Structural Characterisation of Chordin Family Regulators and Their Interactions with Twisted Gastrulation

A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health

2018

Anne Louise Barrett

School of Biological Sciences

Division of Cell Matrix Biology and Regenerative Medicine

List of contents

List of contents ...... 2

List of figures ...... 7

List of tables ...... 9

List of abbreviations ...... 10

Abstract ...... 13

Declaration ...... 14

Acknowledgements ...... 15

1 Introduction ...... 16 1.1 Bone Morphogenetic Protein signalling ...... 16 1.1.1 BMPs and receptor binding ...... 16 1.1.2 BMP signalling pathways ...... 18 1.2 The chordin family of BMP antagonists ...... 20 1.2.1 Chordin and chordin-like protein structures ...... 21 1.2.2 BMP binding by chordin and chordin-like proteins ...... 24 1.2.3 The interaction between vWC domains and BMPs ...... 25 1.2.4 Variation in the BMP interaction within the chordin family ...... 27 1.2.5 Regulation of chordin activity ...... 28 1.3 The biological roles of chordin and chordin-like proteins ...... 31 1.3.1 Embryonic dorsoventral patterning ...... 31 1.3.2 The role of chordin and chordin-like proteins in mammals ...... 35 1.3.3 Chordin, chordin-like proteins, and disease ...... 36 1.4 Tsg: a modulator of the chordin family...... 38 1.4.1 Tsg structure ...... 38 1.4.2 Tsg as a BMP antagonist...... 39 1.4.3 Tsg as a BMP agonist ...... 40 1.4.4 Interactions of Tsg with BMPs and the chordin family ...... 40 1.4.5 Biological roles of Tsg ...... 42 1.4.6 Chordin, Tsg, and BMP shuttling ...... 43 1.4.7 Interactions of the chordin/Tsg/BMP ternary complex components with the extracellular matrix ...... 47 1.5 Aims ...... 49

2 Materials and Methods ...... 51

2 2.1 Cell lines ...... 51 2.2 Plasmid constructs ...... 51 2.3 Molecular biology ...... 52 2.3.1 Generation of pCEP-Pu/AC7 vector constructs ...... 52 2.3.2 Polymerase chain reaction amplification of pCEP-Pu/AC7 inserts...... 53 2.3.3 CHRDL2 pCDH insert generation...... 53 2.3.4 Restriction digest of vector sequences ...... 54 2.3.5 Agarose gel electrophoresis ...... 54 2.3.6 DNA purification ...... 54 2.3.7 In-Fusion ligation ...... 55 2.3.8 Bacterial transformation ...... 55 2.3.9 Purification of expression vectors ...... 55 2.3.10 DNA sequencing ...... 56 2.4 Protein expression in HEK293-EBNA cells ...... 56 2.4.1 HEK293-EBNA cell culture ...... 56 2.4.2 HEK293-EBNA pCEP-Pu/AC7 transfection and selection ...... 56 2.4.3 HEK293-EBNA pCDH transduction ...... 57 2.4.4 Fluorescence activated cell sorting ...... 57 2.4.5 Freezing of HEK293-EBNA cells ...... 58 2.4.6 HEK293-EBNA protein expression ...... 58 2.4.7 Media harvesting and processing ...... 58 2.5 Protein purification...... 59 2.5.1 Affinity chromatography ...... 59 2.5.2 Size exclusion chromatography ...... 59 2.5.3 Ion exchange chromatography ...... 60 2.5.4 Sodium dodecyl sulphate polyacrylamide gel electrophoresis ...... 60 2.5.5 Western blotting ...... 61 2.5.6 Mass spectrometry protein identification ...... 61 2.5.7 Protein concentration determination ...... 61 2.6 Biochemical methods ...... 62 2.6.1 Protein crosslinking ...... 62 2.6.2 Immunoprecipitation of Tsg-FLAG/ΔN-chordin ...... 62 2.6.3 Denaturing protein deglycosylation ...... 62 2.6.4 Lectin binding assay ...... 63 2.6.5 Cleavage assay ...... 63 2.7 Biophysical methods ...... 64 2.7.1 Analysis of protein foldedness ...... 64 2.7.2 Circular dichroism ...... 64

3 2.7.3 Multi-angle light scattering ...... 64 2.7.4 Analytical ultracentrifugation ...... 64 2.8 Binding assays ...... 65 2.8.1 Solid phase assay ...... 65 2.8.2 Surface plasmon resonance ...... 65 2.8.3 Microscale thermophoresis ...... 66 2.8.4 Bio-layer interferometry ...... 66 2.9 Structural analysis ...... 67 2.9.1 Homology modelling ...... 67 2.9.2 Small angle X-ray scattering ...... 67 2.9.3 Small angle X-ray scattering data analysis ...... 68 2.9.4 Negative stain transmission electron microscopy ...... 69 2.9.5 Cryo-transmission electron microscopy grid preparation ...... 70 2.9.6 Cryo-transmission electron microscopy data collection ...... 70 2.9.7 Cryo-transmission electron microscopy image analysis ...... 70

3 Results Chapter 1: Investigating the interaction between chordin and Tsg ...... 72 3.1 Purification of Tsg...... 72 3.2 Purification of chordin fragments ...... 73 3.2.1 Purification of N-chordin ...... 74 3.2.2 Purification of smaller chordin fragments ...... 76 3.3 Binding analysis of chordin fragments to Tsg ...... 81 3.3.1 Binding of large chordin fragments to Tsg ...... 81 3.3.2 Binding of small chordin fragments to Tsg ...... 82 3.3.3 MST binding analysis ...... 84 3.4 Isolating a Tsg/N-chordin complex ...... 85 3.4.1 Size exclusion chromatography of Tsg/N-chordin ...... 85 3.4.2 Crosslinking Tsg and N-chordin ...... 87 3.4.3 Size exclusion chromatography of crosslinked Tsg and N-chordin ...... 87 3.4.4 Ion exchange chromatography of crosslinked Tsg and N-chordin ...... 88 3.4.5 Isolation of the complex with a Tsg-FLAG construct ...... 93 3.5 Summary and discussion ...... 96

4 Results Chapter 2: Characterisation of CHRDL2 ...... 99 4.1 Expression and purification of CHRDL2 ...... 100 4.1.1 CHRDL2 construct generation ...... 100 4.1.2 CHRDL2 purification ...... 101 4.2 CHRDL2 hydrodynamic analysis ...... 104 4.3 Analysis of CHRDL2 glycosylation ...... 106

4 4.4 CHRDL2 secondary structure analysis ...... 109 4.5 Small angle X-ray scattering analysis ...... 111 4.5.1 CHRDL2 SAXS analysis ...... 113 4.5.2 CHRDL2 SAXS shape analysis ...... 115 4.5.3 CHRDL2 ab initio modelling...... 116 4.5.4 Modelling the CHRDL2 flexible ensemble ...... 117 4.6 CHRDL2 binding analysis ...... 122 4.6.1 Solid phase binding assays ...... 122 4.6.2 Bio-layer interferometry ...... 124 4.7 CHRDL2 cleavage assay ...... 127 4.8 Summary and discussion ...... 127

5 Results Chapter 3: Characterisation of the CHRDL2/Tsg complex ...... 130 5.1 Isolation of a CHRDL2/Tsg complex ...... 130 5.2 Hydrodynamic analysis of the CHRDL2/Tsg complex ...... 131 5.2.1 SEC-MALS of the CHRDL2/Tsg complex ...... 131 5.2.2 AUC of the CHRDL2/Tsg complex ...... 132 5.3 SAXS of the CHRDL2/Tsg complex ...... 134 5.3.1 SAXS analysis of the CHRDL2/Tsg complex ...... 135 5.3.2 SAXS analysis of Tsg ...... 137 5.3.3 Multiphase ab initio modelling of the CHRDL2/Tsg complex ...... 139 5.4 Negative stain transmission electron microscopy of the CHRDL2/Tsg complex...... 140 5.5 Cryo-transmission electron microscopy of the CHRDL2/Tsg complex ...... 143 5.5.1 Cryo-transmission electron microscopy without complex purification .....143 5.5.2 Cryo-transmission electron microscopy after purification ...... 146 5.6 Summary and discussion ...... 149

6 Final discussion ...... 152 6.1 The Tsg-chordin interaction ...... 152 6.2 The chordin/Tsg complex ...... 154 6.3 CHRDL2 characterisation ...... 156 6.4 CHRDL2 regulation ...... 157 6.5 The CHRDL2/Tsg complex ...... 159 6.6 Future directions...... 160 6.6.1 The chordin/Tsg complex ...... 160 6.6.2 The CHRDL2/Tsg complex ...... 161 6.6.3 CHRDL1 characterisation ...... 163 6.6.4 Interactions of Tsg, chordin and chordin-like proteins with other matrix components ...... 163 5 6.7 Summary ...... 164

7 References ...... 165

8 Appendices ...... 181 8.1 Appendix 1...... 181 8.2 Appendix 2...... 182 8.3 Appendix 3...... 183 8.4 Appendix 4...... 184 8.5 Appendix 5...... 185 8.6 Appendix 6...... 186 8.7 Appendix 7...... 187 8.8 Appendix 8...... 188 8.9 Appendix 9...... 189 8.10 Appendix 10 ...... 190 8.11 Appendix 11 ...... 191

Word count: 47,209

6 List of figures

Figure 1-1 BMP structure and interaction with receptors...... 18 Figure 1-2 The canonical BMP signalling pathway...... 19 Figure 1-3 Chordin antagonism of BMPs...... 20 Figure 1-4 Chordin family structures...... 23 Figure 1-5 Structure of vWC domains and interaction with BMP-2...... 26 Figure 1-6 Tolloid cleavage of chordin...... 29 Figure 1-7 The establishment of the Xenopus embryo BMP signalling gradient...... 33 Figure 1-8 The structure of Tsg...... 39 Figure 1-9 Establishment of the dorsoventral BMP signalling gradient in the Drosophila embryo...... 45 Figure 3-1 Purification of Tsg...... 73 Figure 3-2 Schematic of the recombinant chordin fragments used in binding analysis. .74 Figure 3-3 Purification of N-chordin...... 75 Figure 3-4 Purification of vWC1-4CHRD...... 77 Figure 3-5 Purification of chordin vWC1...... 78 Figure 3-6 Purification of chordin vWC2-3...... 80 Figure 3-7 SPR binding analysis of large chordin fragments to Tsg...... 82 Figure 3-8 SPR binding analysis of small chordin fragments to Tsg...... 83 Figure 3-9 MST binding analysis of chordin fragments to Tsg...... 85 Figure 3-10 Size exclusion chromatography of a Tsg/N-chordin mixture...... 86

Figure 3-11 Tsg and N-chordin crosslinking...... 87

Figure 3-12 Size exclusion chromatography of the N-chordin/Tsg crosslinking reaction...... 88 Figure 3-13 Ion exchange chromatography of the N-chordin/Tsg crosslinking reaction...... 90 Figure 3-14 Ion exchange chromatography of the N-chordin/Tsg crosslinking reaction with a step gradient protocol...... 92 Figure 3-15 Purification of Tsg-FLAG...... 94 Figure 3-16 Crosslinking of N-chordin and Tsg-FLAG...... 95

Figure 3-17 Immunoprecipitation of the Tsg-FLAG/N-chordin crosslinking reaction. ...96 Figure 4-1. Cloning and expression of CHRDL2...... 101

7 Figure 4-2. Purification of CHRDL2...... 103 Figure 4-3 Analysis of CHRDL2 foldedness...... 104 Figure 4-4 Hydrodynamic analysis of CHRDL2...... 106 Figure 4-5 Analysis of CHRDL2 glycosylation...... 108 Figure 4-6 CHRDL2 secondary structure analysis...... 109 Figure 4-7 CHRDL2 Secondary structure prediction...... 111 Figure 4-8 The SAXS analysis pipeline...... 112 Figure 4-9 CHRDL2 SAXS analysis...... 114 Figure 4-10 CHRDL2 SAXS flexibility analysis...... 115 Figure 4-11 CHRDL2 SAXS shape analysis...... 116 Figure 4-12 CHRDL2 ab initio modelling...... 117 Figure 4-13 CHRDL2 EOM ensemble models...... 119 Figure 4-14 CHRDL2 ensemble modelling...... 120 Figure 4-15 Comparison of EOM analysis with full-length and C-terminally truncated CHRDL2 sequences...... 121 Figure 4-16 CHRDL2 solid phase binding assays...... 123 Figure 4-17 Binding of CHRDL2 to Tsg and BMP-4...... 125 Figure 4-18 CHRDL2 bio-layer interferometry...... 126 Figure 4-19 CHRDL2 cleavage assay...... 127 Figure 5-1 Formation of a CHRDL2/Tsg complex...... 131 Figure 5-2 SEC-MALS of the CHRDL2/Tsg complex...... 132 Figure 5-3 AUC of the CHRDL2/Tsg complex...... 133 Figure 5-4 CHRDL2/Tsg SAXS frame selection...... 135 Figure 5-5 SAXS analysis of the CHRDL2/Tsg complex...... 136 Figure 5-6 SAXS shape analysis of the CHRDL2/Tsg complex...... 137 Figure 5-7 Tsg SAXS analysis...... 138 Figure 5-8 Multiphase modelling of the CHRDL2/Tsg complex...... 140 Figure 5-9 Negative stain TEM of the CHRDL2/Tsg complex...... 141 Figure 5-10 Negative stain TEM three-dimensional reconstruction...... 142 Figure 5-11 Negative stain TEM resolution...... 143 Figure 5-12 Preliminary cryo-TEM of a CHRDL2/Tsg sample...... 144 Figure 5-13 Cryo-TEM data collection and processing summary...... 145 Figure 5-14 Purification of the CHRDL2/Tsg complex for cryo-TEM...... 146

8 Figure 5-15 Cryo-TEM of CHRDL2/Tsg after SEC purification...... 148 Figure 6-1 The interaction of Tsg with both BMP and chordin in the ternary complex. 153 Figure 6-2 Schematic of the chordin/Tsg/BMP ternary complex...... 155 Figure 6-3 Potential BMP-binding modes of CHRDL2...... 157 Figure 6-4 Potential binding modes of the CHRDL2/BMP/Tsg complex...... 160

List of tables

Table 2-1 Primers used for the generation of the Tsg-FLAG and chordin domain pCEP- Pu/Ac7 constructs...... 52 Table 4-1 Analysis of the CHRDL2 circular dichroism spectrum ...... 110 Table 5-1 Comparison of experimentally derived hydrodynamic parameters for CHRDL2 and the CHRDL2/Tsg complex ...... 134

9 List of abbreviations

C Degrees centigrade Å Angstrom

A280 Absorbance at 280 nm ADMP Anti-dorsalising morphogenetic protein AU Absorbance units AUC Analytical ultracentrifugation BAMBI BMP and Activin Membrane Bound Inhibitor BMP Bone morphogenetic protein BMPER BMP-binding endothelial regulator protein ME Beta-mercaptoethanol BS3 Bis(sulfosuccinimidyl)suberate BSA Bovine serum albumin CD Circular dichroism CHRD Chordin domains CHRDL1 Chordin-like 1 CHRDL2 Chordin-like 2 ConA Concanavalin A CMV Cytomegalovirus CTF Contrast transfer function CUB Complement/Uegf/BMP-1 CV Column volumes CV-2 Crossveinless-2 Da Daltons DAMMIF Dummy atom model minimisation fast Dpp Decapentaplegic

Dmax Maximum dimension

DMEM Dulbecco's modified eagle's medium DMSO Dimethyl sulphoxide DNA Deoxyribonucleic acid dRI Differential refractive index EBNA Epstein - Barr virus Nuclear Antigen I EDC 1-ethyl-3-(-3-dimethylaminopropyl)carbodiimide hydrochloride EDTA Ethylenediaminetetraacetic acid EF1α Elongation factor-1 alpha EOM Ensemble optimisation method ExPASy Expert Protein Analysis System

10 FACS Fluorescence activated cell sorting FBS Foetal Bovine Serum FSC Fourier shell correlation GDF Growth and Differentiation Factor HEK Human Embryonic Kidney HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

His6 Polyhistidine HRP Horseradish peroxidase IEC Ion exchange chromatography IgG Immunoglobulin G I(q) Scattering intensity kb kilobase kDa kilodalton

Kd Binding constant

LB Luria-Bertani MALS Multi-angle light scattering MES 2-(N-morpholino)ethanesulphonic acid mg milligram mg/ml Milligrams per millilitre MOPS 3-(N-morpholino)propanesulphonic acid MWCO Molecular weight cut off MST Microscale Thermophoresis mTLD Mammalian tolloid mTLL-1 Mammalian tolloid-like 1 mTLL-2 Mammalian tolloid-like 2 NHS N-hydroxysuccinimide nm Nanometre nM Nanomolar NRMSD Normalised root mean square deviation NSD normalised spatial discrepancy PBS Phosphate buffered saline PCR Polymerase chain reaction PDDF Pair distance distribution function PEI Polyethylenimide PF1 Fibrillin-1 protein fragment 1 pI Isoelectric point PNGase F Peptide-N-glycosidase F PVDF Polyvinylidene difluoride

11 Rg Radius of gyration

Rh Hydrodynamic radius q Scattering vector RELION Regularised Likelihood Optimisation RFP Red fluorescent protein

S20,w Sedimentation coefficient corrected to pure water at 20 C SAXS Small angle X-ray scattering Scw Screw SD1 Subdomain 1 SD2 Subdomain 2 SDS Sodium dodecyl sulphate SEC Size exclusion chromatography SDS-PAGE Sodium dodecyl sulphate polyacrylamide gel electrophoresis SLRP Small leucine-rich repeat protein SNA Sambucus nigra lectin SPR Surface plasmon resonance TAE Tris-acetate EDTA buffer TBS Tris buffered saline TBS-T Tris buffered saline with Tween TEM Transmission electron microscopy Tsg Twisted gastrulation U Units of enzyme activity UEAI Ulex europaeus agglutinin I UV Ultraviolet V Volts v/v Volume per volume VVL Vicia villosa lectin vWC von Willebrand Factor C vWD von Willebrand Factor D WGA Wheat Germ agglutinin w/v Weight per volume Xlr Xolloid-related g Microgram l Microlitre M Micromolar g/ml Micrograms per millilitre 2 Chi-squared

12 Abstract

Structural Characterisation of Chordin Family Regulators and Their Interaction with Twisted Gastrulation

Bone morphogenetic protein (BMP) signalling is a critical signalling pathway in embryonic development and adult tissue homeostasis. Consequently, aberrant signalling is associated with a number of pathologies. In the extracellular matrix, the chordin family of proteins antagonise BMP signalling by preventing interaction of BMPs with their cognate receptors. Twisted gastrulation (Tsg) has a dual role in the modulation of the chordin and chordin-like proteins of this family, wherein Tsg exhibits both pro- and anti-BMP behaviour. Tsg interacts with both chordin and BMPs to form a chordin/BMP/Tsg ternary complex, enhancing the interaction of chordin with BMPs, to act in an anti-BMP manner. Tsg has also been shown to increase BMP antagonism by chordin-like 1 (CHRDL1) and chordin-like 2 (CHRDL2). Additionally, Tsg enhances the cleavage of chordin by tolloid proteinases, which results in chordin inactivation, to act in a pro-BMP manner. The mechanism behind the dual roles of Tsg is not known, and a Tsg-containing complex has not been previously structurally characterised. It is hypothesised that Tsg causes a conformational change in chordin. BMP point mutants suggest differences in the binding of BMPs to chordin and CHRDL2. Therefore, there may also be subtle differences in the modulation of chordin and chordin-like proteins by Tsg. This thesis aims to contribute to the understanding of the chordin family of BMP antagonists and their modulation by Tsg. This study identifies the chordin von Willebrand Factor C (vWC) 2 and vWC3 domains as the specific Tsg-binding region of chordin. This may place Tsg at the centre of the ternary complex, facilitating interactions with both chordin and BMPs. A chordin/Tsg complex could not be isolated for structural characterisation, and further stabilisation of the complex may be required. This thesis provides the first structural characterisation of CHRDL2. Furthermore, a CHRDL2/Tsg complex has been successfully isolated and investigated. Analytical ultracentrifugation, multi-angle light scattering, and small angle X-ray scattering were used to characterise CHRDL2 and the CHRDL2/Tsg complex. These indicate CHRDL2 exists as a monomer in solution, with an elongated conformation. CHRDL2 and Tsg appear to form a 1:1 complex in solution, with Tsg binding towards the end of CHRDL2, maintaining an overall elongated shape.

13 Declaration

No portion of the work referred to in the thesis has been submitted in support of an application for another degree or qualification of this or any other university or other institute of learning

i. The author of this thesis (including any appendices and/or schedules to this thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he has given The University of Manchester certain rights to use such Copyright, including for administrative purposes. ii. Copies of this thesis, either in full or in extracts and whether in hard or electronic copy, may be made only in accordance with the Copyright, Designs and Patents Act 1988 (as amended) and regulations issued under it or, where appropriate, in accordance with licensing agreements which the University has from time to time. This page must form part of any such copies made. iii. The ownership of certain Copyright, patents, designs, trademarks and other intellectual property (the “Intellectual Property”) and any reproductions of copyright works in the thesis, for example graphs and tables (“Reproductions”), which may be described in this thesis, may not be owned by the author and may be owned by third parties. Such Intellectual Property and Reproductions cannot and must not be made available for use without the prior written permission of the owner(s) of the relevant Intellectual Property and/or Reproductions. iv. Further information on the conditions under which disclosure, publication and commercialisation of this thesis, the Copyright and any Intellectual Property and/or Reproductions described in it may take place is available in the University IP Policy (see http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=2442 0), in any relevant Thesis restriction declarations deposited in the University Library, The University Library’s regulations (see http://www.library.manchester.ac.uk/about/regulations/) and in The University’s policy on Presentation of Theses

14 Acknowledgements

Firstly, I would like to thank my supervisor Professor Clair Baldock for her support and advice over the course of this project. Having a supervisor so approachable, patient and communicative has been invaluable. I would also like to acknowledge my advisor Professor Hilary Ashe and my postgraduate tutor Dr. Caroline Milner. I would like to thank all the facilities that have been used in this thesis, and the incredible staff that enable their use. Thanks to the University of Manchester electron microscopy facility, mass spectrometry facility, and the biomolecular analysis facility, particularly to Dr. Thomas Jowitt, Ms. Diana Ruiz and Dr. Paul Mould for their training and support. Thank you to Diamond Light Source for time on Beamline 21 for the SAXS studies, and thank you to the Beamline 21 staff for sharing their insight and enthusiasm for SAXS. I would also like to thank Dr. Michael Lockhart-Cairns and Dr. Alan Godwin for their help and patience with the SAXS and EM work in this thesis.

I would like to thank all members of the Baldock lab, past and present, and my friends throughout my PhD. They have been a welcome distraction and a great support network. Finally, I would like to thank my family for their love and continuous support throughout the PhD. Thank you to my siblings Colin, Ruth, John and Michael for their encouragement. Most of all I would like to thank my parents for their patience and support, and for providing much needed weekends of solace in Cardiff.

This work was funded by the Wellcome Trust.

15 1 Introduction

Bone Morphogenetic Protein (BMP) signalling influences a large variety of cellular processes during embryonic development and in adult tissues. Consequently, aberrant BMP signalling is associated with a number of pathologies. BMP signalling is tightly regulated in the extracellular matrix. Chordin binds BMPs, preventing their interaction with receptors (Larrain et al., 2000, Zhang et al., 2007). The activity of chordin is further modulated by other secreted proteins. Twisted gastrulation (Tsg) and tolloid proteinases work with chordin in the regulation of BMP signalling. Cleavage of chordin by tolloid proteinases ablates BMP antagonism (Piccolo et al., 1997). Tsg interacts with BMPs and chordin to form a Tsg/chordin/BMP ternary complex, and plays a dual role in BMP regulation. Tsg acts as an anti-BMP factor by enhancing the chordin/BMP interaction. Tsg also has a pro-BMP role through its enhancement of chordin cleavage by tolloid proteinases (Larrain et al., 2001). Due to their BMP regulatory roles, chordin and Tsg are required for proper embryonic development and adult tissue homeostasis. This thesis investigates the regulation of BMP signalling by chordin and chordin-like proteins, and their modulation by Tsg.

1.1 Bone Morphogenetic Protein signalling BMPs are highly conserved factors in the extracellular matrix that signal through their cognate receptors, activating intracellular signalling pathways that ultimately bring about changes in gene expression. They act on a large number of cells to influence their behaviour, and their functionality is highly diverse. BMPs were first discovered for their capacity to induce bone formation, however, BMPs display very different osteogenic capacities (Cheng et al., 2003). Furthermore, BMPs are involved in many developmental stages, including dorsoventral patterning, the development of various organs, and limb formation (Luo et al., 1995, Winnier et al., 1995, Kim et al., 2001, Bandyopadhyay et al., 2006). Due to their influence in the differentiation and proliferation of a wide variety of cell types, BMPs are also important for adult tissue homeostasis (He et al., 2004, Bond et al., 2012, Nag et al., 2017). As such, aberrant signalling is associated with a wide range of congenital and non-congenital disorders. Changes in BMP signalling are associated with a number of cancers, vascular diseases, and bone disorders (Cai et al., 2012, Wakefield and Hill, 2013, Salazar et al., 2016).

1.1.1 BMPs and receptor binding

BMPs are the largest subgroup of the Transforming Growth Factor- superfamily, with 15 members, categorised by phylogeny. The BMP clade consists of BMPs, and Growth and Differentiation Factors (GDFs), however not all BMPs and GDFs are in the BMP

16 subgroup. BMP-3, GDF-8, GDF-10 and GDF-11 are in the activin subgroup (Hinck et al., 2016). Within this thesis, BMPs refer to members of the BMP subgroup. The BMP subgroup can further be sorted into six subtypes based on sequence homology: BMP-2 and BMP-4; BMP-5, BMP-6, BMP-7 and BMP-8; GDF-5, GDF-6 and GDF-7; BMP-9 and BMP-10; GDF-1 and GDF-3; and BMP-15 and GDF-9 (Carreira et al., 2014). BMPs show high sequence homology, and structural conservation. BMPs are synthesised as proproteins, consisting of an N-terminal prodomain and a C-terminal growth factor domain that binds BMP receptors for signalling. After synthesis, most BMPs are cleaved at sites between the prodomain and growth factor domain during secretion, and in most cases the prodomains remain non-covalently bound to the growth factor domains. Currently, only the growth factor domain of BMP-2 is known to not form a stable complex with its prodomain (Brown et al., 2005, Sengle et al., 2008a).

Many functions have been proposed to explain the evolutionary conservation of the larger prodomain. These include its requirement for the proper folding and dimerization of the growth factor domains, and a role in the regulation of the growth factor activity. The effect of prodomain binding on activity is specific to each BMP. Many BMPs remain active when bound to their prodomains, as the prodomains are easily displaced by BMP receptors (Sengle et al., 2008b). In some cases, the prodomain confers latency of the BMP, and BMP activation requires cleavage of the prodomain (Sengle et al., 2011). Some prodomains target BMPs to extracellular components, such as perlecan and fibrillin, regulating the bioavailability of bound BMPs. Furthermore, this targeting can also affect BMP activity. BMP-7 remains active when bound to its prodomain, however binding of the prodomain to fibrillin, induces a conformational change in the prodomain/growth factor complex and confers latency on BMP-7 (Wohl et al., 2016). Mature BMPs function as dimers that are disulphide linked in the growth factor domains. The monomers have an α-helix on one side, a cystine knot core and two double- stranded β-sheets projecting away from the core, laterally opposite to the α-helix. The monomer shape is commonly referred to as a hand (Figure 1-1A). The monomers dimerise with the α-helix ‘wrist’ of each monomer sitting in the cystine knot ‘palm’ of the other monomer, so that the β-sheet ‘fingers’ project away from the centre of the dimer (Figure 1-1B). A disulphide bond stabilises the hydrophobic interface between the monomers. This structure is highly conserved and is seen in the crystal structures of BMP-2, -3, -6 and -7 (Scheufler et al., 1999, Groppe et al., 2002, Allendorph et al., 2007).

BMP dimers signal through type I and type II receptors. Signalling is initiated by BMP binding to heterotetrameric receptor complexes consisting of two type I and two type II receptors (Figure 1-1C). Each BMP dimer has four receptor binding sites that

17 predominantly form a hydrophobic interface with BMPs (Kirsch et al., 2000, Allendorph et al., 2006). Type I receptors bind in the wrist region of the BMP dimers, and interact with residues from both BMP monomers. Type II receptors interact with the knuckle region of BMPs, interacting with residues from a single BMP monomer (Allendorph et al., 2006).

Figure 1-1 BMP structure and interaction with receptors. (A) The BMP monomer structure is described as a hand, with an α-helix wrist on one side, a cystine knot core and two double- stranded β-sheet fingers projecting away from the core. The residues forming the cystine knot core are depicted in blue. (B) The monomers dimerise with the α-helix wrist of each monomer sitting in the cystine knot palm of the other monomer, so that the β-sheet ‘fingers’ project away from the centre of the dimer. Annotated are the wrist and knuckle regions which interact with BMP receptors. (C) The crystal structure of the BMP-2 dimer bound to the ectodomains of the BMPRIa and ActRII, type I and type II receptors, respectively. The type I receptor interacts with the wrist region, and the type II receptor interacts with the knuckle region. (PDB ID: 2H62) (Allendorph et al., 2006).

1.1.2 BMP signalling pathways

Following receptor activation, the kinase domain of type I receptors is phosphorylated by type II receptors, initiating an intracellular signalling cascade. The kinase domain of activated type I receptors phosphorylates receptor-activated Smads (R-Smads), facilitating association with Smad-4 in the cytosol. The R-Smad/Smad-4 complex is able to translocate into the nucleus and bind specific promoter elements to alter gene transcription (Figure 1-2) (Dernyk and Zhang, 2003). The type I receptor activated determines the signalling pathway initiated (Persson et al., 1998). BMPs activate the Smad-1, -5, -8 signalling pathway, in which binding to the BMPRIa, BMPRIb, Alk1, and Alk2 type I receptors activates the Smad-1, Smad-5, and Smad-8 R-Smads. A small subset of BMPs initiate the Smad-2, -3 signalling pathway in which binding to the ActRIb type I receptor activates Smad-2 and Smad-3 R-Smads (Mazerbourg et al., 2004). Furthermore, BMPs have also been observed to activate non-Smad signalling pathways. BMP-2 has been implicated in the activation of the phosphatidylinositol 3- kinase/Akt pathway (Ghosh-Choudhury et al., 2002) and mitogen-activated protein kinase signalling pathways (Guicheux et al., 2003).

Figure 1-2 The canonical BMP signalling pathway. In the active BMP ligand/receptor signalling complex type II receptors phosphorylate type I receptors. Type I receptors then phosphorylate receptor-activated Smads (R-Smads), which then associate with Smad-4. The p-R-Smad/Smad-4 complex translocates into the nucleus and binds to BMP response elements to influence gene transcription.

Due to its extensive role in embryonic development and adult tissue homeostasis, BMP signalling is heavily regulated. This includes the regulation of BMPs in the extracellular matrix by antagonists that modulate the BMP ligand/receptor interaction. A number of structurally diverse protein families contribute to BMP regulation via this mechanism. These include noggin, the follistatin family, and the chordin family (Groppe et al., 2002, Zhang et al., 2008, Cash et al., 2009).

1.2 The chordin family of BMP antagonists Chordin is an evolutionarily conserved glycoprotein in the extracellular matrix that antagonises BMP signalling (Srivastava et al., 2008). Chordin binds BMPs via its von Willebrand Factor C (vWC) domains, preventing the interaction of BMPs with their cognate receptors (Figure 1-3) (Larrain et al., 2000, Zhang et al., 2007).

Figure 1-3 Chordin antagonism of BMPs. Chordin binds BMPs in the extracellular matrix and prevent interaction of the BMP dimer with BMP receptors. The BMP dimer is depicted in red, chordin is depicted in blue and purple, and the BMP receptors are depicted in yellow, pink and purple.

Following identification of chordin, sequence homology searches, and Drosophila and Xenopus mutant screens led to the identification of other proteins that contain vWC domains and regulate BMP signalling. Chordin-like 1 (CHRDL1) and chordin-like 2 (CHRDL2) antagonise BMP signalling, and sequence analysis predicts they each have three vWC domains (Nakayama et al., 2001, Sakuta et al., 2001, Nakayama et al., 2004). The regions outside the vWC domain sequences show no homology to sequences of known fold. Crossveinless-2 (CV-2), also known as BMP-binding endothelial regulator protein (BMPER) in humans, and kielin are also vWC domain containing BMP regulators (Conley et al., 2000, Matsui et al., 2000). However, kielin also contains a von Willebrand Factor D (vWD) domain and a thrombospondin domain, and CV-2 contains a vWD domain and a trypsin-like inhibitor domain (Matsui et al., 2000, Coffinier et al., 2002). These domains are not observed in chordin, and so kielin and CV-2 are not considered chordin-like. Collectively, chordin, CHRDL1, CHRDL2, kielin, and CV-2 are often referred to as the chordin family.

1.2.1 Chordin and chordin-like protein structures

Chordin consists of four vWC domains, and four CHRD domains. The CHRD domains are between the vWC1 and vWC2 domains, and are collectively referred to as the 4CHRD region (Figure 1-4A). The vWC domains are the functional modules of the

21 protein, mediating the binding of chordin to BMPs and BMP antagonism (Larrain et al., 2000). vWC domains are characterised by a conserved pattern of ten cysteine residues that includes the C2XXC3XC4 and C8C9XXC10 motifs, and are not exclusive to the chordin family (Figure 1-4B) (Garcia Abreu et al., 2002). The vWC domains of the chordin family adhere to this conserved pattern of cysteines, however, vWC domains have been identified in other protein sequences with slight variations in the spacing of cysteines in these motifs (Zhou et al., 2012). The role of the CHRD domains in chordin is not known, and any biological activity is yet to be demonstrated. Extensive database searches have shown the CHRD domains, characterised by a conserved C-terminal GE[I/L]RGQ[V/I/L] motif, are only present in chordin and some microbial proteins (Hyvonen, 2003). Electron microscopy and SAXS have revealed chordin to have a horseshoe-like conformation (Figure 1-4C). Comparison of the structures of full-length chordin with truncated constructs indicates the vWC domains form the prongs of the horseshoe, and so this conformation would bring the N-terminal and C-terminal vWC domains into close proximity in three-dimensional space (Troilo et al., 2014). Human chordin has four predicted N-glycosylation sites, all within the CHRD domains, and it has been experimentally shown that human chordin is N-glycosylated (Troilo et al., 2014). Two of these sites are conserved across vertebrates and invertebrates, Xenopus chordin has an additional predicted site between vWC3 and vWC4, and the Drosophila homolog Sog has an additional predicted site between vWC2 and vWC3. N- glycosylation may have a functional role, as Sog glycosylation mutants show altered BMP-antagonism (Negreiros et al., 2018). CHRDL1 and CHRDL2 both have three vWC domains, with long linkers between vWC2 and vWC3, and a long C-terminal tail (Figure 1-4A). The structures of the vWC2-3 linker and the C-terminal tail are not known, and they lack homology with sequences of known fold (Nakayama et al., 2001, Nakayama et al., 2004). CHRDL1 and CHRDL2 sequences have been identified in mice, rats and humans (Nakayama et al., 2001, Sakuta et al., 2001, Nakayama et al., 2004). A protein with the same domain arrangement and high homology to both CHRDL1 and CHRDL2 has been identified in zebrafish (Branam et al., 2010). CHRDL1 has two predicted N-glycosylation sites, one in its vWC2 domain, and one it is vWC3 domain (Nakayama et al., 2001). CHRDL2 has a single predicted N- glycosylation site in its vWC2 domain (Nakayama et al., 2004). Recombinantly expressed CHRDL2 is of larger mass than that predicted from the peptide sequence, and this may be due to protein glycosylation (Nakayama et al., 2004, Oren et al., 2004). The structures of CHRDL1 and CHRDL2 are not known. Though they have been expressed recombinantly, analysis of these proteins has been limited to binding studies and cleavage assays (Nakayama et al., 2001, Sakuta et al., 2001, Nakayama et al., 2004, Zhang et al., 2007, Larman et al., 2009, Branam et al., 2010).

Figure 1-4 Chordin family structures. (A) Schematic of the domain structures of chordin, CHRDL1 and CHRDL2 with the number of amino acids in each sequence shown. The vWC domains are depicted in blue and CHRD domains are depicted in purple. Tolloid proteinase cleavage sites and predicted N-glycosylation sites are annotated. (B) Sequence alignment of the vWC1 domains of chordin, CHRDL1 and CHRDL2, showing the conserved C2XXC3XC4 and C8C9XXC10 motifs of vWC domains. Cysteine residues are highlighted in red. Alignment performed in Clustal Omega (Sievers et al., 2011), and annotated in Jalview (Waterhouse et al., 2009). (C) The electron microscopy structure of chordin, with the likely positions of the CHRD (purple) and the vWC domains (green/blue) docked into the structure (middle). Taken from (Troilo et al., 2014). Also shown (lower right) is a schematic of the prospective chordin domain arrangement.

23 1.2.2 BMP binding by chordin and chordin-like proteins

Chordin, CHRDL1 and CHRDL2 directly interact with BMPs (Nakayama et al., 2001, Zhang et al., 2007). Binding analyses with chordin and CHRDL2 indicate this is a high affinity interaction (Zhang et al., 2007). The vWC domains are responsible for BMP interactions, however, not all vWC domains of the antagonists contribute to BMP binding. The direct binding of chordin to BMP-2, BMP-4, BMP-7, GDF-5 and the Xenopus BMP anti-dorsalising morphogenetic protein (ADMP) has been established, and chordin has been shown to prevent the interactions of BMP-2, BMP-4 and ADMP with BMP receptor ectodomains in vitro (Piccolo et al., 1996, Larrain et al., 2000, Reversade and De Robertis, 2005, Zhang et al., 2007, Troilo et al., 2014). BMPs interact with vWC domains at both the N- and C-terminal regions of chordin, with binding affinities similar to that of full-length chordin. All BMPs investigated have shown high affinity interaction with the N-terminal vWC1 domain. However, BMPs show different binding preferences for vWC domains in the chordin C-terminal region. BMP-2 and BMP-4 bind vWC3 with high affinity, whereas BMP-7 binds vWC4 with high affinity (Larrain et al., 2000, Zhang et al., 2007). The C-terminal vWC binding preference may therefore be a characteristic of BMP sub-family. Sequence analysis of the human, mouse, chicken, Xenopus, zebrafish and Drosophila chordin homologs reveals the individual vWC domains are highly conserved between species, more so than the different chordin vWC domains within each species, and so binding preferences are likely to be conserved between species (Garcia Abreu et al., 2002). On the basis of crosslinking studies, a 1:1 binding stoichiometry has been predicted for chordin and the BMP dimer (Oelgeschlager et al., 2000). The horseshoe conformation of chordin brings its N-terminal and C-terminal vWC domains into close proximity (Troilo et al., 2014), explaining how the BMP dimer can be bound simultaneously by vWC domains at the chordin termini, whilst maintaining a 1:1 binding stoichiometry. This would enable a single chordin molecule to mask the receptor binding sites on both halves of the BMP dimer. Furthermore, a cooperative binding model may stabilise the BMP-chordin complex and increase potential steric interference of the BMP ligand/receptor interaction by chordin.

The BMP binding capacities of CHRDL1 and CHRDL2, and the prevention of the BMP ligand/receptor interaction have also been demonstrated. Co-immunoprecipitation experiments have shown CHRDL1 binds BMP-4, BMP-5, BMP-6, and BMP-7, and can prevent binding of BMP-4 to the BMPRIb ectodomain (Nakayama et al., 2001, Sakuta et al., 2001, Larman et al., 2009). CHRDL2 binds BMP-2, BMP-4, BMP-5, BMP-6, BMP-7 and GDF-5, and has been shown to prevent the binding of BMP-2 and BMP-4 with type I and type II BMP receptor ectodomains (Nakayama et al., 2004, Zhang et al., 2007). In contrast to chordin, SPR investigations indicate that different BMPs show the same

24 vWC domain binding preferences for CHRDL2. BMP-2, BMP-7 and GDF-5 all interact with the vWC1 and vWC3 domains, but not the vWC2 domain, of CHRDL2 (Zhang et al., 2007). Whereas chordin appears to bind the BMP dimer at a 1:1 stoichiometry, CHRDL2 is predicted to bind the BMP dimer in a 2:1 antagonist:BMP dimer ratio on the basis of gel filtration and SPR investigations, however a CHRDL2/BMP complex has not been characterised to confirm this (Zhang et al., 2007). SPR screens with BMP-2 mutants suggest both the vWC1 and vWC3 domains of CHRDL2 contribute to BMP binding in the full-length CHRDL2 (Zhang et al., 2007). However, it is not known if CHRDL2 spans both monomers of the BMP dimer, as is hypothesised for chordin.

1.2.3 The interaction between vWC domains and BMPs

X-ray crystallography and NMR structures of vWC domains from CV-2, collagen IIA and CCN3 reveal they have a tripartite structure consisting of an N-terminal region, subdomain 1 (SD1) and sub-domain 2 (SD2) (Figure 1-5A). In all these structures, SD1 forms a short three-stranded antiparallel -sheet, whereas the SD2 structure is variable. The SD2 of the CCN3 vWC domain has a short three-stranded antiparallel -sheet, the SD2 of CV-2 vWC1 has a short two-stranded antiparallel -sheet, and the SD2 of the collagen IIA vWC domain has no regular secondary structure. The N-terminal region is also variable between these structures. The N-terminal region of the collagen IIA and CCN3 vWC domains forms a -hairpin that is stabilised relative to SD1 by a - stacking interaction with SD1 (Figure 1-5B) (Xu et al., 2017). The N-terminal region of the CV-2 vWC1 domain, referred to as the ‘clip’, has an extended conformation that is constrained via a disulphide bond to SD1 (Figure 1-5B) (Zhang et al., 2008). All the vWC domains show the same disulphide bonding patterns. The SD1 and SD2 subdomains are arranged end-to-end in three-dimensional space, giving the vWC domain an overall rod-like structure (Zhang et al., 2008, Xu et al., 2017). The crystal structure of the zebrafish CV-2 vWC1 domain bound to BMP-2 has provided insights into interactions between vWC domains and BMPs, and how this occludes receptor binding (Figure 1-5C) (Zhang et al., 2008). The vWC domain interacts with BMP-2 via two sites, with a single vWC domain able to mask both the type I and type II receptor binding sites in each half of the BMP dimer. The N-terminal ‘clip’ of the CV-2 vWC1 domain interacts with BMP-2 via main chain hydrogen bonds, and masks most of the hydrophobic patch that forms the type I receptor binding interface in the BMP ‘wrist’. SD1 forms a hydrophobic interface with BMP-2, with the bulk of the interactions coming from a cluster of hydrophobic residues formed by the 12 loop, and  strands 2 and 3 of SD1. This is enabled by the first strand of SD1 forming an extended loop. This cluster

25 of residues masks many of the hydrophobic residues that form the type II receptor binding site in the BMP ‘knuckle’ of BMP-2.

Figure 1-5 Structure of vWC domains and interaction with BMP-2. (A) The crystal structures of the vWC1 domain of zebrafish CV-2 (dark blue, left) and the vWC domain of human collagen IIA (light blue, right). These vWC domains show a common tripartite structure of an N-terminal region, subdomain 1 (SD1) and subdomain 2 (SD2). The N-terminal region has an extended conformation in the CV-2 vWC1 domain, and form a -hairpin in the collagen IIA vWC domain. (B) Enlarged views of the N-terminal regions and SD1 of the zebrafish CV-2 vWC1 domain (left) and the collagen IIA vWC domain (right). Shown in yellow on zebrafish CV-2 vWC1 domain are the cysteine residues of the ‘clip’ and the SD1 subdomain that form a disulphide bond, restraining the ‘clip’. Shown on the collagen IIA domain are the residues of the -hairpin and SD1 that form a - stacking interaction. (C) The Zebrafish CV-2 vWC1 interacts with each BMP monomer in BMP-2 via two binding sites. The N-terminal ‘clip’ interacts with the BMP wrist region, masking residues of the type I receptor binding site. SD1 forms a large interface, comprised mainly of residues from the 12 loop, and  strands 2 and 3, that interacts with the BMP knuckle region, masking residues of the type II receptor binding site. (BMP-2/Zebrafish CV-2 vWC1 complex PDB ID: 3BK3. Collagen IIA vWC PDB ID: 5NIR).

