Development of Replicative and Nonreplicative Hepatitis B Virus Vectors

Home , Duck hepatitis B virus, Hepatitis B virus, Pol (HIV), Viral protein

S Chaisomchit, DLJ Tyrrell and L-J Chang Department of Medical Microbiology and Immunology and Glaxo Wellcome Heritage Research Institute, University of Alberta, Edmonton, Alberta, Canada

To investigate the possibility of using hepatitis B virus transactivation activity of the HBVtat recombinant since a (HBV) as a vector, the tat gene from human immunodefi- frameshift mutation in the pol gene did not affect the ciency virus type 1 (HIV-1) was inserted into the full-length recombinant tat function. The functional tat protein, there- HBV genome in-frame with the polymerase (pol) open fore, was most likely expressed as a Tat-Pol fusion pro- reading frame in the tether region and downstream of the duct. Endogenous polymerase assays showed that the pol preS1 promoter. We demonstrated that the tat gene was protein expressed from the HBVtat recombinant was still expressed with full activity in transactivating the HIV-1 long active although at a reduced level. Hepatitis B surface anti- terminal repeat (LTR). The expression of the tat gene in gens and e antigen produced from this recombinant were the context of the HBV genome in chicken hepatoma and detected at similar levels as those produced from the wild human cervical carcinoma cells, however, was not as type. Notably, the capability of forming complete HBV par- efficient as that in human hepatoblastoma cells, which ticles was still retained. These studies indicate the potential reflects the cellular and species specificity of promoters of of constructing HBV as a replicative vector. We also hepadnaviruses. Detection of RNA expressed from this showed that manipulation of a nonreplicative HBV vector HBVtat recombinant revealed transcription of the tat gene was possible. Expression of the HBV polymerase could be by two promoters: the core/pol promoter and the preS1 completely eliminated and replication of the nonreplicative promoter. A Pol-Tat fusion protein expressed by the HBV recombinant could be supported by Pol trans- core/pol promoter did not seem to contribute to the tat complementation.

