterranean termite Coptotermes formosanus. J. Insect Physiol., 2008. 54(1): p. 155-161.

107

258. Masuoka, Y., et al., High Laccase2 expression is likely involved in the formation of specific cuticular structures during soldier differentiation of the termite Reticulitermes speratus. Arthropod Struct Dev., 2013. 42(6): p. 469-475. 259. Cornette, R., et al., Juvenile hormone titers and caste differentiation in the damp- wood termite Hodotermopsis sjostedti (Isoptera, Termopsidae). J. Insect Physiol., 2008. 54(6): p. 922-930. 260. Vander Meer, R.K., et al., Pheromone communication in social insects. Ants, wasps, bees and termites. Westview, Boulder, CO, 1998.

108

11 VITA

Li Tian, Ph.D. Candidate

EDUCATION

University of Kentucky, Lexington, KY, USA Ph.D. candidate, Entomology, August 2010 – present

Auburn University, Auburn, AL, USA M.S., Entomology, August 2008 –August 2010

China Agricultural University, Beijing, China B.S., Entomology, August 2004 –May 2008

PROFESSIONAL POSITIONS

Graduate research assistant, Department of Entomology, University of Kentucky, Lexington, Kentucky. August 2010-Present

Graduate research assistant, Department of Entomology and Plant Pathology, Auburn University, Auburn, Alabama. August 2008-August 2010

Undergraduate Independent Research, Department of Plant Protection, China Agricultural University, Beijing, China. August 2007-May 2008

AWARDS AND HONORS

Department of Entomology Publication Scholarships, University of Kentucky 2014 Graduate School Student Travel Awards, University of Kentucky 2014, 2015 Karri Casner Environmental Sciences Research Fellowship Grant, University of Kentucky 2015 National Agricultural Biotechnology Council Meeting Student Travel Grants. 2014 Scholarship for Outstanding Master Student, Department of Entomology and Plant Pathology, Auburn University 2010 Scholarship for Excellent Undergraduate Students, China Agricultural University 2006, 2007 Scholarship for Excellent Freshman, China Agricultural University 2005

109

PROFESSIONAL MEMBERSHIP

Entomological Society of America 2008-Present Pan-American Society for Evolutionary Developmental Biology 2015 International Union for the Study of Social Insects 2010-Present

RESEARCH PUBLICATIONS

Published (# First author)

Tian L# & X Zhou. The soldiers in societies: defense, regulation, and evolution. Int J Biol Sci. 2014; 10(3): 296.

Tian L#, C Cao, L He, M Li, L Zhang, H Liu & N Liu. Autosomal interactions and mechanisms of pyrethroid resistance in House Flies, Musca domestica. Int J Biol Sci. 2011; 7(6): 902–911.

Xu Q, L Tian, L Zhang & N Liu. Sodium channel genes and their differential genotypes at the L-to-F kdr locus in the mosquito Culex quinquefasciatus. Biochem.Biophys. Res. Com. 2011; 407, 645–649.

Tian L#& Q Liu. Domestic and foreign research status on control techniques of the Greater Wax Moth, Galleria mellonella L. Journal of Anhui Agricultural Sciences. 2008; 36, 5495-5496, & 5653.

Tian L#, H Pu & Q Liu. Utilization status of the greater wax moth, Galleria mellonella, as an experimental insect. Chinese Bulletin of Entomology. 2009; 46, 485-489.

Manuscripts in Preparation

Tian L# & X Zhou. Molecular and functional characterization of Methoprene tolerant gene in a lower termite, Reticulitermes flavipes

Tian L#, KF Haynes, E Preisser & X Zhou. Competition induced stress and caste-dependent stress resistance in a termite

Tian L# & X Zhou. Aggression behavior and social genomic study in eusocial insects

L Tian#, Li X, Q Sun & X Zhou. A comprehensive selection of references genes and MIQE standard in the lower termites.

110

RESEARCH TALKS AND POSTERS

Oral Presentations (# First author, *presenter)

Tian L# *& X Zhou. 2015. Characterizing the function of Methoprene tolerant and its downstream genes in a termite. Student Award Competition. Annual Meeting of the ESA, Minneapolis, MN

Tian L#*, QS Song & X Zhou. 2015. Functional understanding of a Methoprene tolerant gene in termites. The 5th International Symposium on Insect Physiology, Biochemistry and Molecular Biology, Guangzhou, China

Tian L# *& X Zhou. 2015. Molecular and functional characterization of Methoprene tolerant gene in a lower termite, Reticulitermes flavipes. The Cold Spring Harbor Laboratory Symposium: Biology and Genomics of Social Insects.

Tian L#*, KF Haynes & X Zhou. 2014. Competition induced stress and soldier caste-dependent stress resistance in a termite. Student Award Competition. Annual Meeting of the ESA, Portland, ORE

Tian L#*, KF Haynes & X Zhou. 2014. Soldier-dependent tolerance for competitor threats in a termite. Annual Meeting of the International Society of Chemical Ecology. Champaign, IL

Tian L#* & X Zhou. 2012. Cricket fighting: The sport of the emperors. The 42th University of Kentucky Pest Control Short Course. Lexington, KY Tian L#*, X Li, Q Sun & X Zhou. 2011. Genetic understanding of aggression behavior in the lower termite Reticulitermes flavipes. Student Award Competition. Annual Meeting of the ESA. Reno, NV

Tian L#* & X Zhou. 2011. Behavioral study on inter-colony aggression in the Eastern subterranean termite, Reticulitermes flavipes. Student Award Competition. Annual Meeting of the Ohio Valley Entomological Association. Frankfort, KY

Poster Presentations (# First author, *presenter)

Tian L#* & X Zhou. 2015. Molecular and functional characterization of Methoprene tolerant gene in a termite. The Cold Spring Harbor Symposium: Biology and Genomics of Social Insects. Cold Spring Harbor, NY

Tian L#*, KF Haynes & X Zhou. 2014. Molecular mechanisms underlying the soldier-dependent competition stress tolerance in a termite. National Agricultural Biotechnology Council, Cornell University, NY

111

Tian L#*, KF Haynes & X Zhou. 2013. From “Scared to death” to “peace of mind”: The functionality of soldiers. Student Award Competition. Annual Meeting of the ESA, Reno, NV

Li X, Z Li, Q Sun, L Tian & X Zhou. 2011. Identification and functional characterization of a larvae cuticle protein in the lower termite Reticulitermes flavipes. Annual Meeting of the ESA, Reno, NV

Li X, L Tian*, Q Sun & X Zhou. 2011. Transcriptomic dissection of the eusocial Isoptera. International Social Insect Genomics Research Conference. Shenzhen, China

Li Z, X Li, Q Sun, L Tian*, S Jones, MF Potter & X Zhou. 2011. Functional analysis of genes involved in the caste differentiation in termites. 7th KY Innovation Entrepreneurship Conference & 16th KY EPSCoR Joint Conference. Louisville, KY

Xu Q, L Tian*, L Zhang & N Liu. 2009. Multiple sodium channel genes and their differential genotype at the L-to-F kdr locus in the Mosquito, Culex quinquefasciatus. Student Award Competition. Annual Meeting of the ESA, Indianapolis, IN

Tian L#*, Q Xu, L Zhang & N Liu. 2009. Genetic linkages of the Kdr-mediated resistance in the house fly Musca domestica (L.). Student Award Competition. Southeastern Branch Meeting of the ESA, Montgomery, AL

112