26 1.2.4 Variation in the BMP interaction within the chordin family

There is evidence that the BMP binding mechanism may differ for the vWC domains of different members of the chordin family. Though the vWC1 N-terminal ‘clip’ of CV-2 is required for high affinity binding of CV-2 to BMP-2, and is highly conserved between the CV-2 homologs of vertebrate and invertebrates, sequence alignments indicate the ‘clip’ is absent from the vWC domains of other proteins (Zhang et al., 2008). Indeed, both BMP-binding regions of the CV-2 vWC domain are missing in the crystal structure of the collagen IIA vWC domain, which is able to bind BMPs. The collagen IIA vWC domain N- terminal region forms a -hairpin rather than adopting an extended conformation as in the CV-2 vWC1 domain ‘clip’. Additionally, screens of BMP-binding mutants revealed the SD1 residues that bind BMPs are on the opposite face of the collagen IIA vWC subdomain to those in the CV-2 SD1 (Xu et al., 2017). This may be due to the - stacking interaction between the -hairpin and SD1 making it preferable to interact with BMPs on the opposite face of SD1 (Figure 1-5B).

The structures of vWC domains from chordin and CHRDL2 are yet to be determined, however, it has been suggested that chordin and CHRDL2 vWC domains may bind BMPs via yet another mechanism. Whilst it has been shown that the SD1 subdomains of the chordin and CHRDL2 vWC domains are responsible for BMP binding, little is known regarding the molecular details of this interaction (Fujisawa et al., 2009). These vWC domains appear to possess elements of both the solved vWC domain structures from CV-2 and collagen IIA. Residues within the the predicted first strand of SD1 are involved in BMP binding (Fujisawa et al., 2009), and sequence analysis shows the chordin and CHRDL2 vWC domains have a 7-10 residue insertion in the predicted first strand of the SD1 that may form an extended loop, as in the CV-2 vWC1 domain (Zhang et al., 2007, Xu et al., 2017). However, sequence analyses indicate the N-terminal ‘clip’ of the CV-2 vWC domain is not conserved in the vWC domains of chordin and CHRDL2 (Zhang et al., 2008). In addition, the residues that form the - stacking interaction that stabilise the collagen IIA vWC N-terminal hairpin are conserved in the chordin and CHRDL2 vWC domains (Xu et al., 2017). Therefore, it is not clear if the N-terminal region of the CHRDL2 and chordin vWC domains contribute to BMP binding.

Binding screens with BMP-2 point mutants have also alluded to potential differences in BMP binding between the vWC domains of chordin and CHRDL2. The same mutations in the BMP knuckle epitope reduce binding of the chordin vWC1 and vWC3 domains, and the CHRDL2 vWC1 domain. These mutations did not affect binding of the CHRDL2 vWC3 domain. However, mutations were identified in the BMP wrist epitope that only affected binding of the CHRDL2 vWC3 domain (Zhang et al., 2007). Therefore, despite the individual vWC domains and full-length proteins displaying similar BMP binding

27 affinities, there are differences in the specific binding epitopes on BMPs. This may be functionally significant, as it may enable subtle differences in the BMP antagonism exerted by chordin and CHRDL2, and may allow differential regulation of these antagonists by other factors.

1.2.5 Regulation of chordin activity

Chordin activity is ablated by cleavage by tolloid proteinases, and tolloids play a key role in the regulation of BMP signalling through this action. Chordin is cleaved by tolloid proteinases at two sites that are highly conserved across vertebrates and invertebrates. Prior digestion of chordin by the Xenopus tolloid homolog ablates its ability to induce dorsalisation when injected into Xenopus embryos, a functional read-out of BMP inhibition (Piccolo et al., 1997). Tolloid proteinases are highly conserved between arthropods and vertebrates, and are involved in the processing of a range of extracellular matrix proteins (Hopkins et al., 2007). Tolloid proteinases have an N- terminal protease domain, followed by non-catalytic CUB (Complement/Uegf/BMP-1) and epidermal growth factor like (EGF) domains. The non-catalytic domains are believed to determine the specificity and efficiency of tolloids (Wermter et al., 2007, Berry et al., 2010). Tolloid cleavage sites lack a consensus sequence, however, in most substrates an aspartate residue is at the P1’ position (Hopkins et al., 2007). There are four known mammalian tolloids that cleave chordin with varying efficiencies: BMP-1, mammalian Tolloid (mTLD), mammalian Tolloid-like 1 (mTLL-1), and mammalian Tolloid-like 2 (mTLL-2) (Scott et al., 1999). BMP-1 is the most efficient tolloid proteinase, lacking the three C-terminal non-catalytic domains of mTLD, mTLL-1 and mTLL-2 which are responsible for dimerisation and substrate exclusion of mTLD and mTLL-1, and substrate specificity of mTLL-2 (Berry et al., 2010, Bayley et al., 2016).

Chordin has two highly conserved tolloid cleavage sites towards the N- and C-termini (Figure 1-6A). A cleavage site between the vWC1 domain and the 4CHRD region releases the vWC1 domain, and a cleavage site between the vWC3 and vWC4 domains removes the vWC4 domain, and cleavage at both sites is required to ablate chordin antagonism (Figure 1-6B) (Piccolo et al., 1997). Whereas tolloid proteinases can cleave chordin in the absence of other factors in vertebrates (Piccolo et al., 1997, Scott et al., 2001, Troilo et al., 2014), in the Drosophila system the chordin homolog Sog is only cleaved when bound to BMPs (Marques et al., 1997). The cleavage of chordin by tolloid proteinases is enhanced in the extracellular matrix by Tsg, this is discussed in more detail in section 1.4.

Figure 1-6 Tolloid cleavage of chordin. (A) Chordin has two tolloid cleavage sites, indicated by red arrows. An N-terminal cleavage site exists between the vWC1 domain and the 4CHRD region, and a C-terminal cleavage site exists between the vWC3 and vWC4 domains. The vWC domains are depicted in blue and the 4CHRD region is depicted in purple. (B) Cleavage of chordin by tolloid proteinases releases the N- and C-terminal vWC domains for interaction of the BMP ligand with receptors.

Cleavage fragments retain varying levels of BMP antagonistic capacity. Chordin retains significant antagonistic activity following cleavage of a single vWC domain from either terminus. However, there are differences in the activities of truncated chordin against specific BMPs. ΔN-chordin, chordin without the vWC1 domain, shows similar antagonistic activity against BMP-4, but has decreased activity against BMP-7 compared to the full-length protein. Whereas ΔC-chordin, chordin without the vWC4 domain, displays similar activity against BMP-7, and increased antagonistic capacity against BMP-4 (Troilo et al., 2014). This may allow tolloids to fine-tune BMP-4 or BMP-7 signalling by cleaving chordin at a single site. ΔC-chordin and ΔN-chordin have similar high affinities for BMP-4 and BMP-7, comparative to those of full-length chordin. They also show no gross conformational change compared to the horseshoe shape of full- length chordin (Troilo et al., 2014). This may explain the retained activity of ΔN-chordin,

29 as despite only binding to BMPs via its C-terminal region it could still sterically interfere with receptor interaction in the other half of the BMP dimer. The RNA of three chordin splice variants has been detected in foetal and adult human tissues, in a tissue specific manner. These splice variants would encode C-terminally truncated proteins, and two were found to exhibit BMP antagonism when mRNA of each construct was injected into Xenopus embryos. These active variants both encoded complete vWC1 domains, whereas the non-biologically active variant only encoded part of the vWC1 domain (Millet et al., 2001). Therefore, truncated chordin species may play roles in BMP-antagonism in vivo. The biological activity of truncated chordin species has also been analysed in other species. Consistent with the human proteins, zebrafish constructs that are resistant to cleavage at the C-terminal site show a small reduction in antagonism, whilst constructs that are resistant to cleavage at the N-terminal site show an increase in antagonism (Xie and Fisher, 2005). This ΔC-chordin species may be important in BMP regulation in vivo as it appeared at similar levels to full-length chordin in the zebrafish embryo (Xie and Fisher, 2005). In Drosophila, C-terminal truncation of the chordin homolog Sog increases in vivo BMP inhibitory activity, and results in phenotypes that resemble loss of the BMP homolog Decapentaplegic (Dpp). This construct, termed Supersog, contains vWC1 and the four CHRD domains. Removal of the vWC1 domain from Supersog completely ablates its inhibitory activity (Yu et al., 2000). Together these studies suggest the large fragments generated by partial tolloid cleavage of chordin may play important regulatory roles in vivo that are conserved across vertebrates and invertebrates. Although individual vWC domains can bind BMPs with similar high affinity to full-length chordin, they have significantly reduced antagonistic capacity, with five to ten times lower activity than full-length chordin in Xenopus embryo assays. The vWC1 and vWC3 domains can dorsalise Xenopus embryos when overexpressed, a phenotype associated with reduced BMP signalling, however, no such activity was observed for vWC2 and vWC4 (Larrain et al., 2000). The retention of some antagonistic capacity suggests other mechanisms may be involved in the inactivation of chordin. The observation of chordin internalisation in cell culture has led to the proposal that endocytic uptake is a mechanism of chordin regulation. These cell culture experiments suggest membrane- tethered CV-2 and integrin-3 both function to mediate chordin internalisation (Larrain et al., 2003, Kelley et al., 2009), and chordin cleavage fragments may be more rapidly removed from the extracellular matrix (Ambrosio et al., 2008). In Drosophila, endocytosis of the chordin homolog Sog contributes to its inactivation in the dorsal regions of the embryo (Srinivasan et al., 2002). Endocytosis may be a broad

30 mechanism of regulation of BMP antagonists in the extracellular matrix. Indeed, internalisation of gremlin and noggin has been described in vitro (Kelley et al., 2009). Little is known about the regulation of other chordin family members. Murine CHRDL1 is readily cleaved by all four mammalian tolloids between vWC2 and vWC3, whereas murine CHRDL2 is not cleaved by any of the mammalian tolloids (Branam et al., 2010). Other factors in the extracellular matrix may be required to facilitate cleavage, or another mechanism of regulation may be employed. The differences in the interaction of the CHRDL2 vWC3 domain with BMPs may alter competition between CHRDL2 and other extracellular matrix components, causing displacement of CHRDL2 from the BMP dimer to enable BMP signalling (Zhang et al., 2007). Internalisation may also contribute to the regulation of CHRDL2, as has been suggested for chordin.

1.3 The biological roles of chordin and chordin-like proteins 1.3.1 Embryonic dorsoventral patterning

During the development of vertebrates and invertebrates, an embryonic BMP signalling gradient patterns the dorsoventral axis. This is a highly conserved feature of dorsoventral specification, wherein the different levels of BMP signalling specify different cellular fates (Wharton et al., 1993, Neave et al., 1997, Ashe et al., 2000, Plouhinec et al., 2013). Due to the conservation of regulators and components of the BMP signalling pathway, the regulation of BMP signalling has been extensively studied in Drosophila and Xenopus.

In the Xenopus embryo, the BMP signalling gradient spans from high levels ventrally to the absence of BMP signalling dorsally (Plouhinec et al., 2013). Inhibition and low levels of BMP signalling induce neural fates in the ectoderm and mesoderm; increasing levels of BMP signalling induces kidney, muscle and blood in the mesoderm; and high levels induce epidermal fates in the ectoderm (Dosch et al., 1997, Wilson et al., 1997, Reversade et al., 2005). Chordin plays a key role in the establishment of the BMP signalling gradient by antagonising BMPs in the dorsal regions of the Xenopus embryo. The signalling gradient is established by the secretion of factors from two diametrically opposed signalling centres (Figure 1-7A). These signalling centres are under opposing transcriptional control, facilitating self-regulation and scalability of the gradient (Reversade and De Robertis, 2005, Plouhinec et al., 2013). The dorsal centre, commonly referred to as Spemann’s Organiser, acts to reduce BMP signalling by secreting the BMP antagonists chordin, noggin and follistatin (Smith and Harland, 1992, Sasai et al., 1994, Fainsod et al., 1997, Khokha et al., 2005). Indeed, when formation of the organiser is blocked, dorsal tissues are lost (Kelly et al., 2000). The dorsal centre also secretes ADMP when BMP signalling levels are low, acting as a

31 source of BMP should the ventral centre be impaired. Knock down of all four BMPs, BMP-2, BMP-4, BMP-7 and ADMP, is required for complete loss of ventral structures (Reversade and De Robertis, 2005).

The ventral centre establishes peak BMP signalling ventrally through the secretion of BMP-2, BMP-4, BMP-7, CV-2, Tsg, BMP and activin membrane bound inhibitor (BAMBI), Sizzled, and Xolloid-related (Xlr), a tolloid homolog (Fainsod et al., 1994, Dale et al., 2002, Reversade et al., 2005). Transcription of the ventral signalling centre genes is activated by BMP signalling (Reversade and De Robertis, 2005). This ensures high levels of BMP signalling are maintained at the ventral pole. The BMP antagonists Sizzled, BAMBI and CV-2 are also transcribed at the ventral signalling centre as part of a BMP4 synexpression group (Onichtchouk et al., 1999, Reversade et al., 2005). These act as feedback inhibitors of BMP activity, ensuring BMP activity does not reach excessive levels. Together, these centres establish a robust signalling gradient across the dorsoventral axis (Figure 1-7B).

Figure 1-7 The establishment of the Xenopus embryo BMP signalling gradient. (A) Schematic of dorsoventral BMP signalling gradient formation in the early Xenopus embryo. A BMP signalling gradient is established in the Xenopus embryo through the actions of opposing signalling centres at the dorsal and ventral poles of the embryo. The ventral signalling centre secretes BMP-2, BMP-4, BMP-7, CV-2, Tsg, BMP and activin membrane bound inhibitor (BAMBI), Sizzled and the tolloid homolog Xolloid-related (Xlr), to establish peak BMP signalling ventrally. The dorsal centre secretes the BMP antagonists chordin, noggin and follistatin, to antagonise BMP signalling dorsally. ADMP is also secreted from the dorsal centre when BMP signalling levels are very low. (B) The dorsoventral BMP gradient of the Xenopus embryo, visualised with immunofluorescence of pSmad-1/5/8. Taken from Plouhinec et al., 2013. (C) The reciprocal chordin dorsoventral gradient in the space between the ectoderm and mesoderm, visualised with immunofluorescence of chordin. Taken from Plouhinec et al., 2013.

Chordin is a critical factor in dorsoventral axis formation during Xenopus development, and acts as a dorsalising factor via its ability to inhibit BMPs. Chordin is capable of diffusing and forms a reciprocal gradient to BMPs along the dorsoventral axis (Figure 1-7C) (Plouhinec et al., 2013). This gradient forms in the space between the ectoderm and mesoderm, a cavity observed in all vertebrate embryos. Morpholino knock down of chordin results in expansion of the ventral mesoderm and reduces the size of dorsal features such as head structures, phenotypes that indicate an increase in BMP signalling (Oelgeschlager et al., 2003a). These phenotypes are enhanced by combined chordin, noggin and follistatin morpholino injection, supporting there being functional

33 redundancy in BMP antagonism by these factors (Khokha et al., 2005). The tolloid inactivation of chordin in the ventral regions of the embryo is also critical to the proper establishment of the BMP signalling gradient. Depletion of Xlr increases chordin protein levels, and decreases nuclear pSmad1/5/8 levels, resulting in dorsalised phenotypes (Inomata et al., 2008, Plouhinec et al., 2013). These factors are conserved in zebrafish, and are required for proper formation of the BMP signalling gradient along the dorsoventral axis. Genetic screens for mutations affecting dorsoventral patterning identified homologs of BMP-2, BMP-7, tolloid, chordin, sizzled, and ADMP (Schier and Talbot, 2005). Mutation of chordin causes the loss of dorsal tissues due to increased BMP signalling, whereas embryo dorsalisation is observed in BMP and tolloid mutants (Hammerschmidt et al., 1996, Schulte-Merker et al., 1997, Wagner and Mullins, 2002). Chordin-like, a protein homologous to CHRDL1 and CHRDL2, has been identified in zebrafish. Consistent with a biological role as a BMP antagonist, zebrafish chordin-like dorsalises the embryo when overexpressed, however milder phenotypes are observed than with chordin overexpression. Chordin- like is cleaved by BMP-1, and concomitant overexpression of BMP-1 with chordin-like rescues the dorsalised embryos. Zebrafish chordin-like appears to act redundantly with chordin in embryonic development, as morpholino knock-down of both chordin and chordin-like produces ventralised phenotypes more severe than when either is targeted alone (Branam et al., 2010). Chordin-like sequences have not been reported in Xenopus, however, high functional conservation exists between chordin and these proteins, as injection of murine CHRDL1 and CHRDL2 mRNA induces secondary dorsoventral axes in Xenopus embryoes, as has been observed with chordin mRNA injection (Sasai et al., 1994, Nakayama et al., 2001, Nakayama et al., 2004). The dorsoventral BMP signalling gradient is inverted in Drosophila; peak BMP signalling occurs dorsally and BMP signalling is absent in ventral regions (Ferguson and Anderson, 1992). The chordin homolog short gastrulation (Sog) is crucial to establishing the dorsoventral signalling gradient (Francois et al., 1994). Sog mutants display loss of the neuroectoderm, a tissue specified by the absence of BMP signalling in ventral regions (Biehs et al., 1996). Sog is highly homologous to vertebrate chordin and is able to inhibit BMP signalling when injected into Xenopus, promoting dorsal fates (Holley et al., 1995). Hence, chordin and chordin-like proteins play conserved critical roles in establishing the dorsoventral BMP signalling gradient to ensure proper embryonic patterning.

34 1.3.2 The role of chordin and chordin-like proteins in mammals

The role of chordin in mammals has been investigated in mouse knock-out models. Chordin null mice are viable but have mild craniofacial defects including defects in ear and mandibular development (Bachiller et al., 2000, Choi and Klingensmith, 2009). Chordin is expressed in the primitive streak and the node during the early stages of mouse embryogenesis, these are key structures that establish left-right and dorsoventral axes, however, chordin null mice display no obvious defects in body patterning (Bachiller et al., 2000). There is strong evidence for the functional redundancy of chordin with the BMP antagonist noggin in early development. Chrd-/- ;Nog+/- mice are perinatal lethal with cranially-restricted defects of varying severity, including loss of mouth and nose tissues, and mandibular truncations (Stottmann et al., 2001, Anderson et al., 2002), despite Nog+/- mice appearing normal (Brunet et al., 1998, McMahon et al., 1998). In Chrd-/-;Nog-/- double mutants, loss of both antagonists is lethal and results in embryo resorption. The partially resorbed embryos have defects in patterning of the three major body axes. They display loss of the notochord (dorsoventral patterning), loss of extensive areas of the forebrain (anterio-posterior), and defects in left-right patterning (Bachiller et al., 2000). These defects have not been observed in either Chrd-/- mice or Nog-/- mice (McMahon et al., 1998, Bachiller et al., 2000). A role for chordin in organogenesis has been suggested on the basis of chordin expression patterns at later developmental stages. Chordin is expressed from the early stages of formation of many major organs, such as the brain, lungs, heart, liver, kidney, thymus and intestines, as well as being expressed throughout the limb buds (Pappano et al., 1998, Scott et al., 2000). It is also expressed in high levels in condensing and differentiating cartilage, and in the cerebellum and hippocampus of the post-natal brain (Scott et al., 2000, Anderson et al., 2002). Similar broad expression of chordin has been observed in human embryos, with strong expression of chordin in condensing cartilage (Millet et al., 2001). In human adult tissues, chordin expression has been observed in the heart, liver, spinal cord, cerebellum, uterus, cervix and ovaries. The RNA of splice variants encoding C-terminally truncated constructs has been detected in a tissue- specific expression patterns in the liver, ovary and cerebellum (Millet et al., 2001). Although defects were not described in the development of major organs or the skeleton of Chrd-/-;Nog-/- double mutants, this may reflect redundancy with other BMP antagonists, such as the chordin-like proteins.

No CHRDL1 or CHRDL2 knock-out mouse models have been generated, however, their expression patterns have been investigated in mice. Expression of CHRDL1 is observed during development and in adult tissues. CHRDL1 is expressed in the neural plate and node, important structures in early development, and also in many tissues in later

35 stages of development, including the developing cartilage of the face, ribs and vertebrae, and in the developing lungs, kidneys and intestines. In adult mice, expression is observed in the heart, brain, lung, liver, kidney and testis (Coffinier et al., 2001, Nakayama et al., 2001). CHRDL2 is expressed in the developing cartilage of the mouse embryo. A role in joint specification has been proposed due to the observation of strong CHRDL2 expression in the superficial zone of embryonic joint cartilage. CHRDL2 may antagonise chondrogenesis in mesenchymal stem cells, as has been observed in vitro, to form a boundary at the end of developing joints (Nakayama et al., 2004). CHRDL1 and CHRDL2 are also both expressed with chordin in the prospective intervertebral discs and may act redundantly in vertebral development (Zakin and De Robertis, 2004, Zakin et al., 2010). CHRDL2 shows broad expression in adult human tissues. Three splice variants have been identified that contain a putative signal peptide sequence, and so would be of relevance to the extracellular regulation of BMP signalling. Two of these variants encode all three vWC domains, whilst the third variant only encodes the first two vWC domains. The two longer variants domains differ in the C-terminal region after vWC3. Alternative splicing results in inclusion of an exon (exon 9b) after the vWC3 sequence that results in a 22-residue insertion and frame shift, resulting in two variants with either 56 residues or 78 residues at the C-terminus of different peptide sequence (Oren et al., 2004). These longer variants are expressed in a variety of adult tissues including the colon, bladder, lung, heart, stomach, prostate, ovary, spleen and testis (Wu and Moses, 2003, Oren et al., 2004). However, the probes used for these in situ hybridisation experiments anneal upstream of the region encoding vWC3, and so would bind both splice variants. Therefore, it is possible that these tissues are expressing only one of the splice variants. The biological significance of this alternative splicing is not known, but does not affect their vWC domains.

1.3.3 Chordin, chordin-like proteins, and disease Due to the ubiquitous role of BMP signalling in development and tissue homeostasis, perturbations in BMP signalling are associated with a variety of diseases. As such, changes in the expression profile and subsequent activity of chordin and chordin-like proteins have been identified in a number of disease states. However, in many cases it is not clear whether such changes are causative or reactive to the disease state. It is likely that this is highly dependent on the disease, and the cell and tissue type affected.

BMP signalling is required for bone formation, and regulation of BMP signalling is important to maintain homeostasis in healthy adult tissues (Salazar et al., 2016). Changes in the expression of chordin-like proteins has been repeatedly observed in

36 samples of human osteoarthritic tissues, compared to healthy tissues. Reduced expression of CHRDL2 is significantly associated with osteoarthritic disease progression (Chou et al., 2015). Multiple screens analysing changes in expression patterns between paired healthy and osteoarthritic tissues have identified CHRDL2 as one of the most downregulated proteins in chondrocytes taken from osteoarthritic tissue, with significant downregulation at both the RNA and protein level (Steinberg et al., 2017, Ji et al., 2018). In addition to changes in the levels of CHRDL2, the distribution of CHRDL2 may also play a role in the disease. In situ hybridisation analyses show that whereas CHRDL2 is found in the superficial zone of cartilage, in osteoarthritic tissues expression moves to the intermediate zone (Nakayama et al., 2004). The change in expression from the superficial zone to the intermediate zone has also been observed for chordin in immunohistochemical analysis of diseased tissue (Tardif et al., 2006).

In cancer, BMP signalling has been observed to both promote and suppress tumorigenesis (Zhang et al., 2016). Similarly, chordin-like proteins have been described in both pro- and anti-tumorigenic roles. Chordin inhibition of BMP-4-induced melanoma cell migration and invasion has been reported in vitro (Rothhammer et al., 2005). Similarly, recombinant CHRDL1 reduces breast cancer cell migration in vitro, and high CHRDL1 expression is associated with longer survival times in patients with breast cancer (Cyr-Depauw et al., 2016). Knock-down of CHRDL1 in a gastric cancer cell line significantly increased the size of tumours observed when injected into mice. Supporting a tumour-suppressive role, CHRDL1 expression is downregulated in patient gastric cancer tissue samples, and reduced CHRDL1 expression is associated with worse disease prognosis in patients (Pei et al., 2017). In contrast, an increase in CHRDL2 expression has been reported in tumour samples from patients with breast, lung and colorectal cancer (Wu and Moses, 2003). CHRDL2 increases the proliferation of colorectal cancer cells in vitro, and increased CHRDL2 expression is associated with poor disease prognosis in patients (Sun et al., 2017). Changes in CHRDL1 activity has also been observed following acute kidney injuries (Larman et al., 2009). It is believed that in healthy tissues CHRDL1 antagonises BMP-7 to maintain homeostasis. However, following injury CHRDL1 is degraded, allowing BMP-7 signalling for tissue regeneration. These potential disease roles for chordin and chordin-like proteins are of interest, and further understanding of the chordin-family will aid future investigations into their roles in pathogenesis. Furthermore, due to the role of aberrant BMP signalling in a large number of diseases, any further understanding of BMP regulation and how it can be manipulated is of large therapeutic interest.

37 1.4 Tsg: a modulator of the chordin family Tsg is a highly conserved secreted glycoprotein that has a dual role in the modulation of the activity of the chordin family (Graf et al., 2001). Tsg interacts with both chordin and BMPs to form a Tsg/chordin/BMP ternary complex, and exhibits both BMP agonistic and antagonistic activity in a context dependent manner (Larrain et al., 2001, Scott et al., 2001). This has resulted in a number of seemingly contradictory observations being made experimentally.

1.4.1 Tsg structure Sequence alignments have predicted Tsg to have two domains separated by a long linker region. The N-terminal domain is cysteine-rich and shares homology with the vWC domains of the chordin family. The C-terminal domain is also cysteine rich, but lacks homology to domains of known structure (Figure 1-8A) (Oelgeschlager et al., 2000, Vilmos et al., 2001). Tsg is heavily glycosylated and these glycans are exclusively N-linked. N-linked glycans make up ~23% of the mass of human Tsg (Troilo et al., 2016). Most animals have 3 predicted N-linked glycosylation sites, however, rats and mice have two predicted sites (Billington et al., 2011). SAXS analysis has revealed Tsg to be a compact, globular protein with some flexibility, which may result from the putative hinge. Structural modelling generated a flattened bilobal model, in which the glycans were surface accessible and at the centre of the molecule (Figure 1-8B).

Figure 1-8 The structure of Tsg. (A) Schematic of the predicted domains of Tsg, based on sequence analysis. Tsg has an N-terminal cysteine-rich domain that shares homology with vWC domains, depicted in blue, and a C-terminal cysteine-rich domain that lacks homology to domains of known structure, depicted in green. N-linked glycosylation sites conserved in animals are shown in black. The N-linked glycosylation site absent from Tsg in mice and rats is shown in red. (B) The SAXS structures of glycosylated and deglycosylated Tsg, shown in cyan and dark blue, respectively. Taken from Troilo et al., 2016.

1.4.2 Tsg as a BMP antagonist

Tsg forms a ternary complex with chordin and BMPs, enhancing the BMP antagonism of chordin (Larrain et al., 2001). The BMP-antagonistic behaviour of Tsg has been reported in a number of systems. Injection of Tsg mRNA into zebrafish and Xenopus embryos can cause dorsalised phenotypes, and ventral co-injection of Tsg and chordin mRNA in Xenopus embryos induces secondary dorsoventral axes at chordin concentrations that do not induce secondary axes alone (Chang et al., 2001, Ross et al., 2001, Scott et al., 2001). In vitro assays in mammalian cell culture have also shown the enhancement of BMP antagonism by chordin, CHRDL1 and CHRDL2, in the presence of Tsg (Zhang et al., 2007, Larman et al., 2009, Troilo et al., 2014). The enhanced antagonism is believed to be due to increased binding of chordin to BMPs, as increased co-immunoprecipitation of BMPs by chordin is observed in the presence of

39 Tsg (Oelgeschlager et al., 2000, Scott et al., 2001). Tsg interacts directly with BMPs and inhibits BMP signalling alone, but at high concentrations which may not be physiologically relevant (Zhang et al., 2007, Troilo et al., 2014).

1.4.3 Tsg as a BMP agonist

Tsg exhibits pro-BMP behaviour by enhancing tolloid cleavage of chordin, and the presence or absence of tolloid determines whether Tsg acts in a pro- or anti-BMP manner (Larrain et al., 2001, Scott et al., 2001). Tsg exerts this effect via chordin, as this cleavage enhancement has been shown in the absence of BMPs, and Tsg does not interact with tolloids (Scott et al., 2001, Troilo et al., 2016). Furthermore, BMP binding mutants are able to ventralise Xenopus embryos, indicating they retain their pro-BMP capacity (Oelgeschlager et al., 2003b). It is hypothesised that Tsg induces a conformational change in chordin, as the presence of Tsg causes a third site in mouse chordin to be cleaved by tolloids (Scott et al., 2001). This cleavage site is not conserved in chordin of other species. Consistent with this pro-BMP activity, Tsg mRNA injection has been observed to expand ventral markers in Xenopus embryos (Oelgeschlager et al., 2003a), and co-injection of Tsg mRNA has been observed to block the induction of secondary dorsoventral axes on chordin mRNA injection (Oelgeschlager et al., 2000, Larrain et al., 2001). It has been proposed that Tsg also acts as a pro-BMP factor by competing with chordin fragments for BMP binding. Indeed, BMP-4 no longer crosslinks to the chordin vWC1 domain in the presence of Tsg (Oelgeschlager et al., 2000, Larrain et al., 2001). Consistent with this, knock-down of Xenopus Tsg enhances the dorsalising activity of the chordin vWC1 fragment, and ventral structures are rescued by injection of Tsg mRNA (Larrain et al., 2001, Oelgeschlager et al., 2003a). Oelgeschlager et al. reported that a Tsg mutant defective in BMP binding could still antagonise the anti-BMP activity of vWC1, and so this displacement may be via vWC1 binding as opposed to BMP binding (Oelgeschlager et al., 2003b). Furthermore, Tsg may also enhance degradation of the chordin cleavage fragments (Larrain et al., 2001).

1.4.4 Interactions of Tsg with BMPs and the chordin family

Tsg directly interacts with BMPs, and binding has been demonstrated with BMP-2, BMP-4, BMP-7 and GDF-5 (Oelgeschlager et al., 2000, Zhang et al., 2007). Tsg appears to interact with BMPs via its N-terminus as the predicted N-terminal domain is sufficient for BMP binding, whereas the C-terminal domain is not (Oelgeschlager et al., 2000). Furthermore, a point mutation in the putative Tsg N-terminal domain has been observed to ablate BMP binding (Oelgeschlager et al., 2003b). BMP-2 point mutants

40 have been used to identify Tsg interaction sites on the BMP dimer. This revealed that Tsg interacts with residues in the BMP wrist region (Zhang et al., 2007). Chemical crosslinking has suggested two Tsg molecules interact with the BMP dimer, consistent with occupation of the two wrist regions of the BMP dimer by Tsg (Oelgeschlager et al., 2000). The same wrist mutations that reduced Tsg interaction caused a reduction in the binding of BMP-2 with the CHRDL2 vWC3 domain, but not the CHRDL2 vWC1 domain or the chordin vWC domains (Zhang et al., 2007). Therefore, Tsg binding may affect the interactions of BMPs with chordin and CHRDL2 differently. The pro-BMP activity of Tsg is independent of BMP-binding, as ventralised phenotypes were still observed on injection of the mRNA of Tsg BMP-binding mutants into Xenopus embryos (Oelgeschlager et al., 2003b). Tsg has been observed to interact with chordin, CHRDL2 and BMPER with high affinity. (Zhang et al., 2007, Lockhart-Cairns et al., 2018). An interaction between mouse CV-2 and Tsg has also been observed in immunoprecipitation experiments, however, no interaction has been observed between Tsg and zebrafish CV-2, indicating there may be species specific differences in Tsg binding (Zhang et al., 2007, Ambrosio et al., 2008). Tsg directly interacts with the vWC domains of the chordin family. Immunoprecipitation experiments have shown interactions between Tsg and chordin vWC1 and vWC2-3 domain constructs, but not vWC4 (Scott et al., 2001). Low affinity binding has been reported between Tsg and the vWC1, vWC3 and vWC4 domains of chordin based on SPR with single vWC domains. These SPR experiments also reported low affinity binding of CHRDL2 vWC1 and vWC3 with Tsg (Zhang et al., 2007). The vWC domains of chordin and CHRDL2 interact with Tsg via SD1, involving a binding site that overlaps with the BMP-binding region of the vWC SD1 (Fujisawa et al., 2009). The chordin-binding region of Tsg appears to be separate from its BMP binding site. Mutations in the putative N-terminal domain of Tsg that ablate BMP-binding do not affect chordin binding, and a mutation in the putative C-terminal domain of Tsg ablates chordin binding but not BMP binding (Oelgeschlager et al., 2003b). However, in vitro assays with the Drosophila homologs have shown Tsg only binds Sog in the presence of the BMP homolog Dpp (Ross et al., 2001).

The binding of Tsg to chordin and BMPs is not competitive. Tsg can form ternary complexes with chordin and BMPs, and these have been observed with crosslinking (Oelgeschlager et al., 2000, Larrain et al., 2001). Based on SDS-PAGE analysis of the crosslinked species, it has been proposed that one chordin molecule and two Tsg molecules bind per BMP dimer. However, the broad band on SDS-PAGE produced by heavily glycosylated Tsg makes such interpretations difficult when observing mass changes equivalent to a single Tsg molecule. Previously, it was proposed that within such a ternary complex, Tsg would bind as a dimer, however Tsg is a monomer up to

41 high concentrations (Troilo et al., 2016). Crosslinked ternary complexes have also been observed with a N-chordin, indicating the chordin vWC1 domain is not required for ternary complex formation (Larrain et al., 2001). There may be some avidity in the interactions of the ternary complex, as there is increased co-immunoprecipitation of BMPs by chordin in the presence of Tsg (Scott et al., 2001), and a ternary complex could not be formed with a Tsg BMP-binding mutant that retained chordin binding capacity (Oelgeschlager et al., 2003b). Hence, the Tsg/BMP interaction appears important in the ternary complex. As such, this Tsg/BMP interaction may also be important in the anti-BMP activity of Tsg, however, this has not been tested. Crosslinking assays have not been performed with CHRDL1 or CHRDL2. However, BMP-7 and Tsg co-immunoprecipitate with CHRLD1 (Larman et al., 2009), and CHRDL2, BMP-2, and Tsg have been observed to co-elute on gel filtration (Zhang et al., 2007).

1.4.5 Biological roles of Tsg

Tsg is a critical component in the formation of the dorsoventral signalling gradient, and its loss disrupts patterning. Due to the dual role of Tsg in the regulation of BMP signalling, contrary observations have been made on loss of Tsg. In Xenopus embryos, Tsg is expressed as part of the BMP4 synexpression group in the ventral signalling centre (Karaulanov et al., 2004). Morpholino knock-down of Tsg in the Xenopus embryo has been reported to cause both the loss of ventral structures, resembling morpholino known-down of BMP-7 (Zakin et al., 2005), and the loss of dorsal structures, resembling those of chordin knock-down (Blitz et al., 2003). In zebrafish embryos, contradictory observations have also been made, with both ventralised and dorsalised phenotypes reported on morpholino knock-down of Tsg (Ross et al., 2001, Little and Mullins, 2004). Whilst differing experimental observations have been made, it is clear Tsg plays a critical role in dorsoventral patterning. The role of Tsg in mammalian systems has been investigated with mouse genetic studies. Tsg-/- mice are viable and fertile, indicating Tsg is not essential for embryogenesis, however the mice display a number of phenotypes with varying severity. The major phenotypes displayed are dwarfism, reduced bone density, and vertebral defects, indicating a role for Tsg in skeletal development (Nosaka et al., 2003, Zakin and De Robertis, 2004, Ikeya et al., 2008, Sotillo Rodriguez et al., 2009). Phenotypes observed with lower penetrance include defective development of the kidneys, jaw and skull bones (Ikeya et al., 2008); depleted lymphoid cells (Nosaka et al., 2003); and enlarged brains and hydrocephaly (Sun et al., 2010).

42 Tsg is expressed in many regions during mouse embryogenesis. It has been detected in the branchial arches and neural plate, which give rise to the head, neck, and the nervous system; as well as various regions of the developing intestines and the pharynx (Graf et al., 2001). Consistent with a role in skeletogenesis, Tsg is also expressed extensively in mouse cartilage and bones. Strong expression has been reported throughout the cartilage of the mouse embryo, including the cartilage of the long bones, ribs, digits and vertebrae (Schmidl et al., 2006). Tsg is also widely expressed in mouse adult tissues, with expression detected in the brain, kidney, spleen, stomach, lungs, liver, testis, ovaries and lymph nodes (Graf et al., 2001, Nosaka et al., 2003). Tsg expression has been demonstrated at various stages of human brain development (Graf et al., 2001). The observed phenotypes in Tsg null mice suggest Tsg has both BMP-agonist and BMP-antagonistic behaviour in mice. The dwarfism of Tsg null mice resembles mice expressing dominant-negative BMP receptors, and these phenotypes have been attributed to the prevention of chondrocyte transition from the resting to the proliferating state, required for proper bone formation (Zhao et al., 2002, Nosaka et al., 2003). The head phenotypes of Tsg-/- mice are enhanced by loss of a single BMP-4 allele (Zakin and De Robertis, 2004). The Tsg-/- mice also displayed kinky tails with high penetrance, a phenotype also observed in BMP-7 null mice as a result of aberrant ossification in the tail vertebrae (Jena et al., 1997, Zakin and De Robertis, 2004). Furthermore, loss of BMP-7 in combination with a reduction in Tsg causes sirenomelia (Zakin et al., 2005). However, the role of Tsg in lymphoid development suggests a BMP-antagonistic role. Tsg appears to promote thymocyte proliferation, a process inhibited by BMP-4 (Graf et al., 2002). Furthermore, the reduced bone density of Tsg null mice is due to enhanced osteoclast function leading to bone resorption. A process that is recapitulated in vitro by BMP-2 overexpression (Sotillo Rodriguez et al., 2009). The formation and activity of osteoclasts can be reduced by overexpression of Tsg in pre-osteoclasts in vitro (Huntley et al., 2015). Hence, Tsg may act as both a pro- and anti-BMP factor in mammals in a context-specific manner.

1.4.6 Chordin, Tsg, and BMP shuttling

In Drosophila, additional roles for chordin and Tsg have been proposed in the promotion of BMP signalling. In addition to the loss of ventral features, Sog mutants fail to induce the amnioserosa at the dorsal midline, a tissue specified by peak BMP signalling (Francois et al., 1994); and pMad, the Drosophila homolog of pSmad, is no longer observed in the dorsal midline cells of Sog mutants. This phenotype is also observed in Tsg mutants (Shimmi et al., 2005). These observations led to the proposal that in

43 addition to local inhibition of BMP signalling, Sog and Tsg are required for long-range BMP signalling in the Drosophila embryo via a BMP-shuttling mechanism. In the early embryo, Dpp and the BMP Screw (Scw) form Dpp/Scw heterodimers. These heterodimers are the major BMP ligand of the embryo, expressed throughout the embryo, and Tsg and Sog are required for their translocation and concentration at the dorsal midline to ensure proper embryonic patterning (Shimmi et al., 2005). Sog is expressed in ventral regions of the embryo, and is capable of long-range diffusion (Biehs et al., 1996), hence it can diffuse to form antagonised BMP-chordin complexes throughout the embryo. The antagonised Dpp/Scw/Sog complexes assemble on collagen IV, and Tsg, expressed in the dorsal half of the embryo, is required for the mobilisation of complexes by competing with collagen IV for Sog binding (Wang et al., 2008). Tolloid is also expressed in the dorsal half of the embryo and cleaves Sog to liberate Dpp/Scw, increasing local BMP concentration and signalling (Figure 1-9A) (Shimmi and O'Connor, 2003).

The Dpp/Scw heterodimers bind collagen IV via a basic binding motif in the Dpp monomer, and Sog binds collagen IV via basic binding motifs in its vWC1 and vWC4 domains (Sawala et al., 2012). In the BMP-shuttling model, it is proposed that once bound to collagen IV, Dpp/Scw is transferred to Sog via interaction of the Sog vWC4 domain with Scw, and Tsg then liberates this Dpp/Scw/Sog complex by disrupting the interaction between the Sog vWC1 domain and collagen IV (Figure 1-9B). Indeed, both Tsg and Dpp/Scw are required for release of Sog bound to collagen IV (Wang et al., 2008). This mechanism accounts for the partial rescue of Tsg mutants by Supersog, the N-terminal Sog construct containing vWC1 (Yu et al., 2000), as Supersog would be able to compete with the immobilised Sog/Dpp/Scw complex for collagen IV binding via its vWC1 domain. The model proposes that if Sog is cleaved by tolloid in the dorso-lateral region near the Sog source, Sog is available to rebind Dpp/Scw and enable further diffusion of the antagonistic complex. However, if Sog is cleaved by tolloid in the dorsal most regions, the concentration of Sog is low, and so Dpp/Scw are free to bind their cognate receptors. In this model, the production of Sog ventrally, and its cleavage in the dorsal regions, cause net flux of Sog and Sog-BMP complexes dorsally, increasing the local BMP concentration (Shimmi et al., 2005).

Figure 1-9 Establishment of the dorsoventral BMP signalling gradient in the Drosophila embryo. (A) Schematic of the expression domains of Tsg, tolloid and Sog in the Drosophila embryo. The embryo is depicted as a cross-section through the anterior/posterior axis. (B) Schematic of the proposed BMP-shuttling mechanism. Dpp/Scw heterodimers and Sog bind collagen IV independently, and Dpp/Scw is transferred to the Sog vWC4 domain. Tsg then liberates the Sog/Dpp/Scw complex by competing with collagen IV for binding of the Sog vWC1 domain, and the antagonised Sog/Dpp/Scw/Tsg shuttling complex is able to diffuse to the dorsal- most regions of the embryo. Tolloid cleavage liberates the Dpp/Scw from the antagonised shuttling complex. In the dorsal-most region, Sog concentration is low and so Dpp/Scw heterodimers are free to bind their cognate receptors. Adapted from (Winstanley et al., 2015).

Vertebrate BMP-2 and BMP-4 have a highly conserved basic motif in their N-terminal regions that facilitates heparin binding in vitro. This arginine and lysine rich sequence resembles the basic binding motif of Dpp and is thought to interact with heparan sulphate proteoglycans to limit the range of BMP action. Deletion of this motif greatly expands the region of pSmad-1, -5, -8 observed on injection of mouse and Xenopus BMP-4 into Xenopus embryos (Ohkawara et al., 2002). Furthermore, Drosophila

45 embryos show normal dorsoventral patterning when a BMP-4 transgene with the dpp regulatory elements is expressed in dpp null Drosophia (Padgett et al., 1993). However, the existence of a BMP-shuttling mechanism in vertebrates has been disputed. Many laboratories have combined mathematical modelling with experimental observations to investigate whether a shuttling mechanism is required for the formation of a BMP signalling gradient along the vertebrate dorsoventral axis. These studies have led to differing models being proposed for gradient formation during vertebrate embryogenesis. A BMP-shuttling mechanism was proposed in Xenopus embryos based on a computational screen for diffusion rates and rate constants in a system containing ADMP, BMP-2, BMP-4, BMP-7, chordin and Xlr, that generated a robust signalling gradient capable of scaling with the size of the embryo. Only a shuttling based model, rather than a reciprocal chordin gradient alone, generated the required gradient in silico (Ben-Zvi et al., 2008). This computational model relied on the assumption that chordin was primarily cleaved when bound to BMPs. Although this is observed with the Drosophila homologs (Marques et al., 1997), tolloid shows significant cleavage of chordin in the absence of BMPs (Scott et al., 2001, Berry et al., 2010). Ben-Zvi et al., proposed the increased rate of chordin cleavage when bound to Tsg could account for this (Ben-Zvi et al., 2008). The conclusions by Ben-Zvi et al., have been disputed as the model was based on the observation of chordin-dependent movement of a tagged BMP-4 construct, and also assumed that BMP activity comes predominantly from ADMP (Francois et al., 2009). There has also been no reported loss of structures specified by maximal BMP signalling in vertebrate chordin mutants, as is seen in Drosophila Sog mutants (Francois et al., 1994). Similarly, peak BMP signalling is not affected by loss of chordin from zebrafish embryos (Zinski et al., 2017). Furthermore, overexpression of chordin did not appear to affect embryonic distribution of a fluorescent BMP-2 construct (Pomreinke et al., 2017). The use of experimentally derived rates of diffusion of chordin and BMPs in zebrafish embryos in mathematical modelling suggested a source/sink mechanism could account for BMP signalling gradient formation in the zebrafish embryo, in which BMPs produced ventrally diffused towards dorsal regions, and were antagonised by an opposing dorsal chordin gradient (Pomreinke et al., 2017, Zinski et al., 2017). The different models for gradient formation between Drosophila and vertebrates may be due to different properties of the proteins that form the dorsoventral gradient, and the gradient they establish. The embryonic BMP signalling gradient in Drosophila is steeper than that in zebrafish, with BMP antagonism observed far outside the Sog expression domain, and the signalling gradient is formed more rapidly in Drosophila (Peluso et al., 2011, Zinski et al., 2017). Additionally, Drosophila Tsg can only bind Sog in the presence of BMPs, and Sog is only cleaved by tolloids when bound by BMPs (Marques

46 et al., 1997, Ross et al., 2001). Whereas, in vertebrates, BMPs are not required for the chordin-Tsg interaction, or the cleavage of chordin by tolloids (Zhang et al., 2007, Troilo et al., 2016). These differing properties of the Drosophila proteins and their formation of a steeper signalling gradient may necessitate a different mechanism of gradient formation than in vertebrates. Therefore, it is unclear whether BMP-shuttling occurs, and whether chordin and Tsg would play such roles, in vertebrates.