Keywords: HBV; tat; vector; gene therapy; liver

Introduction The genomic organization of these viruses is extremely compact and efficiently organized with overlapping open As we are faced with a number of diseases involving the reading frames (ORFs).13,14 Hepatitis B virus (HBV), the liver, particularly inherited single gene defects and viral prototype of hepadnaviruses and causative agent for diseases, a novel therapeutic approach using targeted human hepatitis, carries four major overlapping ORFs: gene transfer to this organ is of particular interest, preS1/preS2/S (collectively known as the envelope or especially strategies of using human viruses as vectors. surface gene), preC/C, X and P. The envelope gene, In vitro protocols for transferring the low density lipopro- encompassing the preS1, preS2 and S regions as delin- tein (LDL) receptor gene into hepatocytes using a retrovi- eated by three in-frame initiation codons, codes for three 1,2 ral vector have been established. Adenoviral vectors envelope proteins: large (L), middle (M) and major (S). have also been used to deliver therapeutic genes, such as The preC/C gene, including the preC and C regions as 3 4,5 6,7 the genes for factors VIII and IX and LDL receptor delineated by two in-frame initiation codons, codes for into liver cells. However, these viral vectors infect a wide secreted HBV e antigen (HBeAg) and capsid or core pro- range of tissues, not specifically targeting to the liver. tein (HBcAg). The X gene codes for a transactivating pro- Expression of the transferred gene by adenoviral vectors, tein which has activity on HBV enhancers and other for example, is detected in different tissues after systemic cellular genes.15 The P or polymerase (pol) gene has the 6,8,9 7,10,11 administration or via portal or splenic vein. longest ORF. It encompasses about 80% of the entire viral Therefore, the use of hepadnaviruses which are hepato- genome and overlaps with the C-terminus of the preC/C tropic and possess strong liver-specific promoter and gene, the entire envelope gene and the N-terminus of the 12 enhancer elements, as vector systems, may provide a X gene. The C-terminus of the X gene also overlaps with more efficient means for gene delivery to the liver. the N-terminus of the preC/C gene. The protein product Hepadnaviruses are among the smallest DNA viruses (Pol) encoded by the pol gene can be divided into three known, carrying only 3200 base pairs in their genome. major functional domains: the terminal protein domain at the N-terminus, the reverse transcriptase–DNA polymerase in the central domain and the RNase H domain 16,17 Correspondence: L-J Chang, 611 HMRC, University of Alberta, Edmon- at the C-terminus. The terminal protein and reverse ton, Alberta T6G 2S2, Canada transcriptase–DNA polymerase domains are separated Received 16 April 1997; accepted 7 August 1997 by a spacer or tether region. Four promoter elements, the HBV vectors S Chaisomchit et al 1331 preS1, preS2/S, X and core/pol promoters,18 which regu- late transcription of pregenomic and subgenomic mess- engers for expression of the corresponding genes, have been identified on the HBV genome. Almost all nucleotides are included in coding sequences and are therefore indispensable. Only the spacer or tether region may be nonessential for the pol gene function or HBV replication.17,19 To our knowledge, HBV or other hepadnaviruses have not yet been engineered and used as gene transfer tools. The unusually efficient genome of HBV is a factor that limits its genetic manipulation. Mutations, insertions or deletions in many regions of the HBV genome have del- eterious effects on viral gene expression and replication.17,20–24 The tether region of the pol gene, however, seems to be dispensable for HBV replication and can be manipulated. Mutational and computer sequence analyses show that this region starts upstream of the preS1 gene and overlaps with the preS1 and preS2 regions.17,21 Part of the tether region, however, does not overlap with any other HBV genes. A mutational analysis of the pol gene of HBV has demonstrated that up to 90 codons of the intervening tether sequence can be deleted without significant loss of the endogenous polymerase activity.17 It has also been shown that such a deletion has no effect on the RNA encapsidation process.25 Mutants of HBV containing deletions in the preS1 region which overlaps the tether region are capable of replication.23 The duck hepatitis B virus (DHBV) genome carrying the gene for protein A (123 amino acids) inserted in the tether region also retains the capability of expressing an active endogenous polymerase.19 This region, moreover, toler- Figure 1 Schematic representation of HBV constructs and mutants. (a) ates many mutations resulting in amino acid changes.26,27 Construction of HBVtat. The HIV-1 tat gene (267 bp) was inserted into The tether region, therefore, seems to be the most suitable the unique BstEII site in-frame with the pol gene and between the pro- site for engineering the HBV genome as a vector. moter (2784 nt) and the initiation codon of the preS1 gene. All the ORFs encoded on the EcoRI–EcoRI monomer of the HBV genome (3221 bp) are We report here that the HBV genome can be manipu- shown with the positions of all initiation codons according to the adw2 lated to accommodate a foreign gene whose functional subtype. The ORFs start from the blunt end and stop at the arrow end. activity can be demonstrated in the context of the full The four domains of the pol gene corresponding to the functional activities length HBV genome in tissue culture cells. We con- of the Pol protein are indicated. The solid bar is the preS1 promoter and structed a recombinant HBV carrying the HIV-1 tat gene the transcription initiation site of the preS1 RNA (2.4 kb) is indicated by in the tether region. Transient expression in hepatoma an arrow. The NcoI site at the initiation codon of the X gene and the BspEI site downstream of the initiation codon of the pol gene are also and cervical carcinoma cells showed that the tat gene was shown. RT/Pol, reverse transcriptase and DNA polymerase; TP, terminal expressed with functional activity. In addition, the protein. (b) Linear map of the HBVtat replication-competent plasmid HBVtat recombinant exhibited polymerase activity, albeit (pTHBVT-d) (9859 bp) with two EcoRI–EcoRI monomers in a head to at a reduced level compared to the wild-type HBV. tail tandem configuration subcloned into the pT7T318U vector. All ORFs Remarkably, intact viral particles were still produced are depicted by solid bars. The locations of the insertion are indicated from human hepatoma cells transfected with the HBVtat by hatched boxes. T3, T3 promoter; T7, T7 promoter; AmpR, ampicillin resistance. (c) Diagrammatic representation of HBVtat mutations. (i) Site- recombinant. We further established a nonreplicative directed mutagenesis of the X gene at the initiation codon (1376 nt) with HBV vector by inserting a full length Zeocin-resistant an additional stop codon at 1397 nt. (ii) Frameshift mutation in the pol gene in-frame with the pol gene which totally ablated the ORF by digestion of the BspEI site and filling in at 2332 nt to 2336 nt. pol gene expression. Production of this nonreplicative The mutated or additional nucleotides are shown as boldface letters. recombinant HBV vector was successfully complemented by the Pol protein in trans. not interfere with any other HBV ORFs. A replication- competent form of HBVtat containing two copies of the Results EcoRI–EcoRI monomer of the HBVtat recombinant in a head to tail tandem configuration was subsequently con- Construction of a replication-competent HBV vector structed (Figure 1b). This dimeric construct was used for To generate a replication-competent HBV vector, the studying the functions and characteristics of HBVtat. HBVtat recombinant was made by inserting the HIV-1 tat gene into the unique BstEII site in the tether region in- Functional expression of HIV-1 tat from HBVtat frame with the pol ORF (Figure 1a). The tat insert con- The expression of the tat gene from HBVtat was determ- tained the entire tat ORF with its own initiation codon ined by transfection of human hepatoblastoma (HepG2), but without a stop codon. This insertion was 39 base avian hepatoma (LMH) and human cervical carcinoma pairs (bp) downstream of the preS1 promoter and did (HeLa) cells. HBVtat was cotransfected with a HIV-1 HBV vectors S Chaisomchit et al 1332 LTR-CAT reporter plasmid as described in Materials and med in HepG2 cells. The results indicate that the level of methods. The functional activity of the tat protein (Tat) the transactivation of the X gene was as high as that of was demonstrated by transactivation of the HIV-1 LTR wild-type HBV, whereas the transactivation activities of using CAT assay. In HepG2 cells, the basal activity of the the core, pol or surface gene constructs were insignificant CAT enzyme expressed from the HIV-1 LTR-CAT plas- (Figure 3). These results indicated that the high trans- mid in the absence of Tat was low (Figure 2, lane 2), and activation activity (86%) of HBVtat was due to the tat only a residual transactivation activity was observed with insertion. the wild-type HBV construct (Figure 2, lane 3). However, when HBVtat was present, the HIV-1 LTR was activated Expression of functional Tat independent of a Pol-Tat to a level similar to that of the Tat-positive control (Figure fusion 2, lane 4 versus lane 1). The result illustrated the Although the tat insert was designed to be expressed as expression of the Tat function by HBVtat. a Pol-Tat fusion recombinant using the core–pol pro- The tat gene function of HBVtat was also expressed in moter, the tat ORF was also in optimal proximity to the LMH and HeLa cells but not as well as in HepG2 cells. preS1 promoter (Figure 1a). It was thus possible that the The transactivation activity of HBVtat in LMH and HeLa tat gene might be expressed by the preS1 promoter. To cells was about 40 and 50%, respectively, of that of the determine which promoter was used for the expression Tat positive control (data not shown). This suggests that of the Tat function, we initially addressed the question HBV is not expressed as efficiently in other cell types as by generating a frameshift mutation near the beginning in human liver cells. Further studies of the HBVtat of the pol gene in HBVtat (Figure 1c). This mutation recombinant, therefore, were performed only in HepG2 disrupted the translation of the pol ORF, thus abolishing cells. the expression of a Pol-Tat fusion protein. Transient Although the wild-type HBV construct transactivated expression in HepG2 cells and CAT assay showed that HIV-1 LTR to a lesser extent than did the HBVtat recom- the pol frameshift mutant of HBVtat exhibited a trans- binant (Figure 2, lane 3 versus lane 4), it was still possible activation function similar to that of the original HBVtat that the transactivation function of HBVtat was enhanced construct (Figure 4). Thus, although the tat gene was in- by other HBV genes, such as the X gene.28 To test this frame with the pol ORF, the transactivation function of possibility, mutations of the X gene were introduced into HBVtat was not dependent on the expression of Tat as a HBVtat as shown in Figure 1c. The X mutant (HBVtatX−) Pol-Tat fusion protein. retained the transactivation activity, at somewhat To see if the tat gene could be expressed by the preS1 reduced levels when compared with the original HBVtat promoter, a Northern blot analysis was performed. The construct (Figure 2, lane 5 versus lane 4). pregenomic RNA for HBVtat expressed by the core–pol To see if other HBV genes also contributed to the trans- promoter was expected to be about 270 bases longer than activation function, transfection and CAT assays using that expressed from wild-type HBV in accordance with constructs expressing individual HBV genes were perfor- the size of the tat insertion. If a tat transcript was generated from the preS1 promoter, the size of this subgenomic RNA should also increase by about 270 bases. The sizes of the preS2/S and X messages of HBVtat should be the same as those of wild-type HBV. The Northern analysis using an HBV probe detected five species of RNA, 3.70, 3.10, 2.65, 2.05 and 0.80 kb, from HBVtat (Figure 5a, lane 2) and four species of RNA, 3.50, 2.40, 2.10 and 0.80 kb, from wild-type HBV (Figure 5a, lane 1). Only three spec-