1.4.7 Interactions of the chordin/Tsg/BMP ternary complex components with the extracellular matrix Despite BMP-shuttling in vertebrates being contentious, components of the BMP/chordin/Tsg complex interact with other components of the extracellular matrix, adding additional complexity to BMP regulation. Localisation of the ternary complex through these interactions has been suggested as an important aspect in the regulation of BMPs.

Chordin, Tsg and BMPs can all directly interact with mouse CV-2 (Ambrosio et al., 2008). Human BMPER has also been shown to directly interact with chordin and Tsg (Lockhart-Cairns et al., 2018). In addition to antagonising BMP signalling by masking receptor binding sites, CV-2 has been shown to promote BMP signalling (Serpe et al., 2008). CV-2 is cell-surface bound via an interaction between its vWD domain and heparan sulphate proteoglycans (Serpe et al., 2008). It has been proposed that CV-2 localises chordin/Tsg/BMP ternary complexes in the ventral region of Xenopus embryos, and displaces chordin from BMPs, enabling BMP signalling (Rentzsch et al., 2006, Ambrosio et al., 2008). CV-2-dependent chordin internalisation has also been observed, and CV-2 binds with higher affinity to chordin cleavage fragments (Ambrosio et al., 2008, Kelley et al., 2009). This has led to the proposal that CV-2 also depletes free chordin and chordin fragments via endocytosis in the ventral region of the Xenopus embryo (Zakin and De Robertis, 2010). A similar role in ternary complex localisation has been suggested for CV-2 in the mouse vertebral discs. Loss of CV-2 precludes the movement of chordin from prospective intervertebral disc to the prospective vertebral body, a tissue specified by high levels of BMP signalling (Zakin et al., 2010). CV-2-/- mice display vertebral defects, including smaller vertebral bodies (Zakin et al., 2008). CHRDL1 and CHRDL2 are also expressed in the prospective intervertebral discs with chordin and Tsg, and so may also function in this capacity (Zakin and De Robertis, 2004). Such functional redundancy would also explain the vertebral defects being observed in Tsg and CV-2 null mice, but not chordin null mice. However, it is not known whether CHRDL1 or CHRDL2 interact with CV-2.

47 In addition to CV-2, chordin also binds to other proteins at the cell surface. Chordin binds integrin-3 in COS-7 cell culture, and this may mediate chordin endocytosis, as the amount of chordin observed in intracellular vesicles was greatly increased when the COS-7 cells were transfected with integrin-3 cDNA (Larrain et al., 2003). This may be an important regulatory mechanism. In Drosophila, endocytosis of Sog contributes to its inactivation in the dorsal regions of the embryo (Srinivasan et al., 2002). Chordin and BMPs bind to heparin in vitro, whereas Tsg does not. Chordin binding to the cell surface of tissues in cell culture is ablated by tissue pre-treatment with heparin lyases, and transfection of cell cultures lacking endogenous proteoglycans with syndecan-1 and syndecan-4 cDNA facilitated chordin binding to the cell-surface. The BMP-antagonistic activity of chordin was significantly reduced in cell culture under low sulphate conditions (Jasuja et al., 2004). This led to the proposal that interactions with syndecans concentrate chordin at the cell surface, giving chordin the spatial proximity to BMPs to limit interactions with their cognate receptors. Chordin also interacts with fibronectin in vitro (Huang et al., 2009). Many extracellular matrix proteins have been proposed to concentrate BMPs at the cell surface. BMPs have been shown to interact with perlecan (DeCarlo et al., 2012), heparan sulphate (Kuo et al., 2010), fibronectin (Martino and Hubbell, 2010), and fibrillin (Sengle et al., 2011). Chordin and Tsg are also affected by soluble proteoglycans. Biglycan is a conserved small leucine-rich repeat protein (SLRP) expressed during early Xenopus development, and is dorsalising in a chordin-dependent manner when injected into Xenopus embryos. Biglycan interacts with BMP-4, chordin and Tsg, and enhances the inhibition of BMP signalling when chordin and Tsg are added together in in vitro signalling assays (Moreno et al., 2005). This may be via a scaffolding mechanism, as when biglycan is added at high molar ratios to chordin and Tsg, inhibition is greatly reduced. Chordin and BMP-4 also interact with the conserved SLRP Tsukushi, and are able to form a ternary complex. Tsukushi also displays BMP-antagonistic activity when injected into Xenopus embryos (Ohta et al., 2004). Therefore, within the wider context of the extracellular matrix it is clear that chordin and Tsg do not act in isolation, and other components of the extracellular matrix add additional layers to the regulation of BMP signalling by chordin and Tsg. The interactions of CHRDL1 and CHRDL2 with other matrix components has not been tested, but would be of interest in further understanding their regulation of BMP signalling.

48 1.5 Aims Despite the dual roles of Tsg in modulation of the chordin family being known, little is known regarding the mechanism behind this. It is hypothesised that within the chordin/BMP/Tsg ternary complex, Tsg induces a conformational change in chordin altering the chordin/BMP interaction and the tolloid cleavage of chordin. This has been proposed based on the observations that Tsg is able to alter chordin cleavage in vitro in the absence of BMPs, and despite not interacting with tolloid proteinases (Scott et al., 2001, Troilo et al., 2016). The chordin/BMP/Tsg ternary complex has been observed in chemical crosslinking studies, as have the binary complexes (Oelgeschlager et al., 2000, Larrain et al., 2001). Chordin and Tsg have previously been structurally characterised as individual species (Troilo et al., 2014, Troilo et al., 2016). However, no binary complexes, nor the chordin/BMP/Tsg ternary complex, have been isolated. Isolation of a chordin/Tsg complex would enable its characterisation and comparison to the known structure of chordin (Troilo et al., 2014), for molecular insight into the action of Tsg on chordin. Furthermore, the specific Tsg-binding region in chordin is not known. This may provide further insight into how Tsg is arranged in the ternary complex, and how Tsg may affect chordin fragments after tolloid cleavage.

Tsg also enhances BMP antagonism by CHRDL2, and co-elution of CHRDL2, Tsg and BMP-2 has been observed on gel filtration (Zhang et al., 2007). However, mutant binding screens have suggested differences in the vWC domain binding epitopes of BMPs for different chordin family proteins. It is hypothesised that some of the CHRDL2 binding determinants on BMPs are different to those of chordin. This may result in altered modulation of CHRDL2 by Tsg, compared to the modulation of chordin. Characterisation of CHRDL2 would reveal commonalities and differences in BMP regulation by the chordin family, and their modulation by Tsg.

This thesis aims to contribute to the understanding of the chordin family of BMP antagonists and their modulation by Tsg. To this end, three specific objectives will be pursued: 1. Characterisation of the interaction between chordin and Tsg

The specific Tsg binding region of chordin will be investigated with biophysical binding analyses. The isolation of the chordin/Tsg complex will then be pursued via in vitro reconstitution for structural analysis. 2. Characterisation of CHRDL2

To enable CHRDL2 characterisation, a human cell line recombinantly expressing CHRDL2 will be established. Following purification, the structure and hydrodynamic properties of CHRDL2 will be characterised with a number of biophysical techniques.

49 3. Isolation of a CHRDL2/Tsg complex Following CHRDL2 characterisation, isolation of a CHRDL2/Tsg will be pursued via in vitro reconstitution for structural characterisation.

50 2 Materials and Methods

2.1 Cell lines All proteins were expressed in Human Embryonic Kidney (HEK) 293 cells for purification from conditioned media. HEK293 cells containing the Epstein - Barr virus Nuclear Antigen I (HEK293-EBNA) were a stock cell line in the lab prior to the start of this project. HEK293-EBNA cells previously stably transfected with pCEP-Pu/Ac7 containing sequences for human Tsg, ΔN-chordin and the chordin constructs vWC1-4CHRD and vWC2-3 were generated by Dr. Helen Troilo (University of Manchester, UK) and Dr. Richard Tunnicliffe (University of Manchester, UK) prior to this project (Troilo et al., 2014, Troilo et al., 2016). The Tsg, ΔN-chordin (residues D154-S955) and chordin vWC1-4CHRD (residues P29-

A689) constructs has a C-terminal His6 tag. The chordin vWC2-3 (residues G694-A854) construct has an N-terminal Strep tag (amino acid sequence: WSHPQFEK) and a C- terminal terminal His6 tag. HEK293-EBNA cell lines expressing chordin vWC1, CHRDL2 and Tsg-FLAG were generated as part of this project.

2.2 Plasmid constructs The pCEP-Pu/AC7 vector (Life Technologies) enables expression of proteins in mammalian cell lines and selection of transformed mammalian cells based on puromycin resistance (Appendix 1). The pCDH lentiviral cloning vector (System Biosciences) was kindly provided by Dr. Michael Leverentz (University of Manchester, UK). The pCDH vector had been modified at the C-terminus to incorporate a V5 tag, a His6 tag and Red fluorescent protein (RFP).

A T2A peptide sequence between the His6 tag and RFP sequences enables ribosome skipping and expression of unfused cloned protein and RFP (Appendix 2). Mammalian cell transformants were selected based on fluorescence. Both the pCEP-Pu/AC7 and pCDH vectors contain a BM40 signal sequence to enable protein secretion. This signal peptide is cleaved to produce the folded, mature protein.

The chordin vWC1 and FLAG tagged Tsg constructs were cloned into the pCEP- Pu/AC7 vector during this project. CHRDL2 was later cloned into the pCDH vector as this vector enabled more stringent transformant selection.

51 2.3 Molecular biology 2.3.1 Generation of pCEP-Pu/AC7 vector constructs

Individual chordin vWC1 domain with a C-terminal His6 tag, as well as a Tsg construct with C-terminal His6 and FLAG tags (sequence: DYKDDDDK) were cloned into the pCEP-Pu/AC7 mammalian expression vector (Appendices 3 and 4). Inserts were generated by polymerase chain reaction (PCR) amplification from the vWC1-4CHRD and Tsg pCEP-Pu/AC7 vectors provided by Dr. Helen Troilo (University of Manchester, UK) and Dr. Richard Tunnicliffe (University of Manchester, UK). Forward primers encoded a 5’ NheI restriction site. Reverse primers were designed to add either a His6 or FLAG tag at the C-terminus and a 3’ XhoI or BamHI restriction site for the chordin constructs and Tsg construct, respectively. The reverse primers for the chordin construct included the sequence encoding a thrombin cleavage site between the protein and the tag. The His6 tag at the C-terminus of the Tsg-FLAG construct was retained for purification. To allow for In-Fusion HD cloning of the insert into the expression vector, base pairs which were homologous to the vector sequence flanking the insertion site were added to the forward and reverse primers. Table 2-1 summarises the primers used for the PCR amplification of cloning inserts.

Table 2-1 Primers used for the generation of the Tsg-FLAG and chordin domain pCEP- Pu/Ac7 constructs.

Construct Primer Sequence (5’ – 3’ orientation) Direction

vWC1 Forward TGGCAGCCCCGCTAGCGGGCTGCACCTTCGGCG

(5’ – 3’)

Reverse CCTTGCCGGCCTCGAGTCAATGGTGATGGTGGTGGTGGCTGC

(3’ – 5’) CCCGAGGCACCAGCTCCTGGGGGCAGGTC

Tsg- Forward CTCGTCGCTAGCGTGTAACAAAGCACTCTGTGCTAG

FLAG (5’ – 3’)

Reverse CTCGTCGGATCCTTACTTGTCGTCATCGTCTTTGTAGTCTCCTC

(3’ – 5’) CTCCATGGTGGTGATGGTGGTGAAAC

Different sequences present within each primer are highlighted. Green denotes restriction sites, pink denotes residues to maintain the open reading frame, red denotes the stop codon, blue denotes the His6 or FLAG tag and orange denotes the thrombin cleavage site.

52 2.3.2 Polymerase chain reaction amplification of pCEP-Pu/AC7 inserts

For high fidelity polymerase chain reaction (PCR) of the insert Phusion Flash II DNA Polymerase (Thermo Fisher Scientific) was used for amplification. The PCR reaction was performed in a total volume of 50 μl with 25 ng of template DNA, 25 nmol of both forward and reverse primer, 25 μl of 2x Phusion Flash PCR Master Mix and made up to 50 μl with nuclease-free sterile water. PCR amplification was carried out according to manufacturer’s instructions with the following protocol:

1. An initial denaturation step 95°C 10 seconds 2. A second denaturation step 98°C 1 second 3. An annealing step 65°C 30 seconds 4. DNA Polymerase Extension step 72°C (15s/kb extension)

5. A final denaturation step 72°C 2 minutes

Steps 2 to 4 were cyclically repeated for 29 cycles. Following amplification, the template vector was digested by adding 20U DpnI (New England Biolabs) and 5 μl 10x CutSmart Buffer (New England Biolabs) (500 mM Potassium Acetate, 200 mM Tris-Acetate, 100 mM Magnesium Acetate, 0.1 mg/ml Bovine Serum Albumin (BSA), pH 7.9) directly to the PCR reaction mixture at 37°C for 1 hour. Following template digestion, the amplified PCR inserts were purified using the QIAquick PCR Purification Kit (Qiagen) following the manufacturer’s instructions. Briefly, 250 μl Buffer PB (Qiagen) was added to 50 μl PCR reaction and passed through a QIAquick column (Qiagen) by centrifugation at 10000 x g. 750 μl Buffer PE (Qiagen) was added to the spin column and passed through by centrifugation at 10000 x g. DNA was eluted from the column using 20 μl of nuclease-free sterile water (Thermo Fisher Scientific).

2.3.3 CHRDL2 pCDH insert generation

The human CHRDL2 gene sequence (NCBI gene accession code: NM_001278473) (Appendix 5) was purchased as a codon optimised Gene String (Thermo Fisher Scientific) for cloning into the pCDH vector. The Gene String encoded the 5’ NheI restriction site, mature peptide sequence and 3’ BamHI restriction site. A BamHI restriction site within the sequence for the mature peptide was changed to remove the restriction site but maintain the amino acid sequence of the mature protein. To allow for In-Fusion HD cloning of the insert into the expression vector, 15 base pairs which were homologous to the vector sequence flanking the insertion site were added to the 5’ and 3’ ends of the Gene String. The sequence was codon optimised for expression in human cell lines using the manufacturer’s software as an automated process. The Gene

53 String was received as purified linear DNA and was resuspended in nuclease-free sterile water to obtain a concentration of 20 ng/μl.

2.3.4 Restriction digest of vector sequences

Double restriction digest of the multiple cloning site was carried out prior to In-Fusion HD cloning of the insert into the vector. The pCDH vector was digested with NheI (New England Biolabs) and BamHI (New England Biolabs) restriction enzymes, and the pCEP-Pu/AC7 vector was digested with NheI (New England Biolabs) and XhoI (New England Biolabs) restriction enzymes. 3 μg of purified vector was added to 20U of each enzyme and 5 μl 10x CutSmart Buffer (New England Biolabs) (500 mM Potassium Acetate, 200 mM Tris-Acetate, 100 mM Magnesium Acetate, 0.1 mg/ml BSA, pH 7.9), and the final reaction volume made to 50 μl using sterile water. The reaction mixture was incubated at 37°C for 2 hours. Fully digested vector was purified by extraction from an agarose gel.

2.3.5 Agarose gel electrophoresis

DNA was separated by electrophoresis using agarose gels. Gels were prepared through addition of 1% (w/v) agarose (Bioline) to 100 ml of TAE buffer (2 M Tris Buffer, 1 M acetic acid and 0.5 mM EDTA, pH 8.0). Following heating to dissolve the agarose, the solution was cooled and 0.005% (v/v) SafeView nucleic acid stain (NBS Biologicals Ltd.) added. The Hyperladder I DNA standard (Bioline) was used to estimate DNA fragment size. Samples were run at 100 V for 1 hour at room temperature and DNA visualised using UV light.

2.3.6 DNA purification

DNA was purified from agarose gels using the QIAquick Gel Extraction Kit (Qiagen) following the manufacturer’s instructions. Briefly, DNA bands were excised from the gel, transferred to a sterile microfuge tube and QG buffer (Qiagen) was added (3-fold buffer volume to gel fragment weight, where 100 mg ≈ 100 μl) and incubated at 50°C for 10 minutes until the gel completely dissolved. Following this, 1 volume of isopropanol was added to the solution and the sample passed through a QIAquick spin column (Qiagen) by centrifugation at 10000 x g. DNA in the spin column was washed once using 750 μl PE buffer (Qiagen) and buffer removed by centrifugation at 10000 x g. DNA was eluted from the column using 20 μl of nuclease-free sterile water.

54 2.3.7 In-Fusion ligation

DNA ligation of inserts and vectors was carried out using the In-fusion HD cloning kit (Clontech Laboratories) according to the manufacturer’s instructions. Briefly, the ligation reaction contained 2 μl of 5x In-Fusion HD Enzyme Premix incubated with 100 ng of purified insert and 100 ng of restriction-digested vector. The final volume of the reaction was adjusted to 10 μl using sterile water. The reaction mixture was incubated at 50°C for 15 minutes.

2.3.8 Bacterial transformation Following ligation, the mixture was transformed into 10-beta Competent Escherichia coli bacteria (New England Biolabs). 25 μl of cell suspension was defrosted at 4°C, then incubated on ice for 30 minutes with 10 μl of ligation mixture. The DNA-bacteria mixture was heat-shocked at 42°C for 45 seconds and then incubated on ice for a further 5 minutes. 500 μl SOC Outgrowth Medium (New England Biolabs) (2% vegetable peptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4, 20 mM glucose) was then added to the DNA-bacteria mix and incubated shaking at 225 rpm at 37°C for 1 hour. Cells were spread on Luria-Bertani (LB)-Agar plates (1% (w/v) tryptone, 0.5% (w/v) yeast extract, 170 mM NaCl, 1.5% (w/v) agar, pH 7.5) (Thermo Fisher Scientific) supplemented with 100 μg/ml ampicillin antibiotic. Cells were grown at 37°C overnight to allow for antibiotic selection. Colonies were picked from LB-agar plates and grown in LB media (Thermo Fisher Scientific) supplemented with 100 μg/ml ampicillin antibiotic. Cells were grown overnight shaking at 225 rpm at 37°C.

2.3.9 Purification of expression vectors

Expression vectors were purified from the bacteria using the QIAprep Spin Miniprep Kit (Qiagen) according to the manufacturer’s instructions. A 10 ml volume of overnight bacterial culture was pelleted by centrifugation at 10000 x g. The cells were resuspended in a 250 μl of buffer P1 (Qiagen) (with RNase added) and 250 μl of buffer P2 (Qiagen) added. After 5 minutes, the reaction was quenched using 350 μl of buffer N3 (Qiagen). Cell debris was removed by centrifugation at 10000 x g for 10 minutes and the resulting supernatant passed through a QIAprep spin column (Qiagen). DNA in the spin column was washed once using 750 μl PE buffer (Qiagen) and buffer removed by centrifugation at 10000 x g. DNA was eluted from the column using 20 μl of nuclease- free sterile water.

55 2.3.10 DNA sequencing

All constructs were sequenced prior to use. DNA sequencing reactions were prepared in a total volume of 10 μl containing 5 μM of sequencing primer and approximately 500 ng of purified plasmid DNA. For the sequencing of the CHRDL2 pCDH construct, the EF1α forward sequencing primer (5’-CTCCACGCTTTGCCTGACCCT-3’) and a primer that anneals within the CHRDL2 sequence (5’- CAAGGATGAGGCCAGCGAGCAGTCCGATGAAG-3’) were used. For sequencing of pCEP-Pu/AC7 constructs, the pCEP forward sequencing primer was used (5’- AGCAGAGCTCGTTTAGTGAACCG-3’). These samples were sent to GATC Biotech (Cologne, Germany) using the LIGHTrun service for sequencing.

2.4 Protein expression in HEK293-EBNA cells 2.4.1 HEK293-EBNA cell culture

Untransfected HEK293-EBNA cells were cultured in an incubator at 37°C with 5% CO2 in T75 and T225 vented-lid culture flasks (Corning) with 10 ml and 25 ml, respectively, of growth media (Dulbecco’s Modified Eagle’s Media 4 (DMEM4) supplemented with 10% (v/v) Foetal Bovine Serum (FBS) and 1% (v/v) Penicillin Streptomycin Mixture (Sigma)). Cells were passaged upon reaching confluence. For passaging, cells were washed with 10 ml sterile-filtered Phosphate Buffered Saline (PBS) (0.2 g/l KCl, 0.2 g/l

KH2PO4, 8.0 g/l NaCl, 1.15 g/l Na2HPO4, Sigma), and detached by addition of 2 ml or 5 ml Trypsin-EDTA solution (Sigma) for T75 and T225 flasks, respectively, and incubation at 37°C for 2 minutes. Trypsin was deactivated by addition of 8 ml or 20 ml growth media (Dulbecco’s Modified Eagles Media 4 (DMEM4) supplemented with 10% (v/v) Foetal Bovine Serum (FBS) and 1% (v/v) Penicillin Streptomycin Mixture (Sigma)) for T75 and T225 flasks, respectively. Cells were seeded at a 1:5 dilution for further culture.

2.4.2 HEK293-EBNA pCEP-Pu/AC7 transfection and selection

HEK293-EBNA cells were transfected with pCEP-Pu/AC7 constructs using the Lipofectamine3000 kit (Thermo Fisher Scientific). Briefly, two tubes were prepared containing either 5 μl Lipofectamine 3000 Reagent and 125 μl Opti-MEM Medium (Thermo Fisher Scientific), or 2.5 μg construct DNA, 125 μl Opti-MEM Medium and 5 μl P3000 Reagent and were each mixed well. These tubes were then mixed together and incubated for 10 minutes at room temperature. This 250 μl mixture was then added dropwise to HEK293-EBNA cells at ~80% confluency in 1 ml fresh growth media in a 6- well plate and incubated for 2 days at 37°C. 1 ml fresh growth media was added to the well half way through this 2 day incubation. After incubation, cells were washed with 0.5 ml sterile-filtered PBS (Sigma) and detached with 0.5 ml Trypsin-EDTA. Trypsin was

56 deactivated by addition of 5ml growth media, as in section 2.4.1, and the resultant cell suspension was transferred to a T25 flask (Corning). After growth, cells were subsequently passaged using 1ml trypsin into a T75 flask (Corning). Upon reaching 100% confluency, growth media supplemented with 2 μg/ml puromycin (Sigma) was added to select for transformed cells.

2.4.3 HEK293-EBNA pCDH transduction

For transduction of HEK293-EBNA cells with the CHRDL2 pCDH construct, the construct was packaged into lentivirus particles in HEK293-T cells. HEK293-T cells were transfected with two packaging vectors, psPAX2 and pMD2.G (Addgene), and the pCDH vector using Polyethylenimide (PEI) (Sigma) as the transfection reagent. This involved preparation of two tubes of reagents. Tube A contained 6 μg pCDH vector, 4.5 μg psPAX2, 3 μg pMD2.G and 250 μl Opti-MEM (Sigma). Tube B contained 27 μl 1 mg/ml PEI and 250 μl Opti-MEM. Tube B was incubated for 2 minutes at room temperature, before gentle mixing with Tube A. The mixture was then incubated for 15 minutes at room temperature. Existing media was removed from a T75 flask containing HEK293-T cells at 70% confluency and replaced with 6 ml of fresh growth media (DMEM4 supplemented with 10% (v/v) Foetal Bovine Serum (FBS) and 1% (v/v) Penicillin Streptomycin Mixture (Sigma)). The transfection mix was added to the T75 and incubated overnight at 37°C with 5% CO2. The media was replaced with 6 ml fresh growth media containing 10 mM Sodium Butyrate (Millipore) and incubated at 37°C with

5% CO2 for 6 hours. The media was then replaced with fresh growth media and cells were incubated overnight at 37°C with 5% CO2. The virus containing media was then collected and filtered using 0.45 μm syringe filters (Millipore). HEK293-EBNA cells were cultured in a T75 flask for transduction with lentivirus containing the pCDH construct. Once the HEK293-EBNA cells were at 80% confluency, 6 ml virus medium, 4 ml fresh growth medium and 8 μg/ml protamine sulphate (Sigma) were added to the T75 flask. Cells were incubated at 37°C with 5% CO2 for 24 hours. Growth media was replaced and target cells were cultures for 3 days before cell sorting.

2.4.4 Fluorescence activated cell sorting

Transduced cells were sorted based on fluorescence conferred by the RFP sequence in the pCDH vector. To prepare cells for sorting, cells were washed twice with sterile- filtered PBS to remove any traces of serum and detached using Trypsin-EDTA, as described in section 2.4.1, and the cell resuspension was centrifuged at 1000 x g for 4 minutes. The supernatant was discarded and the pellet resuspended in 1 ml serum-free media (DMEM4 supplemented with and 1% (v/v) Penicillin Streptomycin Mixture

57 (Sigma)). The cell suspension was then filtered using a 50 μm cup falcon (BD Biosciences) into a 5 ml round-bottom polypropylene tube (BD Biosciences) for fluorescence activated cell sorting (FACS). FACS was carried out by the Flow Cytometry Facility (Faculty of Biology, Medicine and Health, University of Manchester, UK) using a FACS Aria Fusion (BD Biosciences). Single cells were selected using a plot of forward scatter height against forward scatter area. Intact cells were subsequently gated using a plot of forward scatter area against side scatter area. Intact cells expressing RFP were then sorted using an excitation laser of 561 nm and a 610-620 nm band-pass filter to measure emission. FACS-selected cells were centrifuged at 1000 x g for 4 minutes and resuspended in growth media. Based on cell number, cells were seeded in an appropriate flask and cultured, as described in section 2.4.1.

2.4.5 Freezing of HEK293-EBNA cells

Stores of transfected and transduced HEK293-EBNA cells were produced for future work. Cells at 80% confluency in a T75 flask (Corning) were trypsinised, as described in section 2.4.1, and the cell resuspension was centrifuged at 1000 x g for 4 minutes. The supernatant was discarded and the pellet was resuspended in 2 ml freezing medium (High-glucose DMEM, 10% FBS and 10% DMSO) (Life Technologies). 1 ml aliquots were frozen slowly to -80°C using a Mr Frosty freezing container (Thermo Fisher Scientific).

2.4.6 HEK293-EBNA protein expression

Frozen HEK293-EBNA aliquots were rapidly thawed at 37°C and added to 9 ml growth media in a T75 flask (Corning). Cells were grown at 37°C with 5% CO2 until 90% confluency was reached and the media was then replaced with fresh growth media. Growth media supplemented with 1 μg/ml puromycin was added to cells transformed with pCep-Pu/AC7 constructs. Upon reaching 90% confluency, the cell population was expanded through transfer of the population to a T225 flask (Corning) followed by a HYPERflask (Corning). Once confluent, the media was changed to serum-free media (1:1 v/v DMEM4 and Ham’s Nutrient Mixture F12, supplemented with 1% (v/v) Penicillin Streptomycin Mixture (Sigma)). The serum-free media for ΔN-chordin was also supplemented with 50 mM L-Arginine (Sigma) to reduce cleavage by tolloid proteinases.

2.4.7 Media harvesting and processing

Conditioned media was removed every 72 hours and replaced with fresh serum-free media. Conditioned media was stored at -20°C until required and thawed at 4°C. Imidazole was added to a final concentration of 5 mM to conditioned media prior to

58 filtering. Media was filtered using 11 μm filter paper (Whatman) followed by a 0.65 μm PVDF filter membrane (Millipore).

2.5 Protein purification 2.5.1 Affinity chromatography

Recombinant protein could be isolated from conditioned media using affinity chromatography, due to the C-terminal His6 tag of the protein constructs. Affinity chromatography was performed with 1ml HiTrap Excel columns (GE Healthcare Life Sciences) with a binding buffer consisting of 10 mM HEPES, 500 mM NaCl, 10 mM imidazole, pH 7.4, and an elution buffer consisting of 10 mM HEPES, 500 mM NaCl, 500 mM imidazole, pH 7.4. The ΔN-chordin construct was purified with binding and elution buffers that also contained 2 M urea.

Constructs followed the same basic protocol of purification with an affinity column. Firstly, the affinity column was washed with 5 column volumes (CV) filtered Milli-Q water (Millipore) and pre-equilibrated with 5 CV binding buffer. Filtered, conditioned media was passed through the column and then the column was washed with 20 CV binding buffer. Protein was eluted in 0.5 ml fractions with 5 CV elution buffer.

2.5.2 Size exclusion chromatography

Affinity chromatography fractions were further purified using size exclusion chromatography (SEC). For this, either a Superdex 75 Increase 10/30 GL or Superdex 200 Increase 10/30 GL column (GE Healthcare Life Sciences) was used, based on the molecular weight of the protein. The column was initially washed with 1.5 CV filtered and degassed Milli-Q water (Millipore), and then equilibrated with 1.5 CV buffer (10 mM HEPES, 150 mM NaCl, pH 7.4). A 0.5 ml affinity chromatography fraction was injected onto the size exclusion column and passed at 0.5 ml/min through the column. The eluted volume was collected in 0.5 ml fractions with protein elution monitored using absorbance at 280 nm. SEC was also used for complex purification, using a Superdex 200 Increase 3.2/30 GL column (GE Healthcare Life Sciences). The column was initially washed with 1.5 CV filtered and degassed Milli-Q water (Millipore), and then equilibrated with 1.5 CV buffer (10 mM HEPES, 150 mM NaCl, pH 7.4), and was run at a flow rate of 0.075 ml/min. All samples were input at volumes of 50 l, and 50 l elution fractions were collected.

59 2.5.3 Ion exchange chromatography

Ion exchange chromatography (IEC) was used to purify the ΔN-chordin/Tsg crosslinking reaction (see 2.6.1 for details). A 1ml HiTrap Q hp sepharose column was used in Tris buffer. The column was initially washed with 5 CV filtered and degassed Milli-Q water (Millipore), 5 CV Buffer A, 5 CV Buffer B and 5 CV Buffer A. Buffer A: 10 mM Tris, pH 7.4

Buffer B: 10 mM Tris, 1 M NaCl, pH 7.4. The crosslinking reaction was diluted in buffer A to reach a final NaCl concentration of 50 mM for protein loading onto the column. Two salt gradients were used in this thesis for purification by IEC: a single gradient and a step gradient. These were generated by inline mixing varying proportions of buffer A and buffer B. The IEC traces generated state NaCl concentration as a percentage of Buffer B. This refers to the percentage of buffer B mixed with Buffer A to produce the buffer passing through the column, e.g. 60% buffer B would equal 600 mM NaCl. For the single gradient, NaCl was increased from 20 mM to 500 mM over 10 ml. In the step gradient protocol, NaCl was increased from 20 mM to 290 mM over 5 ml, held at 290 mM for 8 ml and then increased from 290 mM to 500 mM over 5 ml. Buffer was passed through the column at 0.5 ml/min. The eluted volume was collected in 0.5 ml fractions with protein elution monitored using absorbance at 280 nm.

2.5.4 Sodium dodecyl sulphate polyacrylamide gel electrophoresis

Sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was used to assess purified protein purity, complex formation and protein crosslinking efficiency. Sample was mixed with 4x NuPAGE LDS buffer (Life Technologies) and loaded into NuPAGE 4-12% Bis-Tris SDS-PAGE gels (Life Technologies). For reducing SDS- PAGE, 5% beta-mercaptoethanol was added to the sample. In cases where resin was boiled for SDS-PAGE analysis, 10 l resin was boiled in 50 l NuPAGE LDS buffer (Life Technologies). Electrophoresis was performed at 180V for 1 hour at room temperature with NuPAGE MOPS (50 mM MOPS, 50 mM Tris Base, 0.1% SDS, 1 mM EDTA, pH 7.7) or MES buffer (50 mM MES, 50 mM Tris Base, 0.1% SDS, 1 mM EDTA, pH 7.3) (Life Technologies). Protein standards were used to assess molecular weights. Protein standards used were Seeblue Plus2 pre-stained protein standard (Thermo Fisher Scientific) and Precision Plus pre-stained protein standard (Bio-Rad). Proteins were visualised by staining with Instant Blue (Expedeon) or Brilliant Blue G (Sigma), following manufacturers’ instructions.

60 2.5.5 Western blotting

Following SDS-PAGE, proteins were transferred from the gel onto a nitrocellulose membrane (GE Healthcare Life Sciences) using the XCell II Blot Module (Thermo Fisher Scientific) in Tris-glycine transfer buffer (96 mM Tris-HCl, 780 mM glycine, 0.075% (v/v) SDS with 20% (v/v) methanol) for 1 hour at 35 V. The membrane was then blocked in 5% (w/v) milk solution in Tris buffered saline with Tween (10 mM Tris-Cl, 150 mM NaCl, 0.1% Tween-20, pH 7.4) (TBS-T) for 30 minutes at room temperature. Blots were then probed with a primary antibody diluted 1:1000 in 5% (w/v) milk solution in TBS-T for 1 hour at room temperature. Primary antibodies used were: mouse anti-his tag monoclonal IgG (MAB050, R&D systems) and mouse monoclonal anti-FLAG M2 antibody (F1804, Sigma). The membrane was then washed three times each for 10 minutes in TBS-T prior to addition of the secondary antibody. Membranes were incubated with secondary antibodies in 5% (w/v) milk solution in TBS-T for 1 hour at room temperature, before again washing three times with TBS-T prior to visualisation.

For western blots of all purifications except CHRDL2, and ΔN-chordin/Tsg complex experiments (all western blots in chapter 3) a HRP-conjugated anti-mouse secondary antibody (HAF007, R&D systems) was used at 1:4000 dilution. Blots were visualised using UptiLight US WB solution (Interchim) and the ChemiDoc XRS+ System (Bio-Rad). For western blots containing CHRDL2 (all western blots in chapters 4 and 5) an IRdye 800CW donkey anti-mouse IgG (LI-COR) at 1:10000 dilution was used. Blots were visualised using the Odyssey CLx Imaging system (LI-COR) and analysed using Image Studio Lite software version 5.0 (LI-COR).

2.5.6 Mass spectrometry protein identification

Proteins were identified from bands on SDS-PAGE gels. Gels were submitted to the University of Manchester Mass Spectrometry Core Facility (University of Manchester, Oxford Road, M13 9PL) for analysis and analysed using Scaffold software (Proteome Software, Oregon, USA).

2.5.7 Protein concentration determination

Protein concentration was calculated based on the absorbance measurements at a wavelength of 280 nm. UV absorbance at 280 nm wavelength was measured and concentration calculated using a Nanodrop-1000 spectrophotometer (Thermo Fisher Scientific). The concentration was adjusted based on the extinction coefficient of the protein calculated from the peptide sequence using ExPASy protparam software (Swiss Institute of Bioinformatics).

61 2.6 Biochemical methods 2.6.1 Protein crosslinking

Proteins were covalently crosslinked using the bis(sulfosuccinimidyl)suberate (BS3) amine crosslinker (Sigma). Tsg and ΔN-chordin were mixed at a 3:1 molar ratio (12 M Tsg: 4 M ΔN-chordin) in 10 mM HEPES, 150 mM NaCl, pH 7.4 and preincubated for 1 hour at room temperature. BS3 was then added at a 50:1 BS3:protein molar ratio and incubated for 30 minutes at room temperature. Crosslinking was quenched by addition of 1 M Tris, pH 7.4 (to give a final concentration of 25 mM) and incubation for 15 minutes at room temperature. Crosslinking efficiency was assessed with reducing SDS- PAGE (section 2.5.4).

2.6.2 Immunoprecipitation of Tsg-FLAG/ΔN-chordin

Immunoprecipitation was used to isolate a crosslinked Tsg-FLAG/ΔN-chordin complex. 200 l crosslinking reaction was incubated with 100 l Anti-FLAG M2 affinity gel (Sigma) for 2 hours at room temperature. Resin was washed with 500 l wash buffer three times for each wash buffer. Wash 1: 10 mM HEPES, 150 mM NaCl, pH7.4 Wash 2: 10 mM HEPES, 500 mM NaCl, pH7.4 Wash 3: 10 mM HEPES, 500 mM NaCl, 1 M urea, pH7.4

Protein was eluted by incubating resin with 200 g/ml 3X FLAG peptide (Sigma) shaking at 4°C for 1 hour. Fractions were analysed with reducing SDS-PAGE (section 2.5.4).

2.6.3 Denaturing protein deglycosylation N-linked glycans were removed using PNGase F (NEB) and O-linked glycans were removed using the O-linked glycosidase and Neuraminidase Bundle (NEB) under denaturing conditions, following the manufacturer’s protocol. Briefly, the protein was denatured by adding 10-20 μg protein to 1μl 10X Glycoprotein Denaturing Buffer (NEB) and H2O to make a 10 μl total reaction volume and heating at 100°C for 10 minutes. Glycans were then removed by adding to the denatured protein mix 2 µl 10X GlycoBuffer 2 (NEB), 2 µl 10% NP40 and either adding enzymes to remove N-linked glycans (1 µl PNGase F) or O-linked glycans (2 µl Neuraminidase and 2 µl O-

Glycosidase), or adding these in combination, followed by H2O to make a 20 μl total reaction volume. The reaction was incubated for 3 hours at 37°C, and deglycosylation was analysed with SDS-PAGE, as described in section 2.5.4.

62 2.6.4 Lectin binding assay

CHRDL2 was tested for binding to a number of lectins; Wheat germ agglutinin, Concanavalin A, Sambucus nigra lectin, Ulex europaeus agglutinin and Vicia villosa Lectin, (all from Vector Laboratories). All lectins were conjugated to biotin allowing detection via a Streptavidin-fluorophore conjugate (IRDye 800CW Streptavidin, LI- COR). Following denaturing PNGase F treatment, reducing SDS-PAGE was performed on CHRDL2 samples, as in section 2.5.4, followed by transfer onto a nitrocellulose membrane (see 2.5.5). Membranes were then blocked in 5% (w/v) BSA (Sigma) in TBS- T (10 mM Tris-Cl, 150 mM NaCl, 0.1% Tween-20, pH 7.4) for 30 minutes at room temperature. Membranes were then incubated with a single biotin-conjugated lectin and mouse anti-his tag monoclonal IgG (R&D systems), both diluted 1:1000 in TBS-T for 1 hour at room temperature. Membranes were washed three times with TBS-T for 10 minutes each at room temperature. Membranes were then incubated with IRDye 800CW Streptavidin (LI-COR) diluted 1:25000 and IRdye 680RD donkey anti-mouse IgG (LI-COR) diluted 1:10000 in TBS-T for 30 minutes at room temperature, before again washing three times with TBS-T. Blots were visualised using the Odyssey CLx Imaging system (LI-COR) and analysed using Image Studio Lite software version 5.0 (LI-COR).

2.6.5 Cleavage assay

In vitro cleavage assays were used to assess cleavage of CHRDL2 by BMP-1. Either 1.5 μg CHRDL2 or ΔN chordin as a control was incubated with 100 ng BMP-1 in 50 mM

Tris, 150 mM NaCl, 5 mM CaCl2, pH 7.4 in a total of 30 μl for 16 hours at 37 °C. To investigate the effect of Tsg, assays were performed under identical conditions in the presence of 3 μg Tsg. Cleavage was assessed with reducing SDS-PAGE gel in MOPS buffer and silver staining of the gel. For silver staining, the gel was fixed in 50% (v/v) methanol, 5% (v/v) acetic acid for 30 minutes at room temperature. The gel was then washed in 50% (v/v) methanol for 10 minutes and then with filtered Milli-Q water (Millipore) for 10 minutes, both at room temperature. The gel was sensitised in 0.02% (w/v) sodium thiosulphate for 1 minute, before washing twice for 1 minute with filtered Milli-Q water (Millipore), at room temperature. The gel was then soaked in chilled 0.1% (w/v) silver nitrate for 20 minutes at 4°C in the dark, before washing twice for 1 minute with filtered Milli-Q water (Millipore), at room temperature. The gel was developed by the addition of 0.04% (v/v) formalin, 2% (w/v) sodium carbonate and once bands were visible development was stopped by addition of 5% (v/v) acetic acid.

63 2.7 Biophysical methods 2.7.1 Analysis of protein foldedness

The state of CHRDL2 foldedness after freezing in liquid nitrogen was tested using the Tycho NT.6 (NanoTemper Technologies). Measurements were performed on 3.3 M CHRDL2 that had been purified in 10 mM HEPES, 150 mM NaCl, pH 7.4. Temperature was increased from 35°C to 95°C in 0.1°C increments over 3 minutes. Protein unfolding was monitored by measuring the ratio of fluorescence emission at 330 nm and 350 nm.

2.7.2 Circular dichroism CHRDL2 secondary structure was analysed by far-UV circular dichroism using a J810 spectrophotometer (JASCO). Ellipticity measurements were recorded on 5 M CHRDL2 in 10 mM Tris, 150 mM NaCl, pH 7.4, at 20°C from 190-260 nm at 0.2 nm steps, with sample buffer as a reference. 10 accumulations were recorded and averaged. Data analysis was performed with the online DichroWeb suite, using the Contin, Selcon3, CDSSTR, K2d algorithms with the set 7 reference data set (Whitmore and Wallace, 2008).

2.7.3 Multi-angle light scattering Size exclusion chromatography-multi-angle light scattering (SEC-MALS) was used to measure protein molecular weight and hydrodynamic radius. Proteins were injected onto the SEC column in the concentration range 5 M – 10 M. Chordin domain constructs were analysed using a Superdex75 10/30 GL column and CHRDL2 was analysed using a Superdex200 10/30 GL column. Columns were run at 0.75 ml/min in 10 mM HEPES, 150 mM NaCl pH 7.4 and passed through a DAWN Heleos II EOS 18- angle laser photometer (Wyatt Technologies) coupled to an Optilab rEX refractive index detector (Wyatt Technologies). Hydrodynamic radii and molecular mass measurements were analysed using Astra 6 software. Eluted fractions were analysed with SDS-PAGE, as in section 2.5.4.

2.7.4 Analytical ultracentrifugation

Sedimentation velocity analytical ultracentrifugation (AUC) was performed using an XL- A centrifuge (Beckman). Proteins were centrifuged in an An60Ti-4 Hole rotor at 20°C. The sedimenting boundary was monitored at 280 nm every 180 seconds for 200 scans. CHRDL2 was analysed at a concentration of 5 M in 10 mM Tris, 150 mM NaCl pH 7.4, and centrifuged at 45000 rpm. For analysis of the Tsg/CHRDL2 complex, CHRDL2 and Tsg were mixed to final concentrations of 5.5 M and 11 M, respectively, in 10 mM

64 HEPES, 150 mM NaCl pH 7.4, incubated for 1 hour at room temperature prior to centrifugation, and centrifuged at 50000 rpm. Data was analysed using the continuous

C(s) distribution model of the Lamm equation in SEDFIT (Schuk, 2000). S20,w was then calculated from the apparent sedimentation coefficient using SEDNTERP, from which the values for molecular weight, hydrodynamic radius and frictional ratio were given (Biomolecular Interaction Technologies Center, the University of New Hampshire).

2.8 Binding assays

2.8.1 Solid phase assay Solid phase assays were used to screen binding of CHRDL2 to a variety of extracellular matrix proteins. Recombinant human Syndecan-4 expressed in a mouse myeloma cell line and purified without the addition of BSA (carrier free) was purchased from R&D systems, and human placental collagen IV was purchased from Sigma. Purified recombinant human fibronectin III fragment (Cheng et al., 2018), and the fibrillin-1 PF1 fragment (Cain et al., 2005) were kindly provided by Dr. Stuart Cain (University of Manchester, UK).

CHRDL2 was biotinylated with EZ-link NHS-PEG4-Biotin (Thermo Fisher Scientific), by incubating with EZ-link NHS-PEG4-Biotin at a 1:10 molar ratio for 30 minutes at room temperature. Free biotin was removed using a 7kDa MWCO Zeba spin desalting column (Thermo Fisher Scientific). Flat-bottomed clear Immulon 4 HBX coated microtitre plates (Thermo Fisher Scientific) were coated with 100 µl of the protein to be screened at 200 nM, 100 nM, 50 nM and 25 nM in TBS+Ca buffer (10 mM Tris, 150 mM NaCl and 1 mM

CaCl2, pH 7.4) overnight at 4°C. Control wells coated with 4% BSA were used for controls. Nonspecific binding sites were blocked with 100 µl TBS+Ca containing 4% BSA at room temperature for at least 4 hours. Plates were then washed three times with TBS+Ca, 0.1% BSA. 100 µl 100 nM biotinylated CHRDL2 was added in TBS+Ca buffer and incubated overnight at 4 °C. Plates were washed three times and incubated with 100 µl 1:500 dilution of extravidin peroxidase conjugate in TBS+Ca at room temperature for 15 minutes. Wells were then washed four times. Bound protein was quantified by adding 100 µl 40 mm 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) solution (Sigma) for 10 minutes at room temperature. Plates were read at a wavelength of 405 nm. Readings were normalised to the absorbance of wells coated with BSA. All experiments were performed in triplicate.

2.8.2 Surface plasmon resonance

Surface plasmon resonance (SPR) binding analyses were performed using a ProteOn XPR36 (Bio-Rad) with a ProteOn GLC sensor chip (Bio-Rad). Tsg was immobilised on

65 the sensor chip in 50 mM sodium acetate pH 4.0 via amine-coupling using an EDC/NHS chemical cross-linker following the manufacturer's instructions and subsequently blocked with ethanolamine. SPR was performed at 25°C in 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% Tween-20, pH 7.4 with a flow rate of 50 μl/min. Regeneration was performed with 0.1 M glycine pH 2.5. For kinetic analysis, analytes were injected at several concentrations onto immobilised ligands. Kinetic constants were calculated using either kinetic or equilibrium analysis. For kinetic analysis, constants were calculated by nonlinear fitting of a Langmuir 1:1 binding model to the experimental data using the ProteOn Manager. Calculated kinetic constants included the association rate constant (ka), the dissociation rate constant (kd) and the equilibrium dissociation rate constant (Kd). Kd was derived from the ratio of kd to ka. For equilibrium analysis, the maximum response was plotted against analyte concentration, and the Kd was taken as the analyte concentration corresponding to half the maximal response. All experiments were performed in triplicate and the mean Kd given with the standard deviation.

2.8.3 Microscale thermophoresis

For microscale thermophoresis (MST) Tsg was fluorescently labelled for interaction analysis with a titration series of chordin fragments. Tsg was labelled via amine coupling using the Monolith NT Protein Labelling Kit Red-NHS (NanoTemper Technologies). Unbound fluorophore was removed using a desalting column equilibrated with MST buffer (50 mM Tris, 150 mM NaCl, 10 mM MgCl2, 0.05% Tween-20 pH 7.4). For vWC1, 1:1 serial dilutions of vWC1 at a starting concentration of 7 μM in MST buffer were mixed 1:1 with 15 nM NT647-labelled Tsg. For ΔN-chordin, 1:1 serial dilutions of ΔN- chordin at a starting concentration of 9 μM in MST buffer were mixed 1:1 with 9 nM NT647-labelled Tsg. Samples were loaded into standard treated capillaries and analysed using the Monolith NT.115Pico (NanoTemper Technologies) at 20% LED power and 20% MST power. The Kd was calculated using MO.Affinity Analysis software (NanoTemper Technologies) using the “kd model” option.

2.8.4 Bio-layer interferometry

A screen for binding of a number of extracellular matrix proteins with CHRDL2 was performed using the Octet96 system (ForteBio, Inc.). Recombinant human BMP-4 and recombinant human Syndecan-4 both expressed in a mouse myeloma cell line and purified without the addition of BSA (carrier free) were purchased from R&D systems. Purified recombinant human fibronectin III 7-14 fragment (Cheng et al., 2018), and the fibrillin-1 fragments PF1 fragment (Cain et al., 2005) were kindly provided by Dr. Stuart Cain (University of Manchester, UK).

66 The Octet requires immobilisation of a protein (the load) to biosensors that are then moved between wells containing potential binding partners (the analyte) and buffer. Load proteins were biotinylated to enable immobilisation on High Precision Streptavidin Biosensors (ForteBio, Inc.). The load proteins (CHRDL2 and Tsg) were biotinylated with EZ-link NHS-PEG4-Biotin (Thermo Fisher Scientific) at a 3:1 molar ratio for 30 minutes at room temperature. Free biotin was removed using a 7kDa MWCO Zeba spin desalting column (Thermo Fisher Scientific). All experimental stages were carried out at 30°C, using a buffer of 10 mM HEPES, 150 mM NaCl, 0.02% (v/v) Tween-20, pH 7.4. For analysis of BMP-4 binding, experiments were performed in 10 mM HEPES, 500 mM NaCl, 0.05% (v/v) Tween-20, pH 7.4. Regeneration was performed with 0.1M glycine pH 2.5. Biotinylated CHRDL2 and Tsg were immobilised to the sensors to a level of 0.7 nm. Different concentrations of candidate proteins were applied to the sensor for 300 s (the association phase) and washed (the dissociation phase) for 300 s. All experiments were run in parallel with a set of sensors without prior immobilisation of CHRDL2 to act as reference sensors. Reference traces were then subtracted from sample traces. All experiments were performed in triplicate.

2.9 Structural analysis 2.9.1 Homology modelling

Homology models of individual CHRDL2 vWC domains for use in Ensemble Optimisation Method modelling (EOM, see section 2.9.3) were generated using the SWISSMODEL server (Waterhouse et al., 2018). The domain boundaries were taken from those designated on the UniProt website (UniProt ID: Q6WN34). The homology models chosen were those with the most favourable QMEAN score and greatest sequence coverage. CHRDL2 vWC1 (CHRDL2 residues 31-96) and vWC2 (CHRDL2 residues 109-175) used the CCN3 vWC domain as a template (PDB ID: 5nb8), and the vWC3 domains (CHRDL2 residues 250-315) used the collagen IIA vWC domain as a template (PDB ID: 5nir). For full-length CHRDL2, homology modelling was attempted using the I-TASSER server (Yang et al., 2015). However, this did not produce a homology model that included regions outside the predicted vWC domains with confidence, and so was not used. However, I-TASSER uses PSI-PRED to predict secondary structure as part of its analysis, and this was used for comparison to Circular Dichroism spectral data.

2.9.2 Small angle X-ray scattering

Small angle X-ray scattering (SAXS) data were collected at beamline B21, Diamond Light Source, Oxfordshire, UK. Inline SEC-SAXS was used as this facilitates SAXS

67 analysis of a sample as it is eluting from a size exclusion column. For the CHRDL2/Tsg complex, CHRDL2 and Tsg were mixed to final concentrations of 53 M and 106 M, respectively, and incubated for 30 minutes at room temperature prior to SEC-SAXS. For SAXS experiments of CHRDL2 and Tsg individually, proteins were diluted with SEC running buffer to the same final concentrations as they were present in the CHRDL2/Tsg incubation. SEC was performed using a Superdex200 increase 3.2/30 GL column (GE Healthcare) at 0.075 ml/min in 10 mM HEPES, 150 mM NaCl, pH 7.4. Frames were collected every 3 seconds. Data were collected using a wavelength of 1 Å, a Pilatus 2M detector at a distance of 4 m, and a q range between 0.0037 and 0.37 Å-1. Measurements were made at 25 °C. Data were reduced using in-house software.

2.9.3 Small angle X-ray scattering data analysis

Buffer subtraction and analysis was performed using the ScÅtter software package (www.bioisis.net).

For the CHRDL2/Tsg complex the frames of the major peak were chosen based on the Durbin-Watson auto-correlation analysis, using the ‘SIMILARITY?’ option in the ‘Subtract’ tab of ScÅtter. Frames across the signal plot peak were chosen for analysis based on them having a Durbin-Watson statistic of 2 with neighbouring frames, and which gave a flat line when the Radius of Gyration was plotted for each frame. Ab initio bead modelling was performed with DAMMIF (Franke et al., 2017) through the ScÅtter graphical user interface. DAMMIF was used in slow mode with P1 symmetry to generate 13 models. In the ScÅtter DAMMIF functionality, bead models are automatically passed into the DAMAVER suite (Franke et al., 2017) for comparison and generation of an averaged, filtered bead model (the DAMFILT model) based on their normalised spatial discrepancy (NSD). Two models are considered systematically different if their NSD > 1.

Due to CHRDL2 being flexible the Ensemble Optimisation Method (EOM) in the ATSAS suite (Franke et al., 2017) was used to generate an ensemble of structures that best represent the experimental CHRDL2 SAXS data. The input files for EOM were the CHRDL2 amino acid sequence, homology models of the individual vWC domains (see section 2.9.1) and the buffer subtracted scattering data. EOM was run with the native- like chain type option, all other settings were default, to generate 10000 models (the ‘general pool’). EOM then selects a subset of models (the ‘selected pool’) that together best represent the experimental SAXS data.

Ab initio modelling of the CHRDL2/Tsg complex using the SAXS data was performed using MONSA in the ATSAS suite (Franke et al., 2017). MONSA is bead modelling software that enables use of scattering data of the individual components, as well as

68 scattering data of the complex, to generate a three-dimensional bead model of the complex. All default values were used. Six independent runs of MONSA were performed. DAMAVER was used for comparison and generation of an averaged bead model of CHRDL2. The six MONSA models were then aligned based on the CHRDL2 volume using published scripts (Rambo, 2015) to allow visual comparison of the position of Tsg in the complex relative to the averaged CHRDL2 model.

2.9.4 Negative stain transmission electron microscopy

The peak fraction from SEC-MALS of the CHRDL2/Tsg complex (see section 2.7.3) was diluted to 1 M, assuming a 1:1 molar stoichiometry, in SEC-MALS buffer (10 mM HEPES, 150 mM NaCl, pH 7.4) to make grids for negative stain transmission electron microscopy (TEM). Carbon coated 400 mesh copper grids (Agar Scientific) were glow discharged at 25 mA for 30 seconds using a K100X Glow Discharger (EMITECH). After glow discharging, 3 μl of CHRDL2/Tsg was absorbed onto the copper grid for 1 minute. The grid was then washed with 60 µl 2% uranyl acetate and excess uranyl acetate was wicked off the grid surface with filter paper, before leaving the grid to air dry.

Grids were analysed using a Tecnai 12 Biotwin electron microscope (FEI) with a tungsten filament at an operating voltage of 100kV. Images were recorded at a magnification of 30000x onto a Gatan Orius 2,048 x 2,048 pixel Charge Coupled Device (CCD) camera, giving a sampling of 2.1 Å/pixel. Images were recorded between -0.5μm and -1μm defocus range.

Images were analysed using the EMAN 2.0 software suite (Tang et al., 2007). 15771 particles were picked with the swarm setting using a box size of 128 pixels, and processed with a box size of 150 pixels. Contrast Transfer Function (CTF) parameters were estimated before particles were CTF corrected by phase flipping. Particles were binned to 4.2 Å/pixel and a Gaussian mask (outer radius = 22) was applied to particles. Particles were aligned and averaged over 8 iterations to generate 200 two-dimensional class sum images. Classes with poor contrast to background were discarded, leaving 134 class averages which were used to build 10 initial models. An initial model was chosen that best resembled the picked particles, and a final three-dimensional reconstruction was generated by 6 iterative rounds of refinement. The resolution of the model was estimated using the Fourier shell correlation (FSC) of two independently refined half-maps taken at the 0.5 threshold.

69 2.9.5 Cryo-transmission electron microscopy grid preparation

Grid preparation for cryo-transmission electron microscopy (cryo-TEM) was performed in the Electron Microscopy Facility in the Faculty of Biology, Medicine and Health at the University of Manchester, UK. For the first batch of grids, in which the Tsg/CHRDL2 complex was not SEC purified, CHRDL2 and Tsg were mixed to final concentrations of 7 M and 14 M, respectively, and incubated at room temperature for one hour prior to grid making. Quantifoil R2.2 copper grids with a 400 mesh were glow discharged at 25 mA for two minutes using a K100X Glow Discharger (EMITECH). After glow discharging, 3 μl protein was pipetted onto each grid. The FEI Vitribot blotted the grids for 3.5 seconds, and grids were then plunge frozen in liquid ethane. Frozen grids were stored in liquid nitrogen for imaging. For the grids with the purified complex, CHRDL2 and Tsg were mixed to final concentrations of 6.5 M and 13 M, respectively, and incubated for one hour at room temperature prior to SEC. SEC of the complex was performed using a Superdex200 increase 3.2/30 GL column (GE Healthcare) at 0.05 ml/min in 10 mM HEPES, 150 mM NaCl, pH 7.4., collecting 50 μl elution fractions. Fractions were checked with SDS- PAGE (see section 2.5.4) and the fraction at centre of the SEC peak was used to make grids. Quantifoil R2.2 copper grids with a 400 mesh that had been carbon coated in- house were glow discharged at 25 mA for two minutes using a K100X Glow Discharger (EMITECH). After glow discharging, 3 μl protein was pipetted onto each grid. The FEI Vitribot then blotted the grids for 3.5 seconds, and grids were then plunge frozen in liquid ethane. Frozen grids were stored in liquid nitrogen for imaging.

2.9.6 Cryo-transmission electron microscopy data collection

Cryo-TEM was performed in the Electron Microscopy Facility in the Faculty of Biology, Medicine and Health at the University of Manchester, UK. Images of the two batches of grids were collected under the same conditions. Grids were analysed using the FEI Tecnai Polara with a 300 kV field emission gun and images recorded with a Gatan K2 Summit direct detector. Images were taken in movie-mode at a 31000x magnification, giving a sampling size of 1.24 Å per pixel, over a defocus range of –3 to –5 μm. Images were taken as 12 second movies consisting of 60 frames (0.2 second per frame) at a dose rate of 10 e⁻/Å/second. Images were dose weighted and motion corrected with MotionCor2 (Zheng et al., 2017).

70 2.9.7 Cryo-transmission electron microscopy image analysis

Images were binned to 4.96 Å per pixel for processing. Images were manually inspected and images of the carbon grid support removed.

For the non-purified sample, 2937 particles were picked using Gautomatch (http://www.mrc-lmb.cam.ac.uk/kzhang/) using a Gaussian blob of 200 Å diameter as a template. Two rounds of reference-free two-dimensional classification, each of 25 iterations, were performed in RELION-2 (Kimanius et al., 2016) and the classes with highest contrast were used for further particle picking in Gautomatch, resulting in 106454 particles. Particles were picked for the purified sample using the same method, generating a final dataset of 82500 particles. The two datasets were subsequently processed identically. In the RELION-2 pipeline, CTF parameters were calculated with gCTF (Bell et al., 2016). A final round of 2D classification over 20 iterations was then performed in CryoSPARC (Punjani et al., 2017), sorting particles into 100 classes. Class average particle lengths were measured in Fiji image processing software (Schindelin et al., 2012).

71 3 Results Chapter 1: Investigating the interaction between chordin and Tsg

The mechanism behind the pro- and anti-BMP effects of Tsg on chordin are not known. Cleavage studies suggest Tsg is acting directly on chordin (Troilo et al., 2016), and it is hypothesised that this occurs via a Tsg-induced conformational change in chordin. Direct binding of mouse chordin to Tsg has previously been demonstrated (Zhang et al., 2007), however the region of chordin responsible for high affinity binding has not been identified. Furthermore, despite the interest in the action of Tsg on chordin, a Tsg/chordin complex has not previously been isolated. To this end, a number of chordin fragments were screened for Tsg binding to identify the specific Tsg binding region in chordin. Subsequently a number of strategies were employed with the aim of isolating a homogenous, monodisperse N-chordin/Tsg complex in sufficient amounts to allow structural analysis.

3.1 Purification of Tsg Tsg was purified with an established protocol from a previously generated HEK293-

EBNA cell line recombinantly expressing His6-tagged human Tsg (Troilo, 2014). Conditioned media was passed over a nickel affinity column and washed with 10 mM HEPES, 500 mM NaCl, 10 mM imidazole, pH 7.4 to remove non-specifically bound protein. Bound protein was eluted with a buffer of 10 mM HEPES, 500 mM NaCl, 500 mM imidazole, pH 7.4. SDS-PAGE analysis of the input, flow-through, wash and elution fractions was used to assess the protein in each fraction (Figure 3-1A). Reducing coomassie-stained SDS-PAGE of the fractions showed the predominant species in the elution fractions formed a broad band at ~30 kDa. To further purify this species from the nickel affinity fractions, size exclusion chromatography was used with the aim of removing contaminants of different size. Size exclusion chromatography was performed using a Superdex200 Increase 10/30 GL column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4, and protein elution was monitored by absorption at 280 nm. A single peak was observed at an elution volume of 14.5 ml (Figure 3-1B), indicating the purified protein exists as a single monodisperse species in solution. The size exclusion peak fractions were analysed with reducing SDS-PAGE (Figure 3-1C). This showed the protein in a broad band, consistent with the heavy glycosylation of Tsg and glycoforms of Tsg previously documented (Troilo, 2014). SDS-PAGE analysis in non-reducing conditions showed the presence of a single broad band at a molecular weight of ~30 kDa, indicating proper disulphide bond formation (Figure 3-1D). Anti-His6 western blot

72 analysis confirmed this species had a His6 tag (Figure 3-1E). This was consistent with previous purifications of Tsg from this cell line (Troilo, 2014, Troilo et al., 2016).

Figure 3-1 Purification of Tsg. (A) Coomassie-stained reducing SDS-PAGE of fractions from nickel affinity chromatography performed with conditioned media collected from HEK293-EBNA cells expressing recombinant Tsg. Fractions analysed are the column input (IN), flow-through (FT), wash (W) and 0.5 ml elution fractions. (B) SEC of an affinity chromatography elution fraction using a Superdex200 Increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored with absorbance at 280 nm. The dotted lines indicate the fractions analysed in (C). (C) Coomassie stained reducing SDS-PAGE of SEC elution fractions. (D) Coomassie stained SDS-PAGE under reducing (+βME, with β-mercaptoethanol) and non- reducing (-βME, without β-mercaptoethanol) conditions. (E) Anti-His6 western blot analysis following reducing SDS-PAGE of SEC elution fractions.

3.2 Purification of chordin fragments For binding analysis, a number of recombinant chordin fragments were purified from HEK293-EBNA cell lines (Figure 3-2). The fragments used were N-chordin (chordin without the first vWC domain), vWC1, vWC2-3 (the second and third vWC domains), and vWC1-4CHRD (chordin without the three C-terminal vWC domains). N-chordin was used in place of full-length chordin due to the higher purity of protein that could be

73 isolated; the full-length protein undergoes cleavage producing a mix of full-length and N-chordin that cannot be separated with SEC (Troilo et al., 2014, Troilo, 2014). All DNA constructs other than vWC1 had been made and used to generate stably transfected HEK293-EBNA cell lines prior to this project (Troilo et al., 2014, Troilo et al., 2016). All chordin fragments were purified with the same two-step purification protocol of nickel affinity chromatography and SEC as was used for Tsg.

Figure 3-2 Schematic of the recombinant chordin fragments used in binding analysis. vWC domains are depicted in blue and numbered, CHRD domains are depicted in purple. The affinity tags are the polyhistidine tag (His6) and the Strep tag (WSHPQFEK), and are displayed according to whether they are at the protein N- or C-terminus.

3.2.1 Purification of N-chordin

For purification of N-chordin, 2M urea was used in the nickel affinity chromatography buffers to prevent co-purification of the 4CHRD-vWC2-3 cleavage product via its association to N-chordin. Conditioned media from HEK293-EBNA cells expressing recombinant His6-tagged N-chordin was passed over a nickel affinity column and washed with a buffer of 10 mM HEPES, 500 mM NaCl, 10 mM imidazole, 2M urea, pH 7.4 to remove non-specifically bound protein. Bound protein was eluted with 10 mM HEPES, 500 mM NaCl, 500 mM imidazole, 2M urea, pH 7.4. SDS-PAGE analysis of the input, flow-through, wash and elution fractions was used to assess the protein in each fraction (Figure 3-3A). Reducing coomassie-stained SDS-PAGE showed the predominant species in the elution fractions formed a broad band around 90 kDa. Size exclusion chromatography was then used to separate this protein from contaminants in the nickel affinity fractions. Size exclusion chromatography was performed using a Superdex200 Increase 10/30 GL column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4, and protein elution was monitored by absorption at 280 nm. Protein eluted in a sharp peak observed at an elution volume of 11 ml (Figure 3-3B), indicating the purified protein exists as a monodisperse species in solution. The peak size exclusion

74 fraction was analysed with SDS-PAGE in the presence and absence of β- mercaptoethanol (βME) (Figure 3-3C). SDS-PAGE analysis in both reducing and non- reducing conditions showed the presence of a broad band at a molecular weight of around 90 kDa, consistent with the predicted mass of 86.9 kDa based on the peptide sequence. Another minor species was observed at around 200 kDa under non-reducing conditions, suggesting this is a disulphide linked dimer. Anti-His6 western blot analysis confirmed the 90 kDa species had a His6-tag (Figure 3-3D). This agreed with previous N-chordin purifications from this cell line (Troilo et al., 2014).

Figure 3-3 Purification of N-chordin. (A) Coomassie-stained reducing SDS-PAGE of fractions from nickel affinity chromatography using conditioned media from HEK293-EBNA cells expressing recombinant His6-tagged ΔN-chordin. Fractions analysed are the column input (IN), flow-through (FT), wash (W) and 0.5 ml elution fractions. (B) Trace of SEC of a nickel affinity chromatography elution fraction using a Superdex200 increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored with absorbance at 280 nm. The dotted lines indicate the fraction analysed in (C). (C) Coomassie stained SDS-PAGE analysis of the peak SEC elution fraction under reducing (with β-mercaptoethanol, +βME) and non-reducing

(without β-mercaptoethanol, -βME) conditions. (D) Anti-His6 western blot of reducing SDS-PAGE of the SEC peak elution fraction.

75 3.2.2 Purification of smaller chordin fragments

The smaller chordin fragments, vWC1-4CHRD, vWC2-3 and vWC1, were purified following the same protocol as Tsg, in which the nickel affinity chromatography buffers did not contain urea. In the purification of the vWC1-4CHRD construct, reducing SDS-PAGE analysis of nickel affinity chromatography fractions revealed the presence of two distinct species around 60 kDa and 70 kDa (Figure 3-4A). The larger species is likely vWC1-4CHRD which has a predicted molecular weight based on the peptide sequence of 73.0 kDa. The smaller species is likely the tolloid cleavage product 4CHRD as the loss of a vWC1 domain would cause a decrease in mass of 10 kDa. As cleavage of the vWC1 domain from this construct is at the N-terminus, 4CHRD would still have the C-terminal His6-tag and so would be co-purified during nickel affinity chromatography. Size exclusion chromatography of a nickel affinity elution fraction showed a single broad peak over an elution volume from 12 ml to 15 ml, indicating the two species observed in affinity chromatography were not fully resolved on the size exclusion column (Figure 3-4B). This was confirmed by reducing SDS-PAGE analysis of the size exclusion peak fractions (Figure 3-4C). Under non-reducing conditions these migrated faster on SDS- PAGE, suggesting intramolecular disulphide bonds increase the compactness of the protein (Figure 3-4D). Also observed under non-reducing conditions were two minor bands at around 120 kDa, suggesting the presence of disulphide-linked dimers resulting from overexpression. However, these were present in much lower amounts than the proteins at 60 kDa and 70 kDa. Western blot analysis confirmed both these proteins were His6-tagged (Figure 3-4E). SEC-MALS previously performed on this construct also showed these species eluted in a single peak and gave a molecular weight of 77.4 kDa (Dr. Darin Hassan, University of Manchester; data not shown), indicating vWC1-4CHRD is a monomer in solution. Fractions containing only vWC1-4CHRD, the upper band observed in SDS-PAGE, were used for subsequent binding analysis.

Figure 3-4 Purification of vWC1-4CHRD. (A) Coomassie-stained reducing SDS-PAGE of nickel affinity chromatography elution fractions from conditioned media from HEK293-EBNA cells expressing recombinant His6-tagged vWC1-4CHRD. (B) SEC of a nickel affinity chromatography elution fraction using a Superdex200 increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored with absorbance at 280 nm. The dotted lines indicate the fractions analysed in (C). (C) Coomassie stained reducing SDS-PAGE analysis of the SEC elution fractions (D) Coomassie stained SDS-PAGE analysis under reducing (with β- mercaptoethanol, +βME) and non-reducing (without β-mercaptoethanol, -βME) conditions. (E)

Anti-His6 western blot analysis of the purified species following reducing SDS-PAGE.

The vWC1 domain construct was generated as part of this thesis. Chordin vWC1 was cloned into the same pCEP-Pu/Ac7 vector that was used for the recombinant expression of the N-chordin and vWC1-4CHRD constructs. This vector added a C- terminal His6 tag to vWC1, allowing the same purification protocol to be used as the other chordin constructs expressed in this vector. Reducing SDS-PAGE analysis of the nickel affinity chromatography elution fractions showed the presence of a major band around 10 kDa, consistent with the predicted vWC1 molecular weight based on sequence of 10.1 kDa (Figure 3-5A), which eluted from the nickel affinity column with contaminants of larger size. Size exclusion chromatography of the nickel affinity elution

77 fraction using a Superdex75 Increase 10/30 GL column (GE Healthcare) showed peaks at elution volumes between 8 ml and 10 ml, these peaks likely contained the contaminants of larger mass. A prominent peak was observed around 15 ml (Figure 3-5B). SDS-PAGE analysis showed the size exclusion peak contained a doublet around

10 kDa. Both bands of the doublet had His6-tags (Figure 3-5D), and tryptic-digest mass spectrometry detected peptide fragments from chordin vWC1 for both bands (Appendix 7). SEC-MALS of an SEC fraction containing the doublet showed a single peak at an elution volume of 15 ml and calculated a molecular mass of 11.4 kDa, indicating the species co-elute but are monomeric (Figure 3-5E).

Figure 3-5 Purification of chordin vWC1. (A) Coomassie stained reducing SDS-PAGE of nickel affinity chromatography elution fractions from conditioned media of HEK293-EBNA cells expressing vWC1. (B) SEC of a nickel affinity chromatography elution fraction using a Superdex75 increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored with absorbance at 280 nm. The dotted lines indicate the fractions analysed in

(C). (C) Coomassie stained reducing SDS-PAGE of the SEC peak elution fractions (D) Anti-His6 western blot analysis following reducing SDS-PAGE of a size exclusion peak elution fraction. (E) SEC-MALS analysis of a SEC fraction containing the vWC1 doublet performed with a Superdex75 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Relative differential refractive index (dRI) is shown in black on the left y-axis. Molecular mass is shown in red on the right y-axis.

78 The recombinant vWC2-3 construct was purified via its His6-tag. Nickel affinity chromatography with conditioned media from HEK293-EBNA cells expressing the vWC2-3 construct revealed a prominent band around 20 kDa (Figure 3-6A). Size exclusion chromatography of a nickel affinity elution fraction using a Superdex75 Increase 10/30 GL column (GE Healthcare) produced a broad peak between 11 and 14 ml (Figure 3-6B). SDS-PAGE analysis showed fractions across this peak to only consist of the 20 kDa species (Figure 3-6C). The broadness of the peak may result from some self-association on the column causing vWC2-3 to elute as a mix of monomers and dimers, and hence broaden the peak. Western blot analysis confirmed this species had a His6-tag (Figure 3-6D). SEC-MALS was used to analyse the molecular mass of purified vWC2-3. On SEC-MALS a single peak was observed during purification (Figure 3-6E) with a calculated mass of 24.3 kDa across the peak, slightly larger than the 20.8 kDa predicted from the peptide sequence.

Figure 3-6 Purification of chordin vWC2-3. (A) Coomassie-stained reducing SDS-PAGE of nickel affinity chromatography fractions using conditioned media from HEK293-EBNA cells expressing His6-tagged vWC2-3. Fractions analysed are the column input (IN), flow-through (FT), wash (W) and 0.5 ml elution fractions. (B) SEC of a nickel affinity chromatography elution fraction using a Superdex75 increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored with absorbance at 280 nm. The dotted lines indicate the fractions analysed in (C). (C) Coomassie stained reducing SDS-PAGE of the SEC elution fractions. (D)

Anti-His6 western blot of reducing SDS-PAGE of the SEC elution fraction. (E) SEC-MALS analysis of a vWC2-3 SEC fraction performed with a Superdex75 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Relative differential refractive index (dRI) is shown in black on the left y-axis. Molecular mass is shown in red on the right y-axis.

80 3.3 Binding analysis of chordin fragments to Tsg To identify the region of chordin responsible for binding to Tsg, SPR was used. Tsg was immobilised onto a sensor chip surface via amine coupling and the different chordin fragments passed over the sensor as analytes in a running buffer of 10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% Tween-20, pH 7.4 (Figure 3-7 and Figure 3-8). Analytes were perfused over the sensor for 120s, the association phase, followed by perfusion of running buffer for 400s, the dissociation phase. To produce the background subtracted sensorgram, traces from parallel experiments run with a control sensor on which no protein had been immobilised were subtracted from those of the Tsg immobilised sensor.

3.3.1 Binding of large chordin fragments to Tsg

N-chordin was perfused over the sensor over a concentration range of 0-60 nM (Figure 3-7A). The resultant SPR sensorgram fitted a simple Langmuir 1:1 binding model, and a

Kd of 3.1 nM  0.4 nM was calculated. This indicates human N-chordin binds Tsg in a high affinity interaction. For binding analysis of vWC1-4CHRD, fractions containing only the full vWC1-4CHRD, not the 4CHRD cleavage product, were used. The vWC1-4CHRD construct was perfused over the sensor over a concentration range of 0-800 nM (Figure 3-7B). The SPR sensorgram showed that whilst a response was detected, the association and dissociation phases displayed a sharp rise and fall, indicating high on- and off-rates for the interaction. Additionally, the response was comparatively small based on the large vWC1-4CHRD concentrations used and was not approaching saturation at these concentrations, as such a Kd could not be determined. These observations suggest vWC1-4CHRD and Tsg form a very low affinity interaction.

Figure 3-7 SPR binding analysis of large chordin fragments to Tsg. (A) Representative sensorgram of N-chordin injected at concentrations up to 60 nM over Tsg immobilised to 300 RU in the ProteOn SPR system. The sensorgram has been background subtracted, in which the response from a control cell with no immobilised protein is subtracted. In black are the Langmuir

1:1 binding fits used to calculate Kd. Kd = 3.1 nM  0.4 nM, n = 3. (B) Representative background subtracted sensorgram of vWC1-4CHRD injected at concentrations up to 800 nM over Tsg immobilised to 500 RU.

3.3.2 Binding of small chordin fragments to Tsg

The large fragment binding experiments suggested vWC1 and the 4CHRD region were not responsible for high affinity binding to Tsg. With the observation that N-chordin binds Tsg with high affinity, this suggests a high affinity binding region is located in the chordin C-terminal region. However, it is also possible that the 4CHRD region occludes a high affinity interaction between vWC1 and Tsg. To investigate this, SPR was performed with vWC1 and vWC2-3 as analytes over immobilised Tsg. Perfusion of vWC2-3 over immobilised Tsg over a concentration range of 0-150 nM, produced an SPR sensorgram that deviated from the Langmuir 1:1 binding mode

(Figure 3-8Ai), and so equilibrium analysis was performed. The binding constant, Kd, was calculated by determining the vWC2-3 concentration that produced a half maximal

82 response (Figure 3-8Aii). This calculated a Kd of 26.4  4.4 nM, indicating vWC2-3 binds Tsg with high affinity. Perfusion of vWC1 over immobilised Tsg over a concentration range of 0-200 nM, produced an SPR sensorgram with a biphasic dissociation phase (Figure 3-8Bi). This is indicative of the occurance of a second interaction after the initial vWC1-Tsg interaction. This may be the binding of vWC1 to a second site on Tsg, or vWC1 self-association.

Equilibrium analysis calculated a Kd of 48.2  3.1 nM (Figure 3-8Aii). However, this will be an overestimate of affinity, as the graph of maximal response against vWC1 concentration (Figure 3-8Bii), from which the Kd is derived, had not reached a plateau. These data indicate vWC1 does interact with Tsg but with a lower affinity than vWC2-3.

Figure 3-8 SPR binding analysis of small chordin fragments to Tsg. (Ai) Representative background subtracted sensorgram of vWC2-3 injected at concentrations up to 150 nM over Tsg immobilised to 300 RU in the ProteOn SPR system. (Aii) vWC2-3 equilibrium analysis. The maximum response of each trace was plotted against vWC2-3 concentration, and Kd is the vWC2-3 concentration producing half the maximal response. Kd = 26.4  4.4 nM. N = 3, error bars show standard deviation. (Bi) Representative background subtracted sensorgram of vWC1 injected at concentrations up to 200 nM over Tsg immobilised to 500 RU in the ProteOn SPR system. (Bii) vWC1 equilibrium analysis, as in (Aii). Kd = 48.2  3.1 nM. N = 3, error bars show standard deviation.

83 3.3.3 MST binding analysis

The interaction of vWC1 with Tsg was also investigated in solution with MST. MST performs binding analyses based on changes in thermophoresis of a molecule, the directed movement of a molecule in a temperature gradient, in the presence of a ligand. In an MST experiment, thermophoresis of a fluorescent molecule at a constant concentration is induced and detected in the presence of a ligand, over a dilution series, in solution. Thermophoresis is monitored via the change in fluorescence in a specific area and reported as Fnorm, the normalised fluorescent signal in the given area. Molecules can move into or out of the temperature gradient. If the ligand binds, the fluorescence signal will alter in a concentration-dependent manner, producing a binding curve when Fnorm is plotted as a function of ligand concentration (Jerabek-Willemsen et al., 2014). The binding curve can have a negative or positive gradient depending on the direction of movement within the temperature gradient. In this case, Tsg was fluorescently labelled via amine coupling and thermophoresis detected over a broad concentration of either N-chordin or vWC1. Thermophoresis of fluorescently labelled Tsg at a concentration of 9 nM was measured over a dilution series of N-chordin with a starting concentration of 9 M. A plot of Fnorm as a function of N-chordin showed a characteristic sigmoid curve, indicative of binding, from which the

Kd was calculated. A Kd of 42.6  5.2 nM was calculated, confirming the high-affinity interaction between N-chordin and Tsg (Figure 3-9A). For MST analysis of vWC1, thermophoresis of fluorescently labelled Tsg at a concentration of 15 nM was measured over a dilution series of vWC1 with a starting concentration of 7 M. Again, this produced a sigmoid curve, indicating ligand binding (Figure 3-9B). A Kd of 322  134 nM was calculated, showing vWC1 does bind Tsg in solution but is a low affinity interaction site on chordin.

The binding constants calculated by SPR were smaller than those calculated by MST, and may reflect differences between solution and solid phase interactions. However, the relative values of MST and SPR both show the high affinity binding of N-chordin to Tsg, with a lower affinity interaction between vWC1 and Tsg. The interaction between vWC2-3 and Tsg could not be analysed with MST, as it was not possible to concentrate vWC2-3 to the concentrations required for MST. These binding experiments identify the chordin C-terminal region as the high affinity binding region. A lower affinity interaction between vWC1 and Tsg was identified, with the vWC1 binding site occluded in vWC1- 4CHRD. It remains possible that vWC4 also contributes to the interaction between chordin and Tsg.

Figure 3-9 MST binding analysis of chordin fragments to Tsg. Thermophoresis was plotted as normalised fluorescence, Fnorm, as a function of N-chordin concentration. The Kd is the ligand concentration at which half the Fnorm is half maximal. (A) MST data for the binding of N-chordin to Tsg. Thermophoresis of fluorescently labelled Tsg at 9 nM was measured over a dilution series of N-chordin with a starting concentration of 9 M. Kd = 42.6  5.2 nM. N = 3, error bars show standard deviation. (B) MST data for the binding of vWC1 to Tsg. Thermophoresis of fluorescently labelled Tsg at 15 nM was measured over a dilution series of vWC1 with a starting concentration of 7 M. Kd = 322  134 nM. N = 3, error bars show standard deviation.

3.4 Isolating a Tsg/N-chordin complex

3.4.1 Size exclusion chromatography of Tsg/N-chordin

SEC is commonly used to isolate monodisperse protein complexes. Prior to SEC, Tsg and N-chordin were mixed at a 2:1 molar ratio in 10 mM HEPES, 150 mM NaCl, pH 7.4 and incubated for 1 hour at room temperature. The Tsg/N-chordin sample was

85 then passed through a Superdex200 increase 3.2/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4 and eluted fractions collected for SDS-PAGE analysis (Figure 3-10). The SEC trace showed the presence of two elution peaks (Figure 3-10A), and SDS- PAGE confirmed these to be N-chordin and Tsg eluting separately (Figure 3-10B). A small shoulder to the left of the N-chordin peak was likely a Tsg/N-chordin complex, however the amounts of protein were too low to observe with SDS-PAGE. When N- chordin from the same sample was subject to SEC alone under the same conditions, no shoulder was observed on the peak (Figure 3-10C), supporting the observed shoulder of the peak being a N-chordin/Tsg complex, and not a N-chordin dimer. However, N-chordin and Tsg eluted predominantly as individual species under SEC. Multiple attempts were made with different batches of protein, however N-chordin and Tsg consistently eluted as separate species.

Figure 3-10 Size exclusion chromatography of a Tsg/N-chordin mixture. (A) SEC of a preincubated ΔN-chordin and Tsg sample using a Superdex200 increase 3.2/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored by absorbance at 280 nm. Prior to SEC, ΔN-chordin and Tsg were mixed at a 1:2 molar stoichiometry and incubated at room temperature for 1 hour. Dotted lines indicate the elution volume analysed in (B). (B) Coomassie stained reducing SDS-PAGE of 50 μl elution fractions from (A). (C) Overlay of the size exclusion traces observed for ΔN-chordin and the preincubated ΔN-chordin/Tsg sample performed consecutively using the same Superdex200 increase 3.2/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4.

86 3.4.2 Crosslinking Tsg and N-chordin

To increase the proportion of a Tsg/N-chordin complex relative to the individual species, crosslinking was used. For this the BS3 crosslinker was used, which forms covalent amine crosslinks. The BS3 crosslinker was chosen as this is the water soluble analogue of the DSS crosslinker used previously with chordin, Tsg and BMPs (Oelgeschlager et al., 2000, Larrain et al., 2001). Tsg and N-chordin were preincubated at a 3:1 molar ratio for 1 hour at room temperature. BS3 was then added at a 50:1 crosslinker:protein molar ratio and incubated at room temperature for 30 minutes, before quenching with Tris buffer. Crosslinking was analysed with SDS-PAGE (Figure 3-11). A species of ~110 kDa was observed solely in the Tsg/N-chordin/BS3 sample, indicating this was a crosslinked 1:1 Tsg/N-chordin complex. However, this sample also contained significant proportions of Tsg, and monomeric and dimeric N-chordin, and so further purification of the Tsg/N-chordin complex would be required.

Figure 3-11 Tsg and N-chordin crosslinking. Coomassie-stained reducing SDS-PAGE of the ΔN-chordin and Tsg sample after BS3 crosslinking. Tsg and ΔN-chordin were mixed at a 3:1 molar ratio to final concentrations of 12 M and 4 M, respectively, in 10 mM HEPES, 150 mM NaCl, pH 7.4 and preincubated for 1 hour at room temperature. The BS3 crosslinker was added at a 50:1 crosslinker:protein molar ratio, and quenched after 30 minutes.

3.4.3 Size exclusion chromatography of crosslinked Tsg and N-chordin

To purify the crosslinked Tsg/N-chordin complex, a sample of the crosslinking reaction was subject to SEC. The sample was run down a Superdex200 increase 3.2/30 GL

87 column in 10 mM HEPES, 150 mM NaCl, pH 7.4. (Figure 3-12). Two peaks were observed between elution volumes of 1 ml and 1.8 ml in the SEC trace (Figure 3-12A), and elution fractions covering this range were analysed with an anti-His6 blot following reducing SDS-PAGE (Figure 3-12B). This showed the first peak contained an unresolved mix of the Tsg/N-chordin complex, and monomeric and dimeric N- chordin. Monomeric Tsg eluted in the second peak. A large peak was observed over an elution volume of 2 ml to 2.4 ml, this was free BS3 which absorbs strongly at 280 nm. Therefore, it was not possible to separate the Tsg/N-chordin complex from the monomeric and dimeric N-chordin species with SEC.

Figure 3-12 Size exclusion chromatography of the N-chordin/Tsg crosslinking reaction.

(A) SEC of the ΔN-chordin and Tsg BS3 crosslinking reaction using a Superdex200 increase 3.2/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored with absorbance at 280 nm. The enlarged region shows the 50 μl SEC elution fractions analysed in

(B). (Bi) and (Bii) Anti-His6 blot of reducing SDS-PAGE of elution fractions from (A).

3.4.4 Ion exchange chromatography of crosslinked Tsg and N-chordin

IEC was also used to purify the crosslinked Tsg/N-chordin complex. Theoretical isoelectric points (pI) were calculated by inputting peptide sequences of the individual

88 proteins and a 1:1 complex into ExPASy ProtParam (http://web.expasy.org/protparam/). Based on the peptide sequences, the pI values of Tsg and N-chordin were calculated to be 5.6 and 7.7, respectively, and the pI of a 1:1 complex was calculated to be 6.6. A Q sepharose anion exchange column in 10 mM Tris, pH 7.4 was used, under these conditions it is predicted that N-chordin would have net zero charge and so would not bind to the column, whereas Tsg and the Tsg/N-chordin complex would have net negative charges, and so would bind the column, but elute at different salt concentrations. The sample was diluted with 10 mM Tris to reduce the NaCl to a final concentration of 50 mM for column loading. An initial IEC run used an elution protocol of a NaCl gradient from 50 mM to 500 mM over 10 column volumes (Figure 3-13). Protein elution was monitored via absorbance at 280 nm. A large peak was observed at 19 ml, and a second peak was observed at 22 ml (Figure 3-13A). The peak at 19 ml, corresponding to NaCl concentrations from 270 mM to 320 mM, contained monomeric and dimeric N-chordin (Figure 3-13Bi). These species were not predicted to bind to the column, and the peak was much larger than expected (~1000 mAU). The glycosylation of chordin and Tsg may alter their pI values and affect their interactions with the column. Furthermore, the elution of free BS3 bound to the IEC column may account for the large absorbance, as BS3 strongly absorbs at 280 nm. The peak at 22 ml, corresponding to a NaCl concentrations from 370 mM to 420 mM, again contained monomeric and dimeric N-chordin, but also contained the Tsg/N-chordin complex (Figure 3-13Bii). The complex still eluted with the chordin monomers and dimers, potentially due to interactions between chordin and the chordin/Tsg crosslinked species.

Hence, the Tsg/N-chordin complex, and monomeric and dimeric N-chordin all bound the IEC column, however the monomeric and dimeric N-chordin species were eluted from the column by 300 mM NaCl, which did not appear to elute the Tsg/N-chordin complex.

Figure 3-13 Ion exchange chromatography of the N-chordin/Tsg crosslinking reaction.

(A) Ion exchange chromatography of the ΔN-chordin and Tsg crosslinking reaction using a Q sepharose anion exchange column in 10 mM Tris, pH 7.4. Protein was monitored via absorbance at 280 nm (black, left y-axis) over a salt gradient from 50 mM to 500 mM NaCl (green, right y- axis). Fractions analysed in (B) are indicated. (Bi) and (Bii) Anti-His6 blot of reducing SDS-PAGE of elution fractions from (A).

Therefore, a second IEC run was performed with a step gradient. For this run the fractions from the first IEC run containing the complex, fractions between 21 ml and 23 ml, were used. As before, the pooled fractions were diluted with 10 mM Tris to reach a final concentration of 50 mM NaCl for column loading. The protocol consisted of an initial salt gradient from 50 mM to 290 mM over 5 column volumes, followed by a wash step in which NaCl concentration was held at 290 mM for 8 column volumes, followed by a second gradient from 290 mM to 500 mM NaCl over 5 column volumes. The IEC trace showed two peaks across the holding step at 290 mM NaCl, and a peak at 30 ml in the second gradient step (Figure 3-14A). Anti-His6 western blots revealed the first peak contained some of the Tsg/N-chordin complex in addition to the contaminating

90 monomeric and dimeric chordin species, despite the complex remaining bound to the column at this NaCl concentration in the first IEC run. The peak from the second NaCl gradient (elution volume 25-31.5 ml) did contain the complex, but also still contained contaminating species. Therefore, it was not possible to use IEC to separate the crosslinked Tsg/N-chordin from contaminating species using IEC. Glycosylation may alter the surface charges of the various species of the reaction mixture, such that the difference in net surface charge is too small to be used to separate the different species. This may be further complicated by association of contaminating chordin species with the Tsg/N-chordin complex.

Figure 3-14 Ion exchange chromatography of the N-chordin/Tsg crosslinking reaction with a step gradient protocol. (A) IEC of the ΔN-chordin/Tsg crosslinking reaction using a Q sepharose anion exchange column in 10 mM Tris, pH 7.4. Protein elution was monitored via absorbance at 280 nm (black, left y-axis) over a step gradient from 50 mM to 290 mM NaCl over 5 column volumes, followed by a holding step at 290 mM NaCl for 8 column volumes, and a second gradient from 290 mM to 500 mM NaCl over 5 column volumes (green, right y-axis). The fractions analysed in (B) are indicated. (B) Anti-His6 western blots of reducing SDS-PAGE of elution fractions from (A).