Figure 2 Transactivation of HIV-1 LTR by HBVtat in HepG2. HepG2 cells were cotransfected with pLTR-CAT and wild-type HBV (lane 3), HBVtat (lane 4), X mutant of HBVtat (lane 5), pCEP-tat (lane 1) or a mock plasmid (lane 2). The enzyme activities were determined 48 h after transfection. The assay is described in more detail in the text. Relative levels of the CAT expression (normalized to an internal control human growth hormone) are shown as the percentage product converted (AcCm) calculated from three independent experiments with standard deviations. Figure 3 Transactivation of HIV-1 LTR by individual HBV genes. Rela- The negative control represents the basal activity of the inactivated HIV- tive levels of the CAT enzyme activities expressed from HepG2 cells 1 LTR. Elevated levels of the CAT enzyme activities reflect transactivation cotransfected with wild-type HBV (lane 1), pCHBVC (lane 2), pCHBVP of HIV-1 LTR. AcCm, acetylated chloramphenicol; Cm, unacetylated (lane 3), pSV-45 (lane 4), pSG-X (lane 5), pCEP-tat (lane 6) or a mock chloramphenicol, a substrate for CAT enzyme. plasmid (lane 7) were determined as described in the legend to Figure 2. HBV vectors S Chaisomchit et al 1333 (secreted human growth hormone) and to the amounts of hepatitis B e antigen (HBeAg) and hepatitis B surface antigens (HBsAg) secreted into the culture media. The reaction products were analyzed by agarose gel electrophoresis and autoradiography. Labeled DNA bands, corresponding to relaxed circular and linear double- stranded DNA genome and single-stranded DNA, were detected, albeit at reduced levels, as a result of the DNA polymerase activity of HBVtat (Figure 6a and b, lane 1), indicating that the Pol-Tat fusion of HBVtat retained the polymerase function. Compared with wild-type HBV, levels of endogenous polymerase activities in the intracellular core particles of HBVtat measured by a phosphoimager were about 4%, and in the extracellular viral particles of HBVtat were about 1.5%. Southern blot analysis of the intracellular core and extracellular viral particles of HBVtat confirmed these results (data not shown). Thus, the insertion of the Figure 4 Transactivation activity of the pol mutant of HBVtat. HBVtat − 267 bp tat gene within the tether region of the pol gene with frameshift mutation in the pol gene, HBVtatP , (lane 2) was deter- reduced but did not abolish the polymerase function. mined for transactivation activity in comparison with that of HBVtat (lane 1). Relative levels of the CAT enzyme activities are shown in lanes Synthesis of complete viral particles by HBVtat 3 (positive control) and 4 (negative control). The ability to form complete viral particles would be important for the use of recombinant HBV as a vector in ies of RNA transcripts, 3.70, 3.10 and 2.65 kb, were gene transfer. A therapeutic gene carried in the viral gen- detected from HBVtat by a tat probe (Figure 5b, lane 2). ome would be efficiently and specifically introduced to The sizes of the pregenomic RNA (3.70 kb) and the target cells via infection. We thus determined whether subgenomic RNA (2.65 kb) expressed from HBVtat indi- intact viral particles could be produced by HBVtat. cated that the tat insert was included in transcripts from Previous studies have established that the L protein is both the core–pol promoter and the preS1 promoter. It absolutely required for the formation and secretion of appeared that the tat gene sequence was also present in HBV-free virus particles.29,30 The insertion of the tat gene another RNA species of about 3.10 kb in length. between the initiation codon and the promoter of preS1 gene might interrupt the expression of the L protein and, Expression of functional polymerase activity by HBVtat therefore, would affect production and secretion of viral To investigate the effect of the tat insertion on expression particles. The detection of endogenous polymerase and function of the pol gene, we performed an endogen- activity in extracellular products of HBVtat-transfected ous polymerase assay. This assay determines the core- HepG2 cells suggested that complete virus particles car- associated viral DNA polymerase activity through incor- rying the HBVtat recombinant genome had been synthe- poration of radioactively labeled deoxynucleotides into sized. To confirm this, we carried out an immunoaffinity- the viral genome. Cytoplasmic lysates and culture media capture assay directly to analyze the secreted HBV containing intracellular core and extracellular viral par- particles. ticles, respectively, were harvested from HepG2 cells Extracellular virus particles from transfected HepG2 transfected with wild-type HBV or HBVtat. The samples cells were captured using anti-HBV surface antibody as were normalized to an internal transfection control described in Materials and methods, and PCR was per-

Figure 5 RNA transcripts expressed from HBVtat detected by Northern blot analysis. Total RNA from HepG2 cells transfected with wild-type HBV (lane 1), HBVtat (lane 2), pCEP-tat as a positive control for the tat gene expression (lane 3) and a mock plasmid (lane 4) was separated on a 1.2% agarose-0.22M formaldehyde gel. The RNA was transferred to Hybond-N membrane (Amersham Life Science, Oakville, ON, Canada) and hybridized with a 32P-HBV DNA probe. The same blot was stripped by washing in a boiling 0.5% SDS solution as described by the membrane manufacturer and rehybridized with a 32P-tat DNA probe. (a) Autoradiograph of Northern blot analysis using a 32P-HBV DNA probe. Sizes of the transcripts expressed from the cells transfected with wild-type HBV and HBVtat that contain the HBV sequences are shown on the left and right, respectively. (b) Autoradiograph of Northern blot analysis using a 32P-tat DNA probe. The sizes of the transcripts expressed from the cells transfected with HBVtat are shown to the right. Positions of RNA size markers and 28S and 18S rRNA are shown at left and right, respectively. HBV vectors S Chaisomchit et al 1334

Figure 6 Endogenous polymerase activities of HBVtat. The viral core particles and cell-free particles were isolated from the cytoplasmic lysates and the culture media of transfected HepG2 cells, respectively, 4–5 days after transfection. Approximately equal amounts of core particles and extracellular viral particles were used after normalizing to an internal control and to HBeAg and HBsAg produced. Endogenous polymerase activities were determined as described in the text. (a) Endogenous polymerase activities in intracellular core particles. (b) Endogenous polymerase activities in extracellular viral particles or cell-free particles. RC, relaxed circular; L, linear; SS, single-stranded.