92 3.4.5 Isolation of the complex with a Tsg-FLAG construct

Another strategy to purify the crosslinked Tsg/N-chordin complex was to pull-out the complex from the reaction mixture via a differentially tagged Tsg construct. Tsg and the Tsg/N-chordin complex could potentially then be resolved by SEC, due to their size difference. To achieve this, a FLAG-tagged Tsg construct, here named Tsg-FLAG, was generated and purified (Figure 3-15). The His6 tag was retained in this construct, allowing purification via the same strategy as the original recombinant Tsg construct. The purification isolated a species that eluted from a Superdex200 Increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4 at 14 ml (Figure 3-15C). SDS-PAGE showed this species to be around 30 kDa under reducing and non-reducing conditions (Figure 3-15D), consistent with the purification of the original recombinant Tsg construct.

This was confirmed to have both a His6 tag and a FLAG tag (Figure 3-15E).

Figure 3-15 Purification of Tsg-FLAG. (A) Schematic of the Tsg-FLAG construct. (B) Coomassie-stained SDS-PAGE of fractions from nickel affinity chromatography of conditioned media from HEK293-EBNA cells expressing the Tsg-FLAG construct. Fractions analysed are the column input (IN), flow-through (FT), wash (W) and 0.5 ml elution fractions. (C) SEC trace of the affinity chromatography elution fraction using a Superdex200 Increase 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. The dotted lines indicate the fraction analysed in (D). (D) Coomassie-stained SDS-PAGE of the peak SEC elution fraction under reducing (with β- mercaptoethanol, +βME) and non-reducing (without β-mercaptoethanol, -βME) conditions. (E)

Anti-His6 and anti-FLAG western blots of the SEC peak fraction following reducing SDS-PAGE.

Crosslinking of Tsg-FLAG to N-chordin was performed with BS3 under the same reaction conditions as previously (Figure 3-16). SDS-PAGE of the reaction mixture showed the same band pattern as was previously observed, with a species around 110 kDa solely observed in the N-chordin/Tsg-FLAG/BS3 reaction (Figure 3-16A). Western blotting confirmed this species had a FLAG tag (Figure 3-16Bii), and also revealed the presence of larger N-chordin/Tsg-FLAG crosslinked species, in addition to the N- chordin dimer, and a Tsg-FLAG dimer. Uncomplexed Tsg was poorly detected in the anti-His6 blot at the shown exposure (Figure 3-16Bi). Anti-His6 blots containing both Tsg

94 and chordin species indicated the antibody detected N-chordin-His6 with higher sensitivity, and Tsg was only visualised in blots in conditions under which chordin species appeared over-exposed.

Figure 3-16 Crosslinking of N-chordin and Tsg-FLAG. (A) Coomassie-stained reducing SDS-PAGE of the ΔN-chordin and Tsg-FLAG reaction after BS3 crosslinking. Tsg-FLAG and ΔN- chordin were mixed at a 3:1 molar ratio to final concentrations of 12 M and 4 M, respectively, in 10 mM HEPES, 150 mM NaCl, pH 7.4 and preincubated for 1 hour at room temperature. The BS3 crosslinker was added at a 50:1 crosslinker:protein molar ratio, and quenched after 30 minutes. (B) Western blot of reducing SDS-PAGE of the crosslinking reaction with anti-His6 (Bi) and anti-FLAG (Bii) antibodies.

95 An immunoprecipitation with anti-FLAG M2 resin (Sigma) was used to isolate Tsg-FLAG containing species. It was shown that 10 mM HEPES, 1 M urea, 0.5 M NaCl, pH 7.4 was sufficient to wash non-specifically bound ΔN-chordin from the resin, whilst Tsg- FLAG remained bound (Appendix 8). The N-chordin/Tsg-FLAG crosslinking reaction was incubated with the resin overnight, shaking at 4C. The resin was washed with three buffers of increasing NaCl and urea concentrations, three times each. The resin was then boiled in reducing SDS-PAGE loading buffer, and fractions analysed with anti-

His6 western blot (Figure 3-17). This revealed that a large proportion of the reaction components bound weakly to the resin and were in the first two washes. Following the washes, the boiled resin revealed the bound species. This showed the Tsg-FLAG/N- chordin bound the resin, however ΔN-chordin and larger species also bound. As 1M urea was sufficient to wash non-specifically bound ΔN-chordin from the resin, it is possible these species bound to the Tsg-FLAG/N-chordin. 1M urea was used in the wash as this was the highest recommended urea concentration compatible with the resin (Sigma). In the ΔN-chordin purification protocol, 2M urea is used to wash chordin cleavage fragments bound to ΔN-chordin during affinity chromatography (Troilo, 2014), and so higher urea concentrations may be required to remove self-associated chordin species. Hence it was not possible to isolate the N-chordin/Tsg complex in a homogenous sample via immunoprecipitation of Tsg.

Figure 3-17 Immunoprecipitation of the Tsg-FLAG/N-chordin crosslinking reaction. Anti-

His6 western blot of reducing SDS-PAGE of fractions from immunoprecipitation of the N- chordin/Tsg-FLAG crosslinking reaction with FLAG affinity resin. Fractions analysed were resin after incubation with the reaction sample (beads i), supernatant (s/n), three washes each with three buffers (W1 = 10 mM HEPES, 150 mM NaCl, pH 7.4, W2 = 10 mM HEPES, 500 mM NaCl, pH 7.4, W3 = 10 mM HEPES, 500 mM NaCl, 1 M urea, pH 7.4), and resin after washing (beads ii).

96 3.5 Summary and discussion The work in this chapter aimed to characterise the region of chordin responsible for binding to Tsg and isolate a stable N-chordin/Tsg complex for structural analysis. N- chordin, chordin without the first vWC domain, was used due to the higher purity and yield that could be obtained on purification compared to the full-length chordin construct (Troilo, 2014). The binding analyses performed in this chapter were published in Troilo et al., 2016. Recombinant chordin fragments and Tsg were purified for binding analyses from previously generated HEK293-EBNA cell lines. Tsg and N-chordin were purified from previously used cell lines following established protocols (Troilo et al., 2014, Troilo et al., 2016). Purified Tsg had a mass of ~33 kDa (Figure 3-1) and N-chordin had a mass of ~90 kDa (Figure 3-3), consistent with previous characterisations. The vWC1-4CHRD, vWC1 and vWC2-3 fragments were purified using the same purification protocol as Tsg. SEC-MALS of the purified proteins calculated masses of 10.1 kDa and 24.3 kDa for purified vWC1 and vWC2-3, respectively, indicating they both exist as monomers in solution (Figure 3-5 and Figure 3-6).

The binding of the chordin fragments to Tsg was analysed with SPR. Tsg was immobilised onto the sensor surface and chordin fragments used as analytes. The sensorgrams for N-chordin binding to Tsg fit a 1:1 binding model enabling kinetic analysis. Kinetic analysis determined the Kd to be 3.1 nM  0.4 nM, indicating N- chordin binds Tsg with high affinity (Figure 3-7). In contrast, vWC1-4CHRD produced a response but this showed a sharp rise and fall in the association and dissociation phases indicating high on- and off-rates, and did not saturate the sensor at high concentrations. Therefore vWC1-4CHRD may interact with Tsg with very low affinity (Figure 3-7). The N-chordin and vWC1-4CHRD SPR experiments suggested a C- terminal chordin region was responsible for the high affinity interaction with Tsg. To further investigate this, binding of chordin vWC2-3 to Tsg was analysed. This deviated from a 1:1 binding model, and so equilibrium analysis was used. Equilibrium analysis determined the Kd to be 26.4  4.4 nM, indicating vWC2-3 binds Tsg with high affinity and likely makes a large contribution to the binding of chordin to Tsg. To test whether the 4CHRD region occludes high affinity binding of vWC1 to Tsg, the vWC1 domain was also tested for binding. Kinetic analysis could not be performed as the trace deviated from a 1:1 binding model, and so equilibrium analysis was used. Equilibrium analysis determined the Kd to be 48.2  3.1 nM, however, the graph of maximal response as a function of vWC1 concentration had not reached a plateau and so it is likely that the interaction vWC1 to Tsg is weaker than this value suggests. Additionally, MST analysis confirmed the high affinity binding of N-chordin to Tsg (Kd = 42.6  5.2 nM) and the

97 lower affinity binding of vWC1 to Tsg (Kd = 322  134 nM) (Figure 3-9). The SPR traces of vWC1 and vWC2-3 did not fit to 1:1 binding models. This can be indicative of a secondary binding site on the ligand (Tsg) or self-association of the analyte on the sensor. Self-association of vWC domains would not be unexpected, as dimerisation of human N-chordin has previously been reported, with the Kd been determined to be 3.3 M. This is mediated by the vWC domains, as the 4CHRD region shows no self- association (Troilo, 2014). Additionally, vWC domains are known to mediate interactions between different proteins, as has been shown for the interaction between CV-2 and chordin (Zhang et al., 2010). Previous SPR studies have demonstrated a high affinity interaction between chordin and Tsg (Zhang et al., 2007). However, the region within chordin responsible for high- affinity binding had not been identified. Low affinity binding of the individual vWC1, vWC3 and vWC4 domains has previously been observed (Zhang et al., 2007). In contrast, we identified chordin vWC2-3 as a high affinity Tsg-binding region, with chordin vWC1 providing a lower affinity interaction with Tsg. However, the interaction between vWC1 and Tsg appears to be occluded by the 4CHRD region. This is consistent with co-immunoprecipitation of mouse vWC1 and vWC2-3, but not vWC4, by Tsg (Scott et al., 2001). It may be that a binding site spans the vWC2-3 region, hence the lower binding affinity for vWC3 alone observed by Zhang et al. (Zhang et al., 2007). Together the binding analyses in this chapter suggest the chordin C-terminal region is responsible for high affinity binding to Tsg, with vWC2-3 making a large contribution to binding. A lower affinity interaction also occurs between vWC1 and Tsg. It is possible that vWC4 also contributes to high affinity binding to Tsg.

Following identification of a high affinity interaction between N-chordin and Tsg with both SPR and MST, a number of strategies were used to isolate a stable monodisperse N-chordin/Tsg complex. SEC of a pre-incubated N-chordin/Tsg mixture showed the two proteins predominantly eluted in their individual species, however the presence of a shoulder on the chordin elution peak suggested a small proportion did elute as a N- chordin/Tsg complex (Figure 3-10). To stabilise this complex and increase the relative proportions of complex to the monomeric species, covalent crosslinking was employed. The formation of a crosslinked 1:1 N-chordin/Tsg complex was confirmed by SDS- PAGE (Figure 3-11). However, the crosslinked sample still contained large proportions of N-chordin and Tsg as individual species. Furthermore, SDS-PAGE also revealed the formation of a crosslinked N-chordin dimer. Thus, purification of the crosslinked N-chordin/Tsg complex from Tsg and monomeric and dimeric N-chordin would be required prior to any further characterisation of the complex. SEC of the crosslinking reaction did not resolve the various species (Figure 3-12), and so IEC was tried. Based

98 on theoretical pI values calculated from the peptide sequences, Tsg and the N- chordin/Tsg complex would bind the anion exchange column and other chordin species would not bind. Experimentally this was not observed, with all chordin species appearing to bind the IEC column. This may be due to BS3 crosslinker bound to the protein via one terminus, exposing the other negatively charged terminus and causing the protein to bind the positively charged column resin. A FLAG-tagged Tsg construct was generated to pull-out the complex via Tsg (Figure 3-15). The complex could then be separated from Tsg due to the greater size difference between Tsg and the complex. Tsg-FLAG was crosslinked to N-chordin as before. Western blot analysis of the crosslinking reaction revealed the presence of higher order crosslinked Tsg-FLAG/N- chordin complex, in addition to the 1:1 complex and the N-chordin dimer (Figure 3-16). Due to this it was not possible to isolate a homogenous sample of the Tsg-FLAG/N- chordin complex as anti-FLAG resin bound these multiple Tsg-FLAG species.

Therefore, despite the identification of a high affinity interaction between N-chordin and Tsg with both SPR and MST, a stable monodisperse complex could not be isolated via in vitro reconstitution. The binding analyses were performed in one orientation, in which Tsg was immobilised or labelled. It is possible that labelling Tsg increases its affinity for N-chordin, and so binding analyses should be repeated in the reciprocal orientation. Further stabilisation of this interaction may be required for isolation of a complex. In future studies, a co-expression strategy could be tried to isolate a Tsg/N-chordin complex. This approach would involve concurrent expression of recombinant Tsg and N-chordin with different tags in a single cell line, and purification of the complex via one of the tags. This may be advantageous if complex formation is promoted by factors intracellularly or by extracellular matrix components.

99 4 Results Chapter 2: Characterisation of CHRDL2

Due to the difficulty in isolating a ΔN-chordin/Tsg complex it was decided to investigate CHRDL2, another BMP antagonist of the Chordin family. As is observed with chordin, Tsg enhances BMP antagonism by CHRDL2 and binds to its vWC domains (Zhang et al., 2007). Furthermore, CHRDL2 and Tsg have been shown to co-elute during gel filtration (Zhang et al., 2007). Despite this, no previous structural or biophysical characterisation of CHRDL2, either alone or in a complex, has been performed. As such characterisation of CHRDL2 was required prior to the characterisation of a CHRDL2/Tsg complex. To achieve this, a number of biophysical techniques were used to assess its folding, solution behaviour, and structure. In addition, the interactions between human CHRDL2 and extracellular matrix proteins, including Tsg, were then screened.

4.1 Expression and purification of CHRDL2 4.1.1 CHRDL2 construct generation

To enable characterisation, a CHRDL2 construct was recombinantly expressed in HEK293-EBNA cells. The human CHRDL2 sequence was cloned into a pCDH lentiviral vector for expression (Figure 4-1). This was the sequence for the CHRDL2 splice variant used in previous functional studies (Nakayama et al., 2004, Oren et al., 2004, Zhang et al., 2007). Expression was driven by an EF1α promoter and a BM40 signal peptide enhanced protein secretion. The pCDH vector also contains the sequence for a

His6 tag at the 3′ end of the open reading frame for purification of the protein construct via nickel affinity chromatography (Figure 4-1A). A Red Fluorescent Protein (RFP) sequence downstream of these tags enabled selection of cells expressing the construct based on fluorescence. The RFP sequence is separated from the CHRDL2 open reading frame and V5 and His6 tags by a T2A site. During translation the T2A site undergoes cleavage allowing coexpression of RFP for cell sorting without a resulting fusion protein (Szymczak et al., 2004). Successful cloning of the CHRDL2-pCDH construct was confirmed with DNA sequencing and digestion with BamHI and NheI restriction enzymes, yielding ~7200 bp and ~1300 bp fragments, corresponding to the cut pCDH vector and CHRDL2 insert, respectively (Figure 4-1B). Lentivirus containing the CHRDL2-pCDH construct was generated and used to transduce HEK293-EBNA cells. Cells expressing RFP were selected using fluorescence-activated cell sorting, with uninfected HEK293-EBNA cells used to measure background autofluorescence (Figure 4-1C).

100

Figure 4-1. Cloning and expression of CHRDL2. (A) Diagram of the lentiviral pCDH vector generated for recombinant CHRDL2 expression. Labelled are the EF1α promoter, BM40 signal sequence, CHRDL2 open reading frame, C-terminal V5-His6 tag, T2A cleavage site, and RFP tag. (B) Agarose gel of the CHRDL2-pCDH vector after incubation with BamHI and NheI restriction enzymes. (C) Fluorescence-activated cell sorting of HEK293-EBNA cells transduced with the CHRDL2-pCDH lentivirus. Untransduced HEK293-EBNA cells were used to measure background fluorescence (left panel) and define the region of infected cells with good fluorescent signal for sorting (highlighted red in right panel).

4.1.2 CHRDL2 purification

Recombinant CHRDL2 was purified from media using a two-step purification protocol of nickel affinity chromatography followed by size exclusion chromatography. Conditioned media from HEK293-EBNA cells expressing the His6-tagged CHRDL2 construct was passed over a nickel affinity column and washed with 10 mM HEPES, 500 mM NaCl, 10 mM imidazole, pH 7.4 to remove non-specifically bound protein. Bound protein was eluted with 10 mM HEPES, 500 mM NaCl, 500 mM imidazole pH 7.4. SDS-PAGE of the input, flow-through, wash and elution fractions was used to assess the protein in each

101 fraction (Figure 4-2A). A reducing coomassie-stained SDS-PAGE gel of the fractions showed the presence of a broad band at ~60 kDa in the elution fractions, which appeared to be the predominant species.

To further purify this species from the nickel affinity fractions, size exclusion chromatography was used to separate the fraction components based on their size. Size exclusion chromatography was performed using a Superdex200 Increase 10/30 GL column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4, and protein elution was monitored by absorption at 280 nm. A single sharp peak was observed at an elution volume of 13.5 ml (Figure 4-2B), indicating the major purified species exists as a single species in solution. The peak size exclusion elution fraction was subjected to SDS- PAGE in the presence and absence of β-Mercaptoethanol (βME) (Figure 4-2C). In the presence of βME a single species was observed at ~60kDa. In the absence of βME, a minor band was also observed at ~120 kDa. This band disappears on the addition of βME, indicating this minor species is likely a disulphide-linked dimer that results from overexpression. However, the band observed at ~60kDa was still the major species observed in the absence of βME, indicating that recombinant CHRDL2 has no intermolecular disulphide bonds, and so does not form disulphide-linked species of higher order. However, this does not preclude the formation of non-covalently bound higher order structures. Western blot analysis showed the species at ~60 kDa bound a

His6-antibody, strongly suggesting this is the recombinant CHRDL2-His6 construct (Figure 4-2D). The identity of this species as CHRDL2 was confirmed with tryptic-digest mass spectrometry (Figure 4-2E).

102

Figure 4-2. Purification of CHRDL2. (A) Coomassie stained reducing SDS-PAGE gel of fractions from nickel affinity chromatography with conditioned media from HEK293-EBNA cells recombinantly expressing His6-tagged CHRDL2. Labelled are the input (IN), flow-through (FT), wash and elution fractions. (B) Size exclusion chromatography trace of a nickel affinity elution fraction from (A) injected onto a Superdex200 Increase column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4. Elution was monitored by absorbance at 280 nm, and the peak fraction is indicated by dotted lines. (C) Coomassie stained SDS-PAGE gels of the size exclusion peak fraction under reducing (+βME) and non-reducing (-βME) conditions. (D) Anti-His6 western blot of the size exclusion peak fraction under reducing conditions. (E) Tryptic-digest mass spectrometric analysis of the purified protein confirming its identity as CHRDL2. Peptide hits are highlighted in yellow, the CHRDL2 protein sequence is in black and the C-terminal V5 and His6 tags are in blue.

To evaluate the stability and folding state of recombinant CHRDL2, intrinsic fluorescence was monitored over a broad temperature range. Recombinant CHRDL2 that had been purified in 10 mM HEPES, 150 mM NaCl, pH 7.4 and flash-frozen in liquid nitrogen was subjected to a temperature gradient increasing from 35°C to 95°C. The ratio of fluorescence at 350 nm to fluorescence at 330 nm was monitored over this

103 temperature gradient using the Tycho NT.6 (NanoTemper Technologies). The F350/F330 ratio increased with temperature, indicating a transition from a folded towards a non- folded state over the temperature gradient (Figure 4-3A). However, the ratio did not plateau at 95°C, indicating the protein had not completely unfolded. The first derivative of this ratio showed the rate of increase peaking at 87°C, showing CHRDL2 remains predominantly folded to a relatively high temperature (Figure 4-3B). Although CHRDL2 was not completely unfolded at 95°C, the first derivative decreased between 87°C and 95°C, indicating the fluorescence ratio was close to reaching a plateau. These observations indicate CHRDL2 is stable at room temperature and remains folded after being flash-frozen.

Figure 4-3 Analysis of CHRDL2 foldedness. The folding state of purified CHRDL2 after flash freezing in liquid nitrogen was assessed by monitoring intrinsic fluorescence over a temperature gradient. (A) The ratio of fluorescence at 350 nm to fluorescence at 330 nm during heating from 35°C to 95°C showing unfolding as temperature increases (n = 3, replicates indicated by different colours). (B) The first derivative of the ratio of fluorescence at 350 nm to absorbance at 330 nm during heating.

4.2 CHRDL2 hydrodynamic analysis To determine the mass and size of purified CHRDL2 in solution SEC-MALS and analytical ultracentrifugation (AUC) were used (Figure 4-4).

For SEC-MALS, 6.6 M purified CHRDL2 was passed over a Superdex200 column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4. As protein eluted, as monitored with differential refractive index (dRI), it was passed directly into the laser for MALS analysis. CHRDL2 eluted at a volume of 15 ml (Figure 4-4Ai), similar to that observed for the previous CHRDL2 SEC analysis (Figure 4-2B). The small difference in elution volume is due to the use of a different Superdex200 column for CHRDL2 purification.

104 CHRDL2 eluted as a single peak with a calculated molecular weight of 64.1 kDa (Figure 4-4Ai and Aii). However, the mass plot was not flat, indicating a contribution from the dimeric species. Indeed, a small shoulder was observed at an elution volume of 12.5 ml. This will result in slight overestimate of the CHRDL2 mass. Despite this, the mass was still consistent with the SDS-PAGE analysis, and indicates CHRDL2 exists predominantly as a monomer in solution. MALS determined the hydrodynamic radius of CHRDL2 to be 45.9 Å.

Sedimentation velocity AUC analysis was performed on 5 M CHRDL2 in 10 mM Tris, 150 mM NaCl, pH 7.4. The sedimentation coefficient distribution for CHRDL2 showed a major species with a sedimentation coefficient (S20,w) of 3.77S, with a small peak at a higher sedimentation coefficient value (Figure 4-4Bi). The small peak at the higher value is likely the CHRDL2 disulphide-linked dimer that results from its overexpression. The molecular weight calculated by AUC is 60.4 kDa, consistent with the SEC-MALS data, confirming CHRDL2 exists predominantly as a monomer in solution. The hydrodynamic radius calculated by AUC, 37.9 Å, was slightly smaller than that of SEC-MALS. AUC also enabled the measurement of the frictional coefficient ratio of CHRDL2, a measure of particle compactness. A frictional coefficient ratio of 1.5 was determined for CHRDL2, indicating CHRDL2 is slightly elongated in shape. Together, SEC-MALS and AUC showed CHRDL2 exists as a slightly elongated monomer in solution.

105

Figure 4-4 Hydrodynamic analysis of CHRDL2. (Ai) SEC-MALS analysis of purified CHRDL2 using a Superdex 200 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Relative differential refractive index (dRI) is plotted in black, molecular weight is plotted in red. (Aii) CHRDL2 hydrodynamic parameters from SEC-MALS analysis. (Bi) The sedimentation coefficient distribution of CHRDL2 in 10 mM Tris, 150 mM NaCl, pH 7.4 as determined with sedimentation velocity AUC (Bii) CHRDL2 hydrodynamic parameters from Sedimentation velocity AUC analysis with SEDFIT (Schuk, 2000). S20,w was calculated from the apparent sedimentation coefficient using SEDNTERP (Biomolecular Interaction Technologies Center, the University of New Hampshire).

4.3 Analysis of CHRDL2 glycosylation The purified CHRDL2 species was larger than the predicted mass based on the construct peptide sequence (49.6 kDa). A possible reason for this is protein glycosylation, as is observed with other members of the chordin family (Troilo et al., 2014, Lockhart-Cairns et al., 2018). To investigate whether CHRDL2 is glycosylated, protein deglycosylation and lectin binding assays were used (Figure 4-5). To cleave associated glycans, denatured CHRDL2 was incubated with PNGase F and an O- glycosidase/Neuraminidase mix to assess N-linked and O-linked glycosylation,

106 respectively (Figure 4-5A). After incubation with the glycan cleaving enzymes, SDS- PAGE was used to visualise changes in CHRDL2 mass. After incubation of CHRDL2 with PNGase F a small decrease in mass was observed with SDS-PAGE, consistent with CHRDL2 possessing an N-linked glycan (Figure 4-5A). Indeed, CHRDL2 has one predicted N-linked glycosylation site (Asn89). The PNGase F protocol appeared to completely remove the N-linked glycan from all protein in the sample. However, this size shift observed is not large enough to completely account for the larger than predicted observed mass of CHRDL2.

Treatment of CHRDL2 with an O-glycosidase/neuraminidase mix resulted in a very small shift in mass. However, after incubation with both the PNGase F and O- glycosidase/neuraminidase mix, CHRDL2 ran to a very similar size on SDS-PAGE to the sample incubated with the O-glycosidase/neuraminidase mix (Figure 4-5A). Therefore, CHRDL2 was probed with lectins to determine whether it possesses O-linked glycosylation (Figure 4-5B). Lectins bind specific carbohydrate structures, and are commonly used in the analysis of sugar composition (Lam and Ng, 2011). Fully glycosylated CHRDL2 and CHRDL2 that had been treated with PNGase F were run on an SDS-PAGE gel, blotted onto a nitrocellulose membrane and the membrane was subsequently blocked with BSA. The membrane was incubated with a biotinylated lectin, and subsequently probed with a His6 antibody and streptavidin. The lectins used were Wheat Germ agglutinin (WGA), Concanavalin A (ConA), Sambucus nigra lectin (SNA), Ulex europaeus agglutinin I (UEAI) and Vicia villosa lectin (VVL). The ConA and SNA lectins only bound to CHRDL2 that had not been treated with PNGase F, indicating only the N-linked sugar contained mannose and N-acetylneuraminic acid (Figure 4-5C, ConA and SNA). In contrast, WGA, UEAI and VVL still bound CHRDL2 after PNGase F treatment, (Figure 4-5C, WGA, UEAI and VVL), indicating N-acetylglucosamine, N- acetylgalactosamine and fucose are present after the removal N-linked glycans from CHRDL2. These lectin binding experiments support CHRDL2 having O-linked glycosylation.

These analyses show CHRDL2 is secreted in a glycosylated form, and the glycans are both N-linked and O-linked, likely accounting for the larger mass observed for CHRDL2 than is predicted by the peptide sequence.

107

Figure 4-5 Analysis of CHRDL2 glycosylation. (A) Coomassie stained reducing SDS-PAGE gel of CHRDL2 following treatment with either PNGase F, an O-glycosidase/neuraminidase mix or both after CHRDL2 denaturation. (B) Table of the biotinylated lectins used for analysis of CHRDL2 glycan sugar composition in (C), with their respective binding sugars. Lectins used were Wheat Germ agglutinin (WGA), Concanavalin A (ConA), Sambucus nigra lectin (SNA), Ulex europaeus agglutinin I (UEAI) and Vicia villosa lectin (VVL). (C) Anti-His6 and Streptavidin western blot analysis of recombinant purified CHRDL2-His6 following reducing SDS-PAGE, blotting onto a nitrocellulose membrane and incubation with biotinylated lectins. Binding of CHRDL2 with each lectin was tested before (lane 1) and after (lane 2) PNGase F treatment. Analysis was also performed without addition of a biotinylated lectin (Strep control). All panels are shown with the same exposure for each fluorescent channel.

108 4.4 CHRDL2 secondary structure analysis To confirm folding of CHRDL2 and predict its secondary structure circular dichroism was used. The circular dichroism spectrum of CHRDL2 in 10 mM Tris, 150 mM NaCl, pH 7.4 was measured in the far-UV range (190 – 260 nm). Ten circular dichroism spectra were measured, buffer subtracted and averaged (Figure 4-6). The spectrum displayed low ellipticity around 210 nm that increased towards 195 nm and 260 nm. This indicates CHRDL2 is folded and mostly ordered, as proteins with mostly disordered regions display ellipticities that have a trough around 195 nm (Greenfield, 2006).

Figure 4-6 CHRDL2 secondary structure analysis. The buffer-subtracted average circular dichroism spectrum of purified recombinant CHRDL2 in 10 mM Tris, 150 mM NaCl, pH 7.4, showing the change in ellipticity (θ) as a function of wavelength.

The DichroWeb server (Whitmore and Wallace, 2008) was used to predict the secondary structural composition of CHRDL2 based on the average spectrum (Table 4-1). DichroWeb uses multiple algorithms to independently predict the secondary structure composition of the protein producing the experimentally observed spectrum. In addition to the relative proportions of different secondary structural elements, DichroWeb reports the normalised root mean square deviation (NRMSD) for the fit of the theoretical spectrum of a protein with the calculated structural content to the experimental data for each algorithm, and the mean proportions of the elements predicted by the algorithms. DichroWeb analysis of the circular dichroism spectrum predicts CHRDL2 consists of 8% -helix and 37% -strands. The different algorithms calculated CHRDL2 to have a - sheet content between 34% and 41%, and an -helical content between 4% and 14%. The spectral analysis with K2d has a large NRMSD and does not distinguish between

109 turns and disordered regions. However, the proportions of -helix and -sheet calculated by K2d agreed with those of the other analysis algorithms.

Table 4-1 Analysis of the CHRDL2 circular dichroism spectrum

Method α-Helix β-Strand β-Turns Disordered NRMSD

Contin 0.09 0.34 0.23 0.34 0.16

Selcon3 0.06 0.41 0.27 0.25 0.19

CDSSTR 0.04 0.38 0.23 0.34 0.07

K2d 0.14 0.35 n/a 0.52 0.66

Mean 0.08 0.37 0.24 0.31 n/a

Analysis of the CHRDL2 circular dichroism spectrum performed with multiple secondary structure determination algorithms (Contin, Selcon3, CDSSTR, K2d) in the DichroWeb online server (Whitmore and Wallace, 2008). Proportions of structural elements calculated by each algorithm are shown, as is the mean proportion for each structural element. The normalised root mean square deviation (NRMSD) is shown for each analysis, comparing the fit of the theoretical spectrum of a protein with the calculated structural content to the experimental data. K2d does not produce a value for turns as it does not distinguish between turns and disordered regions.

The high proportion of -sheet is consistent with CHRDL2 possessing three vWC domains, which only consist of -strands and turns, and account for ~50% of the CHRDL2 sequence (Figure 4-7A). Given this, it is most likely that the -helical regions exist outside the vWC domains. This agrees with secondary structure predictions using the CHRDL2 peptide sequence (Figure 4-7B). The I-TASSER web server (Yang et al., 2015) was used to determine whether CHRDL2 showed sequence homology with proteins of known fold, and if a subsequent homology model could be generated. Only the vWC domains were modelled with confidence, and so a full-length homology model for CHRDL2 could not be generated. Notably, there is a sequence of 75 amino acids between the vWC2 and vWC3 domains, and a C-terminal sequence of 115 amino acids after vWC3 that are both of unknown fold. As part of its analysis I-TASSER predicts protein secondary structure. In addition to predicting only -strands in the vWC domain sequences, this analysis also predicted -strands and -helices in the vWC2-vWC3 linker region and the C-terminal tail (Figure 4-7B).

110

Figure 4-7 CHRDL2 Secondary structure prediction. (A) Schematic of CHRDL2 domain structure, based on sequence homology, using the domain boundaries from Nakayama et al. (Nakayama et al., 2004). The vWC domains are shown in blue with residue numbers indicated for the domain boundaries. (B) Schematic of predicted secondary structural elements, shown above the sequence, in the CHRDL2 amino acid sequence based on analysis with I-TASSER software (Yang et al., 2015). The sequence of the signal peptide is not shown. -strands are indicated by purple arrows and -helices are indicated by red coils. CHRDL2 vWC domains are highlighted in blue on the amino acid sequence.

4.5 Small angle X-ray scattering analysis The solution behaviour and structure of CHRDL2 was further probed with small angle X- ray scattering (SAXS) (Figure 4-8). In a SAXS experiment, an incident monochromatic X-ray beam is scattered by a sample in solution and the intensity of scattered X-rays are measured by a detector (Figure 4-8A). A radially averaged one-dimensional scattering profile is generated by plotting scattering intensity [I(q)] against the scattering vector of the X-rays (q). This data can then be transformed to yield information about the properties of the sample scattering the X-rays, such as size, shape and flexibility, in

111 solution (Figure 4-8B). The resultant scattering pattern is the sum of the scattering by all particles present averaged over all orientations, therefore the sample must be pure and monodisperse to generate scattering data specific to the particle of interest.

Figure 4-8 The SAXS analysis pipeline. (A) Schematic of the SAXS experimental set-up. A scattering profile is produced by radially averaging scattered X-rays and plotting their intensity against scattering vector, q. (B) The SAXS analysis pipeline. Data is collected and averaged at the beamline. A series of plots are then generated from the one-dimensional scattering profile in ScÅtter (www.bioisis.net) that provide information on sample quality, foldedness, size and shape, and predicts sample flexibility. Ab initio modelling is then performed using DAMMIF and DAMAVER in the ATSAS suite to produce a low resolution model of the sample. EOM is used to model predicted sample flexibility by generating an ensemble of models that recapitulate the scattering profile observed experimentally (Franke et al., 2017).

112 4.5.1 CHRDL2 SAXS analysis

SAXS was performed using in-line SEC, where purified CHRDL2 was passed through a SEC column and injected directly into the X-ray beam after elution to ensure the sample is pure and monodisperse. CHRDL2 at a concentration of 53 M was injected onto the Superdex200 Increase column 3.2/30 GL (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4. Frames were collected across the elution peak and averaged to increase signal-to-noise. This reduces the exposure time required for data collection, reducing sample radiation damage and increasing the quality of data collected. SAXS data was analysed using ScÅtter (www.bioisis.net). Analysis of the Guinier region of the scattering profile, found at low q values, provides information about sample size and quality. A linear Guinier region (Figure 4-9B) shows the CHRDL2 sample is monodisperse and not aggregated, and further analysis can be performed on this SAXS data. The Radius of Gyration (Rg), can be derived from the gradient of the Guinier region (Mertens and Svergun, 2010). For CHRDL2, Rg = 36.3 Å.

2 A normalised Kratky plot, a plot of (I(q)/I(0))(qRg) vs. qRg, provides information about the protein folding state (Figure 4-9C). CHRDL2 displays a peak at low q values, indicative of a folded protein. This peak is slightly displaced from the cross-hairs at (3, 1.104), the peak position for spherical proteins (Mertens and Svergun, 2010), indicating CHRDL2 is slightly elongated.

113

Figure 4-9 CHRDL2 SAXS analysis. (A) The one-dimensional SAXS profile of recombinant purified CHRDL2 displaying relative scattering intensity, log[I(q)], as a function of the scattering vector, q, after buffer subtraction. (B) Guinier analysis at low q values for determination of the radius of gyration (Rg) of CHRDL2 (CHRDL2 Rg = 36.3 Å), with residuals for the Guinier region.

2 (C) The normalised Kratky plot [(I(q)/I(0))(qRg) vs. qRg] derived from the CHRDL2 scattering profile. A peak at (√3, 1.104), shown by crosshairs, indicates a compact globular particle. The curve of a folded particle peaks and then returns towards the x-axis.

Information about protein flexibility can be obtained by determining the power law relationship that exists for the protein’s scattering intensity decay. The Porod-Debye power law asserts that the scattering of an inflexible protein decays as q-4, thus a plateau is observed in a plot of I(q).q4 vs. q4 at low q values. However, the scattering of a multidomain protein with flexible linkers decays as q-3 at low q values. Thus comparison of I(q).q3 vs. q3 and I(q).q4 vs. q4 plots provides information on the flexibility of the scattering sample (Rambo and Tainer, 2011). For CHRDL2, a steady plateau is reached in a plot of I(q).q3 vs. q3 before the I(q).q4 vs. q4 plot (Figure 4-10), indicating CHRDL2 is a multidomain protein with flexible linkers.

114

Figure 4-10 CHRDL2 SAXS flexibility analysis. Porod plots for recombinant CHRDL2 examining the power law relationship of the decay in scattering intensity with q. The plateau reached first in the I(q).q3 vs. q3 plot indicates CHRDL2 is a multidomain protein with flexible linkers.

4.5.2 CHRDL2 SAXS shape analysis Information about the protein shape in real space can be determined from the Fourier transform of the scattering data. This generates a pair distance distribution function (PDDF) (Figure 4-11), which shows the distribution of distances between all electrons in the protein, and so the shape of the PDDF gives information about the protein shape. For example, a sphere would have a PDDF with a Gaussian distribution, whereas a long rod would have a PDDF that peaked at a low distance value but had a long tail to larger distance values (Mertens and Svergun, 2010). The PDDF of CHRDL2 is a smooth peak with a small tail at larger distance values, indicative of a slightly elongated structure, with a maximum distance (Dmax) of 128 Å (Figure 4-11A). The PDDF agreed well with the experimental data (Figure 4-11B). The Rg calculated from the PDDF is 36.5 Å, consistent with the Rg calculated from the Guinier region (36.3 Å).

115

Figure 4-11 CHRDL2 SAXS shape analysis. (A) The pair distance distribution function (PDDF) generated from the indirect Fourier transformation of the CHRDL2 SAXS scattering data, giving a

Dmax of 128 Å for CHRDL2. The PDDF is the distribution of distances between all pairs of points within the particle. (B) Overlay of the experimental scattering data (black) and the theoretical scattering curve calculated from the PDDF (red). 2 = 0.91 for the fit of the theoretical data to the observed data.

4.5.3 CHRDL2 ab initio modelling

The PDDF can be used to generate an ab initio model of the protein. Ab initio modelling was performed with DAMMIF and the DAMAVER software suite (Franke et al., 2017) in the ScÅtter graphical user interface. DAMMIF produces models of the scattering sample by beginning with a sphere of densely packed beads with a search volume specified by

Dmax and iteratively changing its shape until the theoretical scattering of the model converges with the experimental scattering. Multiple DAMMIF simulations are run to produce multiple independent models. The models are compared and their normalised spatial discrepancy (NSD) calculated to quantify the similarity between the models. Superimposed identical models have an NSD = 0, while models that systematically differ have an NSD > 1. DAMMIF models that agree (NSD < 1) are aligned, averaged and filtered in DAMAVER to produce a final low-resolution model of the protein in solution, the DAMFILT model. For CHRDL2, 13 DAMMIF simulations were run independently, with all DAMMIF models (NSD = 0.8) used to generate a final DAMFILT model (Figure 4-12A). The DAMFILT model produced appears flattened and slightly elongated, consistent with the normalised Kratky plot and the AUC frictional coefficient ratio. To corroborate this, the hydrodynamic properties of the CHRDL2 DAMFILT model were simulated using HYDROPRO (Ortega et al., 2011). HYDROPRO analysis predicted a sedimentation coefficient of 3.95S for the DAMFILT model, larger than the CHRDL2 experimental value of 3.77S. The sedimentation coefficient and the frictional coefficient are inversely proportional, indicating the DAMFILT model would have a smaller frictional coefficient

116 ratio than the experimentally derived value. Therefore, this suggests that the SAXS data collected is that of a CHRDL2 monomer, but CHRDL2 is slightly more elongated than the DAMFILT model.

Figure 4-12 CHRDL2 ab initio modelling. (A) The ab initio CHRDL2 model generated from the PDDF using the DAMAVER software suite (Franke et al., 2017). The DAMFILT model shown was produced by aligning, averaging and filtering 13 DAMMIF simulations (NSD = 0.80). (B) Overlay of the experimental scattering data (black) and the theoretical scattering curve calculated for a representative DAMMIF model (red), and residuals of the normalised DAMMIF fit to the experimental SAXS data. 2 = 3.4 for the fit of the theoretical data to the observed data.

4.5.4 Modelling the CHRDL2 flexible ensemble

The scattering profile is the sum of the average scattering intensities of all conformations present in the sample. Therefore, the PDDF and DAMFILT model represent the average shape of the population, but do not account for flexibility. To further investigate the flexibility of CHRDL2 indicated by the Porod plots (Figure 4-10) EOM was used to derive models of the ensemble that collectively produce the observed scattering profile (Tria et al., 2015). EOM generates a random pool of 10,000 models that approximates conformational space, based on the peptide sequence and any input homology models. The theoretical scattering profile of each model is then calculated,

117 and a subset of up to 50 models is selected that represents the ensemble producing the experimental scattering profile. The models as an ensemble describe the behaviour of the flexible system, but do not represent discrete structures adopted by CHRDL2 in solution. The models in the selected subset are weighted dependent on the contribution they make to the scattering ensemble. EOM then reports the Rg and Dmax distributions of the selected subset of models and the total pool. Comparison of these predicts the behaviour of the flexible system in solution. Homology models of individual CHRDL2 vWC domains were produced in SWISSMODEL (Waterhouse et al., 2018) for EOM analysis (Appendix 9). The CHRDL2 vWC sequences share high sequence identity, between 40% and 43%, with the vWC domains of collagen IIa and CCN3. The crystal structures of both these vWC domains have been solved (Xu et al., 2017). The vWC domain of CCN3 was the template for CHRDL2 vWC1 and vWC2 homology models, and the vWC domain of collagen IIa was the template for CHRDL2 vWC3 homology model.

The CHRDL2 EOM analysis generated 10,000 models sampling conformational space based on the input CHRDL2 peptide sequence and vWC domain homology models. EOM identified a subset of 6 models that best represented the experimental scattering data (Figure 4-13). EOM will select up to 50 models to represent the data, as such the representation of the flexible ensemble by only 6 models indicates CHRDL2 exhibits some but relatively small amounts of flexibility. Furthermore, the relative weighting of the model contributions suggests the ensemble is mostly represented by more compact models (Figure 4-13 models 1 to 4), with a smaller contribution from models occupying a larger space (Figure 4-13 models 5 and 6). This is further recapitulated by comparison of the Rg and Dmax distributions of the total pool and the selected subset of models (Figure 4-14). The total pool of models displays a Gaussian-like distribution as the models are free to sample conformational space and so have a broad range of Rg and

Dmax values. In contrast, the selected subset of models has narrower Rg and Dmax distributions that peak with smaller Rg and Dmax values. The simulated scattering of the selected EOM models was consistent with the experimental scattering (Figure 4-14C), and the weighted average of the Rg and Dmax values for the selected subset were consistent with the values measured experimentally (Figure 4-14D). The shift of the distributions to lower Rg and Dmax values predicts CHRDL2 is not adopting random conformations in solution and exhibits limited flexibility. To further validate the EOM modelling, the hydrodynamic properties of the subset of models were simulated using HYDROPRO (Ortega et al., 2011). The sedimentation coefficients were then averaged with a weighting according to the contribution they make to the overall ensemble. This predicted a sedimentation coefficient of 3.87S for

118 the weighted average of the models, consistent with the CHRDL2 experimental value of 3.77S.

Figure 4-13 CHRDL2 EOM ensemble models. The subset of models identified by EOM analysis as best representing the experimental CHRDL2 SAXS data. The models as an ensemble describe the behaviour of the flexible system, but do not represent discrete structures adopted by CHRDL2 in solution. The weighted contribution of each model to the ensemble is given as a percentage. Each model is represented in ribbon form, with rainbow colouring ranging from blue at the N-terminus to red at the C-terminus. Scale bar represents 25 Å.

119

Figure 4-14 CHRDL2 ensemble modelling. EOM was used to generate 10,000 random models based on the CHRDL2 peptide sequence and homology models of the three vWC domains of CHRDL2 (Tria et al., 2015). EOM selected a subset of 6 models that best represents the flexible

CHRDL2 ensemble producing the observed scattering data. (A) Histogram of the Rg distributions for the total pool of EOM models, in blue, and the selected subset that best represent the scattering data, in red. (B) Histogram of the Dmax distributions for the total pool of EOM models, in blue, and the selected subset that best represent the scattering data, in red. (C) Overlay of the experimental SAXS data (black) and the theoretical scattering for the selected subset of EOM models (red), and the residuals for the fit of the EOM selected models to the experimental data.

2  = 2.77 for the fit of the theoretical data to the observed data. (D) Table of the Rg and Dmax values of CHRDL2 experimentally determined with SAXS and the simulated values of the EOM total pool and selected subset of models.

120 To investigate the state of the C-terminal region of unknown fold, EOM was performed with a C-terminally truncated CHRDL2 peptide sequence missing the sequence after the vWC3 domain (the final 114 residues, excluding the exogenous C-terminal tags). In theory, the random pool of the truncated CHRDL2 sequence will sample a smaller volume of conformational space and so the Rg and Dmax distributions will be shifted towards lower Rg and Dmax values. If the C-terminal region of CHRDL2 is not disordered and adopting random conformations in three-dimensional space, the Rg and Dmax distributions of the selected subset for full-length CHRDL2 should more closely resemble the distributions of the truncated total pool than the full-length total pool. 10,000 models were generated using the truncated peptide sequence and the three vWC domain homology models, as had been done for the full-length sequence, and the

Rg and Dmax values calculated for each. Comparison of the Rg and Dmax distributions showed that the selected models for CHRDL2 more closely resembles the truncated sequence total pool than the distribution for the full-length total pool (Figure 4-15).

Figure 4-15 Comparison of EOM analysis with full-length and C-terminally truncated

CHRDL2 sequences. The Rg and Dmax distributions of the full-length and C-terminally truncated total random pools, blue and green, respectively, and the selected subset of models from the full- length CHRDL2 EOM analysis. The mean for the total pools and the weighted average for the selected subset are indicated by vertical dotted lines.

Together these EOM analyses predict CHRDL2 exhibits limited flexibility and is not adopting random conformations in solution. These analyses also suggest the CHRDL2 regions of unknown fold (notably the vWC2-vWC3 linker and the C-terminal tail) are likely not unstructured regions that adopt extended conformations.

121 4.6 CHRDL2 binding analysis Mouse CHRDL2 binds Tsg and BMPs with high affinity (Zhang et al., 2007), however the binding of CHRDL2 to other extracellular matrix proteins has not been investigated. The binding of CHRDL2 to a variety of extracellular matrix proteins was initially screened with solid phase binding assays and further validated with bio-layer interferometry. There is evidence for interactions between chordin and syndecans (Jasuja et al., 2004), the drosophila collagen IV, Viking, and the chordin homolog Sog (Sawala et al., 2012), BMPs and the fibronectin 12th-14th type III repeats (Martino and Hubbell, 2010), and between BMPs and the N-terminal region of fibrillin-1 (Sengle et al., 2008a). As such, the extracellular matrix proteins screened for binding were Tsg, syndecan-4, collagen IV, a fibronectin III fragment containing the 12th-14th type III repeats (fibronectin III 7-14), and an N-terminal fibrillin-1 fragment (fibrillin-1 PF1).

4.6.1 Solid phase binding assays

Solid phase binding assays were used to initially screen the binding of CHRDL2 to a number of extracellular matrix proteins (Figure 4-16). Biotinylated CHRDL2 was incubated in wells coated with increasing concentrations of binding candidates (Tsg, syndecan-4, Collagen IV, the fibronectin III fragment and the fibrillin-1 PF1 fragment).

Bound biotinylated CHRDL2 was detected via absorbance at 405 nm (A405) following a colorimetric reaction after incubation with extravidin peroxidase and the 2,2′-Azino-bis(3- ethylbenzothiazoline-6-sulfonic acid) substrate.

This revealed recombinant human CHRDL2 was capable of binding Tsg, this assay displayed a characteristic binding curve that reached a plateau at the highest levels of Tsg immobilised (Figure 4-16A). A similar binding curve was observed for the binding of CHRDL2 to the fibrillin-1 PF1 fragment (Figure 4-16E). For syndecan-4 (Figure 4-16B) and the fibronectin III fragment (Figure 4-16D), the A405 readings peaked at lower ligand concentrations and then decreased at increasing levels of immobilised syndecan-4 and the fibronectin III fragment. Therefore, it was not clear whether these proteins bound CHRDL2. No binding was detected to the well coated with collagen IV (Figure 4-16C). These solid phase binding analyses indicated binding of the recombinant human CHRDL2 protein to Tsg and the fibrillin-1 PF1 fragment, with potential interactions between CHRDL2 and syndecan-4, and CHRDL2 and the fibronectin fragment.

122

Figure 4-16 CHRDL2 solid phase binding assays. Background subtracted solid phase binding assays of solubilised CHRDL2 binding to immobilised extracellular matrix proteins, (A) Tsg, (B) Syndecan-4, (C) Collagen IV, (D) Fibronectin III 7-14 fragment and (E) Fibrillin-1 PF1 fragment. 100 nM biotinylated CHRDL2 (b-CHRDL2) was incubated with immobilised matrix proteins at increasing concentrations, washed and incubated with extravidin peroxidase. Binding was assessed based on absorption at 405 nm after addition of peroxidase substrate. Control wells were coated with BSA and measurements used for background subtraction. Values are normalised to the absorbance of BSA coated wells. N=3, error bars display the standard deviation.

123 4.6.2 Bio-layer interferometry

To further investigate the binding of CHRDL2 to candidates identified by the solid phase binding assays, bio-layer interferometry was used. This was also used to validate the capacity of the recombinant human CHRDL2 construct for binding to Tsg and BMPs. Bio-layer interferometry involves immobilising a protein on a sensor, which is then dipped into a well containing ligand (the association phase) and then moved to a well of running buffer (the dissociation phase). Binding of a ligand to the immobilised protein changes the bio-layer thickness at the sensor tip and is detected based on changes in the interference of incident and reflected waves traversing the sensor in ligand binding. The interaction between Tsg and CHRDL2 was confirmed with binding being observed in both experimental orientations, in which both CHRDL2 and Tsg were biotinylated and immobilised to 0.7 nm, and dipped into the other protein in 10 mM HEPES, 150 mM NaCl, 0.02% (v/v) Tween-20, pH 7.4. These traces showed reduced binding capacity of CHRDL2 when immobilised, with 200 nM Tsg required for a signal of 0.1 nm (Figure 4-17A). In comparison, when Tsg was biotinylated and immobilised, a signal of 0.1 nm could be detected with 8 nM CHRDL2 (Figure 4-17B). Binding of BMP-4 over a concentration range of 0-200 nM to immobilised CHRDL2 was revealed (Figure 4-17C). These analyses confirmed the binding of the recombinant human CHRDL2 construct to Tsg and BMP-4.

124

Figure 4-17 Binding of CHRDL2 to Tsg and BMP-4. Representative bio-layer interferometry traces for the binding of Tsg (A) and BMP-4 (C) to biotinylated CHRDL2, and CHRDL2 to biotinylated Tsg (B). Biotinylated CHRDL2 or Tsg (b-CHRDL2 and b-Tsg) was immobilised onto streptavidin biosensors to a level of 0.7 nm. Sensors were dipped into candidate binding proteins for 300s and then into buffer for 300s. Experiments were performed in 10 mM HEPES, 150 mM NaCl, 0.02% (v/v) Tween-20, pH 7.4. Experiments with BMP-4 were performed in 10 mM HEPES, 500 mM NaCl, 0.02% (v/v) Tween-20, pH 7.4. All experiments were performed in triplicate.

Following confirmation of the binding capacity of CHRDL2 for Tsg and BMP-4 with the bio-layer interferometry system, this was used to further investigate the binding of CHRDL2 to potential ligands identified in the solid phase binding assays (Figure 4-18). Experiments were performed with the same sensor on which biotinylated CHRDL2 was immobilised to a level of 0.7 nm, and was performed under the same conditions as Tsg, in which the sensor was dipped into candidate ligands in 10 mM HEPES, 150 mM NaCl, pH 7.4 for 300s, and then dipped into buffer for a 300s dissociation phase. No binding

125 was detected when the sensor was dipped into the syndecan-4 (Figure 4-18A) or the fibronectin III fragment (Figure 4-18B). A binding curve was observed when the immobilised CHRDL2 sensor was dipped into the fibrillin-1 PF1 fragment (Figure 4-18C). The signal was relatively low given the ligand concentrations used (0-800 nM), however the Tsg binding analysis showed immobilised CHRDL2 displayed a reduced binding capacity in comparison to when CHRDL2 was used as the free ligand in solution. As no binding was observed in both the solid phase assays, in which syndecan-4 and the fibronectin fragment were immobilised, and the bio-layer interferometry, in which CHRDL2 was immobilised, bio-layer interferometry was not performed in the reciprocal orientation.

Figure 4-18 CHRDL2 bio-layer interferometry. Representative bio-layer interferometry traces for the binding of Syndecan-4 (A), fibronectin III 7-14 fragment (B), and the fibrillin-1 PF1 fragment (C), to biotinylated CHRDL2. Biotinylated CHRDL2 (b-CHRDL2) was immobilised onto streptavidin biosensors to a level of 0.7 nm. Sensors were dipped into candidate binding proteins for 300s and then into buffer for 300s. Experiments were performed in 10 mM HEPES, 150 mM NaCl, 0.02% (v/v) Tween-20, pH 7.4. All experiments were performed in triplicate.

126 4.7 CHRDL2 cleavage assay Chordin cleavage by tolloids is important for inactivation of the BMP antagonist (Marques et al., 1997, Piccolo et al., 1997). To test whether CHRDL2 is cleaved by the tolloid BMP-1, an in vitro cleavage assay was performed (Figure 4-19). No cleavage of CHRDL2 was observed after incubation of BMP-1 with CHRDL2 at a 1:15 mass ratio in

50 mM Tris, 150 mM NaCl, 5 mM CaCl2, pH 7.4 for 16 hours at 37°C (Figure 4-19A). However, under the same conditions, the positive control N-chordin was fully cleaved.

Tsg is known to affect the cleavage of chordin by tolloids. Tsg enhances the rate of chordin cleavage by tolloids (Troilo et al., 2016), and alters the pattern of cleavage fragments observed for tolloid cleavage of mouse chordin (Scott et al., 2001). Therefore, the possibility that Tsg is required for tolloid cleavage of CHRDL2 was investigated. Under the same reaction conditions as previously used, Tsg was added to the reaction at a 1:15:30 BMP-1:CHRDL2:Tsg mass ratio. No CHRDL2 cleavage was observed in the presence of BMP-1 and Tsg (Figure 4-19B).

Figure 4-19 CHRDL2 cleavage assay. Silver stained reducing SDS-PAGE analysis of CHRDL2 cleavage assays. (A) BMP-1 was incubated at a 1:15 mass ratio of BMP-1 to N-chordin or CHRDL2 for 16 hours at 37°C. (B) BMP-1 was incubated at a 1:15:30 mass ratio of BMP- 1:CHRDL2:Tsg for 16 hours at 37°C. Experiments were repeated in triplicate with different batches of CHRDL2 and Tsg.

4.8 Summary and discussion

CHRDL2 was successfully recombinantly expressed and purified from HEK293-EBNA cells. A two-step purification strategy of nickel affinity chromatography and size

127 exclusion chromatography enabled the isolation of recombinant CHRDL2 to a high purity (Figure 4-1), allowing biophysical and structural characterisation of CHRDL2. CHRDL2 homologs from various species have previously been expressed recombinantly in a number of expression systems (Nakayama et al., 2004, Oren et al., 2004, Zhang et al., 2007). This thesis provides the first recombinant expression of human CHRDL2 in a human cell line. The folding of CHRDL2 was confirmed with intrinsic fluorescent measurements (Figure 4-3) and circular dichroism (Figure 4-6). Measurement of intrinsic fluorescence over a broad temperature range (35°C to 95°C) showed CHRDL2 to be stable at room temperature. Analysis of the circular dichroism spectrum also predicted CHRDL2 has a high -strand and turn content (Table 4-1). The structures of vWC domains from human collagen IIA, rat CCN3 and zebrafish CV-2 have been solved with X-ray crystallography (Zhang et al., 2008, Xu et al., 2017). These structures reveal the ordered secondary structure of these vWC domains is entirely -sheet. Therefore, the circular dichroism spectral analysis of CHRDL2 is consistent with it having three predicted vWC domains, which cover approximately half the peptide sequence (Nakayama et al., 2004, Oren et al., 2004). The circular dichroism also predicts CHRDL2 has a small amount of -helical content, and these elements are therefore likely located outside the vWC domains. CHRDL2 has two relatively long regions that lack sequence homology to structures of known fold. These are a region between the vWC2 and vWC3 domains that is 75 amino acids in length, and a C-terminal region after vWC3 that is 115 amino acids in length. Secondary structure predictions suggested -strands in the region between vWC2 and vWC3, and a combination of -strands and -helices in the C-terminal region (Figure 4-7).

SEC-MALS and AUC showed CHRDL2 exists as a monomer in solution (Figure 4-4). Molecular weights of 60.4 kDa and 64.1 kDa were calculated by AUC and SEC-MALS, respectively for CHRDL2, corroborating the mass observed with SDS-PAGE. AUC calculated a frictional coefficient ratio of 1.5, indicating CHRDL2 is compact but slightly elongated.

CHRDL2 was secreted in a form with molecular weight 60 kDa, larger than the predicted mass from the CHRDL2 peptide sequence. Deglycosylation and lectin binding assays revealed CHRDL2 is glycosylated with both N-linked and O-linked glycans, increasing the observed mass of the protein (Figure 4-5). Incubation with PNGase F indicated that CHRDL2 has one N-linked glycan, consistent with its peptide sequence containing a single N-glycosylation consensus sequence. However, CHRDL2 still bound a number of lectins, specific carbohydrate binding proteins, after PNGase F treatment. This indicates CHRDL2 is also modified with O-linked glycans.

128 Consistent with our analysis, the mass of recombinant human CHRDL2 expressed in COS-7 cells and the mouse homolog expressed in HEK293T cells has previously been reported as larger than that predicted from the peptide sequence (Nakayama et al., 2004, Oren et al., 2004). It had been suggested that this was due to glycosylation, but this had not been demonstrated. Indeed, we provide evidence for both N-linked and O- linked glycosylation of CHRDL2. N-linked glycosylation has been observed on chordin and BMPER (Troilo et al., 2014, Lockhart-Cairns et al., 2018). It is not known whether this glycosylation is important to CHRDL2 function.

Solution structural analyses were performed with SAXS. Purified CHRDL2 was shown to be of high quality, lacking aggregation, by Guinier analysis (Figure 4-9). The normalised Kratky plot showed CHRDL2 to be folded with a slightly elongated shape, consistent with the AUC calculations. The decay of scattering intensity with the scattering vector q was characteristic of a multidomain protein with flexible linkers (Figure 4-10). The shape of the PDDF was characteristic of compact but slightly elongated protein (Figure 4-11). The PDDF was used to generate an ab initio model, this resembled a flattened disc (Figure 4-12) and had a theoretical S20,w of 3.95S, larger than the experimental value of 3.77S. This indicates CHRDL2 has a slightly more elongated shape than the ab initio model suggests. The flexibility of CHRDL2 was investigated with EOM analysis (Figure 4-14) and predicted CHRDL2 exhibits limited flexibility, suggesting the regions of unknown fold are not highly flexible and unstructured.

Interactions of human CHRDL2 with proteins of the extracellular matrix were screened with solid phase binding assays, and further investigated with bio-layer interferometry. This demonstrated binding of the human CHRDL2 construct to Tsg, BMP-4 and the fibrillin-1 PF1 fragment (Figure 4-17 and Figure 4-18C). The fibrilin-1 PF1 fragment comprises the N-terminal region up to the fourth EGF-like domain (Cain et al., 2005), which has been shown to interact with the pro-domains of many BMPs (Sengle et al., 2008a), and with the extracellular BMP antagonist Gremlin-2 (Tamminen et al., 2013). Binding was not observed for syndecan-4, collagen IV or the fibronectin III 7-14 fragment (Figure 4-16 and Figure 4-18).

The cleavage of human CHRDL2 by the tolloid BMP-1 was investigated with an in vitro cleavage assay. No cleavage of CHRDL2 was observed, despite complete cleavage of N-chordin under the same conditions (Figure 4-19A), and this was unaltered by the presence of Tsg in the reaction mixture (Figure 4-19B). Therefore, the mechanism of BMP release from the CHRDL2/BMP complex is not known.

129 5 Results Chapter 3: Characterisation of the CHRDL2/Tsg complex

Mouse CHRDL2 and Tsg have been shown to interact with high affinity and co-elute during SEC (Zhang et al., 2007). Following successful purification and characterisation of CHRDL2, and confirmation of the interaction between human CHRDL2 and Tsg (see chapter 4), the CHRDL2/Tsg complex was isolated. In this chapter, the CHRDL2/Tsg complex was characterised with SEC-MALS and AUC, and the structure probed with SAXS and TEM.

5.1 Isolation of a CHRDL2/Tsg complex To form a CHRDL2/Tsg complex, CHRDL2 and Tsg were mixed at a 1:1 molar stoichiometry, at final concentrations of 5 M each, in 10 mM HEPES, 150 mM NaCl, pH 7.4 and incubated at room temperature for 1 hour. SEC was then performed with a Superdex200 increase 10/30 GL column (GE Healthcare) in the same buffer (Figure 5-1).

The SEC trace displayed a major elution peak at a volume of 12 ml with a shoulder at 13.5 ml (Figure 5-1A). SDS-PAGE of the SEC elution fractions showed the peak at 12 ml contained both CHRDL2 and Tsg (Figure 5-1B). The shoulder appeared to be CHRDL2. The formation of a complex between CHRDL2 and Tsg was confirmed by comparison of the SEC trace with SEC traces of the individual CHRDL2 and Tsg species (Figure 5-1C). This showed that following incubation, CHRDL2 and Tsg co- eluted during SEC at an earlier elution volume than their individual species, indicating the formation of a larger species.

130

Figure 5-1 Formation of a CHRDL2/Tsg complex. (A) SEC of the CHRDL2 and Tsg complex in 10 mM HEPES, 150 mM NaCl, pH 7.4 with a Superdex200 Increase column. Prior to SEC, CHRDL2 and Tsg were mixed at a 1:1 molar stoichiometry, to a final concentration of 5 M each, and incubated for 1 hour at room temperature. Protein elution was monitored via absorbance at 280 nm. Dotted lines indicate the fraction analysed in (B). (B) Coomassie-stained reducing SDS- PAGE of SEC elution fractions. (C) Overlay of normalised SEC traces for Tsg (blue), CHRDL2 (red), and the CHRDL2/Tsg incubation (purple), all performed on a Superdex200 Increase column in 10 mM HEPES, 150 mM NaCl, pH 7.4.

5.2 Hydrodynamic analysis of the CHRDL2/Tsg complex Following formation of a CHRDL2/Tsg complex, hydrodynamic analysis was performed on the complex using SEC-MALS and AUC. For SEC-MALS and AUC, CHRDL2 and Tsg were mixed at a 1:2 molar stoichiometry with the aim of decreasing uncomplexed CHRDL2 in the sample, and incubated at room temperature for 1 hour prior to analysis.

5.2.1 SEC-MALS of the CHRDL2/Tsg complex

For SEC-MALS the final concentrations of Tsg and CHRDL2 in the incubating sample were 10 M and 5 M, respectively, and the SEC was performed with a Superdex200 column in 10 mM HEPES, 150 mM NaCl, pH 7.4. The SEC trace showed two peaks (Figure 5-2A). Analysis of the major peak at an elution volume of 12 ml calculated a

131 molecular mass of 91.3 kDa, with a hydrodynamic radius of 54.2 Å. This is consistent with formation of a 1:1 CHRDL2/Tsg complex which has a predicted mass of ~93 kDa. For the second peak, a molecular mass of 31.7 kDa was calculated, indicating this peak consists of Tsg, with a hydrodynamic radius of 36.6 Å (Figure 5-2B). SDS-PAGE analysis of the SEC-MALS elution fractions showed the major peak contained CHRDL2 and Tsg, while the smaller peak was Tsg (Figure 5-2C).

Figure 5-2 SEC-MALS of the CHRDL2/Tsg complex. Prior to SEC-MALS, CHRDL2 and Tsg were mixed at a 1:2 molar stoichiometry, at concentrations of 5 M and 10 M, respectively, and incubated for 1 hour at room temperature. SEC was performed with a Superdex 200 10/30 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. (A) SEC-MALS trace showing relative differential refractive index (dRI) in black on the left y-axis and molecular weight in green on the right y-axis. (B) Hydrodynamic parameters from SEC-MALS analysis. (C) Coomassie-stained SDS-PAGE of 0.5 ml elution fractions from SEC-MALS.

5.2.2 AUC of the CHRDL2/Tsg complex

Sedimentation velocity AUC was performed on a Tsg/CHRDL2 that had not been SEC purified. Prior to AUC, Tsg and CHRDL2 were incubated at 11 M and 5.5 M, respectively, in 10 mM HEPES, 150 mM NaCl, pH 7.4 for 1 hour at room temperature (Figure 5-3). The sedimentation coefficient distribution displayed two peaks, with the larger peak having a prominent shoulder (Figure 5-3A). The sedimentation coefficient

132 distribution was split into three sections for analysis. Due to the peaks overlapping the calculated values will be overestimates for smaller species, and underestimates for larger species.

The peak in section 1 had a S20,w of 2.85S, a hydrodynamic radius of 30.8 Å and a calculated molecular weight of 36.5 kDa, consistent with previous AUC data for Tsg (Troilo, 2014, Troilo et al., 2016), indicating this species was Tsg. The shoulder in section 2 had a S20,w of 4.16S, a hydrodynamic radius of 37.2 Å and a molecular weight of 64.8 kDa. This was consistent with the molecular weight of 60.4 kDa calculated from AUC data for CHRDL2 alone (see Table 5-1), indicating this species is CHRDL2. The peak in section 3 had a S20,w of 5.21S, a hydrodynamic radius of 42.4 Å and a calculated molecular weight of 83.1 kDa, suggesting the species in this peak was a 1:1 CHRDL2/Tsg complex. Hence the CHRDL2/Tsg AUC sample contained three species: Tsg, CHRDL2 and a 1:1 CHRDL2/Tsg complex.

Figure 5-3 AUC of the CHRDL2/Tsg complex. Sedimentation velocity AUC was performed on a CHRDL2/Tsg sample that had been incubated at a 1:2 molar stoichiometry in 10 mM HEPES, 150 mM NaCl, pH 7.4 for 1 hour at room temperature. (A) The sedimentation coefficient distribution produced with SEDFIT (Schuk, 2000). S20,w was calculated from the apparent sedimentation coefficient using SEDNTERP (Biomolecular Interaction Technologies Center, the University of New Hampshire). The dotted lines demarcate the areas analysed in (B). (B) Hydrodynamic parameters for the three demarcated sections of the sedimentation coefficient distribution.

133 Despite differences in the absolute values of the experimental hydrodynamic parameters of the CHRDL2/Tsg complex, SEC-MALS and AUC measurements support the formation of a 1:1 CHRDL2/Tsg complex. Comparison of the hydrodynamic parameters of CHRDL2 and the CHRDL2/Tsg complex determined with AUC and SEC- MALS are consistent with each other (Table 5-1). Both SEC-MALS and AUC show a consistent increase in molecular mass, hydrodynamic radius and sedimentation coefficient in the CHRDL2/Tsg sample compared to the CHRDL2 sample.

Table 5-1 Comparison of experimentally derived hydrodynamic parameters for CHRDL2 and the CHRDL2/Tsg complex

Molecular mass (kDa) Hydrodynamic radius (Å) Sedimentation

coefficient (S20,w)

CHRDL2 CHRDL2/Tsg CHRDL2 CHRDL2/Tsg CHRDL2 CHRDL2/Tsg

SEC-MALS 64.1 91.3 45.9 54.2 - -

AUC 60.4 83.1 37.9 42.4 3.77 5.21

5.3 SAXS of the CHRDL2/Tsg complex SAXS was used for initial structural analysis of the CHRDL2/Tsg complex. The complex was run under identical conditions as the CHRDL2 sample with the same CHRDL2 purification (see section 4.5). CHRDL2 and Tsg were incubated at final concentrations of 106 M and 53 M, respectively, with CHRDL2 at the same concentration as was used for the previous SAXS analysis. After incubation, the sample was injected onto a Superdex200 Increase 3.2/30 GL column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4, and frames were collected as protein eluted from the column, as before. Frames corresponding to the

CHRDL2/Tsg complex peak were selected that had a constant Rg when plotted on the signal plot (Figure 5-4), which estimates the signal intensity of each frame and scales with sample concentration. Frame selection was validated using Durbin-Watson analysis within the ScÅtter software (Appendix 10).

134

Figure 5-4 CHRDL2/Tsg SAXS frame selection. (A) Frames 189 to 201 were selected for SAXS analysis, shown between the grey dashed lines of the signal plot. The SAXS signal plot estimates the signal, displayed as the integral of the ratio of signal intensity to background, for each frame of the sample. (B) These frames generated a flat plot when Rg was plotted for each frame (shown in blue on right y-axis) on the selected frames of the signal plot (orange on left y- axis, as in (A)), and a Durbin-Watson statistic of 2 was calculated for autocorrelation between these frames and neighbouring frames (Apppendix 10).

5.3.1 SAXS analysis of the CHRDL2/Tsg complex

SAXS analysis of the CHRDL2/Tsg complex (Figure 5-5A) showed a linear Guinier region, indicating a monodisperse, non-aggregated species, with an Rg of 49.9 Å (Figure 5-5B). The normalised Kratky plot displayed a peak at low q values, indicating a folded protein. This peak is slightly displaced from the cross-hairs at (3, 1.104), the peak position for spherical proteins (Mertens and Svergun, 2010), indicating the CHRDL2/Tsg complex is slightly elongated (Figure 5-5C). Analysis of the power law relationship of the decay in scattering intensity with q shows the scattering intensity decays as q-3, indicating the complex retains the flexibility observed in CHRDL2 (Figure 5-5D).

135

Figure 5-5 SAXS analysis of the CHRDL2/Tsg complex. (A) The one-dimensional SAXS profile of the CHRDL2/Tsg complex displaying relative scattering intensity, log[I(q)], as a function of the scattering vector, q, after buffer subtraction. (B) Guinier analysis at low q values for determination of the radius of gyration (Rg) (CHRDL2/Tsg complex Rg = 49.9 Å), with residuals

2 for the Guinier region. (C) The normalised Kratky plot [(I(q)/I(0))(qRg) vs. qRg] derived from the scattering profile. A peak at (√3, 1.104), shown by crosshairs, indicates a compact globular particle. The curve of a folded particle peaks and then returns towards the x-axis. (D) Porod plots examining the power law relationship of the decay in scattering intensity with q. The plateau reached first in the I(q).q3 vs. q3 plot indicates flexibility.

136 The PDDF for the CHRDL2/Tsg complex showed a peak between 25 Å and 80 Å, indicating the majority of intermolecular distances for the complex were between these lengths (Figure 5-6). The PDDF also had a tail extending to larger distances, with a Dmax of 174 Å, indicating the complex has a slightly elongated shape.

Figure 5-6 SAXS shape analysis of the CHRDL2/Tsg complex. (A) The pair distance distribution function (PDDF) generated from the indirect Fourier transformation of the

CHRDL2/Tsg complex SAXS data, giving a Dmax of 174 Å. The PDDF is the distribution of distances between all pairs of points within the particle. (B) Overlay of the experimental scattering data (black) and the theoretical scattering curve calculated from the PDDF (red), 2 = 1.04, and the corresponding residuals plot.

5.3.2 SAXS analysis of Tsg Ab initio modelling of complexes can be performed with MONSA (Franke et al., 2017). MONSA uses scattering data from the complex and the individual components to resolve the arrangement of the individual components within a low-resolution shape. MONSA requires input scattering data of the individual SAXS components, as well as the scattering data from the complex. Although SAXS has been performed on Tsg previously (Troilo et al., 2016), this was at a different synchrotron with a different experimental set-up. Therefore, Tsg SAXS data was collected here under identical conditions as CHRDL2 and the complex to enable more accurate MONSA modelling (Figure 5-7). Tsg at 106 M in 10 mM HEPES, 150 mM NaCl, pH 7.4 was injected onto a Superdex200 Increase 3.2/30 GL column (GE Healthcare), and frames were collected as protein eluted from the column, as before. Guinier analysis showed the Tsg sample was monodisperse and non-aggregated, with an Rg of 27.1 Å (Figure 5-7B). The

137 normalised Kratky plot confirmed the Tsg sample to be folded (Figure 5-7C). The PDDF showed a shape consistent with a slightly elongated globular protein and calculated a

Dmax of 95 Å for Tsg (Figure 5-7D).

Figure 5-7 Tsg SAXS analysis. (A) The one-dimensional SAXS profile of Tsg displaying relative scattering intensity, log[I(q)], as a function of the scattering vector, q, after buffer subtraction. (B)

Guinier analysis at low q values for determination of the Rg (Tsg Rg = 27.1 Å), with residuals for

2 the Guinier region. (C) The normalised Kratky plot [(I(q)/I(0))(qRg) vs. qRg] derived from the scattering profile. A peak at (√3, 1.104), shown by crosshairs, indicates a compact globular particle. (D) The PDDF generated from the indirect Fourier transformation of the SAXS data, Dmax = 95 Å. The PDDF is the distribution of distances between all pairs of points within the particle. (E) Overlay of the experimental scattering data (black) and the theoretical scattering curve calculated from the PDDF (red), 2 = 0.93, and the corresponding residuals plot.

138 5.3.3 Multiphase ab initio modelling of the CHRDL2/Tsg complex

Multiphase ab initio modelling of the CHRDL2/Tsg complex was performed with MONSA in the ATSAS suite (Franke et al., 2017). MONSA outputs a model of the complex with the individual components displayed as two separate phases. Six independent MONSA runs were performed and compared (Appendix 11). The CHRDL2 phases of each run MONSA run were compared in the DAMAVER suite (Franke et al., 2017), this showed the independent models of the CHRDL2 phases to be highly consistent with each other (NSD = 0.61), with an elongated shape consistent with the ab initio model produced from the CHRDL2 SAXS analysis. A script was used to collate and align the CHRDL2 volume of the individual MONSA runs (Rambo, 2015). The output is an averaged CHRDL2 model on which the Tsg phases of the independent MONSA runs are displayed, allowing visual inspection of the relative placement of Tsg on CHRDL2 in the independent MONSA models (Figure 5-8). The independent MONSA models all predicted Tsg bound towards the end of CHRDL2, producing a complex that is slightly elongated. The Tsg phase of one run appeared on the other end of the CHRDL2 model in comparison to the other five MONSA runs (Figure 5-8A). This may be due to the low resolution of SAXS precluding the distinction of the two ends of the elongated CHRDL2 model during MONSA modelling. All individual MONSA runs fit the data of the complex well, showing high similarity between the theoretical and experimental scattering curves (Figure 5-8B).

139

Figure 5-8 Multiphase modelling of the CHRDL2/Tsg complex. (A) Multiphase modelling of the CHRDL2/Tsg complex was performed with MONSA (Franke et al., 2017). 6 independent MONSA runs were performed. Displayed is the averaged CHRDL2 volume, in turquoise, with the relative position of the Tsg phases of the independent runs, colour coded Run 1 to Run 6 according to the key. A 20 Å resolution mask has been applied to all models. Scale bar represents 25 Å. (B) A representative fit of the theoretical scattering of one of the MONSA models (red) to the experimental data (black), and the residuals plot for the data fit. All 2 values for the MONSA models were between 1.82 and 1.86.

5.4 Negative stain transmission electron microscopy of the CHRDL2/Tsg complex To directly analyse the structure of the CHRDL2/Tsg complex, TEM was used. Initially, negative stain TEM was used in which after absorption onto the grid, the sample is coated with a heavy metal stain to increase the sample contrast. The use of a stain reduces the resolution achievable but can provide shape and size information that can be used to inform cryo-TEM.

For negative stain TEM, the peak fraction from SEC-MALS (Figure 5-2) was used. The sample was diluted in 10 mM HEPES, 150 mM NaCl, pH 7.4 to 1 M, adsorbed onto carbon coated grids and stained with 2% uranyl acetate. Discrete particles could be seen in the micrographs and so images were collected for processing (Figure 5-9A). Processing was performed in the EMAN2.0 software suite (Tang et al., 2007). Particles

140 were picked using the swarm setting in EMAN with a Gaussian mask to remove particles cropping in to the field of the picked particle. 15600 particles were picked and eight rounds of reference-free class averaging were performed to generate 200 two- dimensional reference-free class averages (Figure 5-9B). The reference-free class averages showed a slightly elongated molecule with a bilobal shape.

Figure 5-9 Negative stain TEM of the CHRDL2/Tsg complex. (A) Representative micrograph of a negatively stained CHRDL2/Tsg TEM grid. Scale bar represents 100 nm. (B) Representative reference-free two-dimensional class averages. Box size = 75 pixels, 4.2 Å per pixel.

Classes with poor contrast were discarded, leaving 134 classes, from which an initial three-dimensional model was made. This was used to iteratively refine the classes over six rounds of model-based particle classification. In this iterative process, two- dimensional classes are generated by aligning particles with two-dimensional projections of the initial three-dimensional model, these classes are then used to generate a refined three-dimensional model that is used for the next round of model- based particle classification. The final three-dimensional model (Figure 5-10) was consistent with the reference-free class averages (Figure 5-9B), and showed a slightly elongated but compact structure. However, this model was smaller than expected based on the SAXS data, the longest axis of the model measured 98 Å.

141

Figure 5-10 Negative stain TEM three-dimensional reconstruction. (A) Three-dimensional reconstruction from iterative rounds of model refinement against the particle set. Scale bar represents 25 Å. (B) Two dimensional projections of the model and model refined two- dimensional class averages. Box size = 75 pixels, 4.2 Å per pixel.

The Fourier Shell Correlation (FSC) for the final three-dimensional reconstruction (Figure 5-11A) displays a curve that falls sharply to zero, indicating the processing was not simply aligning noise, and remains at zero to low spatial frequencies, indicating sufficient angular sampling and mask size during processing (Penczek, 2010). The Euler angle distribution shows a good coverage of angles by particles used to construct the final three-dimensional model (Figure 5-11B). The FSC and Euler angle distribution suggest the final three-dimensional model is representative of the data from which it was constructed. Together with visual comparison showing consistency of the final three-dimensional model with the reference-free class averages, these indicate the final three-dimensional reconstruction in indicative of the input data. The reference-free class averages may be smaller than expected, based on the SAXS data, due to dissociation of the complex due to dehydration and the low pH of the stain. Therefore, cryo-TEM was attempted to see if the complex remained associated in more native conditions.

142

Figure 5-11 Negative stain TEM resolution. (A) The Fourier Shell Correlation (FSC) of the negative stain TEM CHRDL2/Tsg model. The 0.5 FSC criteria estimates a resolution of 31 Å. (B) Euler angle distribution for particles contributing to the final reconstruction. Column colour denotes the particle numbers at each angle. Red indicates a higher number of particles contributing to the given angle.

5.5 Cryo-transmission electron microscopy of the CHRDL2/Tsg complex 5.5.1 Cryo-transmission electron microscopy without complex purification

Higher resolution structures can be obtained with cryo-TEM in which proteins are imaged in vitreous ice. Whilst the absence of stain enables higher resolution structures to be solved with electron microscopy, the sample contrast is reduced, limiting the size of particles that can be observed sufficiently with cryo-TEM to allow processing and structural determination. Therefore, it first needed to be determined whether particles could be seen in images of cryo-TEM grids prepared with a CHRDL2/Tsg sample. To this end, purified CHRDL2 and Tsg were incubated together and used to make cryo-grids without further SEC purification. CHRDL2 and Tsg were mixed at final concentrations of 7 M and 14 M, respectively, in 10 mM HEPES, 150 mM NaCl, pH 7.4 and incubated overnight at 4 °C prior to cryo-grid preparation. Grids were prepared with the CHRDL2/Tsg sample as a neat solution. Following glow discharging of R2.2 copper grids with a 400 mesh (Quantifoil), sample was pipetted onto the grids. Grids were then blotted and plunge frozen in liquid ethane. The sample was imaged with an FEI Tecnai Polara and images recorded with a Gatan K2 Summit direct detector. Images were taken as 12 second movies consisting of 60 frames and motion corrected and dose weighted with MotionCor2 (Zheng et al., 2017). Images showed the cryo-grids had an even distribution of sample, with no aggregation and little ice contamination (Figure 5-12A). Particles were picked with Gautomatch (http://www.mrc-lmb.cam.ac.uk/kzhang/) using a Gaussian blob of 200 Å diameter. Two

143 rounds of reference-free two-dimensional classification were performed in RELION-2 (Kimanius et al., 2016), and the classes with highest contrast were used for further particle picking in Gautomatch, generating a dataset of 106454 particles. A final round of two-dimensional classification was then performed in CryoSPARC (Punjani et al., 2017), sorting particles into 100 reference-free classes. This generated distinct classes with high contrast to the background (Figure 5-12B), confirming particles could be observed with cryo-TEM. The classes had good contrast and showed a number shapes, with elongated and more compact classes being observed. These may represent different orientations of the complex, or reflect the heterogeneity of the sample, as it had not been purified with SEC. This preliminary cryo-TEM confirmed particles could be observed sufficiently for particle picking and classification. Data collection and processing is summarised in (Figure 5-13).

Figure 5-12 Preliminary cryo-TEM of a CHRDL2/Tsg sample. (A) Representative motion- corrected micrograph of the CHRDL2/Tsg sample imaged using cryo-TEM. Cryo-grids were made with a sample of CHRDL2 and Tsg that had been incubated at a 1:2 molar ratio overnight at 4°C in 10 mM HEPES, 150 mM NaCl, pH 7.4. Scale bar represents 100 nm. (B) Reference- free class averages of the CHRDL2/Tsg sample. Box size = 64 pixels, 4.96 Å per pixel.

144

Figure 5-13 Cryo-TEM data collection and processing summary. Cryo-TEM data was collected for CHRDL2/Tsg following incubation, and for a CHRDL2/Tsg sample that had been SEC purified. Following grid preparation both samples were imaged and processed using the same experimental set-up and strategy.

145 5.5.2 Cryo-transmission electron microscopy after purification

Following confirmation that particles could be observed in cryo-TEM, further cryo-TEM was performed on a SEC purified sample. CHRDL2 and Tsg were incubated at final concentrations of 6.5 M and 13 M, respectively in 10 mM HEPES, 150 mM NaCl, pH 7.4 for one hour at room temperature. The sample was then passed through a Superdex200 increase 3.2/30 GL column (GE Healthcare) in 10 mM HEPES, 150 mM NaCl, pH 7.4. The SEC trace showed a peak with a prominent shoulder at larger elution volumes (Figure 5-14A), as was observed with SEC-MALS and SEC-SAXS, and elution fractions were assessed with reducing SDS-PAGE. The peak fraction was used to make grids for cryo-TEM (Figure 5-14B).

Grids were prepared with the CHRDL2/Tsg sample as a neat solution. As before, sample was pipetted onto glow discharged R2.2 copper grids with a 400 mesh (Quantifoil). Grids were then blotted and plunge frozen in liquid ethane.

Figure 5-14 Purification of the CHRDL2/Tsg complex for cryo-TEM. (A) SEC trace for the purification of the CHRDL2/Tsg complex using a Superdex200 increase 3.2/20 GL column in 10 mM HEPES, 150 mM NaCl, pH 7.4. Protein elution was monitored via absorbance at 280 nm and 50 l elution fractions were collected. Prior to SEC CHRDL2 and Tsg were mixed at a 1:2 molar ratio and incubated for one hour at room temperature. The elution fractions between the black dotted lines were analysed in (B). The red dotted lines highlight the fraction used to make cryo- grids. (B) Anti-His6 western blot of the SEC elution fractions following reducing SDS-PAGE.

146 Grids were imaged with the same microscope and conditions as were used for the previous cryo-TEM dataset. On grid inspection, the sample did not appear evenly distributed, with the sample appearing to clump together. Therefore, further grids were made with R2.2 copper grids that had been carbon-coated, to aid sample distribution. This resulted in grids with an evenly distributed sample (Figure 5-15A), however fewer images were recorded with this dataset due to popping of the carbon coating. As before, particles were picked with a Gaussian blob of diameter 200 Å in Gautomatch (http://www.mrc-lmb.cam.ac.uk/kzhang/). Two rounds of reference-free two-dimensional classification were performed on this particle set in RELION-2 (Kimanius et al., 2016), and the classes with highest contrast were used for further particle picking in Gautomatch, generating a dataset of 82500 particles. A final round of reference-free two-dimensional classification was then performed in CryoSPARC (Punjani et al., 2017). Data collection and processing is summarised in (Figure 5-13).

The two-dimensional classes appeared globular and some showed an elongated shape (Figure 5-15B). Measurement of particle length of the two-dimensional class averages in Fiji (Schindelin et al., 2012) reported the classes to have longest axes between 65 Å and 131 Å (Figure 5-15C), consistent with dimensions reported from SAXS. The classes appeared to have poorer contrast than the previous set, which may be due to the carbon film. Little detail could be seen in the class averages as images were recorded at large defocus values (-3 to -5 m) to enable particle identification. An initial three- dimensional model was generated; however, it was not representative of the input class- averages. This could stem from poor contrast from the carbon film and sample heterogeneity.

147

Figure 5-15 Cryo-TEM of CHRDL2/Tsg after SEC purification. (A) Representative motion- corrected micrograph of the CHRDL2/Tsg sample imaged using cryo-TEM. Cryo-grids were made with a sample of CHRDL2 and Tsg that had been incubated at a 1:2 molar ratio for one hour at room temperature and purified with SEC in 10 mM HEPES, 150 mM NaCl, pH 7.4. Scale bar represents 100 nm. (B) Reference-free class averages of the CHRDL2/Tsg sample. Box size = 64 pixels, 4.96 Å per pixel. (C) Class lengths were measured in Fiji (Schindelin et al., 2012). The red lines indicate the axis of measurement.

148 5.6 Summary and discussion Following demonstration of an interaction between human CHRDL2 and Tsg, isolation of a CHRDL2/Tsg complex was pursued. SEC showed the formation of a larger species between CHRDL2 and Tsg after incubation (Figure 5-1). In subsequent analyses, CHRDL2 and Tsg were incubated at a 1:2 molar ratio, to ensure saturation of CHRDL2, however AUC revealed that under these conditions monomeric CHRDL2 remained in the sample (Figure 5-3). The AUC and SEC-MALS analyses suggested CHRDL2 and Tsg form a 1:1 complex in solution (Figure 5-2 and Figure 5-3), however, these mass calculations will be affected by the presence of monomeric CHRDL2 and Tsg. To enable comparison of data recorded from CHRDL2 and Tsg separately to that of the complex under identical experimental conditions, SAXS data was recorded for Tsg in parallel (Figure 5-7). However, SAXS analysis of Tsg has been performed previously in our laboratory (Troilo, 2014, Troilo et al., 2016). The SAXS analysis recorded here reported showed the Tsg sample was monodisperse, folded and did not contain aggregation. Guinier analysis reported an Rg of 27.1 Å and the PDDF calculated a Dmax of 95 Å. These are consistent but slightly smaller than the previously reported values for

Tsg (Rg = 31 Å, Dmax =110 Å). The published Tsg data was recorded before the introduction of the SEC-SAXS set-up, and so traces of aggregate may have increased the Rg and Dmax, resulting in the small discrepancy in values between the published values and those reported here. For SAXS analysis of the complex, a SEC-SAXS setup enabled purification of the complex from the monomeric species. SEC did not fully resolve the complex from the monomeric species and as such, a small amount of heterogeneity is likely to remain. To reduce the signal contribution of the monomeric species, SAXS analysis was performed on frames across the peak that had a constant Rg but did not show autocorrelation. CHRDL2 and Tsg were incubated at final concentrations of 53 M and 106 M, respectively, for SAXS. No signal was detected in the first frames of the SEC-SAXS, recorded as protein eluted from the SEC column, indicating at these higher concentrations the CHRDL2 and Tsg incubating mixture did not have aggregation. An

Rg of 49.9 Å was calculated from Guinier analysis (Figure 5-5), and a Dmax of 174 Å was reported from the PDDF (Figure 5-6). Comparison with the values for Tsg (Rg = 27.1 Å,

Dmax =95 Å) and CHRDL2 (Rg = 36.3 Å, Dmax =128 Å) shows increases consistent with formation of a complex. The normalised Kratky plot indicated the complex was slightly elongated (Figure 5-5), supported by the shape of the PDDF in which it peaked at lower distance values, with a tail to larger distance values (Figure 5-6).

The three sets of scattering data (CHRDL2, Tsg, CHRDL2/Tsg) were used in ab initio modelling of the complex with MONSA. Six independent runs were performed and

149 compared (Figure 5-8). The models were consistent with each other, modelling a 1:1 complex in which Tsg bound towards the end of CHRDL2, maintaining an overall elongated structure. The theoretical scattering from the MONSA models agreed well with the experimental scattering data of the complex, supporting CHRDL2 and Tsg forming a 1:1 complex (Figure 5-8B), as was observed with AUC and SEC-MALS.

Negative stain TEM was used to directly image the structure of the complex, as this can be used to inform the processing of higher resolution cryo-TEM data. Negative stain grids were prepared with the peak fraction from SEC-MALS. (Figure 5-9). Particles could be observed and formed a homogenous distribution in grid images. The two- dimensional class averages showed a bilobal structure, but did not appear as elongated as the SAXS data would suggest. This was recapitulated in the three-dimensional model, which was also smaller than expected based on the SAXS data. This may have resulted for a number of reasons. The low pH of the uranyl acetate stain may have caused dissociation of the complex on the grid, reducing the size of the three- dimensional model. Flattening of particles due to dehydration has also been observed in negative stain TEM to reduce apparent particle size (Ohi et al., 2004). The particles may also be adsorbing to the grid predominantly in orientations in which they are imaged end on. Cryo-TEM images proteins under more native conditions in the absence of stain, this removes artefacts that result from the heavy metal stain, such as the limited resolution and potential complex dissociation. Therefore, it was decided to pursue cryo-TEM. Due to the lower contrast of cryo-TEM it first needed to be determined whether particles of such a small mass, ~90 kDa for a 1:1 CHRDL2/Tsg complex, could be observed. To this end, grids were made with a sample of preincubated CHRDL2/Tsg that had not been further SEC purified. Image processing showed that particles could indeed be picked and sorted into two-dimensional classes (Figure 5-12).