formed to detect the HBV genomic DNA. To eliminate however, a nonreplicative HBV vector may be favorable. contamination of plasmid DNA carried over from trans- To this end, we constructed a HBV recombinant carrying fections, the samples were treated with DNase I before the Zeocin resistant gene (ZeocinR) with a stop codon in- the immunoafﬁnity capturing. Cells transfected with a frame with the pol gene (designated as HBVZeoS). The nonreplicative HBV construct (pTHBVP−) were included ZeocinR insertion completely eliminated the expression of as controls, treated or untreated with DNase I. No viral Pol and therefore rendered HBVZeoS replication incom- DNA could be detected in samples transfected with petent. Endogenous polymerase assay of the extracellular pTHBVP− if treated with DNase I, whereas plasmid DNA viral particles of HBVZeoS trans-complementated by Pol contaminants were detected if the samples were not was carried out to test whether synthesis of viral particles treated with DNase I (Figure 7, lanes 3 and 4). Thus, con- from a nonreplicative HBV vector construct was possible. tamination of transfecting plasmids was eliminated by The result showed that the DNA genome was synthe- the DNase I treatment. HBV genomic DNA was detected sized from HBVZeoS after Pol complementation (Figure in DNase I-treated culture media from cells transfected 9, lane 2 versus lane 1) and the trans-complemented poly- with wild-type HBV or HBVtat (Figure 7, lanes 1 and 2) merase activity was approximately 1.5–3.0% of that of the but not from those transfected with the nonreplicative wild-type HBV. HBV plasmid or a mock plasmid (Figure 7, lanes 3 and 5). The synthesis of the HBVtat viral particles was also Discussion demonstrated by immunoprecipitation and Southern blot analysis (Figure 8). HBeAg and HBsAg produced by Gene therapy has become one of the most attractive HBVtat were also examined, both of which were pro- therapeutic strategies and, if applicable, can treat both duced at levels similar to those of wild-type HBV (Table acquired and genetic disorders. To be successful, how- 1). We concluded from these studies that complete viral ever, gene therapy requires efﬁcient tools for delivery particles were synthesized by HBVtat. and targeting, and the genes need to be expressed at therapeutic levels. For these reasons, viruses have been Construction of a nonreplicative HBV vector: replication used as the best gene delivery mediators. supported by Pol trans-complementation A number of inherited or metabolic disorders affect the The above studies have shown the potential of con- liver. Patients with liver dysfunction often endure a short structing a replicative HBV vector. For therapeutic use, life span. Although liver transplantation has been suc- HBV vectors S Chaisomchit et al 1335 Table 1 Detection of HBsAg and HBeAg produced by HBVtat

Samplesa Amounts (S/Nb ± standard deviation)

HBsAg HBeAg

HBV 56.03 ± 27.35 249.18 ± 65.29 HBVtat 60.06 ± 13.83 226.56 ± 85.76 Mock 1.20 ± 0.04 1.18 ± 0.05

aSamples were culture media of HepG2 cells transfected with wild-type HBV, HBVtat or mock and were assayed for HBsAg and HBeAg by MEIA. bHBsAg and HBeAg produced were determined as S/N values as described by the manufacturer. у2.00 S/N is the cut-off rate for positive results. According to the manufacturer, у7.00 S/N of HBsAg detected is equivalent to 4–15 ng/ml concentration but the absolute concentration of HBeAg is not determined.

Figure 7 Immunoafﬁnity-capture assay to detect complete viral particles produced from HBVtat. The extracellular products were captured from culture media of cells transfected with wild-type HBV (lane 1), HBVtat (lane 2), nonreplicative HBV (lanes 3 and 4) and mock (lane 5) as described in Materials and methods. DNA of the captured HBV or HBVtat particles was determined by PCR and analyzed by 2% agarose gel electrophoresis. The actual ampliﬁed product was 114 bp in size. The DNA band detected in the sample of nonreplicative HBV without DNase I treatment (lane 4) was a contamination of the transfecting plasmid. Lane 6 marker, 1 kb DNA ladder (GIBCO BRL, Life Technologies); +, with DNase I treatment; −, without DNase I treatment.

Figure 9 Endogenous polymerase activities in extracellular viral particles of nonreplicative HBVZeoS. HepG2 cells were cotransfected with wild- type HBV or HBVZeoS with pCHBVP (a Pol expression plasmid) or a mock plasmid. Endogenous polymerase assays were determined as described in the legend to Figure 6. The DNA products were analyzed by agarose gel electrophoresis and autoradiography.