Following confirmation that particles could be observed in cryo-TEM, grids were prepared using an SEC-purified CHRDL2/Tsg sample (Figure 5-14). The two- dimensional class averages appeared globular, with some elongated classes consistent with the SAXS data (Figure 5-15). Measurement of particles lengths confirmed these classes were within dimensions consistent with the SAXS data and MONSA multiphase modelling. However, little detail could be observed within each class. Samples were prepared using grids that were carbon coated to produce a more homogenous sample distribution. This carbon coating may have contributed to the poor sample contrast. This preliminary cryo-TEM showed particles could be identified and initial processing could be performed, however, further optimisation is required to improve the contrast and detail of the classes, to enable a three-dimensional reconstruction. Optimisation of

150 sample and grid preparation, and the use of phase plates during imaging may aid this (see section 6.6.2), however, this was not possible during this project due to time constraints.

151 6 Final discussion

This study aimed to contribute to the understanding of the chordin family of BMP antagonists and their modulation by Tsg. In doing so, the chordin-Tsg interaction was investigated, and CHRDL2 was structurally characterised for the first time. A CHRDL2/Tsg was subsequently isolated for characterisation.

6.1 The Tsg-chordin interaction

This work identified the vWC2-3 region of chordin as the specific Tsg binding region, and showed a lower affinity interaction with the vWC1 domain. This is consistent with coimmunoprecipitation of murine chordin vWC1 and vWC2-3, but not vWC4, by Tsg (Scott et al., 2001). Previous SPR investigations showed low affinity binding of the individual vWC domains of murine chordin to Tsg (Zhang et al., 2007). Taken together with these previous analyses, this work supports the specific Tsg binding site spanning the chordin vWC2 and vWC3 domains. Tsg interacts with both BMPs and chordin, and ternary complex formation has been demonstrated with crosslinking (Oelgeschlager et al., 2000, Larrain et al., 2001, Troilo et al., 2016). Tsg enhances the chordin-BMP interaction, and this is believed to be the mechanism via which Tsg exerts its anti-BMP behaviour within the chordin/BMP/Tsg ternary complex (Oelgeschlager et al., 2000, Scott et al., 2001). The work presented here provides an insight into how this may occur in the ternary complex. By binding to the chordin vWC2-3 region, due to the horseshoe conformation of chordin, Tsg would be located at the centre of the chordin molecule (Figure 6-1). BMP dimers bind a single chordin molecule and interact with the N- and C-terminal vWC domains, hence BMPs would span the prongs of the chordin horseshoe (Zhang et al., 2007, Troilo et al., 2014). By binding at the centre of the chordin molecule, Tsg would be well placed to modulate the BMP/chordin interaction to exert its anti-BMP activity. Though Tsg interacted with the chordin vWC1 domain in isolation, it did not interact with vWC1-4CHRD. This suggests the 4CHRD region occludes an interaction between Tsg and the vWC1 domain in full-length chordin. This may prevent Tsg from competing with the vWC1- BMP interaction in full-length chordin. At the chordin C-terminus, the binding domain varies between BMPs. BMP-2 and BMP-4 bind vWC3, whereas BMP-7 binds vWC4 (Larrain et al., 2000, Zhang et al., 2007). By having vWC2-3 as the major Tsg-binding region in chordin, the vWC1 and vWC4 domains are able to bind BMPs. A crosslinked Tsg/chordin/BMP-4 complex has been observed (Larrain et al., 2001), indicating the Tsg and BMP-4 binding epitopes of the chordin vWC3 domain are different, allowing simultaneous binding.

152

Figure 6-1 The interaction of Tsg with both BMP and chordin in the ternary complex.

Schematic showing the prospective arrangement of molecules in the ternary complex enabling simultaneous interaction of Tsg with BMP and chordin, based on binding studies. Tsg interacts with the chordin vWC2-3 region, and BMP interacts with the chordin vWC1 domain and either the vWC3 domain or the vWC4 domain. The vWC domains of chordin are depicted in blue and the CHRD domains are depicted in purple. Tsg is depicted in green and the BMP dimer is red.

This work identified an interaction between Tsg and the chordin vWC1 domain, but not a chordin vWC1-4CHRD construct. This suggests the 4CHRD region occludes an interaction between Tsg and vWC1 in full-length chordin. However, this interaction may be functionally significant after tolloid cleavage of chordin. In the presence of Tsg, BMP- 4 no longer crosslinks with the chordin vWC1 domain (Oelgeschlager et al., 2000). Hence, it has been proposed that Tsg also exerts pro-BMP activity by preventing an interaction between BMPs and chordin vWC domains that retain antagonistic capacity following chordin cleavage. The chordin 4CHRD region may be important in preventing the occlusion of the vWC1 domain/BMP interaction in full-length chordin. A role in the endocytic clearance of chordin cleavage fragments has also been proposed for Tsg, as the intermediate chordin cleavage fragment was no longer detected in the media of Xenopus embryo explants on injection of tsg mRNA (Larrain et al., 2001). The Tsg- vWC1 interaction following chordin cleavage may play a role in a clearance mechanism. CV-2 has been implicated in endocytic clearance of chordin fragments. CV-2 induces chordin internalisation (Kelley et al., 2009), and binds chordin cleavage fragments with higher affinity than the full-length protein (Ambrosio et al., 2008). CV-2 interacts with all the individual chordin vWC domains and with Tsg (Ambrosio et al., 2008, Zhang et al., 2010, Lockhart-Cairns et al., 2018), and so Tsg may promote interactions between CV-2 and chordin vWC domains for clearance from the extracellular matrix.

153 6.2 The chordin/Tsg complex

In its pro-BMP role, Tsg acts independently of BMP binding. Tsg BMP-binding mutants are still able to ventralise Xenopus embryos, indicating they retain their pro-BMP capacity (Oelgeschlager et al., 2003b). Additionally, in the absence of BMPs, Tsg is able to increase the rate of tolloid cleavage of chordin, and causes tolloids to cleave murine chordin at a third site, in vitro (Scott et al., 2001). Tsg does not interact with tolloids, and so it is hypothesised that Tsg induces a conformational change in chordin that results in altered cleavage by tolloid proteinases. This does not require the chordin vWC1 domain, as an increased rate of tolloid cleavage in the presence of Tsg has also been observed for N-chordin in vitro in the absence of BMPs (Troilo et al., 2016). A crosslinked N- chordin/BMP/Tsg ternary complex has been previously identified (Larrain et al., 2001). Despite, observing a high affinity interaction between N-chordin and Tsg, following incubation of N-chordin and Tsg, the proteins predominantly eluted separately on gel filtration. Further stabilisation of the chordin/Tsg interaction may be required for isolation of a complex. In Drosophila, Tsg only binds the chordin homolog Sog in the presence of the BMP homolog Dpp (Ross et al., 2001). In vertebrates, BMPs directly interact with both Tsg and chordin (Oelgeschlager et al., 2000, Chang et al., 2001, Zhang et al., 2007), and within the ternary complex this may stabilise the Tsg/chordin interaction. This is supported by the failure to observe a crosslinked ternary complex with a Tsg BMP-binding mutant (Oelgeschlager et al., 2003b). The multiple interactions may increase the avidity of binding within the ternary complex. Additionally, the interaction of chordin with other factors may facilitate a conformation that more readily binds Tsg, as in the absence of BMPs, Tsg alters tolloid cleavage of chordin without directly interacting with tolloids (Scott et al., 2001, Troilo et al., 2016).

In this work, a 1:1 N-chordin:Tsg species was observed with crosslinking. The occlusion of the Tsg/vWC1 domain interaction by the 4CHRD region suggests this molar stoichiometry would hold for full-length chordin and Tsg. Crosslinking studies have also indicated a single chordin molecule interacts with the BMP dimers (Oelgeschlager et al., 2000). Taken together, these crosslinking studies may suggest a 1:1:1 molar stoichiometry for the Tsg:chordin:BMP dimer complex. However, chemical crosslinking has also indicated two Tsg molecules bind per BMP dimer (Oelgeschlager et al., 2000), most likely through their interaction with the two wrist regions of the BMP dimer (Zhang et al., 2007). A 2:1:1 Tsg:chordin:BMP dimer stoichiometry has previously been suggested on the basis of crosslinking, however, the broad band produced by this species on SDS-PAGE analysis makes such interpretation difficult (Oelgeschlager et al., 2000). It was suggested that Tsg may bind as a dimer, however, Tsg is a monomer in solution (Troilo et al., 2016). If a complex of 2:1:1 Tsg:chordin:BMP dimer stoichiometry

154 is formed, our interaction studies suggest two characteristics of this ternary complex. Firstly, only one of the Tsg molecules interacts with chordin, via the chordin vWC2-3 region. Secondly, the interaction of Tsg with the BMP wrist region in the other half of the BMP dimer is not affected by the interaction between the chordin vWC1 domain and BMP (Figure 6-2). A separate crosslinking study has shown no significant difference in the migration of the crosslinked N-chordin/BMP/Tsg and chordin/BMP/Tsg ternary complexes on SDS-PAGE analysis (Larrain et al., 2001). This is more consistent with the loss of a single vWC domain (~10 kDa) than the loss of a single vWC1 domain and a molecule of Tsg (~43 kDa), supporting the lack of interaction between Tsg and the chordin vWC1 domain in the ternary complex. Future structural characterisation would aid determination of the arrangement and stoichiometry of the ternary complex.

Figure 6-2 Schematic of the chordin/Tsg/BMP ternary complex. Within a 2:1:1 Tsg:chordin:BMP dimer ternary complex, one Tsg molecule would interact with the chordin vWC2-3 region and one of the BMP dimer wrist regions. The other Tsg molecule would interact with the other wrist region of the BMP dimer, but would not interact with chordin. The vWC domains of chordin are depicted in blue and the CHRD domains are depicted in purple. Tsg is depicted in green and the BMP dimer is red.

We were unable to isolate a pure sample of the crosslinked Tsg/N-chordin complex as we could not separate this from contaminating chordin species. After crosslinking, the sample contained large proportions of higher order chordin and chordin/Tsg species. This is not unexpected as self-association of N-chordin has previously been demonstrated, with a Kd of 3.3 M determined for this interaction (Troilo, 2014). This is unlikely to be relevant at physiological concentrations, however, would occur in crosslinking reactions in which proteins are incubated in this concentration range. Previous chordin/BMP/Tsg crosslinking studies have visualised species with BMP

155 antibodies, and so it is not possible to observe whether higher order chordin and chordin/Tsg species existed in these samples (Oelgeschlager et al., 2000, Larrain et al., 2001, Oelgeschlager et al., 2003b).

6.3 CHRDL2 characterisation

This study provides the first structural characterisation of CHRDL2. Furthermore, this is the first recombinant expression and purification of human CHRDL2 from a human cell line. CHRDL2 had a high -strand and turn content, consistent with it having multiple vWC domains, as is observed in the crystal structures of vWC domains from other proteins (Zhang et al., 2008, Xu et al., 2017). It was also shown to be glycosylated, as is observed with chordin and BMPER of the chordin family (Troilo et al., 2014, Lockhart- Cairns et al., 2018).

In mouse CHRDL2 both the vWC1 and vWC3 domains interact with BMPs (Zhang et al., 2007, Xu et al., 2017). These domains appear to interact with the BMP-2 dimer differently as in a BMP-2 mutant binding screen, mutations in the BMP-2 ‘knuckle’ only affected interaction with the vWC1 domain, and mutations in the BMP-2 ‘wrist’ only affected interaction with the vWC3 domain (Fujisawa et al., 2009). Therefore, two CHRDL2 molecules may interact with the BMP dimer, to mask its two ‘knuckle’ and two ‘wrist’ regions. Indeed, a 2:1 CHRDL2:BMP-2 dimer stoichiometry has been reported on the basis of gel filtration experiments (Zhang et al., 2007). The AUC and SEC-MALS analysis in this thesis shows CHRDL2 to be a monomer in solution, therefore if two CHRDL2 molecules bind a BMP dimer, CHRDL2 would not do so as a dimer. Two binding modes are possible within this 2:1 CHRDL2:BMP dimer complex. The vWC1 and vWC3 domains of each CHRDL2 molecule may span the two receptor binding sites at a single end of the BMP dimer (Figure 6-3A), as in noggin (Groppe et al., 2002); or CHRDL2 may bind across the convex side of each monomer with the vWC1 and vWC3 domains of each CHRDL2 molecule binding the receptor sites on a single face of the BMP dimer (Figure 6-3B), as in gremlin-2 (Cash et al., 2009). AUC and SAXS analysis indicated CHRDL2 has a slightly elongated structure, with SAXS calculating a maximum length of 128 Å. Without the knowledge of the relative positions of the vWC1 and vWC3 domains, this does not rule out either binding mode. Characterisation of a CHRDL2/BMP complex is required to elucidate the BMP binding strategy of CHRDL2.

156

Figure 6-3 Potential BMP-binding modes of CHRDL2. Schematic of potential binding modes in the CHRDL2/BMP complex, shown as an apical view. The BMP dimer is depicted in red and the CHRDL2 vWC domains are depicted in blue. (A) The vWC1 and vWC3 domains of each CHRDL2 molecule may span the two receptor binding sites at a single end of the BMP dimer. (B) The vWC1 and vWC3 domains of each CHRDL2 molecule may bind the receptor sites on a single face of the BMP dimer, with CHRDL2 binding across the convex side of each BMP monomer. Adapted from (Zhang et al., 2007).

The work in this thesis has been performed with the human CHRDL2 sequence encoding three vWC domains, but lacking exon 9b. This variant has been used in most of the previous functional studies (Nakayama et al., 2004, Zhang et al., 2007, Fujisawa et al., 2009). The other major variant has a different C-terminus due to inclusion of exon 9b, causing a frameshift in the mRNA 3' region (Oren et al., 2004). This alternative splicing affects the C-terminal region of unknown fold, but does not change the vWC domains. The vWC domains of mouse CHRDL2 are responsible for Tsg and BMP binding (Zhang et al., 2007, Fujisawa et al., 2009). No functional characterisation of the other major CHRDL2 variant has been performed, the functional implications of this alternative splicing are not known. Given that these variants are expressed in a number of the same tissues (Oren et al., 2004), investigation of the effect of Tsg on the other major variant of CHRDL2 may be of interest.

6.4 CHRDL2 regulation

Chordin inactivation requires tolloid cleavage (Piccolo et al., 1997, Xie and Fisher, 2005). Although additional mechanisms of inactivation may exist as chordin cleavage fragments retain some BMP antagonistic capacity (Larrain et al., 2000). The mechanism of inactivation of CHRDL2 is not known. Whereas the zebrafish homolog chordin-like and mouse CHRDL1 are cleaved by tolloids at a site between their vWC2 and vWC3 domains, mouse CHRDL2 is not cleaved by any of the mammalian tolloids (Branam et

157 al., 2010). We observed no cleavage of human CHRDL2 by BMP-1, the most efficient tolloid proteinase (Berry et al., 2009). Furthermore, this was not affected by addition of Tsg. Sequence analysis of tolloid substrates reveals that tolloid cleavage sites lack a consensus sequence, though an aspartate residue is highly conserved at the P1' position, and has so far been observed in this position for all tolloid substrates other than procollagen N-propeptides (Hopkins et al., 2007). Sequence comparison reveals CHRDL2 does not possess the conserved aspartate observed at the P1' position in chordin, CHRDL1 and zebrafish chordin-like. However, we cannot rule out that CHRDL2 may be cleaved by other proteases. Binding screens with BMP-2 point mutants indicated differences in the binding of chordin and CHRDL2 to BMP-2. Mutations in the BMP knuckle epitope reduced binding to the chordin vWC1 and vWC3 domains, and the CHRDL2 vWC1 domain, but did not affect binding of the CHRDL2 vWC3 domain. Moreover, mutations were identified in the BMP wrist epitope that only affected binding of the CHRDL2 vWC3 domain (Zhang et al., 2007). This difference in BMP binding may allow differential regulation of CHRDL2 by other extracellular matrix factors. Indeed, the Tsg interaction was affected by the same set of BMP-2 wrist mutations but not by the mutations of the BMP-2 knuckle (Zhang et al., 2007). This may result in different effects of Tsg binding in the CHRDL2/BMP/Tsg ternary complex to the chordin/BMP/Tsg ternary complex. The work in this thesis identified a novel interaction between CHRDL2 and the N- terminal region of fibrillin-1. Fibrillin-1 and fibrillin-2 are known regulators of BMP signalling. Fibrillin-1 and fibrillin-2 control the bioavailability of BMPs (Nistala et al., 2010), with the N-terminal regions of fibrillin-1 and fibrillin-2 binding directly to the prodomains of BMP-4, BMP-5, BMP-7, BMP-10, and GDF-5 with high affinity (Sengle et al., 2008b, Sengle et al., 2011). This may serve to concentrate BMPs at the cell surface, as has been suggested for the interaction of BMPs with perlecan (DeCarlo et al., 2012), heparan sulphate (Kuo et al., 2010), and fibronectin (Martino and Hubbell, 2010). Fibrillin-2 null mice have increased BMP signalling, and this is associated with phenotypes that resemble the skeletal phenotypes of patients with Marfan syndrome, caused by mutations in the fibrillin-1 gene (Sengle et al., 2015). The BMP antagonist Gremlin has previously been shown to bind the N-terminus of fibrillin-1 (Tamminen et al., 2013). By binding BMP ligands and antagonists, fibrillin-1 may be acting as a platform in the assembly of BMP-antagonist complexes. CHRDL2 may be regulated by its removal from the extracellular matrix, as has been proposed for chordin. In addition to CV-2 induced internalisation of chordin (Kelley et al., 2009), endocytosis of full-length chordin after integrin-3 binding has also been reported (Larrain et al., 2003). In the investigation of a possible role for endocytosis in the regulation of CHRDL2, the interaction of CHRDL2 with CV-2 and integrins, would be of

158 interest. Heparan sulphate binding has been demonstrated for the BMP antagonists follistatin, noggin and gremlin (Hashimoto et al., 1997, Paine-Saunders et al., 2002, Chiodelli et al., 2011). This interaction is important for the uptake and degradation of follistatin and noggin, and a similar interaction for CHRDL2 may enable its internalisation.

6.5 The CHRDL2/Tsg complex

This thesis confirms the in vitro interaction of human CHRDL2 and Tsg, as has previously been demonstrated for mouse CHRDL2 and Tsg (Zhang et al., 2007, Fujisawa et al., 2009). This work also provides evidence for the formation of a 1:1 complex between human CHRDL2 and Tsg. The binding of CHRDL2 to BMPs is different to that of chordin, as two CHRDL2 monomers are predicted to bind the BMP dimer (Zhang et al., 2007). Crosslinking suggests two Tsg molecules interact with BMP dimer (Oelgeschlager et al., 2000). Together, these observations support two CHRDL2 molecules and two Tsg molecules interacting with the BMP dimer in a ternary complex. This work provides the first investigations into the structure of CHRDL2 in a complex. The only previous structural analysis of a chordin family member in a complex is that of the zebrafish CV-2 vWC1 domain bound to BMP-2 (Zhang et al., 2008). Furthermore, no structural analyses have been performed on a complex containing Tsg. A structure of a chordin family member in complex with Tsg could provide valuable insights into the mechanism of action of Tsg. Here, SAXS analysis produced a low-resolution model of the CHRDL2/Tsg complex, with cryo-TEM being used in effort to obtain a higher resolution structure. The SAXS model predicts Tsg binds towards the end of elongated CHRDL2. Low affinity interactions between Tsg and both the vWC1 and vWC3 domains has been observed (Zhang et al., 2007). As Tsg appears to bind towards the end of CHRDL2, if vWC1 and vWC3 of the same CHRDL2 monomer interact with Tsg simultaneously (Figure 6-4A), this would suggest CHRDL2 vWC1 and vWC3 are in close proximity, towards the end of the CHRDL2 structure. Alternatively, Tsg may interact with the vWC1 and vWC3 domains of different CHRDL2 monomers bound to the BMP dimer (Figure 6-4B).

159

Figure 6-4 Potential binding modes of the CHRDL2/BMP/Tsg complex. Schematic of potential binding modes in the CHRDL2/BMP/Tsg complex, shown as an apical view. The BMP dimer is depicted in red, Tsg is depicted in green and the CHRDL2 vWC domains are depicted in blue. (A) Tsg bound to the wrist region of the BMP dimer may bind the vWC1 and vWC3 domains of a single CHRDL2 molecule that are interacting with the receptor binding sites at a single end of the BMP dimer. (B) Tsg bound to the wrist region of the BMP dimer may interact with the vWC1 and vWC3 domains different CHRDL2 molecules, if CHRDL2 binds across the convex side of each BMP monomer. Adapted from (Zhang et al., 2007).

6.6 Future directions

Many questions remain in the antagonism of BMP signalling by members of the chordin family, and their modulation by Tsg. Building on the work in this thesis, different strategies could be pursued to obtain high resolution structures of complexes, and the work could be expanded to include CHRDL1 to further reveal commonalities and differences in the regulation of BMP signalling by the chordin family and the role of Tsg.

6.6.1 The chordin/Tsg complex

Chordin and Tsg predominantly eluted as separate species in gel filtration. Though a small shoulder on the SEC trace was likely a chordin/Tsg complex, this was not present in sufficient amounts for study with cryo-TEM or SAXS. The interaction between chordin and Tsg may require further stabilisation by another factor for isolation of a complex. The addition of BMP may stabilise the complex due to its interactions with both chordin and Tsg. Furthermore, a chordin/Tsg/BMP complex would reveal interactions between BMP and Tsg (Oelgeschlager et al., 2003b). BMP could be added in the incubation of proteins during in vitro reconstitution of the complex, and a homogenous sample isolated with SEC.

160 Crosslinking was used in an attempt to increase the relative proportions of the chordin/Tsg complex to the monomeric species, however, this resulted in the formation of a crosslinked chordin dimer that could not be separated from the crosslinked chordin/Tsg complex. Chordin from a different species could be used that has a lower propensity for self-association. Human chordin and the Drosophila homolog Sog have 22% sequence identity (Peluso et al., 2011), and human BMP-4 is able to confer normal dorsoventral patterning in dpp null Drosophila embryos (Padgett et al., 1993), indicating that Sog is able to act on human BMP-4. Sog appears to have a lower propensity for dimerisation (Winstanley, 2014), and so could be used at higher concentrations and in crosslinking reactions without the contribution of dimers seen with human chordin. Furthermore, a co-expression strategy could be used, in the case that complex formation is facilitated by intracellular factors. Relative amounts of chordin and Tsg could be controlled by having the gene sequences in the same vector, under the control of the same promoter. Alternatively, cells could be transfected with multiple pCDH vectors, each containing a gene of interest with a different fluorescent protein for the selection of cells successfully transfected with both vectors.

6.6.2 The CHRDL2/Tsg complex The CHRDL2/Tsg complex was successfully formed and analysed with SAXS and cryo- TEM. However, the resolution of cryo-TEM was limited due to the low contrast of the small CHRDL2/Tsg complex (~90 kDa). Low doses are required to reduce sample radiation damage; however, this results in poor contrast images with samples of small size. Increased contrast is required to observe small particles with cryo-TEM, and conventionally has been achieved through image defocus. Recording images at larger defocus values increases the image contribution of waves scattered from scattering centres at lower spatial frequencies, which sample larger features such as the broad particle shape, required for particle observation. However, the image contribution at larger spatial frequencies is reduced at increased defocus, and so higher resolution details are lost (Orlova and Saibil, 2011). In the cryo-TEM images in this study particles could be identified and sorted into two-dimensional classes, however, classes appeared to have little detail. The use of cryo-TEM to solve structures to high resolution is still biased towards large symmetric proteins and complexes. The size and resolution limit of cryo-TEM has been improved in recent years by the use of phase plates. Phase plates increase the phase contrast of images without the need for defocus. This improves the phase contrast and reduces the loss of information at high spatial frequencies, required for the reconstruction of smaller features (Danev and Nagayama, 2001, Danev and Baumeister, 2016). The use of phase plates has enabled

161 the structure of haemoglobin (64 kDa) to be solved at 3.2 Å resolution (Khoshouei et al., 2017). Therefore, a phase plate could be used during data collection to achieve higher- resolution cryo-TEM structures of the CHRDL2/Tsg complex.

Imaging small proteins at high resolutions with cryo-TEM also requires good sample quality and good ice quality. In this study, the CHRDL2/Tsg complex was SEC purified, however, the complex peak was not completely resolved from the monomeric proteins, and so the sample would have some compositional heterogeneity. The flexibility of CHRDL2 may also cause conformational heterogeneity. This could be improved by crosslinking, such as the GraFix method which has been suggested to reduce heterogeneity (Passmore and Russo, 2016). GraFix crosslinking has been used to stabilise complexes and reduce their conformational heterogeneity for cryo-TEM. In the GraFix method, the sample is chemically crosslinked during density centrifugation in a glycerol gradient, for separation of different species (Kastner et al., 2008). Furthermore, nanobodies are increasingly being used to stabilise complexes for structural analyses, reducing both compositional and conformational heterogeneity (Rasmussen et al., 2011). Nanobodies are the recombinant variable domains of camelid antibodies, that consist only of heavy chains. Nanobodies are smaller than IgG antigen-binding fragments, they are able to bind epitopes inaccessible to conventional antibodies and can be rapidly screened for antigen binding (Manglik et al., 2017). Affimers have been developed to function in a similar capacity. Affimers are small non-antibody peptides that can be manipulated to bind specific epitopes with high affinity, and could similarly be used to stabilise a complex (Tiede et al., 2014). These small proteins (~12 kDa) are generated in Escherichia coli and can be fused to other proteins to add functionality to the affimer. For cryo-TEM, affimers could be fused to a larger well characterised protein, such as alkaline phosphatase, this would increase the mass of the sample, increasing the signal contrast, and would aid particle alignment during processing. Following optimisation of cryo-TEM with the CHRDL2/Tsg complex, a high-resolution complex of the CHRDL2/BMP/Tsg ternary complex could then be pursued. Different BMP binding mechanisms have been suggested for the individual vWC1 and vWC3 domains of CHRDL2 (Zhang et al., 2007). A ternary structure would reveal the interactions of these domains with BMPs in the full-length CHRDL2 structure. Furthermore, this would allow a direct comparison to the structure of the chordin/Tsg/BMP ternary complex, for insight into whether Tsg affects the BMP binding of CHRDL2 and chordin vWC domains differently in the full-length proteins.

162 6.6.3 CHRDL1 characterisation

CHRDL1 shares high homology with CHRDL2, and the same predicted domain structure (Nakayama et al., 2001, Nakayama et al., 2004). Tsg enhances BMP antagonism by CHRDL1 in cell reporter assays, and CHRDL1 co-precipitates with BMP- 7 and Tsg in vitro (Larman et al., 2009). As such, CHRDL1 provides another opportunity to investigate the modulation of the chordin family by Tsg. The interactions of full-length CHRDL1 with Tsg and BMPs have previously only been explored with co- immunoprecipitation experiments (Nakayama et al., 2001, Branam et al., 2010), and the vWC domains responsible for BMP and Tsg binding are not known. Therefore, it is not known if multiple vWC domains interact with these binding partners, and whether vWC domains show different BMP-binding characteristics, as is seen for CHRDL2 (Zhang et al., 2007). A CHRDL1/Tsg/BMP ternary complex would provide this insight, and would also allow further investigation into whether Tsg acts differently on the chordin family members. Murine CHRDL1 has previously been recombinantly expressed in human cell lines, and partially purified (Nakayama et al., 2001, Branam et al., 2010), indicating the recombinant expression of CHRDL1 is viable.

6.6.4 Interactions of Tsg, chordin and chordin-like proteins with other matrix components

Chordin appears to interact with syndecan-1 and syndecan-4 in cell culture (Jasuja et al., 2004), and this thesis identified an interaction between CHRDL2 and fibrillin-1 in vitro. The interaction of Sog with collagen IV in Drosophila is important in the formation of the embryonic dorsoventral BMP signalling gradient (Wang et al., 2008), and in vertebrates, the interaction of other extracellular BMP antagonists with heparan sulphate is important for their internalisation (Hashimoto et al., 1997). It is evident that BMP antagonists interact with many components of the extracellular matrix, and these interactions play a role in their function. Therefore, the interaction of Tsg, chordin and chordin-like proteins with other proteins of the extracellular matrix, and the potential interaction network, formed would be of interest. This could be explored with the use of cross-linking mass spectrometry, wherein biotin-tagged chemical cross-linkers could be used to covalently link the recombinant protein of interest to binding partners. Crosslinked complexes are then isolated with a two-step purification protocol against the tagged protein of interest and biotin for analysis with mass spectrometry (Tang and Bruce, 2010, Petrochenko et al., 2011). This may also identify an interaction between chordin-like proteins and CV-2, which may be important for their localisation and potential internalisation.

163 6.7 Summary

This study aimed to contribute to the understanding of the chordin family of BMP antagonists and their modulation by Tsg. The vWC2-3 region of chordin was identified as the specific Tsg-binding region, and this may allow interactions with both chordin and BMP in the chordin/BMP/Tsg ternary complex. A chordin/Tsg complex could not be formed via in vitro reconstitution, and may require further stabilisation for isolation. This work provided the first structural characterisation of CHRDL2, and a CHRDL2/Tsg complex was successfully formed. CHRDL2 and Tsg formed a 1:1 complex, with Tsg binding towards the end of the elongated CHRDL2 molecule. Further work is required to obtain high-resolution structures of the CHRDL2/Tsg complex, and this could be extended to characterising the CHRDL2/Tsg/BMP complex.

164 7 References

ALLENDORPH, G. P., ISAACS, M. J., KAWAKAMI, Y., IZPISUA BELMONTE, J. C. & CHOE, S. 2007. BMP-3 and BMP-6 structures illuminate the nature of binding specificity with receptors. Biochemistry, 46, 12238-47.

ALLENDORPH, G. P., VALE, W. W. & CHOE, S. 2006. Structure of the ternary signaling complex of a TGF-beta superfamily member. Proc Natl Acad Sci U S A, 103, 7643-8.

AMBROSIO, A. L., TAELMAN, V. F., LEE, H. X., METZINGER, C. A., COFFINIER, C. & DE ROBERTIS, E. M. 2008. Crossveinless-2 Is a BMP feedback inhibitor that binds Chordin/BMP to regulate Xenopus embryonic patterning. Dev Cell, 15, 248-60.

ANDERSON, R. M., LAWRENCE, A. R., STOTTMANN, R. W., BACHILLER, D. & KLINGENSMITH, J. 2002. Chordin and noggin promote organizing centers of forebrain development in the mouse. Development, 129, 4975-87.

ASHE, H. L., MANNERVIK, M. & LEVINE, M. 2000. Dpp signaling thresholds in the dorsal ectoderm of the Drosophila embryo. Development, 127, 3305-12.

BACHILLER, D., KLINGENSMITH, J., KEMP, C., BELO, J. A., ANDERSON, R. M., MAY, S. R., MCMAHON, J. A., MCMAHON, A. P., HARLAND, R. M., ROSSANT, J. & DE ROBERTIS, E. M. 2000. The organizer factors Chordin and Noggin are required for mouse forebrain development. Nature, 403, 658-61.

BANDYOPADHYAY, A., TSUJI, K., COX, K., HARFE, B. D., ROSEN, V. & TABIN, C. J. 2006. Genetic analysis of the roles of BMP2, BMP4, and BMP7 in limb patterning and skeletogenesis. PLoS Genet, 2, e216.

BAYLEY, C. P., RUIZ NIVIA, H. D., DAJANI, R., JOWITT, T. A., COLLINS, R. F., RADA, H., BIRD, L. E. & BALDOCK, C. 2016. Diversity between mammalian tolloid proteinases: Oligomerisation and non-catalytic domains influence activity and specificity. Sci Rep, 6, 21456.

BELL, J. M., CHEN, M., BALDWIN, P. R. & LUDTKE, S. J. 2016. High resolution single particle refinement in EMAN2.1. Methods, 100, 25-34.

BEN-ZVI, D., SHILO, B. Z., FAINSOD, A. & BARKAI, N. 2008. Scaling of the BMP activation gradient in Xenopus embryos. Nature, 453, 1205-11.

BERRY, R., JOWITT, T. A., FERRAND, J., ROESSLE, M., GROSSMANN, J. G., CANTY-LAIRD, E. G., KAMMERER, R. A., KADLER, K. E. & BALDOCK, C. 2009. Role of dimerization and substrate exclusion in the regulation of bone morphogenetic protein-1 and mammalian tolloid. Proc Natl Acad Sci U S A, 106, 8561-6.

BERRY, R., JOWITT, T. A., GARRIGUE-ANTAR, L., KADLER, K. E. & BALDOCK, C. 2010. Structural and functional evidence for a substrate exclusion mechanism in mammalian tolloid like-1 (TLL-1) proteinase. FEBS Lett, 584, 657-61.

BIEHS, B., FRANCOIS, V. & BIER, E. 1996. The Drosophila short gastrulation gene prevents Dpp from autoactivating and supressing neurogenesis in the neuroectoderm. Genes & Development, 10, 2922-2934.

165 BILLINGTON, C. J., JR., FIEBIG, J. E., FORSMAN, C. L., PHAM, L., BURBACH, N., SUN, M., JASKOLL, T., MANSKY, K., GOPALAKRISHNAN, R., O'CONNOR, M. B., MUELLER, T. D. & PETRYK, A. 2011. Glycosylation of Twisted Gastrulation is Required for BMP Binding and Activity during Craniofacial Development. Front Physiol, 2, 59.

BLITZ, I. L., CHO, K. W. & CHANG, C. 2003. Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis. Development, 130, 4975-88.

BOND, A. M., BHALALA, O. G. & KESSLER, J. A. 2012. The dynamic role of bone morphogenetic proteins in neural stem cell fate and maturation. Dev Neurobiol, 72, 1068- 84.

BRANAM, A. M., HOFFMAN, G. G., PELEGRI, F. & GREENSPAN, D. S. 2010. Zebrafish chordin-like and chordin are functionally redundant in regulating patterning of the dorsoventral axis. Dev Biol, 341, 444-58.

BROWN, M. A., ZHAO, Q., BAKER, K. A., NAIK, C., CHEN, C., PUKAC, L., SINGH, M., TSAREVA, T., PARICE, Y., MAHONEY, A., ROSCHKE, V., SANYAL, I. & CHOE, S. 2005. Crystal structure of BMP-9 and functional interactions with pro-region and receptors. J Biol Chem, 280, 25111-8.

BRUNET, L. J., MCMAHON, J. A., MCMAHON, A. P. & HARLAND, R. 1998. Noggin, Cartilage Morphogenesis, and Joint Formation in the Mammalian Skeleton. Science, 280, 1455- 1457.

CAI, J., PARDALI, E., SANCHEZ-DUFFHUES, G. & TEN DIJKE, P. 2012. BMP signaling in vascular diseases. FEBS Lett, 586, 1993-2002.

CAIN, S. A., BALDOCK, C., GALLAGHER, J., MORGAN, A., BAX, D. V., WEISS, A. S., SHUTTLEWORTH, C. A. & KIELTY, C. M. 2005. Fibrillin-1 Interactions with Heparin. Journal of Biological Chemistry, 280, 30526-30537.

CARREIRA, A. C., ALVES, G. G., ZAMBUZZI, W. F., SOGAYAR, M. C. & GRANJEIRO, J. M. 2014. Bone Morphogenetic Proteins: structure, biological function and therapeutic applications. Arch Biochem Biophys, 561, 64-73.

CASH, J. N., REJON, C. A., MCPHERRON A. C., B., D. J. & THOMPSON, T. B. 2009. The structure of myostatin:follistatin 288: insights into receptor utilization and heparin binding. The EMBO Journal, 28, 2662-2676.

CHANG, C., HOLTZMAN, D. A., CHAU, S., CHICKERING, T., WOOLF, E. A., HOLMGREN, L. M., BODOROVA, J., GEARING, D. P., HOLMES, W. E. & BRIVANLOU, A. H. 2001. Twisted gastrulation can function as a BMP antagonist. Nature, 410, 483-7.

CHENG, A., CAIN, S. A., TIAN, P., BALDWIN, A. K., UPPANAN, P., KIELTY, C. M. & KIMBER, S. J. 2018. Recombinant Extracellular Matrix Protein Fragments Support Human Embryonic Stem Cell Chondrogenesis. Tissue Eng Part A, 24, 968-978.

CHENG, H., JIANG, W., PHILLIPS, F. M., HAYDON, R. C., PENG, Y., ZHOU, L., LUU, H. H., AN, N., BREYER, B., VANICHAKARN, P., SZATKOWSKI, J. P., PARK, J. Y. & HE, C. 2003. Osteogenic activity of the fourteen types of human Bone Morphogenetic Proteins (BMPs). The Journal of Bone and Joint Surgery, 85, 1544-1552.

166 CHIODELLI, P., MITOLA, S., RAVELLI, C., ORESTE, P., RUSNATI, M. & PRESTA, M. 2011. Heparan sulfate proteoglycans mediate the angiogenic activity of the vascular endothelial growth factor receptor-2 agonist gremlin. Arterioscler Thromb Vasc Biol, 31, e116-27.

CHOI, M. & KLINGENSMITH, J. 2009. Chordin is a modifier of tbx1 for the craniofacial malformations of 22q11 deletion syndrome phenotypes in mouse. PLoS Genet, 5, e1000395.

CHOU, C. H., LEE, M. T., SONG, I. W., LU, L. S., SHEN, H. C., LEE, C. H., WU, J. Y., CHEN, Y. T., KRAUS, V. B. & WU, C. C. 2015. Insights into osteoarthritis progression revealed by analyses of both knee tibiofemoral compartments. Osteoarthritis Cartilage, 23, 571-80.

COFFINIER, C., KETPURA, N. I., TRAN, U., GEISSERT, D. & DE ROBERTIS, E. M. 2002. Mouse Crossveinless-2 is the vertebrate homolog of a Drosophila extracellular regulator of BMP signaling. Mechanisms of Development, 119, 179-184.

COFFINIER, C., TRAN, U., LARRAIN, J. & DE ROBERTIS, E. M. 2001. Neuralin-1 is a novel Chordin-related molecule expressed in the mouse neural plate. Mechanisms of Development, 100, 119-122.

CONLEY, C. A., SILBURN, R., SINGER, M. A., RALSTON, A., ROHWER-NUTTER, D., OLSON, D. J., GELBART, W. & BLAIR, S. S. 2000. Crossveinless 2 contains cysteine-rich domains and is required for high levels of BMP-like activity during the formation of the cross veins in Drosophila. Development, 127, 3947-3959.

CYR-DEPAUW, C., NORTHEY, J. J., TABARIES, S., ANNIS, M. G., DONG, Z., CORY, S., HALLETT, M., RENNHACK, J. P., ANDRECHEK, E. R. & SIEGEL, P. M. 2016. Chordin- Like 1 Suppresses Bone Morphogenetic Protein 4-Induced Breast Cancer Cell Migration and Invasion. Mol Cell Biol, 36, 1509-25.

DALE, L., EVANS, W. & GOODMAN, S. A. 2002. Xolloid-related: a novel BMP1/Tolloid-related metalloprotease is expressed during early Xenopus development. Mech Dev, 119, 177- 90.

DANEV, R. & BAUMEISTER, W. 2016. Cryo-EM single particle analysis with the Volta phase plate. Elife, 5.

DANEV, R. & NAGAYAMA, K. 2001. Transmission electron micrscopy with Zernike phase plate. Ultramicroscopy, 88, 243-252.

DECARLO, A. A., BELOUSOVA, M., ELLIS, A. L., PETERSEN, D., GRENETT, H., HARDIGAN, P., O’-GRADY, R., LORD, M. & WHITELOCK, J. M. 2012. Perlecan domain 1 recombinant protoglycan augments BMP-2 activity and osteogenesis. BMC Biotechnology, 12.

DERNYK, R. & ZHANG, Y. E. 2003. Smad-dependent and Smad-independent pathways in TGF- beta family signalling. Nature, 425, 577-584.

DOSCH, R., GAWANTKA, V., DELIUS, H., BLUMENSTOCK, C. & NIEHRS, C. 1997. Bmp-4 acts as a morphogen in dorsoventral mesoderm patterning in Xenopus. Development, 124, 2325-2334.

167 FAINSOD, A., DEISSLER, K., YELIN, R., MAROM, K., EPSTEIN, M., PILLEMER, G., STEINBEISSER, H. & BLUM, M. 1997. The dorsalizing and neural inducing gene follistatin is an antagonist of BMP-4. Mech Dev, 63, 39-50.

FAINSOD, A., STEINBEISSER, H. & DE ROBERTIS, E. M. 1994. On the function of BMP-4 in patterning the marginal zone of the Xenopus embryo. Embo j, 13, 5015-25.

FERGUSON, E. L. & ANDERSON, K. V. 1992. Decapentaplegic acts as a morphogen to organize dorsal-ventral pattern in the Drosophila embryo. Cell, 71, 451-61.

FRANCOIS, P., VONICA, A., BRIVANLOU, A. H. & SIGGIA, E. D. 2009. Scaling of BMP gradients in Xenopus embryos. Nature, 461.

FRANCOIS, V., SOLLOWAY, M., O'NEILL, J. W., EMERY, J. & BIER, E. 1994. Dorsal-ventral patterning of the Drosophila embryo depends on a putative negative growth factor encoded by the short gastrulation gene. Genes Dev, 8, 2602-16.

FRANKE, D., PETOUKHOV, M. V., KONAREV, P. V., PANJKOVICH, A., TUUKKANEN, A., MERTENS, H. D. T., KIKHNEY, A. G., HAJIZADEH, N. R., FRANKLIN, J. M., JEFFRIES, C. M. & SVERGUN, D. I. 2017. ATSAS 2.8: a comprehensive data analysis suite for small-angle scattering from macromolecular solutions. J Appl Crystallogr, 50, 1212-1225.

FUJISAWA, T., HUANG, Y., SEBALD, W. & ZHANG, J. L. 2009. The binding of von Willebrand factor type C domains of Chordin family proteins to BMP-2 and Tsg is mediated by their SD1 subdomain. Biochem Biophys Res Commun, 385, 215-9.

GARCIA ABREU, J., COFFINIER, C., LARRAIN, J., OELGESCHLAGER, M. & DE ROBERTIS, E. M. 2002. Chordin-like CR domains and the regulation of evolutionarily conserved extracellular signaling systems. Gene, 287, 39-47.

GHOSH-CHOUDHURY, N., ABBOUD, S. L., NISHIMURA, R., CELESTE, A., MAHIMAINATHAN, L. & CHOUDHURY, G. G. 2002. Requirement of BMP-2-induced phosphatidylinositol 3-kinase and Akt serine/threonine kinase in osteoblast differentiation and Smad-dependent BMP-2 gene transcription. J Biol Chem, 277, 33361-8.

GRAF, D., NETHISINGHE, S., PALMER, D. B., FISHER, A. G. & MERKENSCHLAGER, M. 2002. The developmentally regulated expression of Twisted gastrulation reveals a role for bone morphogenetic proteins in the control of T cell development. J Exp Med, 196, 163-71.

GRAF, D., TIMMONS, P. M., HITCHINS, M., EPISKOPOU, V., MOORE, G., ITO, T., FUJIYAMA, A., FISHER, A. G. & MERKENSCHLAGER, M. 2001. Evolutionary conservation, developmental expression, and genomic mapping of mammalian Twisted gastrulation. Mamm Genome, 12, 554-60.

GREENFIELD, N. J. 2006. Using circular dichroism spectra to estimate protein secondary structure. Nat Protoc, 1, 2876-90.

GROPPE, J., GREENWALD, J., WIATER, E., RODRIGUEZ-LEON, J., ECONOMIDES, A. N., KWIATKOWSKI, W., AFFOLTER, M., VALE, W. W., IZPISUA BELMONTE, J. C. & CHOE, S. 2002. Structural basis of BMP signalling inhibition by the cystine knot protein Noggin. Nature, 420, 636-42.

168 GUICHEUX, J., LEMONNIER, J., GHAYOR, C., SUZUKI, A., G., P. & CAVERZASIO, J. 2003. Activation of p38 Mitogen-Actvated Protein Kinase and c-Jun-NH2-Terminal Kinase by BMP-2 and Their Implication in the Stimulation of Osteoblastic Cell Differentiation. Journal of Bone and Mineral Research 18 2060-2068.

HAMMERSCHMIDT, M., PELEGRI, F., MULLINS, M. C., KANE, D. A., VAN EEDEN, F. J., GRANATO, M., BRAND, M., FURUTANI-SEIKI, M., HAFFTER, P., HEISENBERG, C. P., JIANG, Y. J., KELSH, R. N., ODENTHAL, J., WARGA, R. M. & NUSSLEIN-VOLHARD, C. 1996. dino and mercedes, two genes regulating dorsal development in the zebrafish embryo. Development, 123, 95-102.

HASHIMOTO, O., NAKAMURA, T., SHOJI, H., SHIMASAKI, S., HAYASHI, Y. & SUGINO, H. 1997. A Novel Role of Follistatin, an Activin-binding Protein, in the Inhibition of Activin Action in Rat Pituitary Cells. The Journal of Biochemistry and Molecular Biology, 272, 13835-13842.