cessfully performed to save the lives of patients with Figure 8 Immunoprecipitation and Southern blot analysis to detect com- severe liver diseases, transplanted patients still require plete viral particles produced from HBVtat. The extracellular products of long-term immunosuppressive treatment. Moreover, cells transfected with HBVtat (lane 1), wild-type HBV (lane 2) and mock (lane 3) were immunoprecipitated as described in Materials and methods. transplantation is also limited by the availability of liver The viral DNA was detected by Southern blot analysis using a 32P-HBV donors, and the procedure carries significant morbidity DNA probe. and mortality risk. Gene therapy, therefore, is a promis- HBV vectors S Chaisomchit et al 1336 ing approach for correcting genetic liver defects. Owing licative and complete viral particles are formed. Analyses to its natural hepatotropism, hepadnaviruses could be the of the amounts of HBsAg and HBeAg produced from most effective tools for liver gene transfer and may over- HBVtat suggest that the expression of these HBV struc- come the problems often associated with other liver- tural genes is not significantly affected by the tat inser- directed gene transfer systems.31 tion. One major concern about the design of HBVtat was This article exploits the potential of using HBV as a that the tat insertion might interfere with the L protein gene delivery vector. In this study, we have demon- synthesis which has been shown to be absolutely neces- strated that a foreign gene, HIV-1 tat, can be expressed sary for virion assembly29,30 and binding to cellular and fully functional in the context of the full-length HBV receptor(s).41,42 The detection of extracellular viral par- genome. Expression of the tat gene seems to be specific ticles indicates that the L protein is made and particles to human liver cells as it exhibits full transactivation are fully assembled. Therefore, it is highly possible that function in HepG2 cells. Diminished expression of the tat the recombinant viruses could infect liver cells. gene controlled by the endogenous HBV promoter– Although attempts to produce defective and recombi- enhancer elements in LMH and HeLa cells reflects the nant hepadnavirus particles have been reported,43 this is high species and cell-type specificity of hepadna- the first study to clearly demonstrate expression of a viruses.18,32–34 DHBV also replicates more efficiently in foreign gene in the context of a replication-competent chicken hepatoma cells (LMH) than in human liver cells HBV genome. Recombinant viral particles are produced, (HuH-7 and HepG2).35 This shows the necessity of using even though the infectivity or transduction ability of the HBV as a vector in hepatic gene transfer although it may recombinant viruses remains to be demonstrated. The be advantageous to use nonhuman pathogenic hepadna- majority of viral vectors developed for gene delivery are viruses as gene transfer tools. replication defective; as a result, high titers of the recom- Northern blot analysis suggests that the tat gene binant viral vectors are usually required for efficient gene inserted in the tether region is transcribed by both core– transduction. Since this HBV recombinant is replication pol promoter and preS1 promoter. Since the Pol-Tat competent, a low titer of the recombinant viral vector fusion expressed by the core–pol promoter is not may be sufficient for effective gene transfer. accountable for the transactivation activity of HBVtat, the Alternatively, a nonreplicative HBV vector can be con- functional Tat is most likely expressed as a Tat-Pol fusion structed. As demonstrated in this study by complete product using the tat initiation codon. It is known that elimination of the pol gene expression, trans-comp- Tat functions in the nucleus and HBV Pol interacts with lementation of Pol supported the synthesis of a nonrep- the 5′epsilon sequence of the pregenomic RNA and is licative HBV recombinant. This strategy has offered a encapsidated into core particles in the cytoplasm.36,37 It is potential means of inserting a large foreign gene into the conceivable that the Pol-Tat fusion is encapsidated into HBV genome. the viral core particles in the cytoplasm and thus is not An HBV vector would naturally be the most appropri- transported into the nucleus where the tat protein would ate tool for liver gene transfer. Due to its ability to infect function. Since the entire Pol protein is required for nondividing hepatocytes, transduction rates of HBV vec- encapsidation and packaging of the cytoplasmic viral tors can be extremely efficient, particularly in comparison core particles,25,26 the Tat-Pol fusion recombinant lacking to Moloney murine leukemia virus-derived retroviral the N-terminal domain of Pol would not be incorporated vectors which require cell division for gene transfer. The into the core particles. Therefore, the Tat-Pol fusion may fact that a large number of HBV-infected humans appear migrate to the nucleus and confer transactivation activity. continuously to harbor the HBV genome and express Multiple attempts for detecting the Tat-Pol fusion by HBsAg without pathogenic consequences offers a great Western blot analysis and immunoprecipitation have not advantage in terms of long-term maintenance and been successful, possibly due to the low levels of protein expression of a recombinant HBV vector bearing a expression or the lack of optimal anti-Tat antisera. desired gene. A recombinant HBV genome might be Although the Tat-Pol fusion was most likely synthe- attenuated to the extent that the HBV-associated patho- sized from transcripts of the preS1 promoter, we cannot genesis is diminished. Further development and studies officially exclude the possibility of its synthesis from the of HBV as therapeutic gene transfer vectors are neces- pregenomic RNA by internal initiation, a mechanism sary. Nevertheless, this preliminary study has demon- used for the synthesis of HBV Pol.38 strated the feasibility of constructing both replicative and An additional 3.1 kb RNA containing the tat sequence nonreplicative HBV vectors. was detected in HBVtat but not in wild-type HBV transfected cells. The near-genomic size suggests that this tat RNA species might originate from the pregenomic RNA. Materials and methods RNA splicing has been reported in hepadnaviruses.39,40 Sequence analysis of HBVtat has revealed consensus Plasmid construction and mutagenesis splice donor sites on the HBV genome flanking the tat A basic plasmid, pTHBV, was constructed by subcloning insert and a consensus splice acceptor site and a branch the full-length genome (EcoRI–EcoRI) of HBV adw2 sub- point within the tat sequence. Thus, we speculate that type in the pT7T318U vector (Pharmacia Biotech, this 3.1 kb transcript is a spliced product of the pregen- Uppsala, Sweden). A 267-bp HIV-1 tat cDNA fragment omic RNA of HBVtat. with additional BstEII sites at both ends was amplified Insertion of the tat gene in-frame with the pol gene has from plasmid pCEP-tat44 by PCR using the upstream reduced the endogenous polymerase activity of the pol primer 5′ TGCGGGTCACCAATGGAGCCAGTAGA- protein. It is possible that the insertion interferes with the TCCTAAT 3′ and the downstream primer 5′ structural conformation of the Pol protein. Nevertheless, ATATGGTGACCCTTCCGTGGGCCCTGTCGGGTC 3′ our study shows that the HBVtat recombinant is rep- (the BstEII sites are underlined). The Pfu polymerase HBV vectors S Chaisomchit et al 1337 (Stratagene, La Jolla, CA, USA) was used to minimize the surface antigen ORFs for the simultaneous expression of error rate of the polymerase. The PCR amplified tat frag- L, M and S surface proteins.47 pCEP-tat carried the tat ment was subcloned into the unique BstEII site in the pol gene under the CMV promoter.44 pLTR-CAT is a CAT ORF of the HBV genome. This construct is designated reporter plasmid carrying the CAT gene under the HIV- HBVtat. DNA sequencing confirmed the actual sequence. 