HE, X. C., ZHANG, J., TONG, W. G., TAWFIK, O., ROSS, J., SCOVILLE, D. H., TIAN, Q., ZENG, X., HE, X., WIEDEMANN, L. M., MISHINA, Y. & LI, L. 2004. BMP signaling inhibits intestinal stem cell self-renewal through suppression of Wnt-beta-catenin signaling. Nat Genet, 36, 1117-21.

HINCK, A. P., MUELLER, T. D. & SPRINGER, T. A. 2016. Structural Biology and Evolution of the TGF-beta Family. Cold Spring Harb Perspect Biol, 8.

HOLLEY, S. A., JACKSON, P. D., SASAI, Y., LU, B., DE ROBERTIS, E. M., HOFFMANN, F. M. & FERGUSON, E. L. 1995. A conserved system for dorsal-ventral patterning in insects and vertebrates involving sog and chordin. Nature, 376, 249-53.

HOPKINS, D. R., KELES, S. & GREENSPAN, D. S. 2007. The bone morphogenetic protein 1/Tolloid-like metalloproteinases. Matrix Biol, 26, 508-23.

HUANG, G., ZHANG, Y., KIM, B., GE, G., ANNIS, D. S., MOSHER, D. F. & GREENSPAN, D. S. 2009. Fibronectin binds and enhances the activity of bone morphogenetic protein 1. J Biol Chem, 284, 25879-88.

HUNTLEY, R., DAVYDOVA, J., PETRYK, A., BILLINGTON, C. J., JR., JENSEN, E. D., MANSKY, K. C. & GOPALAKRISHNAN, R. 2015. The Function of Twisted Gastrulation in Regulating Osteoclast Differentiation is Dependent on BMP Binding. J Cell Biochem, 116, 2239-46.

HYVONEN, M. 2003. CHRD, a novel domain in the BMP inhibitor chordin, is also found in microbial proteins. Trends in Biochemical Sciences, 28, 470-473.

IKEYA, M., NOSAKA, T., FUKUSHIMA, K., KAWADA, M., FURUTA, Y., KITAMURA, T. & SASAI, Y. 2008. Twisted gastrulation mutation suppresses skeletal defect phenotypes in Crossveinless 2 mutant mice. Mech Dev, 125, 832-42.

INOMATA, H., HARAGUCHI, T. & SASAI, Y. 2008. Robust stability of the embryonic axial pattern requires a secreted scaffold for chordin degradation. Cell, 134, 854-65.

JASUJA, R., ALLEN, B. L., PAPPANO, W. N., RAPRAEGER, A. C. & GREENSPAN, D. S. 2004. Cell-surface heparan sulfate proteoglycans potentiate chordin antagonism of bone morphogenetic protein signaling and are necessary for cellular uptake of chordin. J Biol Chem, 279, 51289-97.

169 JENA, N., MARTIN-SEISDEDOS, C., MCCUE, P. & CROCE, C. M. 1997. BMP7 null mutation in mice: developmental defects in skeleton, kidney, and eye. Exp Cell Res, 230, 28-37.

JERABEK-WILLEMSEN, M., ANDRÉ, T., WANNER, R., ROTH, H. M., DUHR, S., BAASKE, P. & BREITSPRECHER, D. 2014. MicroScale Thermophoresis: Interaction analysis and beyond. Journal of Molecular Structure, 1077, 101-113.

JI, Q., ZHENG, Y., ZHANG, G., HU, Y., FAN, X., HOU, Y., WEN, L., LI, L., XU, Y., WANG, Y. & TANG, F. 2018. Single-cell RNA-seq analysis reveals the progression of human osteoarthritis. Ann Rheum Dis.

KARAULANOV, E., KNOCHEL, W. & NIEHRS, C. 2004. Transcriptional regulation of BMP4 synexpress Xenopus. The EMBO Journal, 23, 844-856.

KASTNER, B., FISCHER, N., GOLAS, M. M., SANDER, B., DUBE, P., BOEHRINGER, D., HARTMUTH, K., DECKERT, J., HAUER, F., WOLF, E., UCHTENHAGEN, H., URLAUB, H., HERZOG, F., PETERS, J. M., POERSCHKE, D., LUHRMANN, R. & STARK, H. 2008. GraFix: sample preparation for single-particle electron cryomicroscopy. Nat Methods, 5, 53-5.

KELLEY, R., REN, R., PI, X., WU, Y., MORENO, I., WILLIS, M., MOSER, M., ROSS, M., PODKOWA, M., ATTISANO, L. & PATTERSON, C. 2009. A concentration-dependent endocytic trap and sink mechanism converts Bmper from an activator to an inhibitor of Bmp signaling. J Cell Biol, 184, 597-609.

KELLY, C., CHIN, A. J., LEATHERMAN, J. L., KOZLOWSKI, D. J. & WEINBERG, E. S. 2000. Maternally controlled (beta)-catenin-mediated signaling is required for organizer formation in the zebrafish. Development, 127, 3899-911.

KHOKHA, M. K., YEH, J., GRAMMER, T. C. & HARLAND, R. M. 2005. Depletion of three BMP antagonists from Spemann's organizer leads to a catastrophic loss of dorsal structures. Dev Cell, 8, 401-11.

KHOSHOUEI, M., RADJAINIA, M., BAUMEISTER, W. & DANEV, R. 2017. Cryo-EM structure of haemoglobin at 3.2 A determined with the Volta phase plate. Nat Commun, 8, 16099.

KIM, R. Y., ROBERTSON, E. J. & SOLLOWAY, M. J. 2001. Bmp6 and Bmp7 are required for cushion formation and septation in the developing mouse heart. Dev Biol, 235, 449-66.

KIMANIUS, D., FORSBERG, B. O., SCHERES, S. H. & LINDAHL, E. 2016. Accelerated cryo-EM structure determination with parallelisation using GPUs in RELION-2. Elife, 5.

KIRSCH, T., SEBALD, W. & DREYER, M. K. 2000. Crystal structure of the BMP-2-BRIA ectodomain complex. Nat Struct Biol, 7, 492-6.

KUO, W., DIGMAN, M. A. & LANDER, A. D. 2010. Heparan Sulfate Acts as a Bone Morphogenetic Protein Coreceptor by Facilitating Ligand-induced Hetero- oligomerization. Molecular Biology of the Cell, 21, 4028-4041.

LAM, S. K. & NG, T. B. 2011. Lectins: production and practical applications. Appl Microbiol Biotechnol, 89, 45-55.

LARMAN, B. W., KAROLAK, M. J., ADAMS, D. C. & OXBURGH, L. 2009. Chordin-like 1 and twisted gastrulation 1 regulate BMP signaling following kidney injury. J Am Soc Nephrol, 20, 1020-31.

170 LARRAIN, J., BACHILLER, D., LU, B., AGIUS, E., PICCOLO, S. & DE ROBERTIS, E. M. 2000. BMP-binding modules in chordin: a model for signalling regulation in the extracellular space. Development, 127, 821-30.

LARRAIN, J., BROWN, C. & DE ROBERTIS, E. M. 2003. Integrin-alpha3 mediates binding of Chordin to the cell surface and promotes its endocytosis. EMBO Rep, 4, 813-8.

LARRAIN, J., OELGESCHLAGER, M., KETPURA, N. I., REVERSADE, B., ZAKIN, L. & DE ROBERTIS, E. M. 2001. Proteolytic cleavage of Chordin as a switch for the dual activities of Twisted gastrulation in BMP signaling. Development, 128, 4439-47.

LITTLE, S. C. & MULLINS, M. C. 2004. Twisted gastrulation promotes BMP signaling in zebrafish dorsal-ventral axial patterning. Development, 131, 5825-35.

LOCKHART-CAIRNS, M. P., LIM, K. T. W., ZUK, A., GODWIN, A. R. F., CAIN, S. A., SENGLE, G. & BALDOCK, C. 2018. Internal cleavage and synergy with twisted gastrulation enhance BMP inhibition by BMPER. Matrix Biol.

LUO, G., HOFMANN, C., BRONCKERS, A. L., SOHOCKI, M., BRADLEY, A. & KARSENTY, G. 1995. BMP-7 is an inducer of nephrogenesis, and is also required for eye development and skeletal patterning. Genes Dev, 9, 2808-20.

MANGLIK, A., KOBILKA, B. K. & STEYAERT, J. 2017. Nanobodies to Study G Protein-Coupled Receptor Structure and Function. Annu Rev Pharmacol Toxicol, 57, 19-37.

MARQUES, G., MUSACCHIO, M., SHIMELL, M. J., WUNNENBERG-STAPLETON, K., CHO, K. W. & O'CONNOR, M. B. 1997. Production of a DPP activity gradient in the early Drosophila embryo through the opposing actions of the SOG and TLD proteins. Cell, 91, 417-26.

MARTINO, M. M. & HUBBELL, J. A. 2010. The 12th-14th type III repeats of fibronectin function as a highly promiscuous growth factor-binding domain. FASEB J, 24, 4711-21.

MATSUI, M., MIZUSEKI, K., NAKATANI, J., NAKANISHI, S. & SASAI, Y. 2000. Xenopus kielin: A dorsalizing factor containing multiple chordin-type repeats secreted from the embryonic midline. Proc Natl Acad Sci U S A, 97, 5291-6.

MAZERBOURG, S., KLEIN, C., ROH, J., KAIVO-OJA, N., MOTTERSHEAD, D. G., KORCHYNSKYI, O., RITVOS, O. & HSUEH, A. J. 2004. Growth differentiation factor-9 signaling is mediated by the type I receptor, activin receptor-like kinase 5. Mol Endocrinol, 18, 653-65.

MCMAHON, J. A., TAKADA, S., ZIMMERMAN, L. B., FAN, C. M., HARLAND, R. M. & MCMAHON, A. P. 1998. Noggin-mediated antagonism of BMP signaling is required for growth and patterning of the neural tube and somite. Genes Dev, 12, 1438-52.

MERTENS, H. D. & SVERGUN, D. I. 2010. Structural characterization of proteins and complexes using small-angle X-ray solution scattering. J Struct Biol, 172, 128-41.

MILLET, C., LEMAIRE, P., ORSETTI, B., GUGLIELMI, P. & FRANCOIS, V. 2001. The human chordin gene encodes several differentially expressed spliced variants with distinct BMP opposing activities. Mech Dev, 106, 85-96.

171 MORENO, M., MUNOZ, R., AROCA, F., LABARCA, M., BRANDAN, E. & LARRAIN, J. 2005. Biglycan is a new extracellular component of the Chordin-BMP4 signaling pathway. The EMBO Journal, 24, 1397-1405.

NAG, A., NIGAM, P., NARAYANAN, A. L., KUMAR, M., GHOSAL, R., SEN, J. & BANDYOPADHYAY, A. 2017. BMP signalling is critical for maintaining homeostasis of hair follicles and intestine in adult mice. bioRxiv.

NAKAYAMA, N., HAN, C. E., SCULLY, S., NISHINAKAMURA, R., HE, C., ZENI, L., YAMANE, H., CHANG, D., YU, D., YOKOTA, T. & WEN, D. 2001. A novel chordin-like protein inhibitor for bone morphogenetic proteins expressed preferentially in mesenchymal cell lineages. Dev Biol, 232, 372-87.

NAKAYAMA, N., HAN, C. Y., CAM, L., LEE, J. I., PRETORIUS, J., FISHER, S., ROSENFELD, R., SCULLY, S., NISHINAKAMURA, R., DURYEA, D., VAN, G., BOLON, B., YOKOTA, T. & ZHANG, K. 2004. A novel chordin-like BMP inhibitor, CHL2, expressed preferentially in chondrocytes of developing cartilage and osteoarthritic joint cartilage. Development, 131, 229-40.

NEAVE, B., HOLDER, N. & PATIENT, R. 1997. A graded response to BMP-4 spatially coordinates patterning of the mesoderm and ectoderm in the zebrafish. Mechanisms of Development, 62, 183-195.

NEGREIROS, E., HERSZTERG, S., KANG, K. H., CAMARA, A., DIAS, W. B., CARNEIRO, K., BIER, E., TODESCHINI, A. R. & ARAUJO, H. 2018. N-linked glycosylation restricts the function of Short gastrulation to bind and shuttle BMPs. Development, 145.

NISTALA, H., LEE-ARTEAGA, S., SMALDONE, S., SICILIANO, G., CARTA, L., ONO, R. N., SENGLE, G., ARTEAGA-SOLIS, E., LEVASSEUR, R., DUCY, P., SAKAI, L. Y., KARSENTY, G. & RAMIREZ, F. 2010. Fibrillin-1 and -2 differentially modulate endogenous TGF-beta and BMP bioavailability during bone formation. J Cell Biol, 190, 1107-21.

NOSAKA, T., MORITA, S., KITAMURA, H., NAKAJIMA, H., SHIBATA, F., MORIKAWA, Y., KATAOKA, Y., EBIHARA, Y., KAWASHIMA, T., ITOH, T., OZAKI, K., SENBA, E., TSUJI, K., MAKISHIMA, F., YOSHIDA, N. & KITAMURA, T. 2003. Mammalian twisted gastrulation is essential for skeleto-lymphogenesis. Mol Cell Biol, 23, 2969-80.

OELGESCHLAGER, M., KURODA, H., REVERSADE, B. & DE ROBERTIS, E. M. 2003a. Chordin is required for the Spemann organizer transplantation phenomenon in Xenopus embryos. Dev Cell, 4, 219-30.

OELGESCHLAGER, M., LARRAIN, J., GEISSERT, D. & DE ROBERTIS, E. M. 2000. The evolutionarily conserved BMP-binding protein Twisted gastrulation promotes BMP signalling. Nature, 405, 757-63.

OELGESCHLAGER, M., REVERSADE, B., LARRAIN, J., LITTLE, S., MULLINS, M. C. & DE ROBERTIS, E. M. 2003b. The pro-BMP activity of Twisted gastrulation is independent of BMP binding. Development, 130, 4047-56.

OHI, M., LI, Y., CHENG, Y. & WALZ, T. 2004. Negative Staining and Image Classification - Poweful Tools in Modern Electron Micrscopy. Biological Procedures, 6, 23-34.

OHKAWARA, B., IEMURA, S., TEN DIJKE, P. & UENO, N. 2002. Action range of BMP is defined by its N-terminal basic amino acid core. Curr Biol, 12, 205-9.

172 OHTA, K., LUPO, G., KURIYAMA, S., KEYNES, R., HOLT, C. E., HARRIS, W. A., TANAKA, H. & OHNUMA, S. I. 2004. Tsukushi functions as an organizer inducer by inhibition of BMP activity in cooperation with chordin. Dev Cell, 7, 347-358.

ONICHTCHOUK, D., CHEN, Y. G., DOSCH, R., GAWANTKA, V., DELIUS, H., MASSAGUE, J. & NIEHRS, C. 1999. Silencing of TGF-beta signalling by the pseudoreceptor BAMBI. Nature, 401, 480-5.

OREN, A., TOPORIK, A., BITON, S., ALMOGY, N., ESHEL, D., BERNSTEIN, J., SAVITSKY, K. & ROTMAN, G. 2004. hCHL2, a novel chordin-related gene, displays differential expression and complex alternative splicing in human tissues and during myoblast and osteoblast maturation. Gene, 331, 17-31.

ORLOVA, E. V. & SAIBIL, H. R. 2011. Structural analysis of macromolecular assemblies by electron microscopy. Chem Rev, 111, 7710-48.

ORTEGA, A., AMOROS, D. & GARCIA DE LA TORRE, J. 2011. Prediction of hydrodynamic and other solution properties of rigid proteins from atomic- and residue-level models. Biophys J, 101, 892-8.

PADGETT, R. W., WOZNEY, J. M. & GELBART, W. M. 1993. Human BMP sequences can confer normal dorsal-ventral patterning in the Drosophila embryo. Proc Natl Acad Sci U S A, 90, 2905-9.

PAINE-SAUNDERS, S., VIVIANO, B. L., ECONOMIDES, A. N. & SAUNDERS, S. 2002. Heparan sulfate proteoglycans retain Noggin at the cell surface: a potential mechanism for shaping bone morphogenetic protein gradients. J Biol Chem, 277, 2089-96.

PAPPANO, W. N., SCOTT, I. C., CLARK, T. G., EDDY, R. L., SHOWS, T. B. & GREENSPAN, D. S. 1998. Coding sequence and expression patterns of mouse chordin and mapping of the cognate mouse chrd and human CHRD genes. Genomics, 52, 236-9.

PASSMORE, L. A. & RUSSO, C. J. 2016. Specimen Preparation for High-Resolution Cryo-EM. Methods Enzymol, 579, 51-86.

PEI, Y., ZHANG, Y., LEI, Y., WU, D., MA, T. & LIU, X. 2017. Hypermethylation of the CHRDL1 promoter induces proliferationand metastasis by activating Akt and Erk in gastic cancer Oncotarget, 8, 23155-23166.

PELUSO, C. E., UMULIS, D., KIM, Y. J., O'CONNOR, M. B. & SERPE, M. 2011. Shaping BMP morphogen gradients through enzyme-substrate interactions. Dev Cell, 21, 375-83.

PENCZEK, P. A. 2010. Resolution Measures in Molecular Electron Microscopy. Cryo-EM, Part B: 3-D Reconstruction.

PERSSON, U., IZUMI, H., SOUCHELNYTSKYI, S., ITOH, S., GRIMSBY, S., ENGSTROM, U., HELDIN, C. H., FUNA, K. & DIJKE, P. 1998. The L45 loop in type I receptors for TGF-B family members is a critical determinant in specifying Smad isoform activation. FEBS Letters, 434, 83-87.

PETROCHENKO, E. V., SERPA, J. J. & BORCHERS, C. H. 2011. An Isotopically Coded CID- cleavable Biotinylated Cross-linker for Structural Proteomics. Molecular & Cellular Proteomics, 10.

173 PICCOLO, S., AGIUS, E., LU, B., GOODMAN, S., DALE, L. & DE ROBERTIS, E. M. 1997. Cleavage of Chordin by Xolloid metalloprotease suggests a role for proteolytic processing in the regulation of Spemann organizer activity. Cell, 91, 407-16.

PICCOLO, S., SASAI, Y., LU, B. & DE ROBERTIS, E. M. 1996. Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4. Cell, 86, 589-98.

PLOUHINEC, J. L., ZAKIN, L., MORIYAMA, Y. & DE ROBERTIS, E. M. 2013. Chordin forms a self-organizing morphogen gradient in the extracellular space between ectoderm and mesoderm in the Xenopus embryo. Proc Natl Acad Sci U S A, 110, 20372-9.

POMREINKE, A. P., SOH, G. H., ROGERS, K. W., BERGMANN, J. K., BLASSLE, A. J. & MULLER, P. 2017. Dynamics of BMP signaling and distribution during zebrafish dorsal- ventral patterning. Elife, 6.

PUNJANI, A., RUBINSTEIN, J. L., FLEET, D. J. & BRUBAKER, M. A. 2017. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. Nat Methods, 14, 290-296.

RAMBO, R. P. 2015. Resolving Individual Components in Protein-RNA Complexes Using Small- Angle X-ray Scattering Experiments. Methods Enzymol, 558, 363-90.

RAMBO, R. P. & TAINER, J. A. 2011. Characterizing flexible and intrinsically unstructured biological macromolecules by SAS using the Porod-Debye law. Biopolymers, 95, 559-71.

RASMUSSEN, S. G., DEVREE, B. T., ZOU, Y., KRUSE, A. C., CHUNG, K. Y., KOBILKA, T. S., THIAN, F. S., CHAE, P. S., PARDON, E., CALINSKI, D., MATHIESEN, J. M., SHAH, S. T., LYONS, J. A., CAFFREY, M., GELLMAN, S. H., STEYAERT, J., SKINIOTIS, G., WEIS, W. I., SUNAHARA, R. K. & KOBILKA, B. K. 2011. Crystal structure of the beta2 adrenergic receptor-Gs protein complex. Nature, 477, 549-55.

RENTZSCH, F., ZHANG, J., KRAMER, C., SEBALD, W. & HAMMERSCHMIDT, M. 2006. Crossveinless 2 is an essential positive feedback regulator of Bmp signaling during zebrafish gastrulation. Development, 133, 801-11.

REVERSADE, B. & DE ROBERTIS, E. M. 2005. Regulation of ADMP and BMP2/4/7 at opposite embryonic poles generates a self-regulating morphogenetic field. Cell, 123, 1147-60.

REVERSADE, B., KURODA, H., LEE, H., MAYS, A. & DE ROBERTIS, E. M. 2005. Depletion of Bmp2, Bmp4, Bmp7 and Spemann organizer signals induces massive brain formation in Xenopus embryos. Development, 132, 3381-92.

ROSS, J. J., SHIMMI, O., VILMOS, P., PETRYK, A., KIM, H., GAUDENZ, K., HERMANSON, S., EKKER, S. C., O'CONNOR, M. B. & MARSH, J. L. 2001. Twisted gastrulation is a conserved extracellular BMP antagonist. Nature, 410, 479-83.

ROTHHAMMER, T., POSER, I., SONCIN, F., BATAILLE, F., MOSER, M. & BOSSERHOFF, A. 2005. Bone Morphogenetic Proteins are Overexpressed in Malignant Melanoma and Promote Cell Invasion and Migration. Cancer Research, 65, 448-456.

SAKUTA, H., SUZUKI, R., TAKAHASHI, H., KATO, A., SHINTANI, T., IEMURA, S., YAMAMOTO, T. S., UENO, N. & NODA, M. 2001. Ventropin: A BMP-4 Antagonist Expressed in a Double-Gradient Pattern in the Retina. Science, 293, 111-115.

174 SALAZAR, V. S., GAMER, L. W. & ROSEN, V. 2016. BMP signalling in skeletal development, disease and repair. Nat Rev Endocrinol, 12, 203-21.

SASAI, Y., LU, B., STEINBEISSER, H., GEISSERT, D., GONT, L. K. & DE ROBERTIS, E. M. 1994. Xenopus chordin: a novel dorsalizing factor activated by organizer-specific homeobox genes. Cell, 79, 779-90.

SAWALA, A., SUTCLIFFE, C. & ASHE, H. L. 2012. Multistep molecular mechanism for bone morphogenetic protein extracellular transport in the Drosophila embryo. Proc Natl Acad Sci U S A, 109, 11222-7.

SCHEUFLER, C., SEBALD, W. & HULSMEYER, M. 1999. Crystal structure of human bone morphogenetic protein-2 at 2.7 A resolution. J Mol Biol, 287, 103-15.

SCHIER, A. F. & TALBOT, W. S. 2005. Molecular genetics of axis formation in zebrafish. Annu Rev Genet, 39, 561-613.

SCHINDELIN, J., ARGANDA-CARRERAS, I., FRISE, E., KAYNIG, V., LONGAIR, M., PIETZSCH, T., PREIBISCH, S., RUEDEN, C., SAALFELD, S., SCHMID, B., TINEVEZ, J. Y., WHITE, D. J., HARTENSTEIN, V., ELICEIRI, K., TOMANCAK, P. & CARDONA, A. 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods, 9, 676- 82.

SCHMIDL, M., ADAM, N., SURMANN-SCHMITT, C., HATTORI, T., STOCK, M., DIETZ, U., DE CROMBRUGGHE, B., POSCHL, E. & VON DER MARK, K. 2006. Twisted gastrulation modulates bone morphogenetic protein-induced collagen II and X expression in chondrocytes in vitro and in vivo. J Biol Chem, 281, 31790-800.

SCHUK, P. 2000. Size-distribution analysis of macromolecules by sedimentation velocity ultracentrifugation and lamm equation modeling. Biophysical Journal, 78, 1606-1619.

SCHULTE-MERKER, S., LEE, K. J., MCMAHON, A. P. & HAMMERSCHMIDT, M. 1997. The zebrafish organizer requires chordino. Nature, 387, 862-3.

SCOTT, I. C., BLITZ, I. L., PAPPANO, W. N., IMAMURA, Y., CLARK, T. G., STEIGLITZ, B. M., THOMAS, C. L., MAAS, S. A., TAKAHARA, K., CHO, K. W. & GREENSPAN, D. S. 1999. Mammalian BMP-1/Tolloid-related metalloproteinases, including novel family member mammalian Tolloid-like 2, have differential enzymatic activities and distributions of expression relevant to patterning and skeletogenesis. Dev Biol, 213, 283-300.

SCOTT, I. C., BLITZ, I. L., PAPPANO, W. N., MAAS, S. A., CHO, K. W. & GREENSPAN, D. S. 2001. Homologues of Twisted gastrulation are extracellular cofactors in antagonism of BMP signalling. Nature, 410, 475-8.

SCOTT, I. C., STEIGLITZ, B. M., CLARK, T. G., PAPPANO, W. N. & GREENSPAN, D. S. 2000. Spatiotemporal expression patterns of mammalian chordin during postgastrulation embryogenesis and in postnatal brain. Dev Dyn, 217, 449-56.

SENGLE, G., CARLBERG, V., TUFA, S. F., CHARBONNEAU, N. L., SMALDONE, S., CARLSON, E. J., RAMIREZ, F., KEENE, D. R. & SAKAI, L. Y. 2015. Abnormal Activation of BMP Signaling Causes Myopathy in Fbn2 Null Mice. PLoS Genet, 11, e1005340.

175 SENGLE, G., CHARBONNEAU, N. L., ONO, R. N., SASAKI, T., ALVAREZ, J., KEENE, D. R., BACHINGER, H. P. & SAKAI, L. Y. 2008a. Targeting of bone morphogenetic protein growth factor complexes to fibrillin. J Biol Chem, 283, 13874-88.

SENGLE, G., ONO, R. N., LYONS, K. M., BACHINGER, H. P. & SAKAI, L. Y. 2008b. A new model for growth factor activation: type II receptors compete with the prodomain for BMP-7. J Mol Biol, 381, 1025-39.

SENGLE, G., ONO, R. N., SASAKI, T. & SAKAI, L. Y. 2011. Prodomains of transforming growth factor beta (TGFbeta) superfamily members specify different functions: extracellular matrix interactions and growth factor bioavailability. J Biol Chem, 286, 5087-99.

SERPE, M., UMULIS, D., RALSTON, A., CHEN, J., OLSON, D. J., AVANESOV, A., OTHMER, H., O'CONNOR, M. B. & BLAIR, S. S. 2008. The BMP-binding protein Crossveinless 2 is a short-range, concentration-dependent, biphasic modulator of BMP signaling in Drosophila. Dev Cell, 14, 940-53.

SHIMMI, O. & O'CONNOR, M. B. 2003. Physical properties of Tld, Sog, Tsg and Dpp protein interactions are predicted to help create a sharp boundary in Bmp signals during dorsoventral patterning of the Drosophila embryo. Development, 130, 4673-82.

SHIMMI, O., UMULIS, D., OTHMER, H. & O'CONNOR, M. B. 2005. Facilitated transport of a Dpp/Scw heterodimer by Sog/Tsg leads to robust patterning of the Drosophila blastoderm embryo. Cell, 120, 873-86.

SIEVERS, F., WILM, A., DINEEN, D., GIBSON, T. J., KARPLUS, K., LI, W., LOPEZ, R., MCWILLIAM, H., REMMERT, M., SODING, J., THOMPSON, J. D. & HIGGINS, D. G. 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol Syst Biol, 7, 539.

SMITH, W. C. & HARLAND, R. M. 1992. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos. Cell, 70, 829-40.

SOTILLO RODRIGUEZ, J. E., MANSKY, K. C., JENSEN, E. D., CARLSON, A. E., SCHWARZ, T., PHAM, L., MACKENZIE, B., PRASAD, H., ROHRER, M. D., PETRYK, A. & GOPALAKRISHNAN, R. 2009. Enhanced osteoclastogenesis causes osteopenia in twisted gastrulation-deficient mice through increased BMP signaling. J Bone Miner Res, 24, 1917-26.

SRINIVASAN, S., RASHKA, K. E. & BIER, E. 2002. Creation of a Sog Morphogen Gradient in the Drosophila Embryo. Developmental Cell, 2, 91-101.

SRIVASTAVA, M., BEGOVIC, E., CHAPMAN, J., PUTNAM, N. H., HELLSTEN, U., KAWASHIMA, T., KUO, A., MITROS, T., SALAMOV, A., CARPENTER, M. L., SIGNOROVITCH, A. Y., MORENO, M. A., KAMM, K., GRIMWOOD, J., SCHMUTZ, J., SHAPIRO, H., GRIGORIEV, I. V., BUSS, L. W., SCHIERWATER, B., DELLAPORTA, S. L. & ROKHSAR, D. S. 2008. The Trichoplax genome and the nature of placozoans. Nature, 454, 955-60.

STEINBERG, J., RITCHIE, G. R. S., ROUMELIOTIS, T. I., JAYASURIYA, R. L., CLARK, M. J., BROOKS, R. A., BINCH, A. L. A., SHAH, K. M., COYLE, R., PARDO, M., LE MAITRE, C. L., RAMOS, Y. F. M., NELISSEN, R., MEULENBELT, I., MCCASKIE, A. W., CHOUDHARY, J. S., WILKINSON, J. M. & ZEGGINI, E. 2017. Integrative epigenomics, transcriptomics and proteomics of patient chondrocytes reveal genes and pathways involved in osteoarthritis. Sci Rep, 7, 8935.

176 STOTTMANN, R. W., ANDERSON, R. M. & KLINGENSMITH, J. 2001. The BMP antagonists Chordin and Noggin have essential but redundant roles in mouse mandibular outgrowth. Dev Biol, 240, 457-73.

SUN, J., LIU, X., GAO, H., ZHANG, L., JI, Q., WANG, Z., ZHOU, L., WANG, Y., SUI, H., FAN, Z. & LI, Q. 2017. Overexpression of colorectal cancer oncogene CHRDL2 predicts a poor prognosis. Oncotarget, 8, 11489-11506.

SUN, M., FORSMAN, C., SERGI, C., GOPALAKRISHNAN, R., O'CONNOR, M. B. & PETRYK, A. 2010. The expression of twisted gastrulation in postnatal mouse brain and functional implications. Neuroscience, 169, 920-31.

SZYMCZAK, A. L., WORKMAN, C. J., WANG, Y., VIGNALI, K. M., DILIOGLOU, S., VANIN, E. F. & VIGNALI, D. A. 2004. Correction of multi-gene deficiency in vivo using a single 'self- cleaving' 2A peptide-based retroviral vector. Nat Biotechnol, 22, 589-94.

TAMMINEN, J. A., PARVIAINEN, V., RONTY, M., WOHL, A. P., MURRAY, L., JOENVAARA, S., VARJOSALO, M., LEPPARANTA, O., RITVOS, O., SENGLE, G., RENKONEN, R., MYLLARNIEMI, M. & KOLI, K. 2013. Gremlin-1 associates with fibrillin microfibrils in vivo and regulates mesothelioma cell survival through transcription factor slug. Oncogenesis, 2, e66.

TANG, G., PENG, L., BALDWIN, P. R., MANN, D. S., JIANG, W., REES, I. & LUDTKE, S. J. 2007. EMAN2: an extensible image processing suite for electron microscopy. J Struct Biol, 157, 38-46.

TANG, X. & BRUCE, J. E. 2010. A new cross-linking strategy: protein interaction reporter (PIR) technology for protein-protein interaction studies. Molecular Biosystems, 6, 939-947.

TARDIF, G., PELLETIER, J. P., HUM, D., BOILEAU, C., DUVAL, N. & MARTEL-PELLETIER, J. 2006. Differential regulation of the bone morphogenic protein antagonist chordin in human normal and osteoarthritic chondrocytes. Ann Rheum Dis, 65, 261-4.

TIEDE, C., TANG, A. A., DEACON, S. E., MANDAL, U., NETTLESHIP, J. E., OWEN, R. L., GEORGE, S. E., HARRISON, D. J., OWENS, R. J., TOMLINSON, D. C. & MCPHERSON, M. J. 2014. Adhiron: a stable and versatile peptide display scaffold for molecular recognition applications. Protein Eng Des Sel, 27, 145-55.

TRIA, G., MERTENS, H. D., KACHALA, M. & SVERGUN, D. I. 2015. Advanced ensemble modelling of flexible macromolecules using X-ray solution scattering. IUCrJ, 2, 207-17.

TROILO, H. 2014. The Role of Chordin and Twisted Gastrulation in Regulating BMP Family Growth Factors. Doctor of Philosophy, University of Manchester.

TROILO, H., BARRETT, A. L., ZUK, A. V., LOCKHART-CAIRNS, M. P., WOHL, A. P., BAYLEY, C. P., DAJANI, R., TUNNICLIFFE, R. B., GREEN, L., JOWITT, T. A., SENGLE, G. & BALDOCK, C. 2016. Structural characterization of twisted gastrulation provides insights into opposing functions on the BMP signalling pathway. Matrix Biol.

TROILO, H., ZUK, A. V., TUNNICLIFFE, R. B., WOHL, A. P., BERRY, R., COLLINS, R. F., JOWITT, T. A., SENGLE, G. & BALDOCK, C. 2014. Nanoscale structure of the BMP antagonist chordin supports cooperative BMP binding. Proc Natl Acad Sci U S A, 111, 13063-8.

177 VILMOS, P., GAUDENZ, K., HEGEDUS, Z. & MARSH, J. L. 2001. The Twisted gastrulation family of proteins, together with the IGFBP and CCN families, comprise the TIC superfamily of cysteine rich secreted factors. Mol Pathol, 54, 317-23.

WAGNER, D. S. & MULLINS, M. C. 2002. Modulation of BMP activity in dorsal-ventral pattern formation by the chordin and ogon antagonists. Dev Biol, 245, 109-23.

WAKEFIELD, L. M. & HILL, C. S. 2013. Beyond TGFbeta: roles of other TGFbeta superfamily members in cancer. Nat Rev Cancer, 13, 328-41.

WANG, X., HARRIS, R. E., BAYSTON, L. J. & ASHE, H. L. 2008. Type IV collagens regulate BMP signalling in Drosophila. Nature, 455, 72-7.

WATERHOUSE, A., BERTONI, M., BIENERT, S., STUDER, G., TAURIELLO, G., GUMIENNY, R., HEER, F. T., DE BEER, T. A. P., REMPFER, C., BORDOLI, L., LEPORE, R. & SCHWEDE, T. 2018. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res, 46, W296-W303.

WATERHOUSE, A. M., PROCTER, J. B., MARTIN, D. M., CLAMP, M. & BARTON, G. J. 2009. Jalview Version 2--a multiple sequence alignment editor and analysis workbench. Bioinformatics, 25, 1189-91.

WERMTER, C., HOWEL, M., HINTZE, V., BOMBOSCH, B., AUFENVENNE, K., YIALLOUROS, I. & STOCKER, W. 2007. The protease domain of procollagen C-proteinase (BMP1) lacks substrate selectivity, which is conferred by non-proteolytic domains. Biol Chem, 388, 513-21.

WHARTON, K. A., RAY, R. P. & GELBART, W. M. 1993. An activity gradient of decapentaplegic is necessary for the specification of dorsal pattern elements in the Drosophila embryo. Development, 117, 807-22.

WHITMORE, L. & WALLACE, B. A. 2008. Protein secondary structure analyses from circular dichroism spectroscopy: methods and reference databases. Biopolymers, 89, 392-400.

WILSON, P. A., LAGNA, G., SUZUKI, A. & HEMMATI-BRIVANLOU, A. 1997. Concentration- dependent patterning of the Xenopus ectoderm by BMP4 and its signal transducer Smad1. Development, 124, 3177-3184.

WINNIER, G., BLESSING, M., LABOSKY, P. A. & HOGAN, B. L. 1995. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse. Genes Dev, 9, 2105-16.

WINSTANLEY, J. 2014. A Structure-Functure Analysis of Drosophila Tolloid. Doctor of Philosophy, University of Manchester.

WINSTANLEY, J., SAWALA, A., BALDOCK, C. & ASHE, H. L. 2015. Synthetic enzyme-substrate tethering obviates the Tolloid-ECM interaction during Drosophila BMP gradient formation. Elife, 4.

WOHL, A. P., TROILO, H., COLLINS, R. F., BALDOCK, C. & SENGLE, G. 2016. Extracellular Regulation of Bone Morphogenetic Protein Activity by the Microfibril Component Fibrillin- 1. J Biol Chem, 291, 12732-46.

WU, I. & MOSES, M. A. 2003. BNF-1, a novel gene encoding a putative extracellular matrix protein, is overexpressed in tumor tissues. Gene, 311, 105-10.

178 XIE, J. & FISHER, S. 2005. Twisted gastrulation enhances BMP signaling through chordin dependent and independent mechanisms. Development, 132, 383-91.

XU, E. R., BLYTHE, E. E., FISCHER, G. & HYVONEN, M. 2017. Structural analyses of von Willebrand factor C domains of collagen 2A and CCN3 reveal an alternative mode of binding to bone morphogenetic protein-2. J Biol Chem, 292, 12516-12527.

YANG, J., YAN, R., ROY, A., XU, D., POISSON, J. & ZHANG, Y. 2015. The I-TASSER Suite: protein structure and function prediction. Nat Methods, 12, 7-8.

YU, K., SRINIVASAN, S., SHIMMI, O., BIEHS, B., RASHKA, K. E., KIMELMAN, D., O'CONNOR, M. B. & BIER, E. 2000. Processing of the Drosophila Sog protein creates a novel BMP inhibitory activity. Development, 127, 2143-54.

ZAKIN, L., CHANG, E. Y., PLOUHINEC, J. L. & DE ROBERTIS, E. M. 2010. Crossveinless-2 is required for the relocalization of Chordin protein within the vertebral field in mouse embryos. Dev Biol, 347, 204-15.

ZAKIN, L. & DE ROBERTIS, E. M. 2004. Inactivation of mouse Twisted gastrulation reveals its role in promoting Bmp4 activity during forebrain development. Development, 131, 413- 24.

ZAKIN, L. & DE ROBERTIS, E. M. 2010. Extracellular regulation of BMP signaling. Curr Biol, 20, R89-92.

ZAKIN, L., METZINGER, C. A., CHANG, E. Y., COFFINIER, C. & DE ROBERTIS, E. M. 2008. Development of the vertebral morphogenetic field in the mouse: interactions between Crossveinless-2 and Twisted Gastrulation. Dev Biol, 323, 6-18.

ZAKIN, L., REVERSADE, B., KURODA, H., LYONS, K. M. & DE ROBERTIS, E. M. 2005. Sirenomelia in Bmp7 and Tsg compound mutant mice: requirement for Bmp signaling in the development of ventral posterior mesoderm. Development, 132, 2489-99.

ZHANG, J. L., HUANG, Y., QIU, L. Y., NICKEL, J. & SEBALD, W. 2007. von Willebrand factor type C domain-containing proteins regulate bone morphogenetic protein signaling through different recognition mechanisms. J Biol Chem, 282, 20002-14.

ZHANG, J. L., PATTERSON, L. J., QIU, L. Y., GRAZIUSSI, D., SEBALD, W. & HAMMERSCHMIDT, M. 2010. Binding between Crossveinless-2 and Chordin von Willebrand factor type C domains promotes BMP signaling by blocking Chordin activity. PLoS One, 5, e12846.

ZHANG, J. L., QIU, L. Y., KOTZSCH, A., WEIDAUER, S., PATTERSON, L., HAMMERSCHMIDT, M., SEBALD, W. & MUELLER, T. D. 2008. Crystal structure analysis reveals how the Chordin family member crossveinless 2 blocks BMP-2 receptor binding. Dev Cell, 14, 739-50.

ZHANG, L., YE, Y., LONG, X., XIAO, P., REN, X. & YU, J. 2016. BMP signaling and its paradoxical effects in tumorigenesis and dissemination. Oncotarget, 7, 78206-78218.

ZHAO, M., HARRIS, S. E., HORN, D., GENG, Z., NISHIMURA, R., MUNDY, G. R. & CHEN, D. 2002. Bone morphogenetic protein receptor signaling is necessary for normal murine postnatal bone formation. J Cell Biol, 157, 1049-60.

179 ZHENG, S. Q., PALOVCAK, E., ARMACHE, J. P., VERBA, K. A., CHENG, Y. & AGARD, D. A. 2017. MotionCor2: anisotropic correction of beam-induced motion for improved cryo- electron microscopy. Nat Methods, 14, 331-332.

ZHOU, Y. F., ENG, E. T., ZHU, J., LU, C., WALZ, T. & SPRINGER, T. A. 2012. Sequence and structure relationships within von Willebrand factor. Blood, 120, 449-58.

ZINSKI, J., BU, Y., WANG, X., DOU, W., UMULIS, D. & MULLINS, M. C. 2017. Systems biology derived source-sink mechanism of BMP gradient formation. Elife, 6.

180 8 Appendices

8.1 Appendix 1

Appendix 1 The pCEP-Pu/AC7 mammalian expression vector. The pCEP-Pu/AC7 mammalian expression vector for expression and secretion of chordin constructs in stably transfected HEK293-EBNA cells. OriP/EBNA-I is the eukaryotic origin of replication induced by EBNA-I, allowing for maintenance of this plasmid in stably-transfected cell lines; AmpR is the ampicillin resistance open reading frame; ColE1 is the bacterial origin of replication; PSV40 is the promoter for Pac in eukaryotic cells; Pac is the puromycin resistance open reading frame; SV40Poly(A) is the 3’ polyadenylation signal; CMV is the construct promoter sequence; BM40 is the signal peptide for construct secretion in eukaryotic cell lines.

181 8.2 Appendix 2

Appendix 2 The pCDH vector. The pCDH lentiviral vector used for generation of lentivirus in HEK293-T cells. The subsequent lentivirus was used to transduce HEK293-EBNA cells for expression and secretion of CHRDL2. EF1 is the construct promoter sequence; tagRFP is the RFP tag for cell sorting; WPRE is the Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element; LTR is the long terminal repeat sequences for integration into the host genome; SV40Poly(A) is the 3’ polyadenylation signal; SV40 ori is the eukaryotic origin of replication; pBR322/Ori is the bacterial origin of replication; AmpR is the ampicillin resistance open reading frame; RRE is the Rev response element; cPPT is the central polypurine tract.

182 8.3 Appendix 3

Appendix 3 The chordin vWC1 sequence. The DNA sequence of the recombinant chordin vWC1 construct following cloning into the pCep-Pu/AC7 vector, and the corresponding peptide sequence.

183 8.4 Appendix 4

Appendix 4 The Tsg-FLAG DNA sequence. The DNA sequence of the recombinant Tsg-FLAG construct following cloning into the pCep-Pu/AC7 vector, and the corresponding peptide sequence.

184 8.5 Appendix 5

Appendix 5 CHRDL2 Gene String sequence. The sequence of the CHRDL2 Gene String (Thermo Fisher Scientific) generated, based on the NCBI gene accession code: NM_001278473.

185 8.6 Appendix 6

Appendix 6 The CHRDL2 peptide sequence. The CHRDL2 peptide sequence generated following cloning of the CHRDL2 gene string into the pCDH vector.

186 8.7 Appendix 7

Appendix 7 Tryptic-digest mass spectrometry of the chordin vWC1 construct. The peptide hits from tryptic-digest mass spectrometry are shown in red for the doublet species observed on vWC1 purification.

187 8.8 Appendix 8

Appendix 8 Optimisation of Tsg-FLAG immunoprecipitation. Anti-His6 western blot of reducing SDS-PAGE of fractions from anti-FLAG immunoprecipitation of TsgFLAG (A) and ΔN- chordin (B) with anti-FLAG M2 affinity gel (Sigma). Fractions shown are the input (IN), flow- through (FT), washes (W1-5), elution and boiled beads after protein elution. Protein was incubated with resin for 2 hours at room temperature. Washes were performed with 10 mM HEPES, 1 M urea, 0.5 M NaCl, pH 7.4, and eluted with 200 μg/ml FLAG peptide. Resin was boiled in reducing SDS-PAGE loading buffer for 5 minutes “boiled beads”.

188 8.9 Appendix 9

Appendix 9 Homology models of the CHRDL2 vWC domains generated for EOM analysis. Homology models of the CHRDL2 vWC domains generated using the SWISSMODEL server. Models were chosen with the most favourable QMEAN score and greatest sequence coverage. CHRDL2 vWC1 (residues 31-96) and vWC2 (residues 109-175) used the CCN3 vWC domain as a template (PDB ID: 5nb8), and the vWC3 domains (residues 250-315) used the collagen IIA vWC domain as a template (PDB ID: 5nir).

189 8.10 Appendix 10

Appendix 10 Frame selection for SAXS analysis of the CHRDL2/Tsg complex. In the ScÅtter software package (www.bioisis.net) frames 189 to 201 of the SAXS signal plot were selected for analysis. (A) The signal plot shows the signal intensity of each frame of the sample, recorded as the sample is eluting from the SEC column. The grey dashed lines indicate the frames selected for analysis. (B) Durbin-Watson autocorrelation analysis of SAXS frames. Frames were selected which had a Durbin-Watson statistic of 2.

190 8.11 Appendix 11

Appendix 11 Individual MONSA runs for the CHRDL2/Tsg complex. Six independent MONSA runs performed with the CHRDL2/Tsg SAXS data in the ATSAS software suite. Shown are the relative positions of the Tsg volume on the averaged CHRDL2 volume for each run.

191