1 LTR.44 Replication-competent plasmids of wild-type HBV A nonreplicative HBVZeoS recombinant was con- (pTHBV-d) and HBVtat (pTHBVT-d) were constructed structed by PCR subcloning the entire ORF of ZeocinR by ligation head to tail of two copies of the full-length with a stop codon from pcDNA3.1/Zeo (Invitrogen) into HBV (EcoRI–EcoRI) sequence and HBVtat (EcoRI–EcoRI) the unique BstEII site in the pol ORF of pTHBV. The PCR sequence, respectively, in the pT7T318U vector. The subcloning was performed using the upstream primer 5′ expression of these replication-competent HBV plasmids TGCGGGTCACCAATGGCCAAGTTGACCAGTGCC 3′ in a eukaryotic system is controlled by the HBV endogen- and the downstream primer 5′ ATATGGTGACC- ous promoters. CTCAGTCCTGCTCCTCGGCCACGAAGTG 3′ (the Mutations of the X gene of HBVtat were performed by BstEII sites are underlined). DNA sequencing confirmed site-directed PCR mutagenesis. Three oligo primers were the actual sequence. Since the insertion had a stop codon designed. The upstream primer 5′ TTACTAGT- and was in-frame with the pol gene, the pol expression GCCATTTGTTCAGTGGTTCG 3′ was homologous to the was eliminated. A dimeric form of HBVZeoS sequence at the unique SpeI site (underlined) located 142 (pTHBVZeoS-d) was constructed by ligation head to tail bp upstream of the X gene. The downstream primer 5′ of two copies of the full-length HBVZeoS monomer in the GTGCACACGGACCGGCAGATG 3′ anneals to the pT7T318U vector and used for studying the replication of sequence at the unique RsrII site (underlined) located 197 HBVZeoS. bp downstream of the X gene. The mutated oligonucleo- tide 5′ ATACATCGTTTCCcTGGCTGCTAGGCTGTAC- Tissue culture and transfection TGCtAACTGGATCCTTC 3′ was targeted to the sequence HepG2 and HeLa cells were cultured and maintained at ° at the unique NcoI site (underlined) at the initiation 37 Cin5%CO2 in Auto-Pow MEM Eagle (modified) codon of the X gene with change from A to C at the 1376 medium (ICN Biomedicals, Costa Mesa, CA, USA) sup- nucleotide (nt) and from C to T at the 1397 nt. These plemented with 10 mm sodium bicarbonate, 2 mml-glut- changes abolished the initiation codon of the X gene and amate, 10% fetal bovine serum, 50 U/ml penicillin G the original NcoI site with the addition of a stop codon sodium, 0.01 mg/ml streptomycin and 50 U/ml nystatin. (mutated nucleotides shown in boldface lower case). LMH cells were cultured and maintained at 37°Cin5% These mutations conserved the pol coding sequences. CO2 in a mixture of 1:1 Auto-Pow MEM Eagle (modified) The mutations were performed by multiple PCR as and F12 (ICN Biomedicals) media with the same supple- described.45 The mutated PCR fragment was then cut mentation as the HepG2 medium. with SpeI and RsrII and cloned into the unique sites in the Transfections were performed using Lipofectin HBVtat plasmid. A frameshift mutation of the pol ORF of (GIBCO BRL Life Technologies) for HepG2 cells and HBVtat was generated by opening at the unique BspEI Lipofectamine (GIBCO BRL Life Technologies) for LMH site (2331 nt) downstream of the initiation codon of the and HeLa cells using the procedure recommended by the pol gene and subsequently filling in (2332 to 2336 nt) with manufacturer. In brief, cells were subcultured 20 h before Klenow Fragment (GIBCO BRL Life Technologies, Gai- transfection. Cells were fed with fresh media 1 h before thersburg, MD, USA). The mutation disrupted the read- transfection. The plasmid DNA and Lipofectin or Lipo- ing frame of the pol gene. It, therefore, ablated the fectamine were each diluted into 300 ␮l of unsup- expression of the tat insert as a Pol-Tat fusion recombi- plemented medium. These two solutions were combined, nant. These mutated sites were verified by restriction incubated for 15–30 min at room temperature, and then mapping and DNA sequencing. applied to cells which had been washed twice with the To construct a HBV core expression plasmid, pCHBVC, unsupplemented medium. The transfected cells were ° a 1500 nt fragment from the NlaIII site to the unique AvrII incubated at 37 Cin5%CO2. At 4 h after transfection, site, which includes the entire sequence of the core gene, an equal volume of the medium plus 10% fetal bovine was PCR amplified from the HBV genome containing serum (no supplementation of antibacterial agents) was plasmid, pKSVHBV146 and cloned into the pTZ19R vec- added with further incubation. About 20 h after transfec- tor (Pharmacia Biotech). The sequence between the Hin- tion, cells were fed with the normal media. For the CAT dIII and XbaI sites containing the core gene was sub- assay, a total amount of 5–10 ␮g of DNA per 60-mm cloned into the eukaryotic expression vector pcDNA I tissue culture dish was used. Cells were cotransfected Amp (Invitrogen, San Diego, CA, USA). An HBV pol with the CAT reporter plasmid (pLTR-CAT) and the HBV plasmid (pCHBVP) was constructed by subcloning a 2734 plasmids or pCEP-tat (as a positive control) or a mock nt fragment containing the entire pol ORF from plasmid (as a negative control). The expression of HBV pKSVHBV1 into the pTZ19R vector by multiple cloning genes was assayed in HepG2 cells and a total amount of steps using restriction enzymes and PCR. The sequence 10 ␮g of DNA per 60-mm tissue culture dish was used coding for the entire HBV pol ORF was cut and sub- for transfection. Endogenous polymerase assays with Pol cloned into the HindIII–EcoRV sites of the eukaryotic complementation were performed by cotransfection of expression vector pcDNA I Amp. The subcloned equimolar quantities of the HBV plasmids and pCHBVP sequences of these recombinant plasmids were verified into HepG2 cells. To assess transfection efficiency, all by restriction mapping and DNA sequencing. pSG-X was transfections were performed in the presence of human constructed by inserting the X gene into the EcoRI–BglII growth hormone plasmid pXGH5 (Nichols Institute sites of the eukaryotic expression vector pSG5 Diagnostics, San Juan, Capistrano, CA, USA). Secreted (Stratagene). A pSV45 plasmid carried the entire HBV human growth hormone was quantified by radioimmun- HBV vectors S Chaisomchit et al 1338 oassay. For preliminary detection and normalization of ture were added 11 ␮m of each of dATP, dGTP and dTTP the expression of HBV genes, HBeAg and HBsAg and 10 ␮Ci of ␣32P dCTP (3000 Ci/mmol; Dupont, Bos- secreted in the cell media were determined by a ton, MA, USA). The reaction was performed at 37°C for Microparticle Enzyme Immunoassay (MEIA) (Abbott 1 h. Chase buffer containing 0.2 mm unlabeled dCTP, and Laboratories, Abbott Park, IL, USA). 0.1 mm of each of dATP, dGTP and dTTP was then added with a further incubation for 30 min. The reaction was CAT assay stopped by adding an equal volume of 2 × proteinase K CAT assays were performed as previously described.44 buffer (300 mm NaCl, 40 mm EDTA, 20 mm Tris (pH 7.5), Cell lysates were prepared 48–72 h after transfection. An 2.5% sodium dodecyl sulfate (SDS)) and proteinase K to optimal amount of enzyme was used to ensure that the a final concentration of 1 ␮g/␮l and incubated at 42°C CAT enzyme reaction rate was within the linear range. for at least 2 h. The 32P-labeled viral DNA was isolated The converted products were separated by thin-layer by phenol–chloroform extraction and ethanol precipi- chromatography and analyzed using a phosphoimager tation and by agarose gel electrophoresis. The 32P-labeled (BAS1000; Fuji, Kanagawa, Japan). The relative level of viral DNA was then transferred to a nylon membrane48 CAT enzyme was determined after normalization for and analyzed by autoradiography. The relative level of transfection efficiency and total quantity of protein in the endogenous polymerase activity was analyzed by a each cell lysate. phosphoimager.

Isolation of extracellular HBV particles Extraction of viral DNA and Southern blot analysis Four to five days after transfection, the culture media Viral materials pelleted from culture media or cell lysates from transfected cells were collected and centrifuged in were suspended in 50 mm Tris (pH 7.5), 150 mm NaCl a Sorvall RT6000B Refrigerated Centrifuge (Dupont, Mis- and 10 mm EDTA. Nucleic acids were then purified by sissanga, ON, Canada) at 2500 g for 10 min to remove proteinase K digestion and phenol–chloroform extrac- cellular debris. The extracellular viral particles were pel- tion, and collected by ethanol precipitation. Viral DNA leted over a 25% sucrose cushion in 50 mm Tris (pH 8.0), was assayed by agarose gel electrophoresis and Southern 150 mm NaCl and 10 mm EDTA solution using an ultra- blot analysis using standard methods.48 centrifuge SW 41 rotor at 150 000 g for 7–20 h. The pellets were resuspended in 50 mm Tris (pH 7.5), 150 mm NaCl Isolation of total RNA and Northern blot analysis and 10 mm EDTA. To remove DNA not present in virus Total RNA was harvested from transfected HepG2 cells m particles or contaminating plasmids, 6 m MgCl2 and 100 using TRIzol reagent (GIBCO BRL Life Technologies) as ␮g/ml of DNase I were added to the suspension with described by the manufacturer. The amount of total RNA incubation at 37°C for 30 min. The virus particles were was determined by spectrophotometer. An equal amount precipitated by the addition of one-third volume of 26% of RNA for each sample was separated on a 1.2% aga- PEG 8000, 1.4 m NaCl, and 25 mm EDTA. After centrifug- rose-0.22M formaldehyde gel as described.49 The RNA ation, the pellets were suspended in appropriate sol- blot was prepared and hybridized to 32P-labeled HIV-1 utions. For endogenous polymerase assay, the pellets tat or HBV gene probes using standard methods.48 were suspended in 30 ␮l of polymerase buffer (50 mm m m Tris pH 8.0, 40 m MgCl2,50m NaCl, 1% Nonidet P- Isolation of HBV particles by immunoaffinity capture 40 and 0.3% ␤-mercaptoethanol). The pellets were suspended in 50 mm Tris (pH 7.5), 150 mm NaCl and 10 mm Microtiter plate preparation: Each well of a high binding EDTA for DNA extraction and Southern blot analysis. round-bottom plate (Corning 25802) (Corning, Cam- For detection of complete HBV particles by immuno- bridge, MA, USA) was coated with a mouse anti-HBV affinity capture or immunoprecipitation, the pellets were surface antigen monoclonal antibody prepared and pur- resuspended in 200 ␮l of phosphate-buffered saline ified from H25B10 cells (ATCC No. CRL 8017). The plate (PBS) solution. was sealed and incubated at 4°C overnight. The antibody solution was then replaced with 0.1% bovine serum albu-

Isolation of intracellular HBV core particles min (BSA) and 0.02% sodium azide (NaN3) in PBS and Transfected HepG2 cells in 60-mm tissue culture dishes incubated further at 4°C for at least 2 h. were lysed by the addition of lysis buffer (10 mm Tris- HCl (pH 7.5), 50 mm NaCl, 1 mm EDTA, 0.25% Nonidet Immunoaffinity capture of HBV particles: The coated plate P-40, and 8% sucrose) and incubated for 2–5 min at room was washed three times with 0.01% Tween 20 and 0.02% ␮ temperature. The cell lysate was collected and subjected NaN3 in PBS (PBS/T/N) and filled with 10 l of 0.035% ␮ to microcentrifugation to remove nuclei and cellular Tween 20 and 0.02% NaN3 in PBS and 25 l of each extra- debris. To eliminate transfected plasmids and cytoplas- cellular viral solution purified from culture media of m mic RNA, the lysate was incubated with 6 m MgCl2, transfected HepG2 cells, as described above. The samples 100 ␮g/ml of DNase I, and 10 ␮g/ml of RNase A at 37°C were further incubated at 4°C overnight and washed five for 30 min. The viral core particles were precipitated by times with PBS/T/N and twice with PBS. The solution the addition of one-third volume of 26% PEG 8000, 1.4 m was pipetted up and down for efficiently washing during NaCl, and 25 mm EDTA followed by centrifugation. The each wash. pellets were then suspended in appropriate solutions as described above. Detection of the captured HBV particles: To isolate DNA of the complete HBV particles bound to the antibody, a Endogenous polymerase assay denaturing solution (0.09 n NaOH and 0.01% NP-40) was Viral materials pelleted from culture media or cell lysates added to each well. The sample was incubated at 37°C were suspended in 30 ␮l polymerase buffer. To the mix- for 1 h and subsequently neutralized with an equal vol- HBV vectors S Chaisomchit et al 1339 ume of 0.09 n HCl/100 mm Tris (pH 8.3). The presence 10 Kozarsky KF et al. In vivo correction of low density lipoprotein of HBV DNA released from the particles was detected by receptor deficiency in the Watanabe inheritable hyperlipidemic PCR using the upstream primer 5′ TCGCTG- rabbit with recombinant adenoviruses. J Biol Chem 1994; 269: GATGTGTCTGCGGCGTTTTAT 3′ and the downstream 13695–13701. 11 Vrancken-Peeters M-JTFD, Lieber A, Perkins J, Kay MA. Method primer 5′ TAGAGGACAAACGGGCAACATACC 3′. The for multiple portal vein infusions in mice: quantification of size of the amplified product would be 114 bp. An aliquot ␮ adenovirus-mediated hepatic gene transfer. BioTechniques 1996; of 5 l of each sample was used as a template. After 30 20: 278–285. cycles of amplification, the DNA product was analyzed 12 Loser P, Sandig V, Kirillova I, Strauss M. Evaluation of HBV by 2% agarose gel electrophoresis. promoters for use in hepatic gene therapy. Biol Chem Hoppe- Seyler 1996; 377: 187–193. Immunoprecipitation of HBV particles 13 Ganem D, Varmus HE. The molecular biology of hepatitis B The extracellular viral particles harvested from culture viruses. Ann Rev Biochem 1987; 56: 651–693. media as described above were resuspended in 200 ␮lof 14 Nassal M, Schaller H. Hepatitis B virus replication. Trends PBS (pH 7.4–7.5) and immunoprecipitated with a goat Microbiol 1993; 1: 221–228. 15 Rossner MT. Review: hepatitis B virus X-gene product: a pro- anti-HBV surface antigen polyclonal antibody (Dako, miscuous transcriptional activator. J Med Virol 1992; 36: 101–117. Carpinteria, CA, USA). The antigen–antibody solution ° 16 Bartenschlager R, Schaller H. The amino-terminal domain of the was incubated at 4 C for 2 h. The solution was further hepadnaviral P-gene encodes the terminal protein (genome- incubated with 10% v/v of protein G-sepharose linked protein) believed to prime reverse transcription. EMBO (Pharmacia Biotech) in PBS for 1 h. After removal of the J 1988; 7: 4185–4192. supernatant, the viral–protein G-sepharose pellets were 17 Radziwill G, Tucker W, Schaller H. Mutational analysis of the washed three times with PBS. The viral DNA was then hepatitis B virus P gene product: domain structure and RNase purified by proteinase K treatment and ethanol precipi- H activity. J Virol 1990; 64: 613–620. tation and analyzed by Southern blot analysis as indi- 18 Schaller H, Fischer M. Transcriptional control of hepadnavirus cated above. gene expression. Curr Top Microbiol Immunol 1991; 168: 21–39. 19 Chang L-J, Hirsch RC, Ganem D, Varmus HE. Effects of inser- tional and point mutations on the functions of the duck hepatitis Acknowledgements B virus polymerase. J Virol 1990; 64: 5553–5558. 20 Beames B, Lanford RE. Insertions within the hepatitis B virus We would like to thank Rajan George for preparing oli- capsid protein influence capsid formation and RNA encapsid- gonucleotides, Graham Tipples for assisting with the ation. J Virol 1995; 69: 6833–6838. immunoaffinity-capture procedure, San Vinh for photo- 21 Faruqi AF et al. Replication-defective missense mutations within graphs and Dorothy Tovell for reading the manuscript. the terminal protein and spacer/intron regions of the poly- This work was supported by a grant from Glaxo Well- merase gene of human hepatitis B virus. Virology 1991; 183: come Canada and a Rattanakosin Scholarship from 764–768. 22 Machein U et al. Deletion and insertion mutants of HBsAg par- the Canadian International Development Agency to ticles. Arch Virol 1992; 4 (Suppl.): 133–136. Sumonta Chaisomchit. 23 Melegari M, Bruno S, Wands JR. Properties of hepatitis B virus pre-S1 deletion mutants. Virology 1994; 199: 292–300. References 24 Nakatake H et al. Effect of X protein on transactivation of hepatitis B virus promoters and on viral replication. Virology 1993; 1 Wilson JM, Johnson D, Jefferson D, Mulligan R. Correction of 95: 305–314. the genetic defect in hepatocyte from the Watanabe heritable 25 Bartenschlager R, Junker-Niepmann M, Schaller H. The P gene hyperlipidemic rabbit. Proc Natl Acad Sci USA 1988; 85: 4421– product of hepatitis B virus is required as a structural compo- 4425. nent for genomic RNA encapsidation. J Virol 1990; 64: 5324– 2 Grossman M, Raper SE, Wilson JM. Transplantation of geneti- 5332. cally modified autologous hepatocytes into nonhuman primates: 26 Hirsch RC et al. Polymerase gene products of hepatitis B viruses feasibility and short-term toxicity. Hum Gene Ther 1992; 3: are required for genomic RNA packaging as well as for reverse 501–510. transcription. Nature 1990; 344: 552–555. 3 Conelly S et al. High-level tissue-specific expression of func- 27 Li JS et al. Duck hepatitis B virus can tolerate insertion, deletion, tional human factor VIII in mice. Hum Gene Ther 1996; 7: 183– and partial frameshift mutation in the distal pre-S region. J Virol 195. 1989; 63: 4965–4968. 4 Smith TAG et al. Adenovirus mediated expression of therapeutic 28 Siddiqui A et al. trans-Activation of viral enhancers including plasma levels of human factor IX in mice. Nat Genet 1993; 5: long terminal repeat of the human immunodeficiency virus by 397–402. the hepatitis B virus X protein. Virology 1989; 169: 479–484. 5 Kay MA et al. In vivo hepatic gene therapy: complete albeit tran- 29 Bruss V, Ganem D. The role of envelope proteins in hepatitis B sient correction of factor IX deficiency in hemophilia B dogs. virus assembly. Proc Natl Acad Sci USA 1991; 88: 1059–1063. Proc Natl Acad Sci USA 1995; 91: 2353–2357. 30 Bruss V, Vieluf K. Functions of the internal pre-S domain of the 6 Herz J, Gerard RD. Adenovirus-mediated transfer of low den- large surface protein in hepatitis B virus particle morphogenesis. sity lipoprotein receptor gene acutely accelerates cholesterol J Virol 1995; 69: 6652–6657. clearance in normal mice. Proc Natl Acad Sci USA 1993; 90: 31 Strauss M. Liver directed gene therapy: prospects and problems. 2812–2816. Gene Therapy 1994; 1: 156–164. 7LiJet al. In vivo gene therapy for hyperlipidemia: phenotypic 32 Patel NU, Jameel S, Isom H, Siddiqui A. Interactions between correction in Watanabe rabbits by hepatic delivery of the rabbit nuclear factors and the hepatitis B virus enhancer. J Virol 1989; LDL receptor gene. J Clin Invest 1995; 95: 768–773. 63: 5293–5301. 8 Kass-Eisler A et al. The impact of developmental stage, route of 33 Jameel S, Siddiqui A. The human hepatitis B virus enhancer administration and the immune system on adenovirus-mediated requires trans-acting cellular factor(s) for activity. Mol Cell Biol gene transfer. Gene Therapy 1994; 1: 395–402. 1986; 6: 710–715. 9 Huard J et al. The route of administration is a major determinant 34 Sandig V et al. HBV-derived promoters direct liver-specific of the transduction efficiency of rat tissues by adenoviral recom- expression of an adenovirally transduced LDL receptor gene. binants. Gene therapy 1995; 2: 107–115. Gene Therapy 1996; 3: 1002–1009. HBV vectors S Chaisomchit et al 1340 35 Condreay LD et al. Efficiency duck hepatitis B virus production 43 Horwich AL, Furtak K, Pugh J, Summers J. Synthesis of hepad- by an avian liver tumor cell line. J Virol 1990; 64: 3249–3258. navirus particles that contain replication-defective duck hepa- 36 Hirsch RC, Loeb DD, Pollack JR, Ganem D. cis-Acting sequence titis B virus genomes in cultured HuH7 Cells. J Virol 1990; 64: required for encapsidation of duck hepatitis B virus pregenomic 642–650. RNA. J Virol 1991; 65: 3309–3316. 44 Robinson D, Elliott JF, Chang L-J. Retroviral vector with a CMV- 37 Junker-Neipmann M, Bartenschlager R, Schaller H. A short cis- IE/HIV-TAR Hybrid LTR gives high basal expression levels and acting sequence is required for hepatitis B virus pregenome is up-regulated by HIV-1 Tat. Gene Therapy 1995; 2: 269–278. encapsidation and sufficient for packaging of foreign RNA. 45 Picard V, Ersdal-Badju E, Lu A, Bock SC. A rapid and efficient EMBO J 1990; 9: 3389–3396. one-tube PCR-based mutagenesis technique using Pfu DNA 38 Chang L-J, Ganem D, Varmus HE. Mechanism of translation of polymerase. Nucleic Acids Res 1994; 22: 2587–2591. the hepadnaviral polymerase (P) gene. Proc Natl Acad Sci USA 46 Seifer M, Heerman KH, Gerlich WH. Replication of hepatitis B 1990; 87: 5158–5162. virus in transfected nonhepatic cells. Virology 1990; 179: 300–311. 39 Obert S et al. A spliced hepadnavirus RNA that is essential for 47 Persing DH, Varmus HE, Ganem D. Inhibition of secretion of virus replication. EMBO J 1996; 15: 2565–2574. hepatitis B surface antigen by a related presurface polypeptide. 40 Wu H-L et al. Characterization and genetic analysis of alterna- Science 1986; 234: 1388–1391. tively spliced transcripts of hepatitis B virus in infected human 48 Sambrook J, Fritsch EF, Maniatis T. Molecular Cloning: A Labora- liver tissues and transfected HepG2 cells. J Virol 1991; 65: tory Manual. Cold Spring Harbor Laboratory Press: New York, 1680–1686. 1989, pp 9.31–9.57. 41 Petit M-A, Capel F, Dubanchet S, Mabit H. PreS1-specific pro- 49 Tsang SS et al. Loss of resolution in gel electrophoresis of RNA: teins as potential receptors for hepatitis B virus in human hepatocytes. Virology 1992; 187: 211–222. a problem associated with the presence of formaldehyde gradi- 42 Klingmuller U, Schaller H. Hepadnavirus infection requires ents. BioTechniques 1993; 14: 380–381. interaction between the viral pre-S domain and a specific hepa- tocellular receptor. J Virol 1993; 67: 7414–7422.